Cardiovascular Research (2015) 105, 340–352
doi:10.1093/cvr/cvu254
miR-21-3p regulates cardiac hypertrophic response
by targeting histone deacetylase-8
Mengwen Yan†, Chen Chen†, Wei Gong, Zhongwei Yin, Ling Zhou,
Sandip Chaugai, and Dao Wen Wang*
Department of Internal Medicine, Institute of Hypertension, Tongji Hospital, Tongji Medical College of Huazhong University of Science and Technology, 1095 Jiefang Avenue, Wuhan 430030, PR
China
Received 16 October 2013; revised 31 October 2014; accepted 27 November 2014; online publish-ahead-of-print 10 December 2014
Time for primary review: 40 days
Aims
Growing evidences indicate that microRNAs (miRNAs) are involved in cardiac hypertrophy development. Multiple
miRNAs have been identified as diagnostic and prognostic biomarkers of cardiac hypertrophy, as well as potential therapeutic tools. The present study aimed to investigate the functions and regulatory mechanisms of miR-21-3p in cardiac
hypertrophy.
.....................................................................................................................................................................................
Methods
Decreased expression of miR-21-3p was observed in cardiac hypertrophy induced by transverse aortic constriction
(TAC) and angiotensin (Ang) II infusion in mice. To further explore the role of miR-21-3p in cardiac hypertrophy,
and results
rAAV-miR-21-3p was administered intravenously in mice. Overexpression of miR-21-3p markedly suppressed TACinduced cardiac hypertrophy and also blocked Ang II-induced cardiac hypertrophy as determined by cardiac function
measurement and biomarker detection. Furthermore, western blot assays showed that histone deacetylase-8
(HDAC8) was silenced by miR-21-3p, and luciferase reporter assays showed that miR-21-3p binds to the 3′ UTR of
HDAC8. Moreover, re-expression of HDAC8 attenuated miR-21-3p-mediated suppression of cardiac hypertrophy by
enhancing phospho-Akt and phospho-Gsk3b expression.
.....................................................................................................................................................................................
Conclusion
Our data reveal a role of miR-21-3p in regulating HDAC8 expression and Akt/Gsk3b pathway, and suggest that modulation of miR-21-3p levels may provide a therapeutic approach for cardiac hypertrophy.
----------------------------------------------------------------------------------------------------------------------------------------------------------Keywords
Cardiac hypertrophy † miRNA † HDAC
1. Introduction
MicroRNAs (miRNAs) are a class of small conserved, non-coding RNAs
of 19–25 nucleotides and act as negative regulators of gene expression
by inhibiting mRNA translation or promoting mRNA degradation.1
A single miRNA can modulate complex physiology or disease phenotypes by regulating entire functional networks.2 miRNAs are involved
in a variety of cardiac function regulations, for example, the conductance
of electrical signals, heart growth, heart muscle contraction, and morphogenesis.3,4 Recently, miRNAs have been reported to play key roles
in the pathogenesis of cardiac diseases, and it is possible to manipulate
miRNA to achieve therapeutic effects.2,5,6
Studies show that miR-21 expression levels vary in a variety of
cardiovascular diseases, such as atherosclerosis, myocardial ischaemia,
myocardial fibrosis, and heart failure.7 Also, miR-21 is involved in the regulation of the function of vascular smooth muscle cells, endothelial cells,
†
cardiac myocytes, and cardiac fibroblasts. Increasing evidences suggest
that miR-21 plays important roles in cardiovascular disease.8 – 10 The
processing of the miRNA biogenesis results in a guide strand and a passenger strand (also termed miRNA and miRNA*). Generally, a guide strand
is selectively loaded onto an Argonaute (AGO) protein to form a
miRNA-induced silencing complex (miRISC), and the passenger strand,
because of its lower steady-state level, is believed to be preferentially
degraded. Recent researches show that numerous miRNA* species accumulate to substantial levels, and that endogenous miRNA genes do not
universally exclude miRNA* species from functional miRISC complexes,
suggesting that miRNA* species should be considered.11 For example,
miR-21-3p (previously named miR-21*) was detected in tumour
samples and was believed to have various functions in tumorigenesis.12,13
However, the role of miR-21-3p in cardiac hypertrophy is still undefined.
Histone deacetylases (HDACs) are post-translational modifying
enzymes that can deacetylate histones and regulate gene expression.14
These authors contributed equally to this work.
* Corresponding author. Tel: +86 27 8366 3280; fax: +86 27 8366 3280, Email: [email protected]
Published on behalf of the European Society of Cardiology. All rights reserved. & The Author 2014. For permissions please email: [email protected].
341
miR-21-3p and cardiac hypertrophy
HDACs are composed of a highly conserved family, with homologues
in yeast and humans that fall into four subfamilies,15 including Class I
HDACs (HDAC 1, 2, 3, and 8), Class IIa HDACs (HDAC 4, 5, 7, and 9),
Class IIb HDACs (HDAC 6 and 10), and Class III HDACs (SIRT1-7).14,15
Recent studies demonstrated that Class II HDACs can repress cardiac
hypertrophy.16 – 18 Nuclear localization of Class II HDACs and their
ability to attenuate myocyte enhancer factor-2 (Mef2)-dependent
hypertrophic gene expression are regulated by phosphorylation of
critical serine residues that are conserved in Class II HDACs.16 – 18
Trivedi et al. 19 demonstrated that overexpression of HDAC2, a Class I
HDAC, would worsen the ISO-induced hypertrophy. In the present
study, based on bioinformatic analysis, we investigated whether
HDAC8 was regulated by miR-21-3p and involved in the process of
cardiac hypertrophy.
2. Methods
2.1 Materials
DMEM and fetal bovine serum (FBS) for standard cell culture were obtained
from Gibco (Grand Island, NY, USA). Angiotensin II (Ang II) was purchased
from Sigma-Aldrich (St Louis, MO, USA). Antibodies against total-Akt,
phospho-Akt (Ser 473), total-Gsk3b, and phospho-Gsk3b were purchased
from Cell Signaling Technology (Boston, MA, USA). Anti-HDAC8 antibody
was from Abcam (Cambridge, MA, USA). Anti-GAPDH antibody was from
Santa Cruz Biotechnology (Santa Cruz, CA, USA). Polyvinylidene difluoride
(PVDF) membranes were from Bio-Rad (Hercules, CA, USA). Horseradish
peroxidase-conjugated secondary antibodies and enhanced chemiluminescence reagents were from Pierce Biotechnology (Thermo Fisher Scientific,
Rockford, IL, USA). Plasmid purification kits were from TIANGEN (Beijing,
China). Chemically synthesized miRNAs and siRNAs were obtained from
RiboBio (Guangzhou, China). All other chemicals and reagents were
purchased from Sigma-Aldrich Company unless otherwise specified.
2.2 Human heart samples
Human heart samples were collected at Tongji Hospital (Wuhan, China).
The study was approved by the Ethics Review Board of Tongji Hospital
and Tongji Medical College and conformed to the principles of the Declaration of Helsinki. The subjects recruited in the study signed informed consent
or signed by the immediate family members in case of incapacity.
2.3 Construction and preparation of type 9
recombinant adeno-associated virus
Type 9 recombinant adeno-associated virus (rAAV) vectors containing
hsa-miR-21-3p, anti-hsa-miR-21-3p (5′ -GGATC CGACG GCGCU AGG
AU CAUCA ACACA GCCCA UCGAU CUACU GGUGU UGCAA
GUAUU CUGGU CACAG AAUAC AACAC AGCCC AUCGA UCUAC
UGGUG UUGCA AGAUG AUCCU AGCGC CGUCU UUUGC GG
CC-3′ ), and HDAC8 were prepared by triple plasmid co-transfection in
human embryonic kidney 293 cells as described previously.20,21 Plasmids
for viral packaging were obtained from Dr Xiao Xiao (University of North
Carolina Eshelman School of Pharmacy, Chapel Hill, NC, USA).21
2.4 Animal treatment and gene delivery
All animal experimental protocols complied with the Guide for the Care and
Use of Laboratory Animals published by the United States National Institutes
of Health. All surgery was performed under sodium pentobarbital anaesthesia (50 mg/kg, IP), and all efforts were made to minimize suffering. Anaesthetization of mice was performed with intraperitoneal injection of xylazine
(5 mg/kg) and ketamine (80 mg/kg) mixture, placed in a supine position
before they were sacrificed. The study was approved by the Institutional
Animal Research Committee of Tongji Medical College. Male C57BL/6
mice (22 – 25 g) were obtained from the Experimental Animal Center of
Changsha (Changsha, China). Experimental animals were housed at the
animal care facility of Tongji Medical College at 258C with 12/12-h light/
dark cycles and allowed free access to normal mice chow and water
throughout the study period. After 1 week of adaptation period, mice
were randomly assigned into different treatment groups (n ¼ 20/group) as
follows: Sham, TAC, TAC + rAAV-GFP, TAC + rAAV-miR-21-3p, TAC +
rAAV-anti-miR-21-3p, and TAC + rAAV-miR-21-3p + rAAV-HDAC8.
For gene delivery, a single intravenous injection of corresponding virus
(1 × 1011 virion particles in 100 mL of saline solution) was given via tail
vein. Two weeks after the rAAV injection, pressure overload was induced
by transverse aortic constriction (TAC) in mice as described previously,22
with sham mice undergoing the same operation without aortic constriction.
Next, the mice were randomly assigned into different treatment groups
(n ¼ 8/group) as follows: Control, Ang II, Ang II + rAAV-GFP, Ang II +
rAAV-miR-21-3p, Ang II + rAAV-anti-miR-21-3p, and Ang II + rAAVmiR-21-3p + rAAV-HDAC8. For gene delivery, corresponding virus
(1 × 1011 virion particles in 100 mL of saline solution) was injected via
tail vein. Two weeks later, pressure overload was induced by Ang II infusion. Mini-osmotic pumps were implanted as described previously.23
Ang II was dissolved in 0.9% normal saline, and pumps (Alzet, Durect)
were filled to deliver at the rate of 1.5 mg/kg/day over a period of 14
days. In control mice, vehicle (0.9% normal saline) was used. Two weeks
after the operation, all the animals were sacrificed, and organs were collected and frozen in liquid nitrogen followed by storage at 2808C. A
portion of the organs were fixed with neutralizing formalin for histological
analysis.
2.5 RNA extraction and real-time PCR
Total RNAs were extracted using TRIzol (Invitrogen, Carlsbad, CA, USA)
according to the manufacturer’s instructions and reverse-transcribed by
M-MLV First-Strand cDNA Synthesis Kit (Invitrogen). The expression of
miR-21-3p was measured by quantitative real-time PCR according to the
manufacturer’s protocol (Ribobio), and U6 small nuclear RNA was used as
an internal normalized reference. The mRNA levels of ACTA, ANP, BNP,
a-MHC, and b-MHC were quantified by quantitative real-time PCR using
Power SYBR Green PCR Master Mix (Invitrogen), and GAPDH was used
as the housekeeping reference gene. Each reaction was performed in triplicate, and the results were analysed using 22DDCt method.
2.6 Echocardiography
Echocardiography examination was performed using a high-resolution
imaging system with a 30-MHz high-frequency scanhead (VisualSonics
Vevo770, VisualSonics Inc., Toronto, Canada) as described previously.24
2.7 In vivo haemodynamics
Mice were anaesthetized, and a pressure– volume catheter (Millar 1.4F, SPR
835, Millar Instruments, Inc. Houston, TX, USA) was inserted into the right
carotid artery and advanced into the left ventricle under pressure control to
measure instantaneous intraventricular pressure and volume as described
previously.25
2.8 Histochemical analysis
Formalin-fixed hearts were embedded in paraffin and sectioned into 4 mm
slices. To measure the cross-sectional area of the cardiomyocytes, staining
with FITC-conjugated wheat germ agglutinin (Sigma) was used according
to the method described.26 Tissue sections were visualized by LM, and
mage-Pro Plus Version 6.0 (Media Cybernetics, Bethesda, MD, USA) was
used to measure the area of each cell, as described previously.
2.9 Luciferase assay
The 3′ UTR of human HDAC8 gene was amplified by PCR using the HDAC8
3′ UTR primers (5′ -AAAGA GCTCC AGGGA ATCTG AAGCA TG-3′ and
342
5′ -CCCTT CGAAC AACGG GACAA AGAGG TA-3′ ) and cloned in the
pMIR-REPORTTM Luciferase Vector (Ambion, Carlsbad, CA, USA). The 3′
UTR of the human HDAC8 was mutated using a Fast Mutagenesis System
kit (TransGen Biotech, Beijing, China).
For luciferase reporter assay, 293T cells were plated in 24-well plates
and then transiently transfected with 400 ng pMIR-HDAC8 3′ UTR or the
empty vector and 20 ng of pRL-TK plasmid (Promega, Madison, WI, USA),
using Lipofectamine 2000 (Invitrogen) following the manufacturer’s protocol. At the same time, miR-21-3p mimics, miR-21 (miR-21-5p) mimics, or
miR-con were co-transfected with reporter plasmids in a final concentration
of 100 nM. Luciferase activity was detected 24 h after transfection using the
Dual-Luciferase Reporter Assay System (Promega) as described previously.27 Renilla luciferase activities were used to normalize the transfection
efficiency and the internally controlled firefly luciferase activity. Transfections were done in duplicates and repeated at least three times in independent experiments.
M. Yan et al.
concentration was measured using the BCA protein assay reagent kit
(Boster). Lysates (20 mg protein/lane) were separated by 10% SDS – PAGE
and transferred onto PVDF membranes. After blocking non-specific sites
with 5% non-fat milk and 3% BSA for 2 h, protein blots were incubated
with primary antibodies overnight at 48C, followed by incubation with a
peroxidase-conjugated secondary antibody for 2 – 3 h at room temperature.
The bands were visualized with enhanced chemiluminescence reagents
according to the manufacturer’s recommendations. Western blots were
quantified by densitometry and analysed with GAPDH as a loading control.
2.15 Statistical analysis
All the quantitative data shown combined from all experiments and presented as mean + SEM unless otherwise noted. Differences between
groups were evaluated for significance using Student’s t-test of unpaired
data or one-way analysis of variance (ANOVA) and Bonferroni post-test.
Statistical significance was defined as P , 0.05.
2.10 Cell culture
H9c2 (2-1) cells were obtained from ATCC and were routinely cultured in
DMEM supplemented with 10% FBS and penicillin–streptomycin (100 IU/mL)
in a humidified atmosphere of 95% air and 5% CO2 at 378C.
3. Results
2.11 Isolation of cardiac fibroblasts
and cardiomyocytes
3.1 The expression of miR-21-3p in cardiac
hypertrophy and heart failure
Hearts were removed from newborn rats (day 0 – 3), placed in ice-cold
Hanks’ medium, cut into pieces, and digested with trypsin and Type II
collagenase at 378C. The collected primary cells were passed through a
cell strainer (200 mesh) and then seeded onto petri dishes and incubated
for 2 h. The supernatant (cardiomyocytes) was collected and plated in
DMEM containing vitamin B12, NaHCO3, and 10% FBS, and the adherent
cells (cardiac fibroblasts) were cultured in DMEM supplemented with
10% FBS. Primary cells were identified by IF staining with antibodies
directed against cardiomyocyte-specific marker a2-actin (ACTN2,
Sigma), fibroblast-specific antigen prolyl-4-hydroxylase (P4HB, Acris),
endothelial cell marker platelet/endothelial cell adhesion molecule
(CD31 antigen), (PECAM1, Abcam), and smooth muscle a2-actin
(ACTA2, Boster, Wuhan, China).
We collected heart samples from 12 receipts of heart transplantation
who suffered from dilated cardiomyopathy (DCM) with end-stage
heart failure and 8 normal hearts of traffic accident victims. The clinical
characteristics of patients are listed in Table 1. We investigated the
expression of cardiac miR-21 family (miR-21-5p and miR-21-3p) of
those patients. The results showed that miR-21-5p and miR-21-3p
were significantly elevated in samples of heart failure (Figure 1A). Then,
we detected the expression of cardiac miR-21-5p and miR-21-3p in
TAC-induced mice. We are surprised to find that miR-21-3p level is
reduced in hypertrophic hearts at 2 weeks after TAC, but its level is
increased in hearts at 4 weeks after TAC (Figure 1B). However, the
miR-21-5p level was significantly increased at 2 weeks and gradually
reduced at 4 weeks (still higher than Sham) (Figure 1B). These results indicated that the expression of miR-21-3p was biphasic regulated, and
miR-21-3p may play critical roles in cardiac hypertrophy.
2.12 Cell transfection and treatments
Cells were transfected with miRNA/siRNA negative control (miR-con and
siR-con), miR-21-3p mimics, or siRNA targeting rat HDAC8 (5′ -CAUCU
AAAGU UAUGA CUGU dTdT-3′ ) (RiboBio) using Lipofectamine 2000
(Invitrogen) following the manufacturer’s protocol. Twenty-four hours
after transfection, cells were treated with 1 mM Ang II for the next 24 h
and then collected.
For some experiments, cells were infected with corresponding rAAV
virus 1 week before use. Then cells were treated with Ang II for 24 h and
collected.
For all in vitro experiments, we repeated the experiment three times with
the same intervention on different samples.
2.13 Immunocytofluorescence
Cells were washed with PBS and fixed in 4% paraformaldehyde for 10 min
and then in 0.25% Triton-X100 for 10 min. After blocking with 5% BSA
for 30 min, cells were incubated in Actin-Trakcer Green (Beyotime, Shanghai, China) at 48C overnight. Then, cells were visualized with DAPI
(Sigma-Aldrich) for nuclear counter staining and subsequently visualized
under a Nikon DXM1200 fluorescence microscope. Image-Pro Plus 6.0 (Media
Cybernetics) was applied for image merging.
2.14 Western blot analysis
Western blotting was performed as described previously.28 Briefly, cells or
frozen animal tissues were homogenized in ice-cold lysis buffer. The protein
Table 1 Clinical characteristics of patients with dilated
cardiomyopathy
Patient
Gender
Age
LVEF (%)
Diagnosis
1
2
Male
Male
44
48
12
17
DCM
DCM
3
Male
54
20
DCM
4
5
Male
Male
53
51
29
23
DCM
DCM
6
Female
57
25
DCM
7
8
Male
Male
43
63
28
34
DCM
DCM
9
Male
44
20
DCM
10
11
Male
Male
44
59
17
22
DCM
DCM
12
Male
56
29
DCM
....................................................................................
DCM, dilated cardiomyopathy; LVEF, left ventricular ejection fraction.
343
miR-21-3p and cardiac hypertrophy
Figure 1 The expression of miR-21-3p in cardiac hypertrophy and heart failure. (A) The expression level of miR-21-3p and miR-21-5p in human myocardial tissue of DCM. Normal (n ¼ 8); DCM (n ¼ 12); *P , 0.05 vs. Normal. (B) The expression levels of cardiac miR-21-3p and miR-21-5p in
TAC-induced mice. n ¼ 5 per group; *P , 0.05 vs. Sham; #P , 0.05 vs. Sham. Hypertrophic parameters in TAC mice (C) and Ang II-treated mice (D). Histological analysis of surface area of cardiomyocytes by WGA staining of TAC mice (E) and Ang II-treated mice (F). Scale bar, 25 mm. (G) Expression of
miR-21-3p was detected by real-time PCR in TAC mice hearts and Ang II-treated mice hearts. n ¼ 5 per group; *P , 0.05 vs. Sham or Control. Data
are shown as mean + SEM.
To study the role of miR-21-3p in cardiac hypertrophy, Ang II-induced
or TAC-induced cardiac hypertrophic mice models were employed. As
shown in Figure 1C – F, TAC and Ang II induced marked cardiac hypertrophy, determined by increased posterior wall thickness in systolic
and diastolic phases (LVPW,s and LVPW,d) using echocardiography
(Figure 1C and D) and increased cardiomyocyte size determined by staining with FITC-conjugated wheat germ agglutinin (WGA) (Figure 1E
and F).
Expression of miR-21-3p in heart was determined by real-time PCR
assays. We found that the basal levels of miR-21-3p in mouse, rat, and
human hearts were similar (Supplementary material online, Table S1),
and miR-21-3p was down-regulated in the hypertrophic heart in TAC
mice and Ang II-treated mice (Figure 1G).
3.2 miR-21-3p regulates cardiac
hypertrophic response in vivo and in vitro
To investigate the effects of miR-21-3p on cardiac hypertrophy,
rAAV9-miR-21-3p and rAAV9-anti-miR-21-3p were used to manipulate
the expressions of mature miR-21-3p in TAC mice. As shown in
Figure 2A, rAAV9-miR-21-3p treatment induced miR-21-3p overexpression in TAC mice as measured by real-time PCR, and rAAV9anti-miR-21-3p delivery decreased the expression of miR-21-3p
(Figure 2A). Overexpression of miR-21-3p significantly inhibited the
increase in heart size and heart weight to body weight (HW/DW)
ratio induced by TAC, while anti-miR-21-3p showed opposite effects
(Figure 2B). These results were further confirmed by myocyte size
344
M. Yan et al.
Figure 2 miR-21-3p regulates cardiac hypertrophic response in vivo and in vitro. (A) Cardiac expression of miR-21-3p detected by real-time PCR. Sham
(n ¼ 10), TAC (n ¼ 7), TAC + GFP (n ¼ 6), TAC + miR-21-3p (n ¼ 8), and TAC + anti-miR-21-3p (n ¼ 6). (B) Representative images of hearts and the
ratio of heart weight to body weight (HW/DW) of mice. Scale bar, 2 mm. Sham (n ¼ 20), TAC (n ¼ 13), TAC + GFP (n ¼ 12), TAC + miR-21-3p
(n ¼ 15), and TAC + anti-miR-21-3p (n ¼ 12). (C) Histological analysis of surface area of cardiomyocytes by WGA staining. Scale bar, 25 mm. Sham
(n ¼ 10), TAC (n ¼ 6), TAC + GFP (n ¼ 6), TAC + miR-21-3p (n ¼ 7), and TAC + anti-miR-21-3p (n ¼ 6). (D) Echocardiographic parameters in
mice with different treatment. LVPW,d, LV posterior wall thickness at diastole; LVPW,s, LV posterior wall thickness at systole; EF, ejection fraction; FS,
fractional shortening. (E) Haemodynamic parameters measured by Millar cardiac catheter system in mice with different treatment. dP/dtmax, peak instantaneous rate of left ventricular pressure increase; dP/dtmin, peak instantaneous rate of left ventricular pressure increase decline. (F ) Expression of markers of
cardiac hypertrophy in the myocardium of mice with different treatments measured by real-time PCR. Sham (n ¼ 10), TAC (n ¼ 7), TAC + GFP (n ¼ 6),
TAC + miR-21-3p (n ¼ 8), and TAC + anti-miR-21-3p (n ¼ 6); *P , 0.05 vs. Sham; #P , 0.05 vs. TAC + GFP; &P , 0.05 vs. TAC + GFP. (G) Measurement of surface area of H9c2 cells with various treatments. n ¼ 3; Scale bar, 50 mm. (H ) Expression of markers of cardiac hypertrophy in cardiomyocytes
with different treatments measured by real-time PCR. n ¼ 3; *P , 0.05 vs. Control; #P , 0.05 vs. Ang II + miR-con; &P , 0.05 vs. Ang II + inhibitor-con.
Data are shown as mean + SEM.
345
miR-21-3p and cardiac hypertrophy
measurement (Figure 2C), indicating that miR-21-3p overexpression prevented cardiac hypertrophy induced by TAC, while anti-miR-21-3p exacerbated the cardiac hypertrophy. Cardiac function was evaluated by
echocardiography and invasive pressure – volume analysis. The echocardiographic assessments showed that overexpression of miR-21-3p attenuated TAC-induced left ventricular hypertrophy (LVH) compared with
control mice. In contrast, anti-miR-21-3p aggravated the severity of LVH
(Table 2 and Figure 2D). Using Millar cardiac catheter system, we found
that miR-21-3p overexpression alleviated cardiac dysfunction of TAC
mice, while rAAV9-anti-miR-21-3p exacerbated cardiac dysfunction
by down-regulating miR-21-3p (Table 3 and Figure 2E). miR-21-3p overexpression down-regulated expression of ACTA, BNP, and b-MHC and
up-regulaled expression of a-MHC measured by real-time PCR assays,
in further confirmation of its anti-hypertrophic effects (Figure 2F). These
results were further confirmed in Ang II-treated mice (Supplementary
material online, Figure S1 and Supplementary material online, Tables S2
and S3).
In vitro, Ang II-treated cardiomyocytes were transfected with
miR-21-3p mimics and miR-21-3p inhibitor. Ang II-induced cellular
hypertrophy was detected by cell surface area measurement.
miR-21-3p mimics inhibited Ang II-induced cardiomyocyte hypertrophy,
while miR-21-3p inhibitor promoted hypertrophy (Figure 2G). Moreover, real-time PCR assays showed that miR-21-3p mimics blunted the
expression of Ang II-induced markers of cardiac hypertrophy including
ACTA, ANP, BNP, and b-MHC, while miR-21-3p inhibitor enhanced
their expression in experiments performed with primary cardiomyocytes (Supplementary material online, Figure S2 and Figure 2H). These
findings were further confirmed in experiments performed with H9c2
cells (Supplementary material online, Figure S3).
All these data indicate that miR-21-3p attenuates cardiac hypertrophy
in vivo and in vitro.
3.3 miR-21-3p directly targets HDAC8
by interaction with the 3′ UTR
Putative miR-21-3p targets were predicted using target prediction
programmes, miRBase and TargetScan. Multiple sequence alignment
of hsa-miR-21-3p indicates a binding site within the 3′ UTR of
the human HDAC8 gene (Figure 3A). When co-transfected with
miR-21-3p mimics into 293T cells, the relative luciferase activity of
Table 2 Echocardiographic characteristics of Sham, TAC, TAC 1 GFP, TAC 1 miR-21-3p, and TAC 1 anti-miR-21-3p mice
Sham
TAC
TAC 1 GFP
TAC 1 miR-21-3p
TAC 1 anti-21-3p
HR (b.p.m.)
LVPW,d (mm)
558 + 28
0.63 + 0.03
571 + 12
1.05 + 0.03*
558 + 11
1.04 + 0.02*
534 + 7
0.78 + 0.02#
568 + 16
1.15 + 0.02&
LVPW,s (mm)
1.18 + 0.06
1.58 + 0.04*
1.56 + 0.04*
1.25 + 0.01#
1.76 + 0.02&
1.11 + 0.02*
1.72 + 0.02*
#
1.17 + 0.01&
1.79 + 0.02&
.......................................................................................................................................................................................
LVAW,d (mm)
LVAW,s (mm)
0.84 + 0.03
1.51 + 0.01
1.12 + 0.03*
1.69 + 0.01*
1.01 + 0.02
1.57 + 0.01#
LVID,d (mm)
1.74 + 0.15
2.96 + 0.18*
3.05 + 0.20*
1.93 + 0.04
3.19 + 0.19
LVID,s (mm)
FS (%)
1.26 + 0.13
58.8 + 1.2
1.93 + 0.15
40.7 + 4.6*
1.94 + 0.21
42.4 + 1.7*
1.33 + 0.24
57.6 + 6.3#
1.91 + 0.16
38.7 + 2.2
EF (%)
87.8 + 1.0
68.6 + 1.5*
73.8 + 2.0*
86.8 + 3.4#
66.7 + 1.4&
Values represent mean + SEM; n ≥ 6 per group.
HR, heart rate; LVPW,d, LV posterior wall thickness at diastole; LVPW,s, LV posterior wall thickness at systole; LVAW,d, LV anterior wall thickness at diastole; LVAW,s, LV anterior wall
thickness at systole; LVID,d LV internal diameter at diastole; LVID,s, LV internal diameter at systole; FS, fractional shortening; EF, ejection fraction.
*P , 0.05 vs. Sham.
#
P , 0.05 vs. TAC + GFP.
&
P , 0.05 vs. TAC + GFP.
Table 3 Comparison of haemodynamic variables for Sham, TAC, TAC 1 GFP, TAC 1 miR-21-3p, and TAC 1 anti-miR-21-3p
mice
Sham
TAC
TAC 1 GFP
TAC 1 miR-21-3p
TAC 1 anti-miR-21-3p
.......................................................................................................................................................................................
HR (b.p.m.)
dP/dtmax (mmHg/s)
417 + 48
6974 + 368
408 + 43
2816 + 136*
413 + 47
3214 + 127*
408 + 60
6659 + 229#
398 + 21
2330 + 289&
dP/dtmin (mmHg/s)
27277 + 902
22957 + 169*
22858 + 337*
27239 + 185#
21914 + 194&
Pmax (mmHg)
Pes (mmHg)
95.5 + 5.8
97.3 + 6.3
59.6 + 3.9*
59.0 + 4.7*
60.2 + 1.6*
63.9 + 1.2*
#
89.6 + 4.9
87.8 + 4.9#
51.2 + 2.7&
51.4 + 2.7&
Values represent mean + SEM; n ≥ 6 per group.
HR, heart rate; dP/dtmax, peak instantaneous rate of left ventricular pressure increase; dP/dtmin, peak instantaneous rate of left ventricular pressure increase decline; Pmax, peak systolic pressure;
Pes, end systolic pressure.
*P , 0.05 vs. Sham.
#
P , 0.05 vs. TAC + GFP.
&
P , 0.05 vs. TAC + GFP.
346
M. Yan et al.
Figure 3 miR-21-3p directly targets HDAC8 by interaction with the 3′ UTR. (A) Schematic representation of the predicted target sites of miR-21-3p in
the 3′ UTR of HDAC8. (B) Luciferase activity was analysed in 293T cells 24 h after transfection with indicated plasmids with miR-con, miR-21, or miR-21-3p
mimics. n ¼ 3; *P , 0.05 vs. HDAC8 3′ UTR + miR-con. (C) Protein level of HDAC8 examined by western blot analysis. n ¼ 3; *P , 0.05 vs. miR-con;
#
P , 0.05 vs. inhibitor-con. (D) Protein level of HDAC8 in rAAV9-miR-21-3p and rAAV9-anti-miR-21-3p-treated TAC mice explored by western blot.
Sham (n ¼ 10), TAC (n ¼ 7), TAC + GFP (n ¼ 6), TAC + miR-21-3p (n ¼ 8), and TAC + anti-miR-21-3p (n ¼ 6); *P , 0.05 vs. Sham; #P , 0.05 vs.
TAC + GFP; &P , 0.05 vs. TAC + GFP. Data are shown as mean + SEM.
HDAC8 3′ UTR reporter was significantly suppressed compared with
the transfection of miR-21 (miR-21-5p) and miR-con as well as with
the mutant reporter or empty vector. (Figure 3B). These results suggest
that hsa-miR-21-3p inhibits human HDAC8 expression by directly binding
its 3′ UTR.
Western blots showed that miR-21-3p mimic transfection significantly reduced HDAC8 level, and miR-21-3p inhibitor increased
HDAC8 level in primary cardiomyocytes (Figure 3C) and H9c2 cells
(Supplementary material online, Figure S4). Moreover, in TAC mice,
HDAC8 protein level was reduced in rAAV9-miR-21-3p-treated
group and rAAV9-anti-miR-21-3p treatment reversed this effect
(Figure 3D).
These results suggest that miR-21-3p can specifically target HDAC8.
3.4 HDAC8 regulates cardiac hypertrophy
via Akt/Gsk3b pathway
To investigate the effects of HDAC8 on cardiac hypertrophy, we
transfected rAAV-HDAC8 or siRNA-HDAC8 into cardiomyocytes to
manipulate HDAC8 expression. Measurement of cell surface area
showed that siRNA-HDAC8 significantly inhibited Ang II-induced
cardiomyocyte hypertrophy, while rAAV-HDAC8 delivery exacerbated
cardiomyocyte hypertrophy (Figure 4A). In addition, the effects of
HDAC8 on cardiomyocyte hypertrophy were also confirmed by
detecting the markers of cardiac hypertrophy in primary cardiomyocytes. siRNA-HDAC8 inhibited Ang II-induced increase in ACTA,
ANP, BNP, and b-MHC expression, and HDAC8 overexpression
increased the expression of these genes (Figure 4B and C). These findings
were further confirmed in experiments performed with H9c2 cells
(Supplementary material online, Figure S5A and B).
HDACs commonly function as transcriptional co-repressors, and
Class I HDACs play an important role in the regulation of cardiac hypertrophy. Akt/Gsk3b pathway that is important for growth control in
cardiovascular system has been shown to be an important modulator
of Class I HDACs regulation.19 In our study, we validated HDAC8, a
member of Class I HDACs, as the target of miR-21-3p. Next, we
evaluated the possibility that the effect of miR-21-3p in cardiac hypertrophy may depend on HDAC8-mediated regulation of Akt/Gsk3b
pathway. Western blots showed that silencing of HDAC8 decreased
phospho-Akt and phospho-Gsk3b levels, while overexpression of
HDAC8 increased the levels of phospho-Akt and phospho-Gsk3b
in both primary cardiomyocytes (Figure 4D and E) and H9c2 cells
(Supplementary material online, Figure S5C and D). These results
suggest that HDAC8 may regulate cardiac hypertrophy via Akt/
Gsk3b pathway.
3.5 Restored HDAC8 expression
eliminated the protective effect of miR-21-3p
overexpression in cardiac hypertrophy
To further verify the role of miR-21-3p/HDAC8 pathway in mediating
cardiac hypertrophic response, we re-expressed HDAC8 in rAAV9miR-21-3p-treated TAC mice using rAAV9-HDAC8. As shown in
Figure 5A, rAAV9-HDAC8 restored HDAC8 expression in rAAV9miR-21-3p-treated TAC mice as verified by western blots (Figure 5A)
and eliminated the protective effects of miR-21-3p overexpression
miR-21-3p and cardiac hypertrophy
347
Figure 4 HDAC8 regulates cardiac hypertrophic response in vitro. (A) Measurement of surface area of H9c2 cells with various treatments. n ¼ 3; Scale
bar, 50 mm. (B) and (C) Expression of markers of cardiac hypertrophy in cardiomyocytes with different treatments measured by real-time PCR. n ¼ 3;
*P , 0.05 vs. Control; #P , 0.05 vs. Ang II + GFP; &P , 0.05 vs. Ang II + siRNA-con. (D) and (E) Protein expressions of phospho-Akt, total-Akt,
phospho-Gsk3b, and total-Gsk3b detected by western blot in cardiomyocytes transfected with siHDAC8 and treated with Ang II. n ¼ 3; *P , 0.05 vs.
Control; #P , 0.05 vs. Ang II + GFP; &P , 0.05 vs. Ang II + siRNA-con. Data are shown as mean + SEM.
in TAC-induced cardiac hypertrophy as determined by heart size, HW/
BW ratio, and myocyte size measurement (Figure 5B and C).
Echocardiography and invasive pressure–volume tests showed that
restored HDAC8 expression markedly reduced heart function in
rAAV9-miR-21-3p-treated TAC mice (Tables 4 and 5 and Figure 5D
and E). In addition, real-time PCR assays showed that miR-21-3p
reduced the expression of markers of cardiac hypertrophy, including
ACTA, BNP, and b-MHC, and increased a-MHC, while restored
348
M. Yan et al.
Figure 5 Restored HDAC8 expression eliminated the protective effect of miR-21-3p overexpression in cardiac hypertrophy in vivo. (A) Cardiac expression of HDAC8 using western blot. Sham (n ¼ 10), TAC (n ¼ 7), TAC + GFP (n ¼ 6), TAC + miR-21-3p (n ¼ 8), and TAC + miR-21-3p + HDAC8
(n ¼ 6). (B) Representative images of hearts and the ratio of heart weight to body weight (HW/DW) of mice. Scale bar, 2 mm. Sham (n ¼ 20), TAC
(n ¼ 13), TAC + GFP (n ¼ 12), TAC + miR-21-3p (n ¼ 15), and TAC + miR-21-3p + HDAC8 (n ¼ 12). (C) Histological analysis of surface area of cardiomyocytes by WGA staining. Scale bar, 25 mm. Sham (n ¼ 10), TAC (n ¼ 6), TAC + GFP (n ¼ 6), TAC + miR-21-3p (n ¼ 7), and TAC + miR-21-3p +
HDAC8 (n ¼ 6). (D) Echocardiographic parameters (LVPW,d, LVPW,s, EF, and FS) in mice with different treatments. (E) Haemodynamic parameters (dP/
dtmax, dP/dtmin) measured by Millar cardiac catheter system in mice with different treatments. (F ) Expression of markers of cardiac hypertrophy in myocardium of different treated mice measured by real-time PCR. Sham (n ¼ 10), TAC (n ¼ 7), TAC + GFP (n ¼ 6), TAC + miR-21-3p (n ¼ 8), and TAC +
miR-21-3p + HDAC8 (n ¼ 6); *P , 0.05 vs. Sham; #P , 0.05 vs. TAC + GFP; &P , 0.05 vs. TAC + miR-21-3p. (G) Measurement of surface area of H9c2
cells with various treatments. n ¼ 3; Scale bar, 50 mm. (H ) Expression of markers of cardiac hypertrophy was confirmed in cardiomyocytes with different
treatments by real-time PCR. n ¼ 3; *P , 0.05 vs. Control; #P , 0.05 vs. Ang II + miR-con; &P , 0.05 vs. Ang II + miR-21-3p + GFP. Data are shown as
mean + SEM.
349
miR-21-3p and cardiac hypertrophy
Table 4 Echocardiographic characteristics of Sham, TAC, TAC 1 GFP, TAC 1 miR-21-3p, and TAC 1 miR-21-3p 1 HDAC8
mice
Sham
TAC 1 GFP
TAC
TAC 1 miR-21-3p
TAC 1 miR-21-3p 1 HDAC8
.......................................................................................................................................................................................
HR (b.p.m.)
558 + 28
571 + 12
558 + 11
534 + 7
545 + 12
LVPW,d (mm)
0.63 + 0.03
1.05 + 0.03*
1.04 + 0.02*
0.78 + 0.02#
1.00 + 0.07&
LVPW,s (mm)
LVAW,d (mm)
1.18 + 0.06
0.84 + 0.03
1.58 + 0.04*
1.12 + 0.03*
1.56 + 0.04*
1.11 + 0.02*
1.25 + 0.01#
1.01 + 0.02#
1.51 + 0.01&
1.16 + 0.08&
LVAW,s (mm)
1.51 + 0.01
1.69 + 0.01*
1.72 + 0.02*
1.57 + 0.01#
1.71 + 0.07&
LVID,d (mm)
LVID,s (mm)
1.74 + 0.15
1.26 + 0.13
2.96 + 0.18*
1.93 + 0.15
3.05 + 0.20*
1.94 + 0.21
1.93 + 0.04
1.33 + 0.24
2.92 + 0.14
1.99 + 0.01
FS (%)
58.8 + 1.2
40.7 + 4.6*
42.4 + 1.7*
57.6 + 6.3#
40.5 + 2.0&
73.8 + 2.0*
#
73.6 + 2.3&
EF (%)
87.8 + 1.0
68.6 + 1.5*
86.8 + 3.4
Values represent mean + SEM; n ≥ 6 per group.
HR, heart rate; LVPW,d, LV posterior wall thickness at diastole; LVPW,s, LV posterior wall thickness at systole; LVAW,d, LV anterior wall thickness at diastole; LVAW,s, LV anterior wall
thickness at systole; LVID,d, LV internal diameter at diastole; LVID,s, LV internal diameter at systole; FS, fractional shortening; EF, ejection fraction.
*P , 0.05 vs. Sham.
#
P , 0.05 vs. TAC + GFP.
&
P , 0.05 vs. TAC + miR-21-3p.
Table 5 Comparison of haemodynamic variables for Sham, TAC, TAC 1 GFP, TAC 1 miR-21-3p, and TAC 1 miR-21-3p 1
HDAC8 mice
Sham
TAC
TAC 1 GFP
TAC 1 miR-21-3p
TAC 1 miR-21-3p 1 HDAC8
.......................................................................................................................................................................................
417 + 48
408 + 43
413 + 47
408 + 60
400 + 25
dP/dtmax (mmHg/s)
6974 + 368
2816 + 136*
3214 + 127*
6659 + 229#
2461 + 424&
dP/dtmin (mmHg/s)
Pmax (mmHg)
27277 + 902
95.5 + 5.8
22957 + 169*
59.6 + 3.9*
22858 + 337*
60.2 + 1.6*
27239 + 185#
89.6 + 4.9#
22863 + 526&
58.3 + 7.6&
HR (b.p.m.)
Pes (mmHg)
97.3 + 6.3
59.0 + 4.7*
63.9 + 1.2*
87.8 + 4.9#
65.2 + 3.9&
Values represent mean + SEM; n ≥ 6 for each group.
HR, heart rate; dP/dtmax, peak instantaneous rate of left ventricular pressure increase; dP/dtmin, peak instantaneous rate of left ventricular pressure increase decline; Pmax, peak systolic pressure;
Pes, end systolic pressure.
*P , 0.05 vs. Sham.
#
P , 0.05 vs. TAC + GFP.
&
P , 0.05 vs. TAC + miR-21-3p.
HDAC8 expression abolished these effects (Figure 5F). These findings
were further confirmed in experiments performed in Ang II-treated
mice (Supplementary material online, Figure S6 and Supplementary
material online, Tables S4 and S5).
To further examine the effects of HDAC8 on cardiac hypertrophy, we
transfected miR-21-3p mimics and/or rAAV-HDAC8 into cardiomyocytes with Ang II stimulation. Overexpression of HDAC8 attenuated
the suppressive effects of miR-21-3p on cardiac hypertrophy as determined by cell surface area measurements and real-time PCR assays of
ACTA, ANP, BNP, and b-MHC (Figure 5G and H), which was consistent
with the results obtained with H9c2 cells (Supplementary material
online, Figure S7A–D).
3.6 Restored HDAC8 expression attenuated
the effects on Akt/Gsk3b pathway of
miR-21-3p in vivo and in vitro
Western blots showed that miR-21-3p overexpression reduced
phospho-Akt and phospho-Gsk3b levels compared with TAC mice.
However, restoring HDAC8 expression induced phospho-Akt and
phospho-Gsk3b compared with the rAAV9-miR-21-3p-treated TAC
mice group (Figure 6A). These findings were further confirmed in Ang
II-treated mice (Supplementary material online, Figure S6G). We also
carried out in vitro cell experiments and the results showed that
miR-21-3p mimics suppressed Ang II-induced Akt/Gsk3b pathway,
while transfection of rAAV-HDAC8 eliminated these effects in both
primary cardiomyocytes (Figure 6B and Supplementary material online,
Figure S8) and H9c2 cells (Supplementary material online, Figure S7E).
These results indicated that Akt/Gsk3b pathway plays an important
role in the regulation of cardiac hypertrophy by miR-21-3p/HDAC8.
To further evaluate the role of miR-21-3p/HDAC8/Akt/ Gsk3b
pathway in mediating cardiac hypertrophic response, we used Gsk3b
inhibitor in siHDAC8 or miR-21-3p mimics-treated primary cardiomyocytes with Ang II stimulation. The results showed that Gsk3b
inhibitor suppressed the inhibitory effects of siHDAC8 and miR-21-3p
on cardiac hypertrophy as determined by real-time PCR assays of markers of cardiac hypertrophy, including ACTA, ANP, BNP, and b-MHC
(Supplementary material online, Figure S9A and B). These results
350
M. Yan et al.
Figure 6 HDAC8 reintroduction reversed the suppression of cardiac hypertrophic response induced by miR-21-3p treatment in cardiomyocytes.
(A) Protein levels of phospho-Akt, total-Akt, phospho-Gsk3b, and total-Gsk3b detected by western blot in myocardium of rAAV-miR-21-3p and
rAAV-HDAC8-treated TAC mice. Sham (n ¼ 10), TAC (n ¼ 7), TAC + GFP (n ¼ 6), TAC + miR-21-3p (n ¼ 8), and TAC + miR-21-3p + HDAC8
(n ¼ 6); *P , 0.05 vs. Sham; #P , 0.05 vs. TAC + GFP; &P , 0.05 vs. TAC + miR-21-3p. (B) Protein expression of phospho-Akt, total-Akt,
phospho-Gsk3b, and total-Gsk3b in cardiomyocytes transfected with rAAV-HDAC8 and miR-21-3p, and treated with Ang II. n ¼ 3; *P , 0.05 vs.
Control; #P , 0.05 vs. Ang II + miR-con; &P , 0.05 vs. Ang II + miR-21-3p + GFP. Data are shown as mean + SEM.
suggested that miR-21-3p/HDAC8 regulated cardiac hypertrophy via
the Akt/Gsk3b pathway.
4. Discussion
We first identified a miR-21-3p-mediated cardiac hypertrophic response involving HDAC8, which participates in modulating Akt/Gsk3b
pathway. Our data show that cardiac expression of miR-21-3p is
reduced in TAC- and Ang II-treated mice, suggesting a role in regulating
cardiac hypertrophy. Overexpression of miR-21-3p reduced hypertrophic response in cardiomyocytes as well as TAC and Ang II-treated
mice. Furthermore, HDAC8 was validated as a target of miR-21-3p,
using bioinformatic analysis, western blot assays, and luciferase reporter
assays. Moreover, reintroduction of HDAC8 attenuated miR-213p-mediated suppression of cardiac hypertrophy in TAC- and Ang
II-treated mice. These effects may be attributable to the modulation of
Akt/Gsk3b by HDAC8.
Cardiac hypertrophy is an early character of many heart diseases,
which is associated with changes in gene expression.29 miRNAs are
involved in a variety of cardiac events, for example, the conduction of
electrical signals, heart growth, muscle contraction, and morphogenesis.2,5,6,30 Recently, the study on miRNAs refurbished our cognition
about the regulation of cardiac hypertrophy.31 Different miRNAs have
been reported to have important effects on cardiac hypertrophy. For
example, overexpression of miR-195 causes severe cardiac hypertrophy,32 inhibition of miR-133 results in significant cardiac hypertrophy,33 and miR-208 is required for the development of cardiac
hypertrophy in response to hypothyroidism.34 Overexpression of
miR-24, miR-214, and miR-23a also causes significant hypertrophy in
the cardiomyocytes.32
Both clinical and basic studies have revealed that miR-21 may play important roles in diverse cardiovascular diseases. Phosphatase and tensin
homology deleted from chromosome10 (PTEN), programmed cell
death 4 (PDCD4), sprouty 1 (SPRY1), and sprouty 2 (SPRY2) are the
currently identified target genes of miR-21 that are involved in miR-21mediated cardiovascular effects, and miR-21 might be a novel therapeutic target in cardiovascular diseases.10,35 Human miR-21-3p and
miR-21-5p are enzymatically derived from the same RNA stem loop precursor, hsa-mir-21 (Accession number: MI0000077). The mature
miR-21 sequence is strongly conserved throughout evolution (UAGCUUAUCAGACUGAUGUUGA). Traditionally, the mature miRNA
is the guide strand for the regulation of gene expression, whereas
the passenger strand is believed to be degraded and inactivated.36 Previous studies evaluated the expressions of and functional relation
between miRNA and its passenger strand using various physiological
and pathological models. Zhou et al. 37 demonstrated that miR-155*
and miR-155 were inversely regulated by autocrine/paracrine type I
IFN and TLR7-activated KHSRP at the post-transcriptional level,
which led to their different dynamic induction by TLR7. Yang et al. 38
reported that, in prostate tumour, miR-17-5p and miR-17-3p were
abundantly expressed from the same precursor and acted in a
co-ordinated fashion to enhance the power of a miRNA precursor by
repressing the same target. However, whether miRNA-21-3p, as the
complementary sequence of miR-21, also plays crucial roles in cardiovascular diseases is unclear.
The present study revealed the important roles of miR-21-3p in
the pathogenesis of cardiac hypertrophy. We demonstrated that
351
miR-21-3p and cardiac hypertrophy
miR-21-3p markedly attenuates TAC- and Ang II-induced cardiac hypertrophy through targeting HDAC8.
At first, we detected the expression levels of miR-21-3p in human
myocardial tissue of DCM and found that miR-21-3p expression was
induced in DCM. Then, we found that cardiac miR-21-3p level was
reduced in hypertrophic mice at 2 weeks after TAC, which was inconsistent with human DCM hearts (Figure 1). Mice 2 weeks after TAC were
animal models of cardiac hypertrophy, which were different from
heart failure. The heart samples used in our study were derived from
patients who suffered from DCM with end-stage heart failure. The inconsistent results may be due to different pathological models. In additional experiments, we detected miR-21-3p levels in hearts with TAC
at 4 weeks, which had advanced heart failure stage, and results
showed that its level was increased, same as in human DCM hearts
(Figure 1). Previous studies demonstrated that miRNAs are differently
expressed in aortic banding-induced hypertrophic mice hearts at
three time points (1w, 2w, and 3w after aortic banding). The results
showed that miR-21, miR-214, and miR-341 were significantly increased
at 1 week and gradually reduced at 2 and 3 weeks, whereas miR-30c and
miR-424 gradually increased within 3 weeks after aortic coarctation.39
Similarly, Tatsuguchi et al.40 demonstrated that in thoracic aortic
banding (TAB) mouse hearts, the expression level of miR-21 was significantly up-regulated at 2 weeks and then decreased to nearly normal
levels at 4 weeks. These suggest that there is a temporality-effective
miRNA expression in cardiac hypertrophy and heart failure process.
Likewise, our result shows that miR-21-3p has different expression in different pathological stages.
HDACs have been studied in the context of chromatin, where they
deacetylate nucleosomal histones and alter the electrostatic properties
of chromatin in a manner that favours gene repression.41 Currently, at
least 18 different members of the HDAC family have been found from
mammalian cells and are classified into four subfamilies.42 The role of
the HDAC family in cardiomyocyte homeostasis is complex.18 Previous
studies have shown that Class I and Class II HDACs play opposing roles in
the regulation of cardiac hypertrophic response. Class II HDACs function in the heart to repress hypertrophic pathway,16,18 whereas
HDAC2, a Class I HDAC, is required for at least some hypertrophic
responses. Further, HDAC inhibitors that can block catalytic activity
of both Class I and Class II HDACs suppress the hypertrophic response
in animals and isolated cardiac myocytes.43 – 45 This suggests that the predominant targets of these chemical inhibitors are Class I HDACs. Class I
HDACs may play more important role in the regulation of cardiac hypertrophy. Then, what is the role of HDAC8, another Class I HDAC, in
cardiac hypertrophy and heart failure?
To further explore the role of HDAC8 in the regulation of cardiac
hypertrophy, we used rAAV9-HDCA8 and siRNA-HDAC8. First of all,
we found that overexpression of HDAC8 worsens Ang II-induced cardiomyocyte hypertrophy. Secondly, our data showed that siRNA-HDAC8
attenuates Ang II-induced cardiac hypertrophy in cardiomyocyte. These
results suggested that HDAC8 may play an important role in cardiac
hypertrophy. To further verify whether miR-21-3p attenuated cardiac
hypertrophy is dependent on HDAC8, we injected rAAV9-HDCA8 to
mice overexpressing miR-21-3p. The results showed that reintroduction of HDAC8 attenuated miR-21-3p-mediated suppression of
cardiac hypertrophy.
What are the mediators of miR-21-3p-HDAC8 pathway-mediated
hypertrophic response? Previous studies demonstrated that Class I
HDACs are involved in the control of cardiac growth, proliferation,
and differentiation, and function as a pro-hypertrophic regulator.14
HDAC2-mediated, a member of Class I HDACs, regulation of Inpp5f
modulates PIP3 levels in the heart and thereby affects the degree to
which hypertrophic signals are transmitted via the PI3K/Akt/Gsk3b
pathway.19 Likewise, HDAC8 is a member of Class I HDACs. In our
study, we found that HDAC8 may regulate cardiac hypertrophy via
the Akt/Gsk3b pathway. In additional experiments, we detected
Inpp5f expression in siHDAC8-treated primary cardiomyocytes. Realtime PCR assays showed that siHDAC8 significantly promoted the
expression of Inpp5f (Supplementary material online, Figure S8C). The
result suggested that HDAC8 regulates Inpp5f and indicated that
HDAC8 regulates cardiac hypertrophy via Akt/Gsk3b pathway in vivo
and in vitro. Akt is required for at least some hypertrophic responses.
The data showed that transgenic overexpression of Akt is sufficient to
induce significant cardiac hypertrophy in mice without affecting systolic
function.46,47 Akt can directly phosphorylate Gsk3b, a widely expressed
kinase that phosphorylates a series of serine/threonine residues in the
N-terminal regulatory regions of NFAT proteins, thereby masking their
nuclear import sequences and promoting translocation to the cytoplasm
and transcriptional inactivation.48 Phosphorylation status of its serine-9
residue regulated the activity of Gsk3b.49 Overexpression of a mutant
of Gsk3b (Ser-9 to Ala), which renders the kinase resistant to phosphorylation, attenuates ET-1-mediated cardiomyocyte hypertrophy in vitro, and
overexpression of this Gsk3b mutant in hearts of transgenic animals also
blunts the hypertrophic response to chronic isoproterenol administration
and pressure overload.50 Taken together, these data indicate that there is
significant crosstalk between miR-21-3p/HDAC8/Akt/Gsk3b and hypertrophic pathways. Akt/Gsk3b pathway is the mediator of miR-21-3pHDAC8 pathway-mediated hypertrophic response.
During the writing and submitting of our manuscript, another independent research study of miR-21-3p using cholesterol-modified antisense oligonucleotides (antagomirs) in mouse heart hypertrophy has
been published.51 The results of both two independent studies warranted that miR-21-3p played an important role in cardiac hypertrophy.
Inconsistent results of the two studies may be due to different experimental conditions. In our study, we injected rAAV9 via the tail vein,
whereas Thum et al. injected antagomir via the jugular vein. rAAV9
offers advantages of cardiac targeting after intravenous injection and longterm stability.52 However, antagomir is a systemic effect compound. There
is also a possibility that cholesterol-conjugated chemistry has a cardioprotective effect. Using miR-21-3p KO or miR-21-3p TG animal may be better
to confirm the effect of miR-21-3p on the hypertrophic response.
In summary, our findings revealed that miR-21-3p attenuates cardiac
hypertrophy by suppressing HDAC8 expression to activate Akt/Gsk3b
pathway, which suggested a novel miR-21-3p/HDAC8/Akt/Gsk3b regulatory circuitry whose dysfunction may contribute to progression of
cardiac hypertrophy.
Funding
This work was supported by grant from the National Basic Research Program
of China (973 Program) (No. 2012CB518004), National Natural Science
Foundation of China (No. 31130031 and 31200594) and Research Fund for
the Doctoral Program of Higher Education of China (No. 20120142120056).
Supplementary material
Supplementary material is available at Cardiovascular Research online.
Conflict of interest: none declared.
352
References
1. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 2004;116:
281 –297.
2. Basson M. MicroRNAs loom large in the heart. Nat Med 2007;13:541.
3. Latronico MV, Catalucci D, Condorelli G. Emerging role of microRNAs in cardiovascular
biology. Circ Res 2007;101:1225 –1236.
4. Da Costa Martins PA, De Windt LJ. MicroRNAs in control of cardiac hypertrophy.
Cardiovasc Res 2012;93:563 –572.
5. Thum T, Galuppo P, Wolf C, Fiedler J, Kneitz S, van Laake LW, Doevendans PA,
Mummery CL, Borlak J, Haverich A, Gross C, Engelhardt S, Ertl G, Bauersachs J. MicroRNAs in the human heart: a clue to fetal gene reprogramming in heart failure. Circulation
2007;116:258 –267.
6. Chien KR. Molecular medicine: microRNAs and the tell-tale heart. Nature 2007;447:
389 –390.
7. Cheng YH, Zhang CX. MicroRNA-21 in cardiovascular disease. J Cardiovasc Transl Res
2010;3:251 –255.
8. da Costa Martins PA, De Windt LJ. miR-21: a miRaculous Socratic paradox. Cardiovasc Res
2010;87:397 –400.
9. Roy S, Khanna S, Hussain SR, Biswas S, Azad A, Rink C, Gnyawali S, Shilo S, Nuovo GJ,
Sen CK. MicroRNA expression in response to murine myocardial infarction: miR-21 regulates fibroblast metalloprotease-2 via phosphatase and tensin homologue. Cardiovasc
Res 2009;82:21 –29.
10. Thum T, Gross C, Fiedler J, Fischer T, Kissler S, Bussen M, Galuppo P, Just S, Rottbauer W,
Frantz S, Castoldi M, Soutschek J, Koteliansky V, Rosenwald A, Basson MA, Licht JD,
Pena JT, Rouhanifard SH, Muckenthaler MU, Tuschl T, Martin GR, Bauersachs J,
Engelhardt S. MicroRNA-21 contributes to myocardial disease by stimulating MAP
kinase signalling in fibroblasts. Nature 2008;456:980 – 984.
11. Okamura K, Phillips MD, Tyler DM, Duan H, Chou YT, Lai EC. The regulatory activity of
microRNA* species has substantial influence on microRNA and 3′ UTR evolution. Nat
Struct Mol Biol 2008;15:354 – 363.
12. Lo TF, Tsai WC, Chen ST. MicroRNA-21 –3p, a berberine-induced miRNA, directly
down-regulates human methionine adenosyltransferases 2A and 2B and inhibits hepatoma cell growth. PLoS ONE 2013;8:e75628.
13. Gordillo GM, Biswas A, Khanna S, Pan X, Sinha M, Roy S, Sen CK. Dicer knockdown inhibits endothelial cell tumor growth via microRNA 21a-3p targeting of Nox-4. J Biol Chem
2014;289:9027 –9038.
14. Kee HJ, Kook H. Roles and targets of class I and IIa histone deacetylases in cardiac hypertrophy. J Biomed Biotechnol 2011;2011:928326.
15. Ekwall K. Genome-wide analysis of HDAC function. Trends Genet 2005;21:608 –615.
16. Zhang CL, McKinsey TA, Chang S, Antos CL, Hill JA, Olson EN. Class II histone deacetylases act as signal-responsive repressors of cardiac hypertrophy. Cell 2002;110:
479 –488.
17. Chang S, McKinsey TA, Zhang CL, Richardson JA, Hill JA, Olson EN. Histone deacetylases 5 and 9 govern responsiveness of the heart to a subset of stress signals and play redundant roles in heart development. Mol Cell Biol 2004;24:8467 –8476.
18. McKinsey TA, Olson EN. Toward transcriptional therapies for the failing heart: chemical
screens to modulate genes. J Clin Invest 2005;115:538–546.
19. Trivedi CM, Luo Y, Yin Z, Zhang M, Zhu W, Wang T, Floss T, Goettlicher M,
Noppinger PR, Wurst W, Ferrari VA, Abrams CS, Gruber PJ, Epstein JA. Hdac2 regulates
the cardiac hypertrophic response by modulating Gsk3 beta activity. Nat Med 2007;13:
324 –331.
20. Xie J, Ameres SL, Friedline R, Hung JH, Zhang Y, Xie Q, Zhong L, Su Q, He R, Li M, Li H,
Mu X, Zhang H, Broderick JA, Kim JK, Weng Z, Flotte TR, Zamore PD, Gao G. Longterm, efficient inhibition of microRNA function in mice using rAAV vectors. Nat
Methods 2012;9:403 – 409.
21. Xiao X, Li J, Samulski RJ. Production of high-titer recombinant adeno-associated virus
vectors in the absence of helper adenovirus. J Virol 1998;72:2224 –2232.
22. Takimoto E, Champion HC, Li M, Belardi D, Ren S, Rodriguez ER, Bedja D, Gabrielson KL,
Wang Y, Kass DA. Chronic inhibition of cyclic GMP phosphodiesterase 5A prevents and
reverses cardiac hypertrophy. Nat Med 2005;11:214 –222.
23. Nienaber JJ, Tachibana H, Naga Prasad SV, Esposito G, Wu D, Mao L, Rockman HA. Inhibition of receptor-localized PI3K preserves cardiac beta-adrenergic receptor function
and ameliorates pressure overload heart failure. J Clin Invest 2003;112:1067 –1079.
24. Wu J, Bu L, Gong H, Jiang G, Li L, Ma H, Zhou N, Lin L, Chen Z, Ye Y, Niu Y, Sun A, Ge J,
Zou Y. Effects of heart rate and anesthetic timing on high-resolution echocardiographic
assessment under isoflurane anesthesia in mice. J Ultrasound Med 2010;29:1771 – 1778.
25. Cingolani OH, Yang XP, Cavasin MA, Carretero OA. Increased systolic performance
with diastolic dysfunction in adult spontaneously hypertensive rats. Hypertension 2003;
41:249 – 254.
26. Dolber PC, Bauman RP, Rembert JC, Greenfield JC Jr. Regional changes in myocyte structure in model of canine right atrial hypertrophy. Am J Physiol 1994;267:H1279 –H1287.
27. Ding H, Wu B, Wang H, Lu Z, Yan J, Wang X, Shaffer JR, Hui R, Wang DW. A novel
loss-of-function DDAH1 promoter polymorphism is associated with increased susceptibility to thrombosis stroke and coronary heart disease. Circ Res 2010;106:1145 – 1152.
M. Yan et al.
28. Wang H, Lin L, Jiang J, Wang Y, Lu ZY, Bradbury JA, Lih FB, Wang DW, Zeldin DC.
Up-regulation of endothelial nitric-oxide synthase by endothelium-derived hyperpolarizing factor involves mitogen-activated protein kinase and protein kinase C signaling
pathways. J Pharmacol Exp Ther 2003;307:753 –764.
29. Hunter JJ, Chien KR. Signaling pathways for cardiac hypertrophy and failure. N Engl J Med
1999;341:1276 –1283.
30. van Rooij E, Marshall WS, Olson EN. Toward microRNA-based therapeutics for heart
disease: the sense in antisense. Circ Res 2008;103:919 –928.
31. van Rooij E, Olson EN. MicroRNAs: powerful new regulators of heart disease and provocative therapeutic targets. J Clin Invest 2007;117:2369 –2376.
32. van Rooij E, Sutherland LB, Liu N, Williams AH, McAnally J, Gerard RD, Richardson JA,
Olson EN. A signature pattern of stress-responsive microRNAs that can evoke cardiac
hypertrophy and heart failure. Proc Natl Acad Sci USA 2006;103:18255 –18260.
33. Care A, Catalucci D, Felicetti F, Bonci D, Addario A, Gallo P, Bang ML, Segnalini P, Gu Y,
Dalton ND, Elia L, Latronico MV, Hoydal M, Autore C, Russo MA, Dorn GW 2nd,
Ellingsen O, Ruiz-Lozano P, Peterson KL, Croce CM, Peschle C, Condorelli G.
MicroRNA-133 controls cardiac hypertrophy. Nat Med 2007;13:613 –618.
34. van Rooij E, Sutherland LB, Qi X, Richardson JA, Hill J, Olson EN. Control of stressdependent cardiac growth and gene expression by a microRNA. Science 2007;316:
575 –579.
35. Ji R, Cheng Y, Yue J, Yang J, Liu X, Chen H, Dean DB, Zhang C. MicroRNA expression
signature and antisense-mediated depletion reveal an essential role of MicroRNA in vascular neointimal lesion formation. Circ Res 2007;100:1579 –1588.
36. Gregory RI, Chendrimada TP, Cooch N, Shiekhattar R. Human RISC couples microRNA
biogenesis and posttranscriptional gene silencing. Cell 2005;123:631 –640.
37. Zhou H, Huang X, Cui H, Luo X, Tang Y, Chen S, Wu L, Shen N. miR-155 and its star-form
partner miR-155* cooperatively regulate type I interferon production by human plasmacytoid dendritic cells. Blood 2010;116:5885 – 5894.
38. Yang X, Du WW, Li H, Liu F, Khorshidi A, Rutnam ZJ, Yang BB. Both mature miR-17 –5p
and passenger strand miR-17-3p target TIMP3 and induce prostate tumor growth and
invasion. Nucleic Acids Res 2013;41:9688 –9704.
39. Cheng Y, Ji R, Yue J, Yang J, Liu X, Chen H, Dean DB, Zhang C. MicroRNAs are aberrantly
expressed in hypertrophic heart: do they play a role in cardiac hypertrophy? Am J Pathol
2007;170:1831 –1840.
40. Tatsuguchi M, Seok HY, Callis TE, Thomson JM, Chen JF, Newman M, Rojas M,
Hammond SM, Wang DZ. Expression of microRNAs is dynamically regulated during cardiomyocyte hypertrophy. J Mol Cell Cardiol 2007;42:1137 –1141.
41. Bush EW, McKinsey TA. Targeting histone deacetylases for heart failure. Expert Opin Ther
Targets 2009;13:767 –784.
42. Gray SG, Ekstrom TJ. The human histone deacetylase family. Exp Cell Res 2001;262:
75 –83.
43. Kook H, Lepore JJ, Gitler AD, Lu MM, Wing-Man Yung W, Mackay J, Zhou R, Ferrari V,
Gruber P, Epstein JA. Cardiac hypertrophy and histone deacetylase-dependent transcriptional repression mediated by the atypical homeodomain protein Hop. J Clin
Invest 2003;112:863 –871.
44. Kee HJ, Sohn IS, Nam KI, Park JE, Qian YR, Yin Z, Ahn Y, Jeong MH, Bang YJ, Kim N, Kim JK,
Kim KK, Epstein JA, Kook H. Inhibition of histone deacetylation blocks cardiac hypertrophy induced by angiotensin II infusion and aortic banding. Circulation 2006;113:51 –59.
45. Kong Y, Tannous P, Lu G, Berenji K, Rothermel BA, Olson EN, Hill JA. Suppression of
class I and II histone deacetylases blunts pressure-overload cardiac hypertrophy. Circulation 2006;113:2579 –2588.
46. Shioi T, McMullen JR, Kang PM, Douglas PS, Obata T, Franke TF, Cantley LC, Izumo S. Akt/
protein kinase B promotes organ growth in transgenic mice. Mol Cell Biol 2002;22:
2799– 2809.
47. Matsui T, Li L, Wu JC, Cook SA, Nagoshi T, Picard MH, Liao R, Rosenzweig A. Phenotypic
spectrum caused by transgenic overexpression of activated Akt in the heart. J Biol Chem
2002;277:22896 –22901.
48. Zhou P, Sun LJ, Dotsch V, Wagner G, Verdine GL. Solution structure of the core
NFATC1/DNA complex. Cell 1998;92:687 –696.
49. Frey N, Olson EN. Cardiac hypertrophy: the good, the bad, and the ugly. Annu Rev Physiol
2003;65:45–79.
50. Antos CL, McKinsey TA, Frey N, Kutschke W, McAnally J, Shelton JM, Richardson JA,
Hill JA, Olson EN. Activated glycogen synthase-3 beta suppresses cardiac hypertrophy
in vivo. Proc Natl Acad Sci USA 2002;99:907 –912.
51. Bang C, Batkai S, Dangwal S, Gupta SK, Foinquinos A, Holzmann A, Just A, Remke J,
Zimmer K, Zeug A, Ponimaskin E, Schmiedl A, Yin X, Mayr M, Halder R, Fischer A,
Engelhardt S, Wei Y, Schober A, Fiedler J, Thum T. Cardiac fibroblast-derived microRNA
passenger strand-enriched exosomes mediate cardiomyocyte hypertrophy. J Clin Invest
2014;124:2136 –2146.
52. Suckau L, Fechner H, Chemaly E, Krohn S, Hadri L, Kockskamper J, Westermann D,
Bisping E, Ly H, Wang X, Kawase Y, Chen J, Liang L, Sipo I, Vetter R, Weger S,
Kurreck J, Erdmann V, Tschope C, Pieske B, Lebeche D, Schultheiss HP, Hajjar RJ,
Poller WC. Long-term cardiac-targeted RNA interference for the treatment of heart
failure restores cardiac function and reduces pathological hypertrophy. Circulation
2009;119:1241 –1252.