Syddansk Universitet
Ibuprofen reduces zebrafish PGE2 levels but steroid hormone levels and reproductive
parameters are not affected
Morthorst, Jane Ebsen; Lister, Andrea; Bjerregaard, Poul; Van Der Kraak, Glen
Published in:
Comparative Biochemistry and Physiology. Part C: Toxicology & Pharmacology
DOI:
http://dx.doi.org/10.1016/j.cbpc.2012.12.001
Publication date:
2013
Document version
Publisher's PDF, also known as Version of record
Citation for pulished version (APA):
Morthorst, J. E., Lister, A., Bjerregaard, P., & Van Der Kraak, G. (2013). Ibuprofen reduces zebrafish PGE2
levels but steroid hormone levels and reproductive parameters are not affected. Comparative Biochemistry and
Physiology. Part C: Toxicology & Pharmacology, 157, 251-257. DOI:
http://dx.doi.org/10.1016/j.cbpc.2012.12.001
General rights
Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners
and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights.
• Users may download and print one copy of any publication from the public portal for the purpose of private study or research.
• You may not further distribute the material or use it for any profit-making activity or commercial gain
• You may freely distribute the URL identifying the publication in the public portal ?
Take down policy
If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately
and investigate your claim.
Download date: 17. Jun. 2017
Comparative Biochemistry and Physiology, Part C 157 (2013) 251–257
Contents lists available at SciVerse ScienceDirect
Comparative Biochemistry and Physiology, Part C
journal homepage: www.elsevier.com/locate/cbpc
Ibuprofen reduces zebrafish PGE2 levels but steroid hormone levels and reproductive
parameters are not affected
Jane E. Morthorst b,⁎, 1, Andrea Lister b, Poul Bjerregaard a, Glen Van Der Kraak b
a
b
Institute of Biology, University of Southern Denmark, Campusvej 55, DK-5230 Odense M, Denmark
Department of Integrative Biology, University of Guelph, Guelph, Ontario, Canada N1G 2W1
a r t i c l e
i n f o
Article history:
Received 30 August 2012
Received in revised form 3 December 2012
Accepted 4 December 2012
Available online 13 December 2012
Keywords:
COX
Endocrine
NSAID
Prostaglandin
Steroidogenesis
a b s t r a c t
Prostaglandins are important regulators of reproductive function in fish. Analgesics like aspirin and ibuprofen
are prostaglandin inhibitors and have been detected in freshwater systems at ng/L–μg/L levels. We investigated
whether ibuprofen would affect prostaglandin and sex steroid hormone levels in adult zebrafish (Danio rerio)
and if expression levels of genes involved in steroidogenesis and prostaglandin synthesis were affected. Zebrafish
were exposed to moderate concentrations of ibuprofen (21, 201 or 506 μg/L) for 7 days in a semi-static test
system. Ibuprofen concentrations were close to nominal levels and decreased by a maximum of 12–13% over
24 h. Prostaglandin E2 (PGE2) levels in whole body homogenates of males and ovaries of females decreased in
a monotonic dose–response relationship whereas male 11-ketotestosterone levels and ovarian 17β-estradiol
levels remained unchanged. Ibuprofen did not have an influence on vitellogenin levels, female gonadosomatic
index or cumulative egg production and no dose–response relationship in ovarian and testicular expression
levels of the investigated genes was observed. This study shows that ibuprofen reduces PGE2 levels in male
and female zebrafish but has no consistent effects on other investigated reproductive parameters.
© 2012 Elsevier Inc. All rights reserved.
1. Introduction
Human pharmaceuticals are excreted and eliminated into wastewaters either as the parent compound or as metabolites. Removal
rates of pharmaceuticals in sewage treatment plants (STPs) are generally high although not 100%. Hence, persistent or highly consumed
pharmaceuticals like analgesics have been detected in aquatic systems
that receive water from STPs or untreated wastewater from point
sources and consequently fish living in receiving waters are exposed
to these chemicals (Ankley et al., 2007). Ibuprofen is a commonly used
over-the-counter analgesic and has been detected in final effluent
from STPs at concentrations up to 25.4 μg/L (Metcalfe et al., 2003;
Camacho-Munoz et al., 2010). Little is known about how exposure to
analgesics affects reproductive processes of aquatic animals.
Several studies have shown that fish are more sensitive than
mammals or invertebrates to environmental estrogens such as 17αethinylestradiol (EE2) (Segner et al., 2003; Ankley et al., 2007) and
that might also apply for environmental pharmaceuticals. To date,
only a few laboratory studies have tested the effect of analgesics on
fish. Ibuprofen (1–100 μg/L) caused increased mortality, limb and
organ malformations and behavioral disruptions in exposed zebrafish
fry (David and Pancharatna, 2009) and egg production in zebrafish
⁎ Corresponding author. Tel.: +45 6550 2744; fax: +45 6550 2786.
E-mail address: [email protected] (J.E. Morthorst).
1
Present address: Institute of Biology, University of Southern Denmark, Campusvej
55, DK-5230 Odense M, Denmark.
1532-0456/$ – see front matter © 2012 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.cbpc.2012.12.001
was reduced after exposure to indomethacin (Lister and Van Der
Kraak, 2008).
Most weak analgesics including ibuprofen are non-steroidal
anti-inflammatory drugs (NSAIDs) and they exert their effect by
inhibiting the activity of enzymes involved in prostaglandin synthesis
(Vane, 1971). Prostaglandins and their fatty acid precursor arachidonic
acid are involved in several processes related to vertebrate reproduction including oocyte maturation (Sorbera et al., 2001) and regulation
of gonadal steroidogenesis (Van Der Kraak and Chang, 1990; Wade
and Van Der Kraak, 1993) and changes in prostaglandin levels could
possibly influence other reproduction related processes. Prostaglandins
are synthesized continuously through a multi-step pathway initiated by
the conversion of arachidonic acid into prostaglandin H2 (PGH2), which
serves as substrate for a variety of different enzymes involved in the
synthesis of other prostaglandins, prostacyclin and thromboxanes.
Arachidonic acid is mobilized from the cell membrane by phospholipases
A2 (PLA2) and the conversion of arachidonic acid into PGH2 is catalyzed
by the bifunctional enzyme prostaglandin H2 synthase (PGHS) also
known as cyclooxygenase (COX). PGHS exists in two isoforms called
COX-1 (ptgs1) and COX-2 (ptgs2) and these enzymes are the targets
of NSAIDs (FitzGerald and Patrono, 2001). Functional genes for both
COX-1 and COX-2 have been found in zebrafish and prostaglandin E2
(PGE2) is the predominant prostaglandin in adult zebrafish (Grosser
et al., 2002; Ishikawa et al., 2007). Prostaglandin inhibitors like indomethacin reduced the PGE2 concentration in female zebrafish (Lister
and Van Der Kraak, 2008) and both prostaglandins and NSAIDs are
known to affect steroidogenesis in vitro (Wade and Van Der Kraak,
252
J.E. Morthorst et al. / Comparative Biochemistry and Physiology, Part C 157 (2013) 251–257
1993). Arachidonic acid and its derivatives have also been shown to
regulate steroidogenic acute regulatory protein (StAR) gene expression
(reviewed by Stocco et al. (2005)). StAR is the enzyme regulating cholesterol transport from the outer to the inner mitochondrial membrane
where cholesterol is converted to pregnenolone. Steroids are synthesized from cholesterol and the rate-limiting step for steroid synthesis is
the transport of cholesterol. Alterations in steroid production could be
expected if COX enzymes are inhibited. Prostaglandin inhibitors have
been shown to alter steroid hormone levels in rats (Didolkar et al.,
1980, 1981) and prenatal exposure to prostaglandin inhibitors blocked
masculinization of male fetal mice (Gupta and Goldman, 1986). Given
the possible cross talk between prostaglandin and steroidogenic pathways, it was interesting to investigate if an inhibition of prostaglandin
synthesis would affect the steroidogenic pathway and reproductive
parameters in fish.
The aim of the present study was to investigate if ibuprofen interfered with steroidogenesis in zebrafish (Danio rerio) by measuring
11-ketotestosterone (11-KT) and 17β-estradiol (E2) levels in males
and females, respectively, after a 7-day exposure period. Expression
levels of genes involved in both prostaglandin synthesis (ptgs1, ptgs2
and cpla2) and steroidogenesis (star, cyp19a, 11β-hsd2, cyp11β and
17β-hsd3) were investigated in order to reveal possible sites of action
of ibuprofen in zebrafish (Table 1). PGE2 levels, vitellogenin concentration, spawning success as measured by the numbers of eggs spawned
and female gonadosomatic index (GSI) were also determined.
2. Materials and methods
2.1. Animals and experimental design
Zebrafish (D. rerio) were purchased from DAP International
(Etobicoke, ON, Canada) and held at the Hagen Aqualab at the University
of Guelph in an A-HAB fish containment unit (Aquatic Habitats, Apopka,
FL, USA) with re-circulated well water at 26 °C. The photoperiod was
12 h light:12 h dark. Fish were acclimatized for one week in the test
aquaria and fed three times daily: twice with commercial salmon fry
pellets (Martin Mills, Elmira, ON, Canada) and once with bloodworms
(Oregon Desert Brine Shrimp Co., Lakeview, OR, USA).
The exposure was performed as a 7-day semi-static exposure in
20 L glass aquaria each containing 15 L of water. The water was
changed every day and water temperature and oxygen saturation
were measured every second day. Each aquarium was aerated and
the oxygen level was 91% ± 1.04 (mean ± SEM) of the air saturation
and the temperature was 25.5 ± 0.8 °C. Egg trays with artificial plants
were placed in the tanks and eggs were collected and counted every day
after spawning. Egg collection started four days before the exposure.
Each exposure was performed in triplicate with 26 fish (12 females
and 14 males) in each aquarium.
Ibuprofen (CAS no. 15687-27-1, Sigma-Aldrich Co., St. Louis, MO,
USA) was dissolved in methanol and added to the test aquaria every
day when water was renewed. The nominal ibuprofen concentrations
were 0, 20, 200 and 500 μg/L and the final solvent concentration was
b0.01%.
2.2. Actual water concentrations of ibuprofen
Water samples (2 mL) were collected from each aquarium three
times during 24 h (0.5–1, 3–4 and 24 h after water renewal). Water
samples were passed through PVDF filters (pore size 0.45 μm,
Frisenette, Denmark) before the actual concentrations were determined
on a Triple Quad LC/MS (Agilent, Wilmington, DE, USA). Isocratic elution
was performed using an Agilent Zorbax Eclipse XDB C-18 Rapid Resolution HT column (50× 4.6 mm i.d.; 1.8 μm particle size) and column
temperature was set at 70 °C. Injection volume was 30 μL. The mobile
phase consisted of a 40:60 (v/v) mixture of 0.1% formic acid and
acetonitrile (pH = 3.0) and a flow rate of 1.0 mL/min (retention time:
1.39 min). Analysis was done using electrospray ionization (ESI) in
positive ion mode. Drying gas flow was 11.0 L/min and drying gas
temperature was set at 350 °C. The nebulizer pressure was set at
35 psi and capillary voltage at 4000 V. Fragmentor voltage was 90 V
and collision energy 15 V. The mass-to-charge-ratio (m/z) of precursor
ion and quantifier ion was respectively 224.3 and 161.2. The detection
limit (signal-to-noise-ratio> 10) for ibuprofen in sample matrix was
11.7 pg on column (0.39 pg/μL).
2.3. Sampling
After seven days of exposure the fish were anesthetized in MS-222
(0.1 g/L), blot dried on KIM™ wipes, and weighed. Individuals used
for gene expression had their head and tail separated from the
trunk with cuts made right behind the pectoral fins and right behind
the dorsal fin, respectively. The head and tail fraction was weighed
and immediately put on dry ice and stored at − 80 ºC until vitellogenin analysis was performed. The ovaries were removed from the trunk
and put in RNase-free microcentrifuge tubes, weighed, and frozen in
dry ice. The trunks of the males were placed on dry ice with the
body cavity opened and intestines removed in order to make the testes
easier to locate. The testes were dissected out and placed in RNase-free
microcentrifuge tubes. All female fish for gene expression studies were
sampled between 10:00 and 11:30 h and all males between 12:00 h
and 14:00 h. Male fish for whole body steroid determination were
snap frozen in microcentrifuge tubes after the presence of testis had
been verified. Ovaries for steroid determination were dissected as described above and GSI was calculated for all female fish by the following
equation: GSI = (gonad mass (mg) / [body mass (mg)− gonad mass
(mg)]) ∗ 100.
2.4. RNA extractions
Ovarian tissue from 6 females and testis tissue from 7 to 8 males
per aquarium were used for gene expression studies. Gonad tissue
was homogenized with a handheld homogenizer and RNA was
extracted from the tissue with Trizol® (Invitrogen, Carlsbad, CA, USA)
according to manufacturer's instructions. Chloroform and isopropanol
were purchased from Sigma-Aldrich Co. During extraction of testes
3.75 μL of a 10 times diluted glycogen solution (Roche, 20 mg/mL)
was added to the aqueous phase to aid in RNA precipitation. The RNA
pellets from ovary extractions were re-suspended in 30–50 μL GIBCO™
water (Invitrogen) whereas the volume used for testes was 10 μL.
RNA concentrations were quantified on a NanoDrop-8000 spectrophotometer (Agilent Technologies, Missisauga, ON, Canada) and
diluted to 1000 ng/μL (females) or 800 ng/μL (males). RNA quality of
each sample was determined by the ratio of absorbance at 260 nm
and 280 nm. Further, RNA integrity of a subset of RNA samples was
assessed using an Agilent 2100 Bioanalyzer and a RNA 6000 Nano
LabChip kit (Agilent Technologies). Before reverse transcription (RT)
the samples were quantified again with the NanoDrop-8000 spectrophotometer and DNase treated by mixing each sample with 2 μL
DNase I (AMP-D1; Sigma-Aldrich) according to manufacturer's instructions. Primers were designed according to Ings and Van Der Kraak
(2006) and the sequences are shown in Table 2. In order to prevent
genomic DNA amplification primers were designed to span an exon–
exon boundary in the mRNA sequence.
2.5. Reverse transcription and real-time PCR (RT-PCR)
For the reverse transcription (RT) reaction a total of 2 and 1.6 μg
RNA for each sample was used for females and males, respectively.
RT water controls were prepared by adding 2 μL of GIBCO™ water
instead of sample. The samples were incubated for 5 min at 70 °C with
2 μL (0.1 μg) random primer (Promega, Madison, WI, USA) per tube
and immediately transferred to ice. The total reaction volume was
J.E. Morthorst et al. / Comparative Biochemistry and Physiology, Part C 157 (2013) 251–257
253
Table 1
List of investigated genes and their abbreviations. The pathway in which the genes are active is also listed as well as the tissue they were measured in. (AA: arachidonic acid).
Name
Abbreviation
Pathway
Investigated tissue
Elongation factor-1 α
Cytosolic phospholipase A2
Prostaglandin endoperoxide synthase 1
Prostaglandin endoperoxide synthase 2
Aromatase cyp19a
Steroidogenic acute regulatory protein
11β-hydroxysteroid dehydrogenase type 2
17β-hydroxysteroid dehydrogenase type 3
Cytochrome P450 family 11 β
ef1a
cpla2
ptgs1
ptgs2
cyp19a
star
11β-hsd2
17β-hsd3
cyp11β
Reference gene
AA cascade
AA cascade
AA cascade
Steroidogenesis
Steroidogenesis
Steroidogenesis
Steroidogenesis
Steroidogenesis
Ovaries and testes
Ovaries
Ovaries
Ovaries
Ovaries
Ovaries and testes
Testes
Testes
Testes
brought to 25 μL and contained the following final concentrations: 5×
RT first strand buffer (50 mM Tris–HCl, 75 mM KCl, 3 mM MgCl2;
Invitrogen), DTT (10 mM; Invitrogen), dNTPs (0.5 mM; Roche Molecular
Biochemicals, Laval, PQ, Canada), M-MLV reverse transcriptase (200 U;
Invitrogen) and GIBCO™ water. The reaction was performed at 37 °C
for 1 h followed by 5 min at 90 °C and subsequently cooling down to
4 °C.
qPCR was performed using ABI Prism 7000 sequence detection
system (Applied Biosystems, Foster City, CA, USA) and each sample
was run in duplicate. The following was added to each reaction:
5 μL cDNA template (diluted 5, 10 or 20× depending on gene of interest),
2.5 μL of both forward and reverse primers (0.4 μM) and 10 μL SYBR®
Green PCR Master Mix. The qPCR cycling conditions were: 2 min at
50 °C and 10 min at 95 °C followed by 40 cycles of 15 s at 95 °C and
1 min at 60 °C (Lister and Van Der Kraak, 2009). To demonstrate primer
specificity and amplification of a single product, a melting curve analysis
was applied to all reactions.
2.6. Determination of steroid hormones and PGE2
Six females and six males from each aquarium were used for steroid
and PGE2 measurements. Extraction of steroids was performed on
dissected ovaries and whole body homogenate of males. The ovary
tissue was sonicated after addition of 100 μL of a 0.1 M PBS buffer
(Na2HPO4, NaH2PO4 and NaCl; pH 7.4) with 1 mM EDTA and 10 μM
indomethacin. Whole body male fish were pulverized in a chilled
ceramic mortar filled with liquid nitrogen and the homogenate was
mixed with 4× homogenate weight (v/v) of PBS buffer and then
sonicated.
Ovaries and whole body homogenates were extracted with 400 μL
or 4 mL methanol respectively, vortexed and placed at 4 °C for 1 h
and then centrifuged at 3000 g for 5 min at 4 °C. The pellet was
frozen with dry ice and the upper methanol phase decanted in to a
Table 2
Primer sequences used in real-time PCR assays.
Gene
ef1a
ptgs1
ptgs2
star
cyp19a
cpla2
11β-hsd2
17β-hsd3
cyp11β
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Forward
Reverse
Primer sequence
Accession no.
GATCACTGGTACTTCTCAGGCTGA
GGTGAAAGCCAGGAGGGC
AAGGTCTGGGTCACGGAGTG
CAAGAGAATCTCCATAAATGTGTCCA
GTTTAAAGATGGAAAGCTTAAATACCAGG
GGGTACACCTCACCATCCACA
ACCTGTTTTCTGGCTGGGATG
GGGTCCATTCTCAGCCCTTAC
AGTTCAACTGGCACACGCAG
AGCTCTCCATGGCTCTGAGC
TGCTCTTGGAAGTTTGCGC
TCTGCGTGTCTGCATGAACAG
ACCCTCAGCCTATAAGACAGGGCA
TTGGGGACAAGCCCTGGAGC
ATGGTCACATTCACGGCTGA
CTGCACGATCCTGCCCAG
GGAATCACCGTTCAGAGGTATCC
CACCTGCACCAGCGTCC
NM_131263
NM_153656.1
NM_153657.1
NM_131663
test tube. This procedure was repeated twice with 400 μL (ovaries) or
2 mL (males) methanol and the incubation time reduced to 30 min.
The three methanol phases were combined and dried down under a
stream of nitrogen or in a TurboVap® (Caliper Life Sciences, Hopkinton,
MA, USA). The extract was reconstituted in 300 μL (ovaries) or 4×
homogenate weight (males) of a 50 mM acetate buffer (glacial acetic
acid and sodium acetate; pH 4.0). The ovary sample extract was passed
through 100 mg/mL Amprep C-18 octadecyl mini-columns (Amersham
Biosciences, Little Chalfont, England) according to the manufacturer's
instructions for non-polar analytes whereas a fraction (250 μL) of all sample extract from the males was passed through 30 mg/mL Strata™-X
columns (Phenomenex, Denmark) according to manufacturer's instructions for reversed phase solid phase extraction of neutral compounds. Ethyl acetate (1% methanol) was used to collect the final
elute from ovaries and 50:50 methanol/acetonitrile (1% acetic acid)
was used to elute the male samples. This fraction was dried down
under a stream of nitrogen or in a TurboVap®. Ovary samples were
reconstituted in 300 μL EIA buffer whereas males were reconstituted
in 1000 μL. E2, 11-KT and PGE2 levels were analyzed by enzyme immuno
assays (EIA; Cayman Chemical, Ann Arbor, MI, USA) as per
manufacturer's instructions. Plate development times for E2, 11-KT and
PGE2 were 120, 30 and 90–120 min respectively.
2.7. Vitellogenin by ELISA
Homogenization and preparation of the samples for vitellogenin
analysis was performed according to Kinnberg et al. (2007). Direct
non-competitive sandwich ELISA was used to quantify vitellogenin
concentrations in the supernatant of the sample homogenate
according to Holbech et al. (2001) with the modifications described
in Morthorst et al. (2010).
2.8. Data analysis and statistics
Prior to analyses all data sets were screened for homogeneity of
variance and normality and if necessary data were log transformed.
To make sure the replicates in each exposure group did not differ
from each other a one-way ANOVA was performed before values
from the replicates were pooled. A Bonferroni–Holm corrected oneway ANOVA was performed to compare the exposure groups with the
control. The software package SigmaStat® Statistical Software version
2.0 was used in all statistical analyses and statistical differences were
considered significant if p b 0.05.
NM_131154
3. Results
NM_131295.1
NM_212720
AY551081
NM_001080204
3.1. Chemical analysis of ibuprofen concentrations in water
The measured concentrations of ibuprofen during the 24-hour
period between water renewals are shown in Table 3. The variation
between the replicates within a treatment was minimal. Ibuprofen
concentrations were constant throughout the experiment and the
254
J.E. Morthorst et al. / Comparative Biochemistry and Physiology, Part C 157 (2013) 251–257
Table 3
Actual measured concentrations of ibuprofen in the exposure tanks ± SEM. The final
actual concentrations (column 2) are mean values of the three replicates per treatment
during a 24-hour period. The actual concentrations over time (columns 3–5) are mean
values of the three replicates per treatment at a given time. The indication of time (h)
refers to the time elapsed since water renewal.
Nominal
concentration
(μg/L)
0
20
200
500
Actual
concentration
(μg/L)
Actual concentrations over time between water
renewals (μg/L)
Average
0.5–1.0 h
3–4 h
24 h
0.0 ± 0.0
21 ± 0.5
201 ± 7.8
506 ± 10.9
0.0 ± 0.0
22.7 ± 0.4
215.5 ± 21.1
547.8 ± 6.1
0.0 ± 0.0
21.3 ± 0.7
200.4 ± 8.8
487.9 ± 4.6
0.0 ± 0.0
19.8 ± 0.7
187.4 ± 1.3
482.1 ± 5.9
drop in ibuprofen concentration over a 24-h period was 12–13% in all
exposure groups.
3.4. Vitellogenin analysis
Body weights of males and females were similar between the
exposure groups (Fig. S1). A few males with high levels of vitellogenin
were present in all groups except the high exposure group. Those four
outlying values were removed from the dataset prior to performance
of the statistical tests. Outlying values were defined as values more
than 10 times higher than the highest remaining value in the dataset.
Vitellogenin levels in exposed males and females were not significantly
different from the control (Fig. 3A and B).
3.5. Egg production and GSI
Egg production was not affected at any of the exposure concentrations (Fig. 4).
GSI of the females was not affected in a significant way but a slight
increase in GSI was observed in the high exposure group (Fig. 5).
4. Discussion
3.2. Steroid and PGE2 concentrations
Whole body male and ovarian PGE2 levels in the control groups
were in the range 25–85 and 11 to 45 pg/mg tissue, respectively. PGE2
levels in both males and females decreased in a monotonic dose–
response relationship in response to ibuprofen (Fig. 1A and B). The
male PGE2 levels were significantly different from the control at all
exposure concentrations whereas ovarian PGE2 levels were only significantly different at 506 μg ibuprofen/L. Whole body 11-KT levels in
control males ranged from 0.34 to 5.77 pg/mg tissue and ovarian E2
levels were in the range 1.2 to 10.8 pg/mg ovary. No significant effect
on 11-KT or E2 levels was observed in any of the treatment groups
(Fig. 2A and B).
3.3. Ovarian and testicular gene expressions
A significant decrease in ovarian expression levels of cpla2 was
found in the intermediate exposure group (201 μg/L) (Fig. S2). The
expression levels of ef1a among the different groups were not significantly different; however, the median expression level in the intermediate group was higher compared to the other groups (Fig. S2).
No effect was observed on the expression levels of the remaining
investigated genes in ovaries (ptgs1, ptgs2, star and cyp19a) and testes
(cyp11β, 11β-hsd2, 17β-hsd3, star and ef1a) (Figs. S2 and S3).
B
60
*
PGE2 concentration
(pg/mg homogenate)
50
*
*
40
30
20
10
0
n=17
n=17
n=18
n=18
Control
21
201
506
Exposure concentration (µg/L)
PGE2 concentration (pg/mg ovary)
A
Due to high consumption rates and insufficient removal in STPs
human and veterinary pharmaceuticals have been detected in aquatic
ecosystems and aquatic organisms might therefore be continuously
exposed to highly consumed pharmaceuticals like analgesics (Ankley
et al., 2007). However, only few experiments have investigated the possible effects of analgesics on aquatic vertebrates. Mild analgesics inhibit
the enzymes responsible for prostaglandin synthesis, cyclooxygenase-1
and -2 (COX-1 and COX-2). Prostaglandins and their precursor arachidonic acid play key roles in vertebrate reproduction for example oocyte
maturation, ovulation and regulation of gonadal steroidogenesis (Van
Der Kraak and Chang, 1990; Wade and Van Der Kraak, 1993; Sorbera
et al., 2001; Patino et al., 2003). Both steroid- and prostaglandinderived sex pheromones have been identified in fish (Stacey, 2003),
and exposure to prostaglandin F2α (PGF2α) increases goldfish testosterone levels (Mennigen et al., 2010) suggesting that alterations in prostaglandin levels could influence fish reproduction.
This experiment clearly demonstrates that PGE2 levels were
significantly reduced in male whole body homogenate at all exposure
concentrations (21–506 μg/L) and in ovaries a similar pattern was
observed (Fig. 1). Prostaglandins are involved in induction of both
male and female sexual behavior in fish (reviewed by Sorensen and
Goetz (1993)) suggesting that prostaglandin inhibitors could affect
spawning and fertilization. Despite significantly reduced prostaglandin
levels the cumulative egg production (Fig. 4), female GSI (Fig. 5) and
number of spawning events (data not shown) were not affected. In a
40
*
30
20
10
0
n=19
n=18
n=18
n=17
Control
21
201
506
Exposure concentration (µg/L)
Fig. 1. Male and female PGE2 concentrations. PGE2 concentrations in (A) male whole body homogenate and (B) ovaries of adult zebrafish. Data represent mean± SEM. The number
of male and female fish in each exposure group is indicated in the bottom of the figure. * indicates significantly different from the control group (p b 0.05).
J.E. Morthorst et al. / Comparative Biochemistry and Physiology, Part C 157 (2013) 251–257
255
B
10
4
3
2
1
0
n=17
n=17
n=18
n=18
Control
21
201
506
E2 concentration (pg/mg ovary)
11-ketotestosterone concentration
(pg/mg homogenate)
A
8
6
4
2
0
Exposure concentration (µg/L)
n=19
n=18
n=18
n=17
Control
21
201
506
Exposure concentration (µg/L)
Fig. 2. Male and female 11-KT and E2 concentrations. (A) 11-KT concentrations in male whole body homogenate and (B) E2 concentrations in ovaries. Data represent mean ± SEM.
The number of male and female fish in each exposure group is indicated in the bottom of the figure.
long-term study (132 days) ibuprofen did also not affect GSI in medaka
(Han et al., 2010) but reduced spawning events and increased number
of eggs was observed which is in accordance with another study
(Flippin et al., 2007). The effect of ibuprofen on spawning in the medaka
could be due to a longer exposure period but also zebrafish egg production can be difficult to assess, as the daily egg production is variable and
affected by temperature, age, spawning strategy etc. (Paull et al., 2008).
Indomethacin caused reduced egg production and reduced PGE2 levels
in female zebrafish after 16 days of exposure (Lister and Van Der Kraak,
2008), but it remains unclear whether reduced egg production was
caused by changes in male reproductive behavior or oocyte maturation
and ovulation.
Analgesics impair testosterone synthesis in male rats (Didolkar et al.,
1980; Kristensen et al., 2011, 2012) and Fernandes et al. (2011) recently
showed, that ibuprofen inhibits enzymes involved in androgen synthesis
in gonads of male carp in vitro. On the other hand ibuprofen did not
influence testosterone levels in male mice (Martini et al., 2008) and generally mammalian studies have provided conflicting results regarding
effects of analgesics on steroid production, which could be explained
by the fact that analgesics have different mechanisms of action even
though acting on the same enzyme and in addition test species, timing
and duration of exposure may also play a role (Didolkar et al., 1981;
Gupta and Goldman, 1986; Wise et al., 1991). Altered steroid production
due to short-term exposure to endocrine disrupters has been demonstrated (Andersen et al., 2006) but in our experiment E2 and 11-KT levels
of adult fish were not affected by ibuprofen (Fig. 2). If long-term
140
120
100
80
60
40
20
0
n=21
Control
n=23
21
n=17
201
n=16
506
Exposure concentration (µg/L)
Vitellogenin concentration (ng/g fish)
B
A
Vitellogenin concentration (ng/g fish)
depression could influence steroid metabolism and subsequent reproductive processes related to hormone levels was beyond the scope of
this experiment.
Alteration in levels of the estrogen-dependent yolk precursor
vitellogenin is a well-known biomarker for exposure to endocrine
disrupters in fish (Tyler et al., 1999; Holbech et al., 2012). Ibuprofen
did not affect male or female vitellogenin levels (Fig. 3), which suggests
that ibuprofen does not affect steroidogenesis through the estrogen
receptor pathway. This is in accordance with results from the yeast
estrogen screen assay (YES assay) in our lab where ibuprofen and other
analgesics failed to induce a response by binding to the human estrogen
receptor (data not published).
Steroids are synthesized through multiple steps and numerous
enzymes are involved and changes in expression levels of involved
enzymes and substrate levels can influence hormone levels. C17, 20lyase (also called P450c17 and CYP17) and 11β-hydroxylase (CYP11β)
are involved in androgen synthesis. In an in vitro system with male
carp gonads analgesics impaired the activity of CYP11β and CYP17
(Fernandes et al., 2011) but ibuprofen did not influence adult male 11KT levels in our study. Enzymes like CYP11β were demonstrated mainly
to be active during early spermatogenesis in sea bass (Fernandes et al.,
2007) and hence exposure to ibuprofen during juvenile life stages
could influence androgen production. Expression levels of the following
genes directly or indirectly involved in androgen synthesis were investigated in testes: 11β-hsd2, 17β-hsd3, cyp11β and star but expression
of these genes was not affected.
4x106
3x106
2x106
1x106
0
n=18
n=18
n=18
n=18
Control
21
201
506
Exposure concentration (µg/L)
Fig. 3. Male and female vitellogenin concentrations. Vitellogenin concentrations in (A) males and (B) females. Four outlying male values were removed. Data represent mean±
SEM. The number of male or female fish in each exposure group is indicated in the bottom of the figure.
256
J.E. Morthorst et al. / Comparative Biochemistry and Physiology, Part C 157 (2013) 251–257
Fig. 4. Egg production. Data points represent the sums of replicates (n = 3) from each exposure group. The accumulative egg production is pictured as the sum of eggs per female
per day. Start of exposure is marked with a red line between days four and five. (For interpretation of the references to color in this figure legend, the reader is referred to the web
version of this article.)
Both cpla2 and ptgs2 are involved in prostaglandin synthesis and
ovarian expression levels of those genes fluctuate during the ovulatory
cycle of spawning zebrafish whereas expression of ptgs1 remains fairly
stable (Lister and Van Der Kraak, 2009). In this experiment ovarian
expression of cpla2 in the intermediate exposure group (201 μg/L)
was significantly different from the control (Fig. S2). Zebrafish ovarian
development is asynchronous with follicles in different stages. The proportions of follicles in different stages vary between individuals and
could explain the significant difference of cpla2 expression even though
sampling occurred at the same time every day. Ibuprofen inhibits the
COX enzymes by substrate competition and a response to overcome
this inhibition could be increased COX enzyme synthesis. However,
expression of ptgs1 and -2 was not affected by ibuprofen in the present
experiment which supports the finding of Lister and Van Der Kraak
(2008) who showed that reduced PGE2 levels did not affect COX
enzyme activity levels. Together these results suggest that a reduction
in prostaglandin levels is not necessarily linked to a reduced COX activity
or that ibuprofen is unable to inhibit COX activity in zebrafish and may
reduce prostaglandin levels through other yet unknown pathways. The
role of the prostaglandin pathway in testosterone production has
recently been investigated by Kristensen et al. (2012) in a fetal rat
culture system and they suggest that the anti-androgenic effects of
analgesics might not result from a direct inhibition of prostaglandin
synthesis.
10
8
GSI
6
PGE2 stimulates aromatase (cyp19a) gene expression through
different signaling pathways (Su et al., 2007) and COX-inhibitors
also affect the activity of the aromatase (Komar, 2005) which is the
enzyme catalyzing the conversion of androgens to estrogens. Arachidonic
acid and its metabolites are involved in regulation of StAR, the enzyme
responsible for transport of cholesterol from the outer to the inner
mitochondrial membrane (Wang et al., 2003) and hence changes in
prostaglandin levels could also influence cholesterol transport and
thereby steroid synthesis. However, ibuprofen did not influence female
star and cyp19a or male star gene expression (Fig. S2) and also not 11KT and E2 levels. Ibuprofen significantly increased both E2 production
and aromatase activity by up-regulation of mRNA transcription in
H295R cells (Han et al., 2010) and a tendency to decreased testosterone
production was also observed, which could be due to increased aromatase activity. Those abovementioned equivocal results suggest that
NSAIDs may influence vertebrate species differently and illustrate that
further investigations are needed to understand the impact of NSAIDs
on aquatic wildlife.
Prostaglandins are involved in many pathways and processes and
their synthesis is regulated through different pathways. In the present
experiment we observed a significant effect of ibuprofen on PGE2 levels
at concentrations also detected in effluent from STPs (Metcalfe et al.,
2003; Camacho-Munoz et al., 2010) but no consistent effects on other
reproductive endpoints were found. Prostaglandins have been shown
to affect several sperm parameters in mammals and a prolonged reduction of prostaglandin levels could lead to more severe effects due to
changes in fertilization success. More research is needed in the field of
secondary effects of prostaglandin disruption in fish, as wild fish
populations are exposed to numerous pharmaceuticals including several
NSAIDs in concentrations able to affect endogenous prostaglandin levels.
Acknowledgments
4
2
n=37
n=36
n=36
n=35
Control
21
201
506
0
Exposure concentration (µg/L)
Fig. 5. Female GSI. Female GSI. Data represent mean ± SEM. The number of females in
each exposure group is indicated in the bottom of the figure.
We thank Jacquie Matsumoto and Kyle Alkema, University of
Guelph, for their help during sampling of the fish and we also thank
Bente Frost Holbech and Brian Olsen, University of Southern Denmark,
for technical assistance in the laboratory. Also we acknowledge Henrik
Holbech, University of Southern Denmark, for his advice relating to
statistical analyses. This project was supported by grants from the
Danish Natural Science Research Council and the Natural Sciences and
Engineering Research Council of Canada.
J.E. Morthorst et al. / Comparative Biochemistry and Physiology, Part C 157 (2013) 251–257
Appendix A. Supplementary data
Supplementary data to this article can be found online at http://dx.
doi.org/10.1016/j.cbpc.2012.12.001.
References
Andersen, L., Goto-Kazeto, R., Trant, J.M., Nash, J.P., Korsgaard, B., Bjerregaard, P., 2006. Shortterm exposure to low concentrations of the synthetic androgen methyltestosterone
affects vitellogenin and steroid levels in adult male zebrafish (Danio rerio). Aquat.
Toxicol. 76, 343–352.
Ankley, G.T., Brooks, B.W., Huggett, D.B., Sumpter, J.P., 2007. Repeating history: pharmaceuticals in the environment. Environ. Sci. Technol. 41, 8211–8217.
Camacho-Munoz, M.D., Santos, J.L., Aparicio, I., Alonso, E., 2010. Presence of pharmaceutically active compounds in Donana Park (Spain) main watersheds. J. Hazard.
Mater. 177, 1159–1162.
David, A., Pancharatna, K., 2009. Developmental anomalies induced by a non-selective
COX inhibitor (ibuprofen) in zebrafish (Danio rerio). Environ. Toxicol. Pharmacol.
27, 390–395.
Didolkar, A.K., Gurjar, A., Joshi, U.M., Sheth, A.R., Roychowdhury, D., 1980. Effects of
aspirin on blood plasma levels of testosterone, LH and FSH in maturing male rats.
Int. J. Androl. 3, 312–318.
Didolkar, A.K., Gurjar, A., Joshi, U.M., Sheth, A.R., Roychowdhury, D., 1981. Effect of
prostaglandin-a-1, prostaglandin-E-2 and prostaglandin-F-2a on blood plasma
levels of testosterone, LH and FSH in male rats. Andrologia 13, 50–55.
Fernandes, D., Bebianno, M.J., Porte, C., 2007. Mitochondrial metabolism of 17alphahydroxyprogesterone in male sea bass (Dicentrarchus labrax): a potential target
for endocrine disruptors. Aquat. Toxicol. 85, 258–266.
Fernandes, D., Schnell, S., Porte, C., 2011. Can pharmaceuticals interfere with the
synthesis of active androgens in male fish? An in vitro study. Mar. Pollut. Bull. 62,
2250–2253.
FitzGerald, G.A., Patrono, C., 2001. Drug therapy: the coxibs, selective inhibitors of
cyclooxygenase-2. N. Engl. J. Med. 345, 433–442.
Flippin, J.L., Huggett, D., Foran, C.M., 2007. Changes in the timing of reproduction
following chronic exposure to ibuprofen in Japanese medaka, Oryzias latipes.
Aquat. Toxicol. 81, 73–78.
Grosser, T., Yusuff, S., Cheskis, E., Pack, M.A., FitzGerald, G.A., 2002. Developmental
expression of functional cyclooxygenases in zebrafish. Proc. Natl. Acad. Sci. U. S. A.
99, 8418–8423.
Gupta, C., Goldman, A.S., 1986. The arachidonic-acid cascade is involved in the
masculinizing action of testosterone on embryonic external genitalia in mice.
Proc. Natl. Acad. Sci. U. S. A. 83, 4346–4349.
Han, S., Choi, K., Kim, J., Ji, K., Kim, S., Ahn, B., Yun, J., Choi, K., Khim, J.S., Zhang, X.W.,
Giesy, J.P., 2010. Endocrine disruption and consequences of chronic exposure to
ibuprofen in Japanese medaka (Oryzias latipes) and freshwater cladocerans Daphnia
magna and Moina macrocopa. Aquat. Toxicol. 98, 256–264.
Holbech, H., Andersen, L., Petersen, G.I., Korsgaard, B., Pedersen, K.L., Bjerregaard, P.,
2001. Development of an ELISA for vitellogenin in whole body homogenate of
zebrafish (Danio rerio). Comp. Biochem. Physiol. C 130, 119–131.
Holbech, H., Kinnberg, K.L., Brande-Lavridsen, N., Bjerregaard, P., Petersen, G.I.,
Norrgren, L., Orn, S., Braunbeck, T., Baumann, L., Bomke, C., Dorgerloh, M., Bruns,
E., Ruehl-Fehlert, C., Green, J.W., Springer, T.A., Gourmelon, A., 2012. Comparison
of zebrafish (Danio rerio) and fathead minnow (Pimephales promelas) as test species
in the fish sexual development test (FSDT). Comp. Biochem. Physiol. C: Toxicol.
Pharmacol. 155, 407–415.
Ings, J.S., Van der Kraak, G.J., 2006. Characterization of the mRNA expression of StAR
and steroidogenic enzymes in zebrafish ovarian follicles. Mol. Reprod. Dev. 73,
943–954.
Ishikawa, T., Griffin, K.J.P., Banerjee, U., Herschman, H.R., 2007. The zebrafish genome
contains two inducible, functional cyclooxygenase-2 genes. Biochem. Biophys.
Res. Commun. 352, 181–187.
Kinnberg, K., Holbech, H., Petersen, G.I., Bjerregaard, P., 2007. Effects of the fungicide
prochloraz on the sexual development of zebrafish (Danio rerio). Comp. Biochem.
Physiol. C 145, 165–170.
Komar, C.M., 2005. Peroxisome proliferator-activated receptors (PPARs) and ovarian
function — implications for regulating steroidogenesis, differentiation, and tissue
remodeling. Reprod. Biol. Endocrinol. 3.
257
Kristensen, D.M., Hass, U., Lesne, L., Lottrup, G., Jacobsen, P.R., Desdoits-Lethimonier, C.,
Boberg, J., Petersen, J.H., Toppari, J., Jensen, T.K., Brunak, S., Skakkebaek, N.E.,
Nellemann, C., Main, K.M., Jegou, B., Leffers, H., 2011. Intrauterine exposure to
mild analgesics is a risk factor for development of male reproductive disorders in
human and rat. Hum. Reprod. 26, 235–244.
Kristensen, D.M., Lesne, L., Le Fol, V., Desdoits-Lethimonier, C., Dejucq-Rainsford, N.,
Leffers, H., Jegou, B., 2012. Paracetamol (acetaminophen), aspirin (acetylsalicylic
acid) and indomethacin are anti-androgenic in the rat foetal testis. Int. J. Androl.
35, 377–384.
Lister, A.L., Van Der Kraak, G., 2008. An investigation into the role of prostaglandins in
zebrafish oocyte maturation and ovulation. Gen. Comp. Endocrinol. 159, 46–57.
Lister, A.L., Van Der Kraak, G.J., 2009. Regulation of prostaglandin synthesis in ovaries of
sexually-mature zebrafish (Danio rerio). Mol. Reprod. Dev. 76, 1064–1075.
Martini, A.C., Vincenti, L.M., Santillan, M.E., Stutz, G., Kaplan, R., Ruiz, R.D., de Cuneo,
M.F., 2008. Chronic administration of nonsteroidal-antiinflammatory drugs
(NSAIDS): effects upon mouse reproductive functions. Rev. Fac. Cien. Med. Univ.
Nac. Cordoba 65, 47–59.
Mennigen, J.A., Sassine, J., Trudeau, V.L., Moon, T.W., 2010. Waterborne fluoxetine
disrupts feeding and energy metabolism in the goldfish Carassius auratus. Aquat.
Toxicol. 100, 128–137.
Metcalfe, C.D., Koenig, B.G., Bennie, D.T., Servos, M., Ternes, T.A., Hirsch, R., 2003. Occurrence
of neutral and acidic drugs in the effluents of Canadian sewage treatment plants.
Environ. Toxicol. Chem. 22, 2872–2880.
Morthorst, J.E., Holbech, H., Bjerregaard, P., 2010. Trenbolone causes irreversible
masculinization of zebrafish at environmentally relevant concentrations. Aquat.
Toxicol. 98, 336–343.
Patino, R., Yoshizaki, G., Bolamba, D., Thomas, P., 2003. Role of arachidonic acid
and protein kinase c during maturation-inducing hormone-dependent meiotic
resumption and ovulation in ovarian follicles of Atlantic croaker. Biol. Reprod. 68,
516–523.
Paull, G.C., Van Look, K.J.W., Santos, E.M., Filby, A.L., Gray, D.M., Nash, J.P., Tyler, C.R.,
2008. Variability in measures of reproductive success in laboratory-kept colonies
of zebrafish and implications for studies addressing population-level effects of
environmental chemicals. Aquat. Toxicol. 87, 115–126.
Segner, H., Caroll, K., Fenske, M., Janssen, C.R., Maack, G., Pascoe, D., Schafers, C.,
Vandenbergh, G.F., Watts, M., Wenzel, A., 2003. Identification of endocrinedisrupting effects in aquatic vertebrates and invertebrates: report from the European
IDEA project. Ecotoxicol. Environ. Saf. 54, 302–314.
Sorbera, L.A., Asturiano, J.F., Carrillo, M., Zanuy, S., 2001. Effects of polyunsaturated fatty
acids and prostaglandins on oocyte maturation in a marine teleost, the European
sea bass (Dicentrarchus labrax). Biol. Reprod. 64, 382–389.
Sorensen, P.W., Goetz, F.W., 1993. Pheromonal and reproductive function of
F-prostaglandins and their metabolites in teleost fish. J. Lipid Mediat. 6, 385–393.
Stacey, N., 2003. Hormones, pheromones and reproductive behavior. Fish Physiol.
Biochem. 28, 229–235.
Stocco, D.M., Wang, X.J., Jo, Y., Manna, P.R., 2005. Multiple signaling pathways regulating
steroidogenesis and steroidogenic acute regulatory protein expression: more complicated than we thought. Mol. Endocrinol. 19, 2647–2659.
Su, B., Landini, S., Davis, D.D., Brueggemeier, R.W., 2007. Synthesis and biological
evaluation of selective aromatase expression regulators in breast cancer cells.
J. Med. Chem. 50, 1635–1644.
Tyler, C.R., van Aerle, R., Hutchinson, T.H., Maddix, S., Trip, H., 1999. An in vivo testing
system for endocrine disruptors in fish early life stages using induction of vitellogenin.
Environ. Toxicol. Chem. 18, 337–347.
Van Der Kraak, G., Chang, J.P., 1990. Arachidonic-acid stimulates steroidogenesis in
goldfish preovulatory ovarian follicles. Gen. Comp. Endocrinol. 77, 221–228.
Vane, J.R., 1971. Inhibition of prostaglandin synthesis as a mechanism of action for
aspirin-like drugs. Nat. New Biol. 231, 232–235.
Wade, M.G., Van Der Kraak, G., 1993. Arachidonic-acid and prostaglandin-E2 stimulate
testosterone production by goldfish testis in vitro. Gen. Comp. Endocrinol. 90,
109–118.
Wang, X.J., Dyson, M.T., Jo, Y., Stocco, D.M., 2003. Inhibition of cyclooxygenase-2 activity
enhances steroidogenesis and steroidogenic acute regulatory gene expression in
MA-10 mouse Leydig cells. Endocrinology 144, 3368–3375.
Wise, L.D., Vetter, C.M., Anderson, C.A., Antonello, J.M., Clark, R.L., 1991. Reversible
effects of triamcinolone and lack of effects with aspirin or L-656,224 on external
genitalia of male Sprague–Dawley rats exposed in utero. Teratology 44, 507–520.