Journal of General Virology (2008), 89, 232–244
DOI 10.1099/vir.0.83312-0
Persistence of foot-and-mouth disease virus in cell
culture revisited: implications for contingency in
evolution
Mónica Herrera, Ana Grande-Pérez,3 Celia Perales and Esteban Domingo
Correspondence
Esteban Domingo
[email protected]
Received 12 July 2007
Accepted 20 September 2007
Centro de Biologı́a Molecular ‘Severo Ochoa’ (CSIC-UAM), Universidad Autónoma de Madrid,
Cantoblanco, 28049 Madrid, Spain
If we could rewind the tape of evolution and play it again, would it turn out to be similar to or
different from what we know? Obviously, this key question can only be addressed by fragmentary
experimental approaches. Twenty-two years ago, we described the establishment of BHK-21
cells persistently infected with foot-and-mouth disease virus (FMDV), a system that displayed as
its major biological feature a coevolution of the cells and the resident virus in the course of
persistence. Now we report the establishment of two persistently infected cell lines in parallel,
starting with the same clones of FMDV and BHK-21 cells used 22 years ago. We have asked
whether the evolution of the two newly established cell lines and of the earlier cell line would be
similar or different. The main conclusions of the study are: (i) the basic behaviour characterized by
virus–cell coevolution is similar in the three carrier cell lines, despite differences in some
genetic alterations of FMDV; (ii) a strikingly parallel behaviour has been observed with the two
newly established cell lines passaged in parallel, unveiling a deterministic virus behaviour during
persistence; and (iii) selective RT-PCR amplifications have detected imbalances in the proportion
of positive- versus negative-strand viral RNA, mediated by both viral and cellular factors. The
results confirm coevolution of cells and virus as a major and reproducible feature of FMDV
persistence in cell culture, and suggest that rapidly evolving viruses may constitute adequate test
systems to probe the influence of historical contingency on evolutionary events.
INTRODUCTION
A role for historical contingency in biological evolution is
widely accepted. In the words of S. J. Gould, if we could
rewind the tape of evolutionary history to the remote past
and play it again, it would turn out entirely different
(Gould, 1989). This fundamental issue has been
approached with disparate replicative systems such as
nucleic acid enzymes evolving in vitro (Joyce, 2004;
Lehman, 2004) or adaptation of bacteria to thermostability
(Couñago et al., 2006) but, for obvious reasons, only
fragmentary experimental approaches are possible.
Recurrence is the term used to describe the possibility of
reaching the same end point multiple times when a
biological system is allowed to evolve repeatedly starting
from a given initial point (Lehman, 2004). Some rapidly
evolving systems consisting of two interacting biological
entities, can offer the possibility of probing the contribution of historical contingency versus predictable selection in a complex evolutionary process. Admittedly,
3Present address: Departamento de Genética, Universidad de Málaga,
29071 Malaga, Spain.
The GenBank/EMBL/DDBJ accession numbers of the sequences
reported in this paper are AM503966, AM503965 and AJ133358.
232
present-day viruses represent highly evolved systems, and
they constitute incomplete tools for investigating the
reproducibility of evolutionary developments, at least as a
general problem. Current genomics suggests that viruses
have played an important role as agents of cellular
evolution (Bushman, 2002; Villarreal, 2005; Forterre,
2006). The virus–cell interactions that are of evolutionary
consequence may involve a number of mechanisms such as
genome integration, gene transduction or differential
survival of cell subpopulations, particularly in the course
of persistent infections (Ahmed et al., 1981; Ahmed &
Chen, 1999; Nathanson & Gonzalez-Scarano, 2007). Given
the complexity of interactions involved, the independent
initiation of a persistent infection from the same initial
virus and cells may constitute a system for interrogating
contingency versus recurrence of an evolutionary trajectory
involving two interacting biological entities.
Foot-and-mouth disease virus (FMDV) is an important
animal pathogen that usually produces an acute infection
of cloven-hoofed animals, but it may also produce a
persistent infection in ruminants (reviewed by Rowlands,
2003; Sobrino & Domingo, 2004; Mahy, 2005). BHK-21
cells persistently infected with FMDV were established and
characterized in our laboratory (de la Torre et al., 1985,
Downloaded from www.microbiologyresearch.org by
0008-3312 G 2008 SGM
IP: 88.99.165.207
On: Sat, 17 Jun 2017 15:47:32
Printed in Great Britain
Coevolution of FMDV and host cells
1988, 1989a, b; Dı́ez et al., 1990a, b; Martı́n Hernández
et al., 1994). The main feature of FMDV persistence in cell
culture was a rapid coevolution of the cells and the resident
virus, reflected in a gradual increase of resistance of the
cells to infection by the parental FMDV, and a gradual
increase of FMDV virulence towards the parental BHK-21
cells (de la Torre et al., 1988, 1989a; Martı́n Hernández
et al., 1994; Sáiz & Domingo, 1996; Toja et al., 1999). These
events conformed to the accepted definition of coevolution, meaning an interdependence of the evolution of two
interacting biological entities (Futuyma & Slatkin, 1983;
Woolhouse et al., 2002). The genetic instability of the
BHK-21 cells and the infecting FMDV probably favoured
their rapid coevolution. BHK-21 cells were isolated from a
tumour of a Syrian hamster (Stoker & MacPherson, 1964),
and manifested an increasing degree of cell transformation
in the course of persistence (de la Torre et al., 1988, 1989a).
FMDV displayed rapid genetic variation (de la Torre et al.,
1985, 1988; Dı́ez et al., 1990a), in agreement with the high
mutability of RNA viruses (Batschelet et al., 1976; Drake &
Holland, 1999).
Because of the genetic and phenotypic flexibility of the cells
and the virus in the course of FMDV persistence in cell
culture, we considered that it was uncertain whether, upon
re-establishment of FMDV persistence using the same initial
clonal populations of FMDV and BHK-21 cells, similar or
different evolutionary events would be observed. Furthermore, other systems with which contingency in evolution
has been addressed (Joyce, 2004; Lehman, 2004; Couñago et
al., 2006) involved a single replicating entity subjected to a
specific selective pressure, while the demand imposed upon
the BHK-21–FMDV ensemble was survival in a broad sense,
without other specifications. Here we report the establishment of two parallel lines of BHK-21 cells persistently
infected with FMDV, using cells and virus that had been
kept frozen for 20 years, and following the same procedure
reported previously (de la Torre et al., 1985). Both the
process of establishment of persistence and the coevolution
of cells and virus observed with the newly established cell
lines were very similar to those observed previously (de la
Torre et al., 1985, 1988), despite differences in specific
genetic modifications of the virus and a different evolution
of virus production with cell passage number. The results
suggest that, once a certain level of biological complexity has
been achieved, evolutionary outcomes may have a restricted
number of solutions regarding phenotypic traits.
METHODS
Cells and viruses. BHK-21c1 is a clone of BHK-21 cells obtained as
described previously (de la Torre et al., 1985). Cells were grown in
Dulbecco’s modified Eagle’s medium (DMEM) supplemented with
5 % fetal calf serum (FCS). The FMDV used was the biological clone
C-S8c1, obtained by plating the natural isolate C-Sta Pau Sp/70 on
BHK-21 cells (Sobrino et al., 1983). Both cells and virus were the
same as used to establish the first FMDV carrier cell line (de la Torre
et al., 1985). The stock of cells was kept in liquid nitrogen and FMDV
C-S8c1 was kept at 270 uC. VR100 was derived from persistently
http://vir.sgmjournals.org
infected BHK-21 cells at passage 100 (Dı́ez et al., 1990a). MARLS is a
monoclonal antibody-escape mutant isolated from population CS8c1p213 (Charpentier et al., 1996). Clone H595 was obtained after 95
successive plaque-to-plaque transfers of H50 (a biological clone
isolated from population C-S8c1p113) (Escarmı́s et al., 1996).
Infections. Procedures for infection of BHK-21 cell monolayers in
liquid medium and plaque assays in semisolid agar medium were
described previously (Sobrino et al., 1983; de la Torre et al., 1985).
Cell killing assay. The capacity of FMDV to kill BHK-21 cells was
measured as described previously (Sevilla & Domingo, 1996; Garcı́aArriaza et al., 2004; Herrera et al., 2007). The assay consists of
determining the minimum number of p.f.u. required to kill 104 BHK21 cells after variable times of infection. The assay was performed in
M96 multiwell plates with monolayers of 104 BHK-21 cells per well,
infected with serial dilutions of virus. Results are expressed as the
logarithm of the number of p.f.u. needed for complete cell killing as a
function of time post-infection (p.i.) (Sevilla & Domingo, 1996;
Garcı́a-Arriaza et al., 2004; Herrera et al., 2007).
Establishment of cell lines persistently infected with FMDV. To
establish two new BHK-21 cell lines persistently infected with FMDV
C-S8c1, the procedure described previously (de la Torre et al., 1985)
was used: confluent BHK-21c1 cells were infected with FMDV C-S8c1
at a m.o.i. of 0.1 p.f.u. per cell. At 24 h post-infection (p.i.)
cytopathology was extensive, but 1023 to 1024 of the initial number
of cells remained attached to the dish. At 48 h p.i., the cells were
washed extensively and allowed to grow in DMEM, 5 % FCS. The cells
were subcultured every 2–3 days upon reaching confluence; each
passage involved seeding of about 26106 cells that were allowed to
grow to about 66106 cells. Two persistently infected BHK-21 cell
lines were established in parallel; they are termed R-B and R-D. In this
manuscript, the BHK-21 cells persistently infected with FMDV CS8c1 that were established previously [termed c1-BHK-Rc1 in de la
Torre et al. (1985)] are renamed R for simplicity.
Treatment of cells with ribavirin. A stock of ribavirin (1-b-D-
ribofuranosyl 1,2,4-triazole-3-carboxamide) was prepared at 50 mM
concentration in PBS and stored at 270 uC. It was diluted in DMEM,
5 % FCS as needed. To cure persistently infected cells of FMDV, cell
monolayers (with about 66106 cells) were treated with 500 mM
ribavirin for 72 h (de la Torre et al., 1987; Airaksinen et al., 2003).
They were then washed and passaged three times in the absence of
ribavirin. The cured R-B and R-D cells are named C-B and C-D,
respectively (for example, throughout the manuscript, including
tables and figures, C-B15 and C-D15 denote R-B and R-D cells that
were passaged 15 times and were then cured of FMDV by treatment
with ribavirin). Curing was ascertained by absence of infectivity and
of FMDV sequences amplifiable by RT-PCR (as described below).
Extraction of viral RNA. Extracellular viral RNA was extracted either
from 150 ml supernatant of monolayers of lytically infected cells or
from 500 ml supernatant of monolayers of persistently infected cells.
The supernatant was mixed with 2 vols Trizol (Gibco) and incubated
for 5 min at room temperature, chloroform (100 ml per 150 ml
supernatant) was added and the mixture was incubated for 10 min at
room temperature and centrifuged for 15 min at 14 800 g. Nucleic
acids were recovered from the aqueous phase by ethanol precipitation.
Quantification of FMDV RNA. FMDV RNA was quantified by real-
time RT-PCR amplification using the LightCycler instrument (Roche)
and the RNA Master SYBR green I kit (Roche), according to the
instructions of the manufacturer, using Tth polymerase and a
concentration of Mn2+ that was found to be optimal (3 mM). The
amplified genomic region was 3D (polymerase), using oligonucleotides oligo-U (59-GGATGCCATCTGGCTGT; sense orientation; 59
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 15:47:32
233
M. Herrera and others
nucleotide corresponds to genomic residue 7493; numbering of
genomic residues according to Escarmı́s et al., 1996) and oligo-A (59AGGAGATCATGGTGTAGGTGTC; antisense orientation; 59 nucleotide at genomic residue 7615) as primers. Quantification was
relative to a standard curve obtained with known amounts of FMDV
RNA, synthesized by in vitro transcription of DNA plasmid pMT28
(Garcı́a-Arriaza et al., 2004). The specificity of the reaction was
monitored by determining the denaturation curve of the amplified
DNA and the size of the amplified DNA by agarose gel electrophoresis. Negative controls (without template RNA) were run in parallel
with each amplification reaction.
harvested in 0.1 ml sample buffer (160 mM Tris/HCl, pH 6.8, 2 %
SDS, 11 % glycerol, 0.1 M DTT, 0.033 % bromophenol blue) (Guinea
& Carrasco, 1990). The samples were boiled for 5 min and aliquots
were analysed by SDS-PAGE run at 200 V. Fluorography of the gels
was carried out as described previously (Irurzun et al., 1992). The
amount of cell extract used for electrophoretic analysis was normalized to a constant amount of cellular actin, measured by reactivity
with a monoclonal antibody (anti-b-actin clone AC-15; Sigma), and
corresponded to a concentration of protein in the linear region of the
relationship between the Western blot signal and the protein
concentration.
Quantification of positive- and negative-strand FMDV RNA.
Western blotting. Proteins were transferred to a 0.45 mM-pore-size
Total RNA was reverse-transcribed by employing the Transcriptor RT
kit (Roche), using either oligonucleotide oligo-A or tag-oligo-U to
amplify positive- or negative-strand FMDV RNA, respectively. ‘tag’ is
the oligonucleotide 59-AGTTTAAGAACCCTTCCCGC, corresponding to lymphocytic choriomeningitis virus (LCMV) RNA (segment L,
positions 3662–3681), which does not hybridize with positive- or
negative-strand FMDV RNA. Real-time quantitative PCR was carried
out using the Light Cycler Fast Start DNA Master SYBR Green I
(Roche), following the instructions of the manufacturer.
Quantification was by extrapolation of fluorescence values of standard
curves determined in parallel either with positive-strand FMDV RNA
obtained by transcription of pMT28 DNA, or with negative-strand
FMDV RNA obtained by transcription of the FMDV 3D region by T7
RNA polymerase (Garcı́a-Arriaza et al., 2004). In the standard assay
with in vitro transcripts, a range of 1.86103–1.86108 positive-strand
FMDV RNA molecules and of 2.26103–2.26108 negative-strand
FMDV RNA molecules per ml sample could be quantified, with a limit
of detection of 1.86102 RNA molecules per ml sample. No
amplification of positive-strand FMDV RNA was obtained using up
to 2.26108 molecules of negative-strand FMDV RNA as template for
RT-real-time PCR using the oligonucleotide set for positive-strand
FMDV RNA amplification, and no amplification of negative-strand
FMDV RNA was obtained using up to 1.86108 molecules of positivestrand FMDV RNA as template for RT-real-time PCR using the
oligonucleotide set for negative-strand FMDV RNA amplification. The
quantification of serial dilutions of positive- and negative-strand RNA
was not affected by the presence of total BHK-21 RNA extracted from
16105–66105 BHK-21 cells per assay. The presence of 1.86107
molecules of positive-strand FMDV RNA did not have any effect on the
quantification of negative-strand FMDV RNA in the range of
2.26103–2.26108 molecules per ml in the standard assay.
nitrocellulose membrane (Bio-Rad). Western blots were developed
with the following antibodies: mouse monoclonal anti-VP3 antibody
at a dilution of 1 : 500, mouse monoclonal anti-2C (a gift from F.
Sobrino, Centro de Biologı́a S. Ochoa, Spain) at a dilution of 1 : 1000,
mouse monoclonal anti-3D (a gift from E. Brocchi, Istituto
Zooprofilattico Sperimentale della Lombardia e dell’Emilia
Romagna, Brescia, Italy) at a dilution of 1 : 1000 and mouse
monoclonal anti-actin antibody (Sigma) at a dilution of 1 : 1000.
Goat anti-rabbit IgG antibody coupled to peroxidase and goat antimouse IgG antibody coupled to peroxidase (Pierce) were used at
1 : 10000 dilution. Each sample was analysed by Western blotting to
identify virus-specific proteins following previously described procedures (Mateu et al., 1989; Perales et al., 2007).
Molecular cloning and nucleotide sequencing. Synthesis of
FMDV cDNA and cloning in pGEM-T Easy vector (Promega) were
carried out as described previously (Grande-Pérez et al., 2005;
Herrera et al., 2007). To obtain consensus FMDV genomic sequences,
viral RNA was retrotranscribed using Transcriptor reverse transcriptase (Roche) and amplified by PCR using an Expand High Fidelity
polymerase system (Roche), following the directions of the manufacturer. Each sequence was determined at least twice in independent
reactions. Oligonucleotide primers used for molecular cloning and
sequencing have been described previously (Escarmı́s et al., 2002;
Garcı́a-Arriaza et al., 2004). The single-letter amino acid code is used.
Amino acid residues are numbered independently for each FMDV
protein; capsid proteins are indicated by the first digit in the
numbering of residues (i.e. D3009A means amino acid substitution
DAA at residue 9 of capsid protein VP3).
Analysis of protein synthesis. Viral protein synthesis was analysed
by metabolic labelling with [35S]Met–Cys, followed by SDS-PAGE and
fluorography. Proteins were labelled by the addition of 60 mCi
(2.22 MBq) [35S]Met–Cys (Amersham) ml21 contained in methionine-free DMEM. After 1 h of incubation of the cell monolayers with
the radioactive medium, the medium was removed and the cells were
234
RESULTS
Establishment of two BHK-21 cell lines
persistently infected with FMDV
To test whether newly established BHK-21 cells persistently
infected with FMDV would behave similarly to a cell line
characterized previously in our laboratory (de la Torre
et al., 1985), we again established persistence in two parallel
cultures, by growth of cells that survived a cytolytic
infection, as detailed in Methods. The procedures and the
starting cells and virus were the same as used when the first
FMDV carrier cell line (termed R) was established (de la
Torre et al., 1985). The two newly established cell lines,
termed R-B and R-D, were passaged a total of 100 times.
Cells were subcultured when just reaching confluence to
prevent a cytopathology crisis involving cell detachment
after confluence. The course of events, from the initial
cytolytic infection to the full establishment of persistence,
were very similar for R-B and R-D cells, and to the events
recorded previously for R cells (de la Torre et al., 1985).
Basic features of the cells are shared by the three
persistently infected cell lines R, R-B and R-D
In the course of persistence, R-B and R-D cells acquired a
round morphology, increased their rate of duplication and
became increasingly resistant to infection by FMDV CS8c1, as documented previously for R cells (de la Torre
et al., 1988) (results not shown). The cells were cured of
FMDV by treatment with the nucleoside analogue
ribavirin, and the cured cells maintained their resistance
to FMDV C-S8c1, as measured by the extent of
cytopathology and the number of viral progeny (Table 1).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 15:47:32
Journal of General Virology 89
Coevolution of FMDV and host cells
Table 1. Resistance of R-B and R-D cells to infection by FMDV C-S8c1 and MARLS
BHK-21, C-B or C-D cells (ribavirin-treated R-B and R-D cells at passages 90 and 100) were infected with either FMDV C-S8c1 or FMDV MARLS.
The progeny virus is expressed as the number of FMDV RNA molecules per ml infected cell-culture supernatant either at 48 h p.i. or when the
cytopathic effect (c.p.e.) was complete (indicated in brackets; no c.p.e. indicates no evidence of cytopathology at 48 h p.i.). Each value represents
the mean±SD of triplicate determinations. Procedures are detailed in Methods.
FMDV
Cells
BHK-21
C-S8c1
MARLS
C-B90
7
(4.1±1.2)610
[24 h p.i.]
(1.6±0.8)6109
[20 h p.i.]
C-D90
5
(7.2±2.0)610
[no c.p.e.]
(2.8±1.9)6108
[48 h p.i.]
In contrast, C-B and C-D cells were productively infected
with the FMDV mutant MARLS, a virus which, as a result
of multiple passages in BHK-21 cells, has acquired high
fitness and virulence (cell-killing capacity) measured in
BHK-21 cells (Charpentier et al., 1996; Herrera et al.,
2007). MARLS was able to overcome partially the
resistance of C-B and C-D cells to infection, as evidenced
by FMDV RNA yields and cytopathology (Table 1). Thus,
the evolution of the carrier cells in the R-B and R-D
lineages with regard to morphology, rate of cell division
and resistance to FMDV was indistinguishable from that
reported previously for R cells.
Deterministic events in two parallel lineages of
persistently infected cells: infectivity and the ratio
of positive- versus negative-strand FMDV RNA
The variation of extracellular and intracellular infectivity
with cell passage number followed a very similar pattern in
the R-B and R-D lineages (Fig. 1a). Strikingly, the virus titre
fell below detectability at passage 30 and then increased
transiently around passages 40–45, becoming undetectable
again up to passage 100. The peak of infectivity at cell
passage 45 and undetectable infectivity at cell passage 100
corresponded to the levels of intracellular structural and
non-structural FMDV proteins, as quantified by Western
blotting using specific monoclonal antibodies (Fig. 1b). As a
control, extracts of C-B and C-D cells that had been cured of
FMDV by treatment with ribavirin did not show a signal
with the same monoclonal antibodies.
To investigate the relationship between infectivity and viral
RNA levels, the numbers of extracellular and intracellular
positive- and negative-strand FMDV RNA molecules were
quantified at 16 different passages, spanning passages 2 to
100. The results (Fig. 2a) indicate a dominance of positivestrand RNA coincident with the passages at which virus
infectivity was detectable (compare Figs 1a and 2a). When
infectivity was not detected, the amount of negativestrand RNA was similar to or greater than the amount of
positive-strand RNA. Again, strikingly, lineages R-B and RD followed a parallel variation in the proportion of
positive- and negative-strand RNA. This observation
http://vir.sgmjournals.org
C-B100
5
(2.6±1.7)610
[no c.p.e.]
(2.3±2.4)6108
[48 h p.i.]
C-D100
5
(4.4±2.3)610
[no c.p.e.]
(1.5±1.4)6108
[48 h p.i.]
(3.3±2.2)6106
[no c.p.e.]
(1.4±0.9)6108
[48 h p.i.]
identifies a deterministic event at the level of intracellular
viral RNA replication during viral persistence.
A crisis of cytopathology, when cells grow to overconfluence, is generally accompanied by an increase in
FMDV titres (de la Torre et al., 1985). To investigate
whether the peak of extracellular infectivity detected at
passage 45 (Fig. 1a), which coincided with a maximum of
positive-strand RNA (Fig. 2a), could be triggered by cells
entering a phase of cytopathology, the numbers of
extracellular and intracellular positive-strand RNA molecules were measured in R-B and R-D cells at passage 45
prior to confluence and after reaching confluence. The
results (not shown) indicated that the numbers of
extracellular and intracellular positive-strand RNA molecules at passage 45 were very similar prior to confluence
and after reaching confluence, suggesting that the peak of
extracellular infectivity detected was not due to cells
entering a phase of cytopathology.
The altered ratio of positive- versus negativestrand FMDV RNA is due to viral and cellular
factors
The evolution towards a decrease in the dominance of
positive-strand FMDV RNA during persistence (Fig. 2a)
could be due to either viral factors or cellular factors or to a
combination of both. To distinguish between these
possibilities, parental BHK-21 cells or late C-B and C-D
cells were infected either with FMDV from a passage in
which positive-strand RNA was dominant or with FMDV
from a passage in which negative-strand RNA was
dominant. The results (Fig. 2b) show that, in the infections
of BHK-21 cells, the virus that produced a higher
proportion of positive-strand RNA in the course of
persistence also produced a higher proportion of positive-strand RNA in the progeny of the cytolytic infection.
Likewise, late virus that produced a higher proportion of
negative-strand FMDV RNA during persistence also produced a higher proportion of negative-strand RNA in the
progeny of the cytolytic infections. This result suggests that
viral factors are involved in determining the proportion of
positive- and negative-strand FMDV RNA during viral
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 15:47:32
235
M. Herrera and others
Fig. 1. Establishment of BHK-21 cell lines persistently infected with FMDV, and evolution of levels of infectivity and intracellular
viral proteins. (a) Variation of extracellular (dashed lines) and intracellular (solid lines) infectivity with passage number in lineages
R-B and R-D. The total number of p.f.u. in ~6¾106 cells was determined by plaque assay. Each value represents the mean±SD
(error bars) from triplicate assays. (b) Virus-specific proteins expressed by FMDV in R-B and R-D cells at cell passages 2, 45
and 100. R-B and R-D refer to R-B and R-D cells and C-B and C-D refer to the same cells cured of FMDV by treatment with
ribavirin. Virus-specific proteins (VP3, 2C and 3D) were identified by reactivity with specific monoclonal antibodies in Western
blot assays (Mateu et al., 1989; Perales et al., 2007). Procedures are detailed in Methods.
replication. In the infections of late C-B and C-D cells with
virus that produced a higher proportion of positive-strand
RNA in the course of persistence, the dominance of the
positive strand was diminished and, in some cases, the
negative-strand RNA became dominant (Fig. 2b). When
the same cells were infected with FMDV from a persistence
passage in which negative strands dominated, the latter
accentuated their dominance (Fig. 2b). Therefore, both
cellular and viral factors contribute to the evolution of
dominance of positive- versus negative-strand RNA in the
course of viral replication.
236
The proportion of positive- and negative-strand FMDV
RNA was also quantified at passages 45, 60 and 100 of
R cells (those previously established in our laboratory; de
la Torre et al., 1985, 1988). In all cases, in both intracellular
and extracellular virus, levels of positive-strand RNA
were 102- to 104-fold higher than negative-strand RNA.
Although we cannot exclude the possibility that the
dominance of the positive strand was lost at some
other passages of R cells, the pattern of RNA polarity
dominance in R cells was different from that in R-B and
R-D cells. In turn, the results suggest that imbalances
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 15:47:32
Journal of General Virology 89
Coevolution of FMDV and host cells
Fig. 2. Evolution of the number of positive- and negative-strand FMDV RNA molecules during persistence of FMDV in BHK-21
cells, and the influence of viral and cellular factors. (a) Quantification of extracellular (ec) or intracellular (ic) positive- (solid lines)
and negative- (dashed lines) strand RNA as a function of passage number. At each passage analysed, total RNA was extracted
either from the cell culture supernatant or from an extract of ~6¾106 R-B or R-D cells. Each value represents the mean±SD
(error bars) from triplicate determinations. (b) Influence of the virus and of the host cells in the proportion of positive- (shaded
bars) versus negative- (open bars) strand FMDV RNA. Parental BHK-21 cells, or R-B and R-D cells cured of FMDV by
treatment with ribavirin (C-B and C-D), were infected either with FMDV from a passage in which positive-strand RNA was
dominant (R-B5, R-B15, R-B25, R-D5, R-D15, R-D25) or with FMDV from a passage in which negative-strand RNA was
dominant (R-B60, R-B70, R-B90, R-D60, R-D70, R-D90) [compare with (a)]. Each value represents the mean±SD (error bars)
of the number of RNA molecules (ml supernatant)”1 from triplicate determinations. Procedures are detailed in Methods.
http://vir.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 15:47:32
237
M. Herrera and others
of positive- versus negative-strand RNA are not a necessary
condition for maintaining FMDV persistence in BHK-21
cells, as also evidenced by the fact that, at passages 2–25
of R-B and R-D cells, persistence was maintained
with continuous dominance of positive-strand RNA
(Fig. 2a).
Phenotypic and genetic changes of FMDV during
persistence
In the course of persistence in R cells, the resident FMDV
became temperature sensitive (ts), acquired a small plaque
morphology (0.5–1 mm versus 2–4 mm for C-S8c1) and
increased its virulence for BHK-21 cells (de la Torre et al.,
1985, 1988). These traits were also observed for FMDV
rescued from R-B and R-D cells (Table 2). Virulence,
quantified as the capacity to kill BHK-21 cells, increased
with the time of residence of the virus in the carrier cells,
reaching virulence levels comparable to those of FMDVs
that have been passaged more than 100 times cytolytically
(Herrera et al., 2007) (Fig. 3a and Table 3).
To compare the amounts of virus-specific proteins
expressed by persistent virus when infecting BHK-21 cells
cytolytically, either standard C-S8c1 or FMDV shed by R-B
and R-D cells at cell passages 2 and 45 were used to infect
BHK-21 cells and intracellular proteins were metabolically
labelled and then analysed electrophoretically using actin as
a control. The results (Fig. 3b) show that the persistent
virus shed by R-B and R-D cells at passage 45 displays
increased expression of viral proteins as well as increased
shut-off of host-cell protein synthesis compared with the
virus shed by R-B and R-D cells at passage 2, or with CS8c1. Therefore, the increase in virulence of FMDV during
Table 2. Phenotypic traits of FMDV C-S8c1 and its persistent
derivatives
R-B and R-D refer to the FMDV shed by R-B and R-D cells to the
culture medium; the cell passage number (2, 20 or 45) is indicated.
Viral yields from infections of BHK-21 with either the parental clone
FMDV C-S8c1 or the persistent FMDVs shed by R-B and R-D cells at
37 and 42 uC are expressed as viral genomic RNA molecules per ml
cell-culture supernatant. Quantification of RNA molecules was
carried out by real-time RT-PCR. Each value represents the
mean±SD from triplicate determinations. Procedures are detailed in
Methods.
FMDV
Yield at 37 6C
Yield at 42 6C
Plaque diameter
(mm)
C-S8c1
R-B2
R-B20
R-B45
R-D2
R-D20
R-D45
(4.4±1.2)6108
(2.2±1.8)6107
(2.6±2.4)6107
(2.8±1.9)6107
(1.8±2.2)6107
(1.6±3.1)6107
(5.6±2.8)6107
(3.1±0.9)6108
(1.0±2.5)6104
(2.3±1.6)6104
(2.4±3.1)6104
(9.6±1.9)6103
(3.2±2.7)6104
(1.0±1.6)6104
2–4
2–4
1–3
0.5–1
2–4
1–3
0.5–1
238
persistence is also reflected in a more intense shut-off of
host-cell protein expression.
To evaluate the extent of genetic variation undergone by
FMDV during persistence in R-B and R-D cells, the entire
genomic RNA of virus produced by R-B and R-D cells at
passage 45 was sequenced and the sequences were
compared with that of the parental FMDV C-S8c1. The
results (Table 4) indicate that 62.5 % of the mutations
found are common to the virus from R-B and R-D cells,
and that only two amino acids (position 13 in VP3 and
position 291 in 3D) differ between the R-B and R-D
lineages. Thus, up to passage 45, the consensus nucleotide
and deduced amino acid sequences showed minimal
divergence between the two lineages.
It was not possible to amplify and determine the entire
genomic nucleotide sequence of FMDV in R-B and R-D
cells at passage 100, despite several attempts (probably due
to the small amounts of viral RNA present). However, the
consensus sequence of genomic residues 1897–3030
(residues encoding VP2 and part of VP3) and 6610–8019
(residues encoding 3D) could be determined, and they
were compared with the consensus nucleotide sequence of
VR100, the persistent virus shed by carrier cells at R cell
passage 100 (Dı́ez et al., 1990a; Toja et al., 1999). In the
VP2- and VP3-coding regions examined, three mutations
at genomic positions 2433, 2477 and 2517 that were not
detected at passage 45 were dominant in the consensus
sequence of R-D100 (Table 5). Interestingly, none of the
mutations present in the 3D-coding region at passage 45
were maintained as dominant at passage 100 and,
furthermore, four additional mutations, three of them
leading to amino acid substitutions in either R-B and R-D,
were present in the consensus sequences at passage 100
(compare Tables 4 and 5). The comparison with the
corresponding regions of FMDV VR100 (Dı́ez et al., 1990a;
Toja et al., 1999) indicates that two mutations (D3009A
and N3013H) were common to the three lineages (R, R-B
and R-D cells). All the phenotypic traits analysed and part
of the genetic changes undergone by persistent FMDV
point to a remarkable reproducibility of the coevolutionary
events during FMDV persistence in BHK-21 cells, despite
an inherent genetic instability of both the cells and the
resident virus.
DISCUSSION
Coevolution of cells and virus has been described in the
course of persistence of several animal viruses in cell
culture (Takemoto & Habel, 1959; Ahmed et al., 1981;
Chiarini et al., 1983; Delli Bovi et al., 1984; Ron & Tal,
1985, 1986; Cummings & Rinaldo, 1989; Dermody et al.,
1993; Calvez et al., 1995; Chen & Baric, 1996; Mrukowicz
et al., 1998; Zhong et al., 2006). In other persistent
infections in cell culture, no cell evolution was observed,
and persistence was associated with defective interfering
particles or with small-plaque and ts viral mutants
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 15:47:32
Journal of General Virology 89
Coevolution of FMDV and host cells
Fig. 3. Cell-killing capacity of FMDVs rescued from R-B and R-D cells. (a) Time needed by C-S8c1 and virus shed by R-B and
R-D at cell passage 10, 20 and 45 to kill 104 BHK-21 cells as a function of the initial number of infectious units (p.f.u.). Each
value represents the mean±SD (error bars) from triplicate assays. The data are summarized in Table 3. (b) Electrophoretic
analysis of 35S-labelled FMDV and cellular proteins upon infection of BHK-21 cells with C-S8c1 or with virus shed by R-B and
R-D at cell passage 2 and 45. Infections were carried out at an m.o.i. of 10 (p.f.u. per cell). Proteins were labelled with
[35S]Met–Cys from 1–2, 4–5 and 7–8 h p.i. using uninfected cultures treated in parallel (”virus) as a control (upper panel).
Procedures are detailed in Methods.
(Igarashi et al., 1977; Holland et al., 1980, 1982; Youngner
& Preble, 1980). Our objectives in reanalysing FMDV
persistence in BHK-21 cells were to evaluate whether
the major biological events characterized previously
would be repeated with the newly established cell lines
and to examine features of FMDV replication with tools
not available 20 years ago, notably quantitative PCR
amplification.
The main biological features of FMDV persistence in BHK21 cells, which is a coevolution of cells and virus, were
repeated in the three cell lines. Mutations in the viral
genome were not identical in the three lineages (Tables 4
and 5). However, amino acid substitutions D3009A and
http://vir.sgmjournals.org
N3013H in VP3, which affect residues located around a
pore at the capsid fivefold axes (Lea et al., 1994), became
dominant in the three lineages. These two substitutions
were previously identified in an antigenic variant of FMDV
C-S8c1 (Holguin, 1996), and they are very rare in other
FMDVs or picornaviruses (http://www.iah.bbsrc.ac.uk/
virus/picornaviridae/SequenceDatabase/3Ddatabase/3D.htm).
Substitutions C3007V and M3014L present in VR100 (Dı́ez
et al., 1990a; Toja et al., 1999) were not detectable in
populations R-B and R-D (Table 5). In contrast, D3009A
has invariably been found in FMDV from persistently
infected BHK-21 cells, and this substitution was readily
selected when FMDV C3Arg/85, an isolate of FMDV of a
different subtype, associated with acute infections, was
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 15:47:32
239
M. Herrera and others
Table 3. Cell-killing capacity of FMDVs rescued from R-B and
R-D cells
Numbers of p.f.u. of C-S8c1 and of virus shed by R-B and R-D at cell
passage 10, 20 and 45 needed to kill 104 cells in 24 h are based on the
data shown in Fig. 3(a). The numbers in the first column indicate the
cell passage number. Each virulence value represents the mean±SD
from triplicate assays; relative virulence values were normalized to the
virulence of C-S8c1.
FMDV
C-S8c1
R-B10
R-B20
R-B45
R-D10
R-D20
R-D45
Virulence (p.f.u.)
Relative virulence
4
(1.9±0.5)610
(6.9±1.0)6103
(1.6±1.6)6103
(3.0±1.1)6102
(1.2±1.2)6104
(1.7±1.1)6103
(2.8±0.8)6102
1
2.7
11.9
63.3
1.6
11.2
67.8
passaged in modified BHK-21 cells that had become
partially resistant to FMDV in the course of persistence
(Escarmı́s et al., 1998). Furthermore, replacement A3009T
was observed in five out of six passage series in which
VR100 was subjected to serial cytolytic infections in BHK21 cells (Sevilla & Domingo, 1996). These observations
suggest that fixation of D3009A was guided by some
selective constraints that are encountered in carrier BHK21 cells that have evolved to became partially resistant to
the parental FMDV C-S8c1 (de la Torre et al., 1988; Dı́ez et
al., 1990a; Escarmı́s et al., 1998). Substitution D3009A
caused a drastic reduction in plaque size and viability, and
cytolytic replication of C-S8c1 with D3009A led to fixation
of M3014L as a compensatory substitution. In turn, the
introduction of the double substitution D3009A/M3014L
facilitated the fixation of N3013H (Mateo & Mateu, 2007).
In the FMDV rescued from R-B and R-D cells at passage
100, the only VP3 substitution that accompanies D3009A is
N3013H (Table 5), and its possible compensatory role
remains to be demonstrated. Also, the phenotypic
implications of replacements around the FMDV pore at
the fivefold axes, and their connections with persistence,
require additional studies.
Repeated mutations in parallel evolutionary lineages have
been reported in FMDV (Borrego et al., 1993; Martı́nHernández et al., 1994; Mateu et al., 1994; Ruiz-Jarabo
et al., 2003) and in other picornaviruses (de la Torre et al.,
1992; Borzakian et al., 1993; Chumakov et al., 1994;
Couderc et al., 1994; Lu et al., 1996; reviewed by Domingo
et al., 2001). The higher reproducibility of phenotypic than
genotypic modifications during FMDV persistence relates
to the general problem of mapping genotypes into
phenotypes (Schuster, 1997; Schuster & Stadler, 1999;
Table 4. Nucleotide and deduced amino acid substitutions in the genomic RNA of FMDVs R-B45
and R-D45 compared with their parental virus C-S8c1
Residue numbering of the FMDV genome is given as described by Escarmı́s et al. (1996); amino acid residues
(single-letter code) are numbered individually for each protein from the N terminus to the C terminus;
genomic regions (S fragment and pseudoknots at the 59 UTR; non-structural proteins L, 2B, 2C, 3A and 3D
and capsid proteins VP3 and VP1) are based on Mahy (2005) and references therein. Silent (synonymous)
mutations amounted to 41.7 and 35.7 % of the total number of mutations in the open reading frames of R-B
and R-D, respectively. The 59- and 39-terminal 24 residues of the genome, the 22 residues at the 59 and 39 ends
of the poly(C) and the homopolymeric regions [internal poly(C) and 39 poly(A)] were not sequenced.
Nucleotide position
(amino acid residue)
365
367
452
1118
1411
2576
2587
2767
2997
3653
4026
4539
5465
7071
7305
7480
240
(27)
(125)
(9)
(13)
(73)
(149)
(149)
(48)
(65)
(56)
(154)
(232)
(291)
Genomic region or
encoded protein
S fragment
S fragment
Pseudoknots
L
L
VP3
VP3
VP3
VP3
VP1
2B
2C
3A
3D
3D
3D
Virus
C-S8c1
R-B45
R-D45
U
A
U
G (G)
U (C)
A (D)
A (N)
C (L)
U(G)
C (T)
A (K)
U (D)
A (K)
A (E)
A (Q)
A (T)
U
A
C
A (E)
G (G)
C (A)
A (N)
U (L)
C (G)
A (K)
G (K)
A (E)
G (G)
C (D)
G (Q)
A (T)
C
C
U
A (E)
G (G)
C (A)
C (H)
U (L)
C (G)
A (K)
A (K)
A (E)
G (G)
C (D)
G (Q)
G (A)
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 15:47:32
Journal of General Virology 89
Coevolution of FMDV and host cells
Table 5. Nucleotide and deduced amino acid substitutions of FMDVs VR100, R-B100 and
R-D100 compared with their parental virus C-S8c1
Residues are numbered as described in Table 4. Mutations found in the consensus sequence of the indicated
genomic residues (1897–3030, encoding VP2 and part of VP3, and 6610–8019, encoding 3D) are shown.
Procedures for preparation of FMDV RNA and nucleotide sequence determination are described in Methods.
Nucleotide position
(amino acid residue)
Encoded
protein
Virus
C-S8c1
Residues 1897–3030
1944 (16)
1956 (20)
2316 (140)
2325 (143)
2431–2433 (179)
2470 (192)
2473 (193)
2477 (194)
2517 (207)
2569–2570 (7)
2576 (9)
2587 (13)
2590 (14)
Residues 6610–8019
7595
7324
7358
7458
VP2
VP2
VP2
VP2
VP2
VP2
VP2
VP2
VP2
VP3
VP3
VP3
VP3
3D
3D
3D
3D
VR100
R-D100
U
G
A
C
CUC
G
G
C
C
UG
A
A
A
(T)
(G)
(L)
(Y)
(L)
(A)
(G)
(A)
(N)
(C)
(D)
(N)
(M)
C
C
C
U
CUC
A
A
C
C
GU
C
C
U
(T)
(G)
(L)
(Y)
(L)
(T)
(S)
(A)
(N)
(V)
(A)
(H)
(L)
U
G
A
C
CUC
G
G
C
C
UG
C
C
A
(T)
(G)
(L)
(Y)
(L)
(A)
(G)
(A)
(N)
(C)
(A)
(H)
(M)
U
G
A
C
GUG
G
G
U
A
UG
C
C
A
(T)
(G)
(L)
(Y)
(V)
(A)
(G)
(V)
(K)
(C)
(A)
(H)
(M)
A
G
G
C
(D)
(V)
(S)
(H)
A
G
G
C
(D)
(V)
(S)
(H)
G
G
G
C
(G)
(V)
(S)
(H)
A
A
U
U
(D)
(M)
(I)
(H)
van Nimwegen et al., 1999; Fontana, 2002; Fernández &
Solé, 2007). In a simple but realistic scenario for theoretical
studies, folding of RNA has been used as the phenotype,
and evolution towards a different phenotype was preceded
by drift in a vast neutral space of primary sequences
(Schuster, 1997; Fontana & Schuster, 1998). What the
results of FMDV persistence suggest is that, when the
requirement of a genetic entity (in this case FMDV) is to
reach a very complex set of phenotypic traits, needed to
replicate and survive in a changing and increasingly hostile
cellular environment, some specific genomic residues may
be constrained. Thus, the degeneracy of sequence space
when mapping a single phenotype such as RNA folding
may be greatly decreased when mapping interconnected
phenotypic traits.
At the phenotypic level, the need to cope with multiple
constraints may be reflected in a number of deterministic
features, notably variation in production of infectious virus
and imbalances in the proportion of positive- versus
negative-strand FMDV RNA, which occurred at virtually
the same passage numbers of R-B and R-D cells (Figs 1a
and 2a). Both cells and virus influenced the proportion of
positive- versus negative-strand FMDV RNA (Fig. 2b), a
feature which may have coevolved as a means to modulate
the extent of viral RNA replication. A 310- to 820-fold
excess of RNA of positive polarity over negative polarity
http://vir.sgmjournals.org
R-B100
has been quantified in the cell culture supernatant of
cytolytic infections with FMDV C-S8c1, MARLS or H595
(results not shown), in agreement with determinations
with other positive-strand RNA viruses (Cunningham et al.,
1990; Novak & Kirkegaard, 1991; Komurian-Pradel et al.,
2004). In several persistent infections, however, similar
levels of positive- and negative-strand viral RNA have been
observed (Cunningham et al., 1990; Tam & Messner, 1999;
Hohenadl et al., 1991; Andreoletti et al., 1997).
Deterministic events during RNA virus evolution, which
were not imposed by obvious external selective pressures
(drugs, antibodies) have been previously observed in
competitions between a vesicular stomatitis virus wild-type
clone and a neutral mutant derivative (Quer et al., 1996,
2001). These studies defined the concept of contingent
neutrality, meaning that, despite its neutrality, the mutant
was more vulnerable to mutation than its parental clone.
These results represented an experimental counterpart of the
concept of ‘advantage of the flattest’ (advantage of a variant
lying on a flat fitness surface) established with digital
organisms (Wilke et al., 2001). Another instance of
determinism was the synchronous loss of memory genomes
in parallel lineages of FMDV (Ruiz-Jarabo et al., 2003). The
initial formulation of quasispecies was deterministic, as are
many initial theoretical treatments to place a problem in
solvable mathematical terms, and determinism necessitated
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 15:47:32
241
M. Herrera and others
an infinite population size of replicons (Eigen & Schuster,
1979). It could be inferred that a deterministic behaviour of
a real viral quasispecies would be observed with higher
probability when large viral population sizes are involved.
However, during FMDV persistence, very low population
sizes preceded the passages at which deterministic behaviour
was manifested (passage 45 in Figs 1 and 2). In this case,
determinism was probably imposed by selective demands of
a biological environment acting on highly dynamic FMDV
mutant repertoires since the early stages of persistence
(Martı́n-Hernández et al., 1994).
infected cells by ribavirin involves enhanced mutagenesis. Virology
311, 339–349.
Thus, if the tape of evolution were played again from the
remote past, would it turn out similar to or different from
what we know (Gould, 1989)? In comparing the unavoidably very fragmentary information that we have on major
evolutionary transitions [the RNA world about 46109 years
ago (Eigen, 1992; Orgel, 2004) and the Cambrian explosion
about 56108 years ago (Gould, 1989; Conway Morris,
1998)] a major difference that could influence the weight of
contingency is complexity of forms. Evolved, complex
biological forms, as cells and viruses are, may be highly
constrained to yield a specific biological solution when faced
with a mutual interaction. The comparison of our results
with previous tests of recurrence during RNA evolution in
vitro suggests that, when a complex biological system has
survival as its critical requirement, as is the case for cells and
the resident virus during persistence, phenotypic alterations
may be channelled towards a unique, reproducible outcome.
In contrast, because of the larger degeneracy of the neutral
sequence space (to reach alternative phenotypes) in
primitive self-organized systems (such as in the RNA world;
Eigen, 1992), the latter could have evolved towards
alternative solutions in an unpredictable manner. If we are
correct, the answer to S. J. Gould’s fundamental question
would depend on how ‘remote’ the remote past is.
disease virus in the presence or absence of immune selection. J Virol
67, 6071–6079.
ACKNOWLEDGEMENTS
Andreoletti, L., Hober, D., Becquart, P., Belaich, S., Copin, M. C.,
Lambert, V. & Wattre, P. (1997). Experimental CVB3-induced chronic
myocarditis in two murine strains: evidence of interrelationships
between virus replication and myocardial damage in persistent
cardiac infection. J Med Virol 52, 206–214.
Batschelet, E., Domingo, E. & Weissmann, C. (1976). The proportion
of revertant and mutant phage in a growing population, as a function
of mutation and growth rate. Gene 1, 27–32.
Borrego, B., Novella, I. S., Giralt, E., Andreu, D. & Domingo, E.
(1993). Distinct repertoire of antigenic variants of foot-and-mouth
Borzakian, S., Pelletier, I., Calvez, V. & Colbere-Garapin, F. (1993).
Precise missense and silent point mutations are fixed in the genomes
of poliovirus mutants from persistently infected cells. J Virol 67,
2914–2917.
Bushman, F. (2002). Lateral DNA Transfer. Mechanisms and Con-
sequences. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Calvez, V., Pelletier, I., Couderc, T., Pavio-Guedo, N., Blondel, B. &
Colbere-Garapin, F. (1995). Cell clones cured of persistent poliovirus
infection display selective permissivity to the wild-type poliovirus
strain Mahoney and partial resistance to the attenuated Sabin 1 strain
and Mahoney mutants. Virology 212, 309–322.
Charpentier, N., Davila, M., Domingo, E. & Escarmis, C. (1996).
Long-term, large-population passage of aphthovirus can generate and
amplify defective noninterfering particles deleted in the leader
protease gene. Virology 223, 10–18.
Chen, W. & Baric, R. S. (1996). Molecular anatomy of mouse hepatitis
virus persistence: coevolution of increased host cell resistance and
virus virulence. J Virol 70, 3947–3960.
Chiarini, A., Arista, S., Giammanco, A. & Sinatra, A. (1983). Rotavirus
persistence in cell cultures: selection of resistant cells in the presence
of fetal calf serum. J Gen Virol 64, 1101–1110.
Chumakov, K. M., Dragunsky, E. M., Norwood, L. P., Douthitt, M. P.,
Ran, Y., Taffs, R. E., Ridge, J. & Levenbook, I. S. (1994). Consistent
selection of mutations in the 59-untranslated region of oral poliovirus
vaccine upon passaging in vitro. J Med Virol 42, 79–85.
Conway Morris, S. (1998). The Crucible of Creation. The Burgess Shale
and the Rise of Animals. Oxford: Oxford University Press.
We thank N. Sevilla for insightful suggestions during the course of
this project, M. Dávila and A. I. de Avila for expert technical
assistance and J. C. de la Torre for supply of ribavirin. This work was
supported by grant BFU 2005-00863 from the Ministerio de
Educación y Ciencia (MEC) and by the Fundación R. Areces. M. H.
was supported by a pre-doctoral fellowship from the MEC, A. G.-P.
by a contract Ramón y Cajal and C. P. by an I3P contract from the
Consejo Superior de Investigaciones Cientı́ficas (CSIC), financed by
Fondo Social Europeo.
Couderc, T., Guedo, N., Calvez, V., Pelletier, I., Hogle, J., ColbereGarapin, F. & Blondel, B. (1994). Substitutions in the capsids of
poliovirus mutants selected in human neuroblastoma cells confer on
the Mahoney type 1 strain a phenotype neurovirulent in mice. J Virol
68, 8386–8391.
Couñago, R., Chen, S. & Shamoo, Y. (2006). In vivo molecular
evolution reveals biophysical origins of organismal fitness. Mol Cell
22, 441–449.
Cummings, P. J. & Rinaldo, C. R., Jr (1989). Coevolution of virulent
virus and resistant cells as a mechanism of persistence of herpes
simplex virus type 1 in a human T lymphoblastoid cell line. J Gen
Virol 70, 97–106.
REFERENCES
Ahmed, R. & Chen, S. Y. (editors) (1999). Persistent Viral Infections.
New York: Wiley.
Ahmed, R., Canning, W. M., Kauffman, R. S., Sharpe, A. H., Hallum,
J. V. & Fields, B. N. (1981). Role of the host cell in persistent viral
infection: coevolution of L cells and reovirus during persistent
infection. Cell 25, 325–332.
Airaksinen, A., Pariente, N., Menendez-Arias, L. & Domingo, E.
(2003). Curing of foot-and-mouth disease virus from persistently
242
Cunningham, L., Bowles, N. E., Lane, R. J., Dubowitz, V. & Archard,
L. C. (1990). Persistence of enteroviral RNA in chronic fatigue
syndrome is associated with the abnormal production of equal
amounts of positive and negative strands of enteroviral RNA. J Gen
Virol 71, 1399–1402.
de la Torre, J. C., Davila, M., Sobrino, F., Ortin, J. & Domingo, E.
(1985). Establishment of cell lines persistently infected with foot-and-
mouth disease virus. Virology 145, 24–35.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 15:47:32
Journal of General Virology 89
Coevolution of FMDV and host cells
de la Torre, J. C., Alarcón, B., Martı́nez-Salas, E., Carrasco, L. &
Domingo, E. (1987). Ribavirin cures cells of a persistent infection with
foot-and-mouth disease virus in vitro. J Virol 61, 233–235.
de la Torre, J. C., Martı́nez-Salas, E., Diez, J., Villaverde, A., Gebauer, F.,
Rocha, E., Dávila, M. & Domingo, E. (1988). Coevolution of cells and
Futuyma, D. J. & Slatkin, M. (editors) (1983). Coevolution.
Sunderland, MA: Sinauer Associates.
Garcı́a-Arriaza, J., Manrubia, S. C., Toja, M., Domingo, E. &
Escarmı́s, C. (2004). Evolutionary transition toward defective RNAs
that are infectious by complementation. J Virol 78, 11678–11685.
viruses in a persistent infection of foot-and-mouth disease virus in cell
culture. J Virol 62, 2050–2058.
Gould, S. J. (1989). Wonderful Life: The Burgess Shale and the Nature
de la Torre, J. C., Martı́nez-Salas, E., Dı́ez, J. & Domingo, E. (1989a).
Grande-Pérez, A., Gomez-Mariano, G., Lowenstein, P. R. &
Domingo, E. (2005). Mutagenesis-induced, large fitness variations
Extensive cell heterogeneity during persistent infection with foot-andmouth disease virus. J Virol 63, 59–63.
de la Torre, J. C., de la Luna, S., Diez, J. & Domingo, E. (1989b).
Resistance to foot-and-mouth disease virus mediated by trans-acting
cellular products. J Virol 63, 2385–2387.
de la Torre, J. C., Giachetti, C., Semler, B. L. & Holland, J. J. (1992).
High frequency of single-base transitions and extreme frequency of
precise multiple-base reversion mutations in poliovirus. Proc Natl
Acad Sci U S A 89, 2531–2535.
Delli Bovi, P., De Simone, V., Giordano, R. & Amati, P. (1984).
Polyomavirus growth and persistence in Friend erythroleukemic cells.
J Virol 49, 566–571.
Dermody, T. S., Nibert, M. L., Wetzel, J. D., Tong, X. & Fields, B. N.
(1993). Cells and viruses with mutations affecting viral entry are
of History. New York: W. W. Norton.
with an invariant arenavirus consensus genomic nucleotide sequence.
J Virol 79, 10451–10459.
Guinea, R. & Carrasco, L. (1990). Phospholipid biosynthesis and
poliovirus genome replication, two coupled phenomena. EMBO J 9,
2011–2016.
Herrera, M., Garcı́a-Arriaza, J., Pariente, N., Escarmı́s, C. &
Domingo, E. (2007). Molecular basis for a lack of correlation between
viral fitness and cell killing capacity. PLoS Pathog 3, e53.
Hohenadl, C., Klingel, K., Mertsching, J., Hofschneider, P. H. &
Kandolf, R. (1991). Strand-specific detection of enteroviral RNA
in myocardial tissue by in situ hybridization. Mol Cell Probes 5,
11–20.
Holguin, A. (1996). Variantes genéricos y fenotı́picos en cuasiespecies
selected during persistent infections of L cells with mammalian
reoviruses. J Virol 67, 2055–2063.
del virus de la fiebre aftosa y del virus de la inmunodeficiencia humana.
PhD thesis, Universidad Autónoma de Madrid, Spain (in Spanish).
Dı́ez, J., Dávila, M., Escarmı́s, C., Mateu, M. G., Dominguez, J., Pérez,
J. J., Giralt, E., Melero, J. A. & Domingo, E. (1990a). Unique amino
Holland, J. J., Kennedy, S. I. T., Semler, B. L., Jones, C. L., Roux, L. &
Grabau, E. A. (1980). Defective interfering RNA viruses and the host-
acid substitutions in the capsid proteins of foot-and-mouth disease
virus from a persistent infection in cell culture. J Virol 64, 5519–5528.
cell response. In Virus-host Interactions: Viral Invasion, Persistence,
and Disease (Comprehensive Virology, vol. 16), pp. 137–192. Edited by
H. Fraenkel-Conrat & R. R. Wagner. London: Plenum Press.
Dı́ez, J., Hofner, M., Domingo, E. & Donaldson, A. I. (1990b). Foot-
and-mouth disease virus strains isolated from persistently infected cell
cultures are attenuated for mice and cattle. Virus Res 18, 3–7.
Domingo, E., Biebricher, C., Eigen, M. & Holland, J. J. (2001).
Quasispecies and RNA Virus Evolution: Principles and Consequences.
Austin, TX: Landes Bioscience.
Drake, J. W. & Holland, J. J. (1999). Mutation rates among RNA
viruses. Proc Natl Acad Sci U S A 96, 13910–13913.
Eigen, M. (1992). Steps Towards Life. Oxford: Oxford University
Press.
Eigen, M. & Schuster, P. (1979). The Hypercycle. A Principle of
Natural Self-Organization. Berlin: Springer.
Escarmı́s, C., Dávila, M., Charpentier, N., Bracho, A., Moya, A. &
Domingo, E. (1996). Genetic lesions associated with Muller’s ratchet
in an RNA virus. J Mol Biol 264, 255–267.
Escarmı́s, C., Carrillo, E. C., Ferrer, M., Arriaza, J. F., Lopez, N., Tami, C.,
Verdaguer, N., Domingo, E. & Franze-Fernandez, M. T. (1998). Rapid
selection in modified BHK-21 cells of a foot-and-mouth disease virus
variant showing alterations in cell tropism. J Virol 72, 10171–10179.
Escarmı́s, C., Gomez-Mariano, G., Davila, M., Lazaro, E. & Domingo, E.
(2002). Resistance to extinction of low fitness virus subjected to plaque-
to-plaque transfers: diversification by mutation clustering. J Mol Biol
315, 647–661.
Fernández, P. & Solé, R. V. (2007). Neutral fitness landscapes in
Holland, J. J., Spindler, K., Horodyski, F., Grabau, E., Nichol, S. &
VandePol, S. (1982). Rapid evolution of RNA genomes. Science 215,
1577–1585.
Igarashi, A., Koo, R. & Stollar, V. (1977). Evolution and properties of
Aedes albopictus cell cultures persistently infected with sindbis virus.
Virology 82, 69–83.
Irurzun, A., Perez, L. & Carrasco, L. (1992). Involvement of
membrane traffic in the replication of poliovirus genomes: effects of
brefeldin A. Virology 191, 166–175.
Joyce, G. F. (2004). Directed evolution of nucleic acid enzymes. Annu
Rev Biochem 73, 791–836.
Komurian-Pradel, F., Perret, M., Deiman, B., Sodoyer, M., Lotteau, V.,
Paranhos-Baccala, G. & Andre, P. (2004). Strand specific quantitat-
ive real-time PCR to study replication of hepatitis C virus genome.
J Virol Methods 116, 103–106.
Lea, S., Hernández, J., Blakemore, W., Brocchi, E., Curry, S.,
Domingo, E., Fry, E., Abu-Ghazaleh, R., King, A. & other authors
(1994). The structure and antigenicity of a type C foot-and-mouth
disease virus. Structure 2, 123–139.
Lehman, N. (2004). Assessing the likelihood of recurrence during
RNA evolution in vitro. Artif Life 10, 1–22.
Lu, Z., Rezapkin, G. V., Douthitt, M. P., Run, Y., Asher, D. M.,
Levenbook, I. S. & Chumakov, K. M. (1996). Limited genetic changes
signalling networks. J R Soc Interface 4, 41–47.
in the Sabin 1 strain of poliovirus occurring in the central nervous
system of monkeys. J Gen Virol 77, 273–280.
Fontana, W. (2002). Modelling ‘evo-devo’ with RNA. Bioessays 24,
Mahy, B. W. (2005). Foot-and-mouth disease virus. Curr Top
1164–1177.
Microbiol Immunol 288, 1–8.
Fontana, W. & Schuster, P. (1998). Shaping space: the possible and
Martı́n Hernández, A. M., Carrillo, E. C., Sevilla, N. & Domingo, E.
(1994). Rapid cell variation can determine the establishment of a
the attainable in RNA genotype-phenotype mapping. J Theor Biol 194,
491–515.
persistent viral infection. Proc Natl Acad Sci U S A 91, 3705–3709.
Forterre, P. (2006). The origin of viruses and their possible roles in
Mateo, R. & Mateu, M. G. (2007). Deterministic, compensatory
major evolutionary transitions. Virus Res 117, 5–16.
mutational events in the capsid of foot-and-mouth disease virus in
http://vir.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 15:47:32
243
M. Herrera and others
response to the introduction of mutations found in viruses from
persistent infections. J Virol 81, 1879–1887.
Sáiz, J. C. & Domingo, E. (1996). Virulence as a positive trait in viral
persistence. J Virol 70, 6410–6413.
Mateu, M. G., Martı́nez, M. A., Rocha, E., Andreu, D., Parejo, J., Giralt, E.,
Sobrino, F. & Domingo, E. (1989). Implications of a quasispecies
Schuster, P. (1997). Genotypes with phenotypes: adventures in an
genome structure: effect of frequent, naturally occurring amino acid
substitutions on the antigenicity of foot-and-mouth disease virus. Proc
Natl Acad Sci U S A 86, 5883–5887.
Schuster, P. & Stadler, P. F. (1999). Nature and evolution of early
Mateu, M. G., Hernández, J., Martı́nez, M. A., Feigelstock, D., Lea, S.,
Pérez, J. J., Giralt, E., Stuart, D., Palma, E. L. & Domingo, E. (1994).
Antigenic heterogeneity of a foot-and-mouth disease virus serotype in
the field is mediated by very limited sequence variation at several
antigenic sites. J Virol 68, 1407–1417.
Mrukowicz, J. Z., Wetzel, J. D., Goral, M. I., Fogo, A. B., Wright, P. F. &
Dermody, T. S. (1998). Viruses and cells with mutations affecting viral
entry are selected during persistent rotavirus infections of MA104
cells. J Virol 72, 3088–3097.
Nathanson, N. & Gonzalez-Scarano, F. (2007). Viral persistence. In
RNA toy world. Biophys Chem 66, 75–110.
replicons. In Origin and Evolution of Viruses, pp. 1–24. Edited by
E. Domingo, R. G. Webster & J. J. Holland. San Diego: Academic
Press.
Sevilla, N. & Domingo, E. (1996). Evolution of a persistent
aphthovirus in cytolytic infections: partial reversion of phenotypic
traits accompanied by genetic diversification. J Virol 70, 6617–6624.
Sobrino, F. & Domingo, E. (2004). Foot-and-Mouth Disease: Current
Perspectives. Wymondham, UK: Horizon Bioscience.
Sobrino, F., Dávila, M., Ortı́n, J. & Domingo, E. (1983). Multiple
genetic variants arise in the course of replication of foot-and-mouth
disease virus in cell culture. Virology 128, 310–318.
by
Stoker, M. & MacPherson, I. (1964). Syrian hamster fibroblast cell
Novak, J. E. & Kirkegaard, K. (1991). Improved method for detecting
Takemoto, K. K. & Habel, K. (1959). Virus-cell relationship in a carrier
poliovirus negative strands used to demonstrate specificity of
positive-strand encapsidation and the ratio of positive to negative
strands in infected cells. J Virol 65, 3384–3387.
Tam, P. E. & Messner, R. P. (1999). Molecular mechanisms of
Viral Pathogenesis and Immunity, pp.
N. Nathanson. San Diego: Academic Press.
130–145.
Edited
Orgel, L. E. (2004). Prebiotic chemistry and the origin of the RNA
world. Crit Rev Biochem Mol Biol 39, 99–123.
Perales, C., Mateo, R., Mateu, M. G. & Domingo, E. (2007). Insights
into RNA virus mutant spectrum and lethal mutagenesis events:
replicative interference and complementation by multiple point
mutants. J Mol Biol 369, 985–1000.
line BHK21 and its derivatives. Nature 203, 1355–1357.
culture of HeLa cells and Coxsackie A9 virus. Virology 7, 28–44.
coxsackievirus persistence in chronic inflammatory myopathy: viral
RNA persists through formation of a double-stranded complex
without associated genomic mutations or evolution. J Virol 73,
10113–10121.
Toja, M., Escarmis, C. & Domingo, E. (1999). Genomic nucleotide
sequence of a foot-and-mouth disease virus clone and its persistent
derivatives. Implications for the evolution of viral quasispecies during
a persistent infection. Virus Res 64, 161–171.
Quer, J., Huerta, R., Novella, I. S., Tsimring, L., Domingo, E. &
Holland, J. J. (1996). Reproducible nonlinear population dynamics
van Nimwegen, E., Crutchfield, J. P. & Huynen, M. (1999). Neutral
and critical points during replicative competitions of RNA virus
quasispecies. J Mol Biol 264, 465–471.
evolution of mutational robustness. Proc Natl Acad Sci U S A 96,
9716–9720.
Quer, J., Hershey, C. L., Domingo, E., Holland, J. J. & Novella, I. S.
(2001). Contingent neutrality in competing viral populations. J Virol
Villarreal, L. P. (2005). Viruses and the Evolution of Life. Washington,
75, 7315–7320.
Wilke, C. O., Ronnewinkel, C. & Martinetz, T. (2001). Dynamic fitness
DC: American Society for Microbiology.
Ron, D. & Tal, J. (1985). Coevolution of cells and virus as a mechanism
landscapes in molecular evolution. Phys Rep 349, 395–446.
for the persistence of lymphotropic minute virus of mice in L-cells.
J Virol 55, 424–430.
Woolhouse, M. E., Webster, J. P., Domingo, E., Charlesworth, B. &
Levin, B. R. (2002). Biological and biomedical implications of the co-
Ron, D. & Tal, J. (1986). Spontaneous curing of a minute virus of mice
carrier state by selection of cells with an intracellular block of viral
replication. J Virol 58, 26–30.
Youngner, J. S. & Preble, O. (1980). Viral persistence: evolution of viral
evolution of pathogens and their hosts. Nat Genet 32, 569–577.
Disease Special Issue), 1.
populations. In Virus-host Interactions: Viral Invasion, Persistence, and
Disease (Comprehensive Virology, vol. 16), pp. 73–135. Edited by
H. Fraenkel-Conrat & R. R. Wagner. London: Plenum Press.
Ruiz-Jarabo, C. M., Miller, E., Gómez-Mariano, G. & Domingo, E.
(2003). Synchronous loss of quasispecies memory in parallel viral
Zhong, J., Gastaminza, P., Chung, J., Stamataki, Z., Isogawa, M.,
Cheng, G., McKeating, J. A. & Chisari, F. V. (2006). Persistent
lineages: a deterministic feature of viral quasispecies. J Mol Biol 333,
553–563.
hepatitis C virus infection in vitro: coevolution of virus and host.
J Virol 80, 11082–11093.
Rowlands, D. J. (2003). Preface. Virus Res 91 (Foot-and-Mouth
244
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 15:47:32
Journal of General Virology 89