DIABETES-INSULIN-GLUCAGON-GASTROINTESTINAL
Glucose Regulates Cyclin D2 Expression in Quiescent
and Replicating Pancreatic !-Cells Through Glycolysis
and Calcium Channels
Seth J. Salpeter, Agnes Klochendler, Noa Weinberg-Corem, Shay Porat,
Zvi Granot, A. M. James Shapiro, Mark A. Magnuson, Amir Eden,
Joseph Grimsby, Benjamin Glaser, and Yuval Dor
Department of Developmental Biology and Cancer Research (S.J.S., A.K., N.W.-C., S.P., Z.G., Y.D.), The
Institute for Medical Research Israel-Canada, and Endocrinology and Metabolism Service (B.G.),
Department of Internal Medicine, Hadassah-Hebrew University Medical Center, Jerusalem 91120, Israel;
Department of Cell and Developmental Biology (A.K., A.E.), Institute of Life Sciences, and Department of
Obstetrics and Gynecology (S.P.), Division of Obstetrics, Hadassah Medical Center, Hebrew University,
Jerusalem 91904, Israel; Department of Surgery and the Clinical Islet Transplant Program (A.M.J.S.),
University of Alberta, Edmonton, Alberta, Canada AB T6G 2M7; Department of Cell and Developmental
Biology (M.A.M.), Vanderbilt University School of Medicine, Nashville, Tennessee 37232; and
Department of Metabolic Diseases (J.G.), Hoffmann-La Roche, Nutley, New Jersey 07110
Understanding the molecular triggers of pancreatic !-cell proliferation may facilitate the development of regenerative therapies for diabetes. Genetic studies have demonstrated an important
role for cyclin D2 in !-cell proliferation and mass homeostasis, but its specific function in !-cell
division and mechanism of regulation remain unclear. Here, we report that cyclin D2 is present at
high levels in the nucleus of quiescent !-cells in vivo. The major regulator of cyclin D2 expression
is glucose, acting via glycolysis and calcium channels in the !-cell to control cyclin D2 mRNA levels.
Furthermore, cyclin D2 mRNA is down-regulated during S-G2-M phases of each !-cell division, via
a mechanism that is also affected by glucose metabolism. Thus, glucose metabolism maintains high
levels of nuclear cyclin D2 in quiescent !-cells and modulates the down-regulation of cyclin D2 in
replicating !-cells. These data challenge the standard model for regulation of cyclin D2 during the
cell division cycle and suggest cyclin D2 as a molecular link between glucose levels and !-cell
replication. (Endocrinology 152: 2589 –2598, 2011)
he uncovering of molecular mechanisms that regulate
organ size and their consequent harnessing is a major
goals of regenerative medicine. In the case of type 1 and
type 2 diabetes, diseases characterized by insufficient
numbers of insulin-producing !-cells, the therapeutic expansion of !-cell mass represents a novel strategy that
could potentially lead to a cure. We and others have recently shown that proliferation of differentiated !-cells,
rather than differentiation of stem cells, is the major mechanism responsible for the maintenance and regeneration of
postnatal !-cell mass, in rodents (1– 6) as well as in humans (7). Thus, the elucidation of the molecular mecha-
T
nisms regulating !-cell proliferation is key to understanding how !-cell mass is determined and to manipulating this
process.
When quiescent cells are stimulated by extracellular
mitogens, D-type cyclins and cyclin-dependent kinase
(CDK) proteins form activated nuclear complexes that
phosphorylate the retinoblastoma protein, causing the release of the E2F transcription factor and the initiation of
the gene expression program of DNA synthesis (8, 9). The
expression level of D-type cyclins is typically low in quiescent cells and is elevated by factors driving cell cycle
entry (9 –13). For example, cyclin D1 is a transcriptional
ISSN Print 0013-7227 ISSN Online 1945-7170
Printed in U.S.A.
Copyright © 2011 by The Endocrine Society
doi: 10.1210/en.2010-1372 Received November 29, 2010. Accepted April 7, 2011.
First Published Online April 26, 2011
Abbreviations: AKT, Serine-threonine kinase; BrdU, bromodeoxyuridine; CDK, cyclin-dependent kinase; DMSO, dimethylsulfoxide; FBS, fetal bovine serum; GCK, glucokinase;
GFP, green fluorescent protein; GKA, glucokinase activator; NFAT, nuclear factor of activated T cells; PCNA, proliferating cell nuclear antigen.
Endocrinology, July 2011, 152(7):2589 –2598
endo.endojournals.org
2589
2590
Salpeter et al.
Regulation of Cyclin D2 in Pancreatic !-Cells
target of nuclear factor "B (14), !-catenin (15), and activator protein-1 (16), whereas cyclin D2 is induced by FSH
(12), cAMP (17), Stat5 (18), and others. In the case of
pancreatic !-cells, genetic analyses have established that
cyclin D2 is a key factor in !-cell proliferation, during
normal postnatal life in the mouse (4, 19, 20) as well as
under conditions of insulin resistance (21). Furthermore,
studies in !-cells under specific conditions that enhance
!-cell proliferation, such as the transgenic expression of a
constitutively active !-catenin mutant (22), a constitutively active serine-threonine kinase (AKT) (23), a constitutively active nuclear factor of activated T cells (NFAT)
(24), glucose infusion (25), or exposure to prolactin and
GH (26), have suggested that an increase in the overall
levels of cyclin D2 may be responsible for cell cycle entry
of quiescent !-cells. A recent article has also suggested that
cyclin D2 may expand !-cell mass by preventing programmed cell death (27). Taken together, these studies
demonstrate that cyclin D2 is important for !-cell expansion and suggest that its up-regulation might be a key link
between extracellular mitogens and cell cycle entry.
Given the central role of cyclin D2 in the process of
!-cell replication, we set out to examine the regulation of
cyclin D2 expression in quiescent and replicating !-cells.
Here, we show that cyclin D2 is expressed at high levels in
the nucleus of almost all quiescent pancreatic !-cells. This
high basal expression level is maintained by glucose metabolism and calcium signaling in !-cells, which control
cyclin D2 mRNA levels. Lastly, we show that glucose metabolism also controls cyclin D2 levels during !-cell replication, causing down-regulation of cyclin D2 mRNA
and protein during S-G2-M phases of the cell division
cycle.
Materials and Methods
Immunofluorescence
Paraffin sections of the pancreas were prepared and stained as
described previously (2). The antibodies used in this study for
immunohistochemistry were: rabbit anticyclin D2 (1:1000;
Santa Cruz Biotechnology, Inc., Santa Cruz, CA), mouse anticyclin D2 (1:100; Neomarkers, Fremont, CA), mouse antiproliferating cell nuclear antigen (PCNA) (1:500; Dako, Glostrup,
Denmark), mouse anti-bromodeoxyuridine (BrdU) (1:300; Amersham/GE Healthcare, Princeton, NJ), and guinea pig antiinsulin (1:200; Dako). Antigen retrieval was performed using citrate buffer and a pressure cooker (Biocare, Concord, CA) for all
antibodies. All primary antibodies are left overnight in CasBlock (Zymed, San Francisco, CA). Secondary antibodies were
purchased from Jackson ImmunoResearch (West Grove, PA),
diluted 1:500 in PBS, and left for 1 h. Images were taken using a
Nikon i90 C1 confocal microscope (Nikon, Melville, NY).
Endocrinology, July 2011, 152(7):2589 –2598
Cell culture
Islets were isolated as previously described (28). After extraction, islet cultures were performed in RPMI 1640, 1%
serum, and with varying glucose concentrations for 20 h. Islet
lysate was then prepared by adding buffer A [20 mM Tris (pH
7.5), 5 mM EDTA, 4.45 mg/ml of Na4P2O7, and 1% Nonidet
P-40]. All cell culture experiments were performed at least
three times with consistent results unless otherwise noted in
the figure legend. Min-6 cells (passage 50 – 60) were cultured
in DMEM 1% fetal bovine serum (FBS) at varying glucose
concentration. Cadaveric human islets were obtained from
Edmonton (Canada) and cultured in RPMI with 1% heatinactivated FBS. Results were confirmed on two separate donors, each with at least n ! 3.
The following chemicals and their concentrations were used:
BayK8644, 60 #M (Sigma, St. Louis, MO); Verapamil, 10 or 30
#M (Sigma); cyclohexamide, 3 #M; insulin, 20 #M (Novo Nordisk, Bagsværd, Denmark); glucokinase (GCK) activator (GKA),
3 #M (Roche); and Arry-142886, 2 #M (Selleck, Houston, TX).
For in vitro experiments, BayK8644, Arry-142886, and GKA
were prepared in dimethylsulfoxide (DMSO).
Reverse transcription-polymerase chain reaction
The level of cyclin D2 mRNA was determined using a commercial TaqMan Probe (Applied Biosystems, Foster City, CA) and were
normalized to TATA-binding protein (Applied Biosystems). GCK
RT-PCR was performed using SYBR Green with the following sequences: forward, TGCTACTATGAAGACCGCCAAT and reverse, CTTCCACCAGCTCCACATTC at a working concentration of 10 pmol/#l. RNA of replicating islet cells was obtained by
sorting green fluorescent protein (GFP)" cells from dissociated islets of transgenic cyclin B1-GFP mice (Klochendlr, A., N. WeinbergCorem, A. Eden, and Y. Dor, unpublished observations), and values
were normalized to actin with the following sequences: forward,
CGCCATGGATGACGATATCG and reverse, CACATAGGAGTCCTTCTGAC. All experiments were performed on an Applied
Biosystems 7300 Real-Time PCR system.
Western blotting
Western blottings were performed using 10% acrylamide gels
and a miniprotein gel system (Bio-Rad, Hercules, CA). Primary
antibodies were blotted overnight, and secondary antibodies
(Dako) were hybridized for 1 h. Primary antibodies were used at
a concentration of 1:1000. In addition to antibodies described in
Immunofluorescence, the following antibodies were used for
Western blotting: rabbit anti-pAKT (Cell Signaling, Beverly,
MA), mouse antiactin (Sigma), rabbit anti-CDK4 (Santa Cruz
Biotechnology, Inc.), mouse anti-p16 (Santa Cruz Biotechnology, Inc.), rabbit anti-p18 (Santa Cruz Biotechnology, Inc.),
mouse anti-p27 (Santa Cruz Biotechnology, Inc.), mouse anticyclin D1 (Santa Cruz Biotechnology, Inc.), and rabbit anticyclin
D3 (Santa Cruz Biotechnology, Inc.). All Western blottings were
repeated at least three times unless otherwise noted in the figure
legend.
Mouse strains
All mice used in these experiments were male and on ICR
background. Sections of cyclin D2 heterzygous and wild-type
littermates, originally described by Sicinski et al. (12), were the
generous gifts of Anil Bhushan and Jake Kushner. Mice were
Endocrinology, July 2011, 152(7):2589 –2598
A
B
endo.endojournals.org
2591
Results
Cyclin D2 is present in the nucleus of
quiescent !-cells
D-type cyclin levels in some cell types decrease
significantly once they enter quiescence and increase again if and when they reenter the cell cycle
KO
(9 –13). We thus hypothesized that the expres1
Wk
sion pattern of cyclin D2 will identify the small
subpopulation of !-cells that undergo a transition from quiescence to replication within postInsulin Cyclin D2 DNA
Cyclin D2
Cyclin D2 DNA
Cyclin D2
natal islets. To test this idea, we stained paraffin
C
sections of mouse pancreas using an antibody
against cyclin D2. Surprisingly, in 1-wk-old mice,
we observed a strong nuclear signal in the ma1 Month
jority of !-cells (Fig. 1A), even though only 9% of
!-cells are cycling at this age (Supplemental Fig.
1, published on The Endocrine Society’s Journals
Online web site at http://endo.endojournals.org).
Cyclin D2
Cyclin D2 PCNA Insulin
Sections of the pancreas from 1-wk-old cyclin
D2#/# mice showed no signal in !-cells or in the
D
exocrine pancreas, verifying antibody specificity
(Fig. 1, A and B). We then examined the expres1 Month
sion of cyclin D2 in !-cells of 1-month-old mice.
As shown in Fig. 1C and Supplemental Fig. 1,
only approximately 7% of !-cells at this age stain
for the general proliferation marker PCNA.
Insulin Cyclin A BrdU
BrdU
Cyclin A
However, approximately 90% of !-cells in such
FIG. 1. Cyclin D2 is present in the nucleus of most !-cells in vivo. A,
mice contain cyclin D2 in their nucleus, indicatImmunostaining for cyclin D2 in the pancreas of 1-wk-old wild-type (WT) (top) and
ing that cyclin D2 is present in almost all quiescyclin D2#/# (KO) (bottom) mice. The absence of signal in mutant pancreas
indicates that nuclear staining in wild-type animals reflects true cyclin D2 protein. B,
cent !-cells. To validate this finding, we repeated
Immunostaining for cyclin D2 in acinar cells of 1-wk-old wild-type (top) and cyclin
the staining with a different cyclin D2 antibody
D2#/# (bottom) mice. As with islets, in the acinar, there is no cyclin D2 signal in the
and obtained identical results (Supplemental Fig.
knockout mouse. C, Costaining for cyclin D2 (red), the proliferation marker PCNA
2). We also examined the expression of cyclin A,
(blue), and insulin (green) in 1-month-old mice shows that cyclin D2 is present in the
nucleus of most !-cells, even though only a small fraction of the cells is proliferating.
a known marker of S-G2 phases of the cell cycle,
D, Costaining for cyclin A (red), BrdU (blue), and insulin (green) in 1-month-old mice
to verify our ability to detect a cell cycle phaseinjected with BrdU 2 h before killing, showing that only proliferating cells express
specific expression pattern. Costaining for cyclin
cyclin A.
A and BrdU in mice injected with BrdU 2 h before
implanted with Alzet 2001 pumps for 5 d containing 200 #l of
killing revealed that cyclin A is present, as expected, only in
600 #M insulin.
the nuclei of BrdU" !-cells (Fig. 1D). Lastly, given the
GKA (29) was diluted in 80% saline, 20% DMSO, and 1%
Tween 80 and injected ip at 0.04 mg/1!g body weight.
known age-related decline in !-cell proliferation, we examBayK8644 (Sigma-Aldrich, St. Louis, MO) was injected at 2
ined whether cyclin D2 levels decreased with age. Using both
mg/kg (30) in a suspension of 80% saline, 20% DMSO, and
immunohistochemistry and Western blot analysis, we found
1% Tween 80.
that there was no decrease in levels of cyclin D2 between 1The joint ethics committee (Institutional Animal Care and
and 6-month-old !-cells (Supplemental Fig. 3, A and B).
Use Committee) of the Hebrew University and Hadassah Medical Center approved the study protocol for animal welfare. The
Taken together, these results indicate that in contrast to the
Hebrew University is an Association for Assessment and Accredstandard model, the presence of abundant cyclin D2 in the
itation of Laboratory Animal Care International accredited
nucleus of !-cells is not a marker of proliferation.
WT
1
Wk
institute.
Analysis
All statistical values were computed using the Student’s t test.
A two-tailed distribution was used with two sample unequal
variance. Where needed, ANOVA was performed.
Cyclin D2 expression is controlled by glucose in
mouse and human !-cells
Previous studies have shown that an increase in glucose
yields an increase in cyclin D2 levels (25, 31). Other studies
2592
Salpeter et al.
Regulation of Cyclin D2 in Pancreatic !-Cells
Endocrinology, July 2011, 152(7):2589 –2598
Given the central role of glucose in !-cell
function
and proliferation, we hypothesized
10 mM 5 mM 0.5 mM
5 mM
2.5 mM
0.5 mM
Glucose:
that glucose is responsible for maintaining
Cyclin D1
basal levels of cyclin D2 in pancreatic !-cells.
First, we cultured both primary pancreatic isCyclin D2
lets and Min-6 insulinoma cells at different glucose concentrations for 20 h. Among numerCyclin D3
ous cell cycle markers examined, only the
expression of cyclin D2 significantly changed
CDK4
in response to glucose levels in the medium
(Fig. 2A). In both islets and Min-6 cells, cyclin
P27
D2 was gradually down-regulated as glucose
was lowered, ultimately dropping by approxP16
imately 50% between 10 and 1 mM glucose in
Min-6 cells and decreasing by 50% between 5
p18
and 0.5 mM in isolated mouse islets.
We next examined whether human islets are
Cyclin D2 Levels in Min-6 and Islets
subject
to a similar regulation. First, we per*
*
*
*
formed Western blot analysis comparing mouse
and human D-type cyclin levels in islets from
adults (8 months for mouse and 54 yr for human). For all cyclins, human cyclin levels were
lower than mouse cyclins, yet the proteins were
expressed (Fig. 2B). We then cultured cadaveric
10 mM
5 mM
0.5 mM 5 mM
2.5 mM 0.5 mM
human islets at 10 and 2.5 mM glucose for 48 h
Min-6
Islets
and examined whether their cyclin D2 was
B
Cyclin D1
Cyclin D2
Cyclin D3
Actin
down-regulated in low glucose. Similar to the
H (54 Y) M (8M)
H (54 Y) M (8M) H (54 Y) M (8M)
H
M
mouse results, we found that cyclin D2 was gradually down-regulated when the glucose concentration in the medium was lowered (Fig. 2C).
Cyclin D2 Levels in Cultured Human Islets
To confirm the connection between glucose
levels
and cyclin D2 in vivo, we made use of
10 mM 2.5 mM 10 mM 2.5 mM
C
Glucose
two mouse models where pancreatic !-cells
were
exposed to low levels of glucose. First, we
Cyclin D2
implanted insulin pumps in 1-month-old mice
for 3 d. After 24 h, blood glucose dropped to
Actin
approximately 50 mg/dl and was maintained
at this level for 48 h. When mice were killed and
FIG. 2. Cyclin D2 is down-regulated in response to low glucose in cultured mouse and
pancreas was stained for cyclin D2, we found
human islets. A, Western blottings of cell cycle markers in Min-6 cells and mouse islets
cultured in the indicated glucose concentrations. Only cyclin D2 was significantly reduced
a dramatic decrease in the levels of !-cell but
by glucose. Islets were cultured for 20 h after isolation. ANOVA yielded P $ 0.01 for
not acinar, cyclin D2 (Fig. 3A). To test whether
cyclin D2 difference in Min-6 and P $ 0.05 for cyclin D2 difference in islets. B, Expression
this result was connected to high systemic inof D-type cyclins in islets from an 8-month-old mouse (M) and a 54-yr-old human (H),
showing presence of all three proteins in both species. C, Reduced levels of cyclin D2 in
sulin levels released from the pumps, we made
human islets cultured for 48 h in low glucose. *, P $ 0.05.
use of another mouse model mirroring systemic hypoglycemia. Here, we crossed Pdxhave shown that both prolactin and human GH (26), as
well as !-catenin (22), calcineurin/NFAT (24), and AKT CreER mice (32), expressing a tamoxifen-dependent Cre
(23), are able to up-regulate !-cell cyclin D2 levels. How- recombinase in !-cells, with mice containing a floxed alever, although numerous factors have been shown to in- lele of GCK (33). At 1 month of age, these PdxCreER;
crease D2 levels, it is unclear which physiological factors GCK lox/lox mice were injected with three doses of 8 mg
actually maintain the high levels of cyclin D2 expression in of tamoxifen to delete GCK in !-cells. GCK deficiency in
normal !-cells. Indeed, a factor that correlates with the !-cells caused glucose levels to rise to 500 – 600 mg/dl, due
down-regulation of cyclin D2 has yet to be demonstrated. to reduced glycolysis in !-cells and consequently reduced
Min-6
Ratio to Normoglycemia
A
2.5
2
1.5
1
0.5
0
Islet Culture
Hypoglycemia
A
endo.endojournals.org
Normoglycemia
Endocrinology, July 2011, 152(7):2589 –2598
B
Insulin Cyclin D2 DNA
Cyclin D2
PdxCreEr
Gck lx/lx
-Tx
2593
ficiency of glycolysis within !-cells, cyclin D2 had been dramatically downregulated (Fig. 3B). Finally, to confirm
that cyclin D2 levels were directly regulated by GCK enzyme activity, we cultured mouse islets with a small molecule
GKA for 3 h (Fig. 3C) after an overnight
culture in 2.5 mM glucose. Here, we
found a 2-fold increase in the levels of
cyclin D2, establishing that cyclin D2 expression is directly controlled by GCK
activity.
These results demonstrate that systemic glucose maintains the high level of
basal cyclin D2, both in vitro and in vivo.
Moreover, they suggest that glucose controls cyclin D2 levels via GCK, glycolysis,
and ATP production. The down-regulation of cyclin D2 in !-cells but not in acinar cells suggests that the glucose-dependent regulation of cyclin D2 is !-cell
specific.
Relative Ratio
Glucose controls cyclin D2 levels
through a calcium-dependent
pathway
We next investigated the molecular
pathway
by which glucose controls !-cell
PdxCreEr
Gck lx/lx
cyclin D2 levels. Downstream of GCK
+Tx
and glycolysis, a major signaling pathway in !-cells involves membrane depolarization and calcium entry, leading to
Cyclin D2
Insulin Cyclin D2 DNA
glucose-stimulated insulin exocytosis.
Effect of Glucokinase Activation on
Furthermore, calcium was shown to have
Cyclin D2
important roles in !-cell replication (35).
2.5 mM 2.5 mM
C
Glucose
We therefore hypothesized that glucose
1.5
*
GKA
+
may control cyclin D2 via calcium entry.
1
Cyclin D2
To test this hypothesis, we cultured
0.5
mouse islets in normal (5 mM) and low
Actin
(0.5 mM) glucose for 20 h and then
0
treated the islets with the calcium channel
C
GKA
opener BayK8644 (60 #M) (30) for 3 h.
FIG. 3. Cyclin D2 is down-regulated in response to circulating hypoglycemia or reduced
glycolysis in vivo. Panel A, Cyclin D2 is down-regulated in !-cells of a hypoglycemic mouse
We then examined whether the low glu(blood glucose, %40 mg/dl), implanted with an insulin osmotic minipump for 5 d. Panel B,
cose-mediated decline in cyclin D2 was
Low levels of cyclin D2 in !-cells deficient for GCK. PDX1-CreER; GCK lox/lox mice were
rescued by BayK8644. Although cyclin
injected with tamoxifen at 1 month of age, to delete GCK in adult !-cells. After GCK
deletion, mice became diabetic (blood glucose, &500 mg/dl), due to defective glucose
D2 was down-regulated in response to
metabolism and insulin secretion. Panel C, GKA significantly increased cyclin D2 expression
lower glucose when vehicle was added,
when cultured with mouse islets for 3 h after overnight culture in 2.5 mM glucose and 1%
BayK8644-treated islets maintained norheat-inactivated FBS. C, Control. *, P $ 0.05.
mal cyclin D2 despite low glucose, indicating that calcium channel opening can
insulin secretion (34). After 1 wk, mice were killed, and
rescue
glucose-dependent
cyclin D2 down-regulation
pancreas was stained for cyclin D2. Here, under conditions of systemic hypoinsulinemia/hyperglycemia but de- (Fig. 4A).
2594
Salpeter et al.
A
Glucose
Regulation of Cyclin D2 in Pancreatic !-Cells
5 mM
0.5 mM
5 mM
0.5 mM
-
+
+
-
+ BayK8644 (60 uM)
Endocrinology, July 2011, 152(7):2589 –2598
20 h at 10 mM glucose and 1 mM glucose, after
which insulin was added to the culture for 3 h
(Supplemental Fig. 4A). Although insulin caused
increased phosphorylation of AKT, it did not upregulate cyclin D2 levels in low glucose. Next,
given that insulin is known to activate pERK signaling in !-cells (36), we examined whether inhibition of ERK signaling impacts cyclin D2 levels by culturing Min-6 with a the pERK inhibitor
Arry-142886 (Supplemental Fig. 4B). After 3 h of
culture, pERK was down-regulated, yet cyclin
D2 was not affected. Taken together, these results suggest that insulin signaling is not involved
in !-cell cyclin D2 regulation.
Cyclin D2
Actin
% of Control
*
Cultured Islets with BayK8644
*
1.2
1
0.8
0.6
0.4
0.2
0
5 mM
B
0.5 mM
Min-6 Culture
Glucose
Verapamil
5 mM +Bayk
0.5 mM +BayK
Islet Culture
10 mM
10 mM
5 mM
-
+
-
5 mM
+
Cyclin D2
% of Control
Actin
1.2
1
0.8
0.6
0.4
0.2
0
Ca+ Channel Inhibitor Lowers Cyclin D2
*
*
Control
Verapamil
Min-6
Control
Verapamil
Islets
FIG. 4. Glucose impacts cyclin D2 through calcium channels. A, Cyclin D2 downregulation in low glucose is prevented by forced membrane depolarization or
calcium entry. Mouse islets were cultured in the indicated glucose concentrations for
20 h, after which the calcium channel opener BayK8644 was added for 3 h. ANOVA
yielded P $ 0.01. B, The calcium channel blocker Verapamil reduces the level of
cyclin D2 in Min-6 cells cultured in 25 mM DMEM and in mouse islets cultured in 10
mM RPMI. Cells and islets were treated with Verapamil for 20 and 3 h, respectively.
*, P $ 0.05.
To further validate that calcium entry is responsible for
glucose maintenance of cyclin D2 levels, we used a calcium
channel blocker. When Verapamil was added to Min-6
cells (10 #M for 3 h) or to islets (30 #M for 20 h) under
conditions of normal glucose, cyclin D2 was dramatically
down-regulated (Fig. 4B). These results demonstrate that
glucose determines the basal levels of cyclin D2 in !-cells
via glycolysis, membrane depolarization, and voltagegated calcium channels.
Lastly, we examined the possibility that paracrine insulin
signaling downstream of calcium depolarization is the main
regulator of cyclin D2 levels. Min-6 cells were cultured for
Low glucose down-regulates cyclin D2
mRNA
Conflicting reports exist in the literature as
to whether cyclin D2 up-regulation in response
to glucose stimulus occurs at the mRNA (31) or
protein level (25). We examined the mRNA
levels of cyclin D2 using quantitative real-time
PCR and found a significant down-regulation
in mRNA levels in both Min-6 cells and islets
cultured in low glucose (Fig. 5A).
Previous reports have demonstrated that cyclin D2 protein has a short half-life of approximately 1 h in !-cells (27). To test whether glucose
controls cyclin D2 protein stability, we treated
islets with cyclohexamide to block protein synthesis and examined the rate of decay of cyclin
D2, reflecting its degradation rate. As previously
reported, cyclin D2 had a short half-life of approximately 1 h. However, the rate of decay did
not differ in islets cultured in normal or low glucose (Fig. 5B). These results suggest that hypoglycemia-dependent down-regulation of cyclin
D2 operates mostly at the mRNA level.
Cyclin D2 is down-regulated during
S-G2-M phases of the cell division cycle
via a glucose-dependent pathway
We noticed that a significant number of proliferating
!-cells did not stain for cyclin D2 (Fig. 1C). To examine
the dynamics of cyclin D2 during the cell division cycle in
!-cells, we costained sections of pancreata from 1-monthold mice for insulin, cyclin D2, and BrdU (injected 2 or 7 h
before killing). Only 30% of BrdU" !-cells expressed cyclin D2 at 2 h and 20% at 7 h, whereas 80% of nonreplicating, BrdU# !-cells stained positive for cyclin D2 (Fig.
6, A and B). These results agree with previous reports
showing down-regulation of D-type cyclins during
Endocrinology, July 2011, 152(7):2589 –2598
A
endo.endojournals.org
Cyclin D2 Transcript Levels
*
1.4
1.2
Percent of Normal
*
**
1
0.8
0.6
0.4
0.2
0
5 mM Islets
0.5 mM Islets
10 mM Min6
5 mM Min6
0.5 mM Min6
1
3
B
Hrs w/ CHX
Glucose
0
1
2
5 mM
5 mM
5 mM
3
0
2
5 mM 0.5 mM 0.5 mM 0.5 mM 0.5 mM
Cyclin D2
Actin
Degradation Rates of Cyclin D2
5 mM
0.5 mM
Ratio to Time 0
1.2
1
0.8
0.6
0.4
0.2
0
0
1
2
3
Hrs
FIG. 5. Glucose down-regulates cyclin D2 mRNA without affecting stability of cyclin
D2 protein. A, Cyclin D2 mRNA is significantly decreased in Min-6 cells and mouse
islets cultured for 20 h in low glucose. ANOVA yielded P $ 0.01. B, The rate of cyclin
D2 protein degradation is not affected by low glucose. Mouse islets were cultured
for 17 h at 5 and 0.5 mM glucose and yielding a down-regulation in cyclin D2
protein. Cyclohexamide (CHX) was then added and cyclin D2 levels were measured
at 0, 1, 2, and 3 h. Similar rate of degradation in high and low glucose indicates that
protein stability is not affected. *, P $ 0.05; **, P $ 0.01.
S-G2-M phases of the cell cycle in vitro (37, 38). We then
hypothesized that glucose signaling is involved in the
down-regulation of cyclin D2 in replicating !-cells. To test
this idea, we treated mice with a small molecule activator
of GCK (GKA) (29), which enforces an increased rate of
glycoysis specifically in !-cells. We injected mice with
BrdU, injected GKA 1 h later, and killed them 7 h after
GKA. Immunostaining revealed that although in vehicletreated mice only 30% of BrdU" !-cells were cyclin D2",
GKA treatment resulted in expression of cyclin D2 in over
60% of BrdU" !-cells (Fig. 6C). We next examined
whether calcium signaling is able to increase cyclin D2
levels during the S-G2-M phases of !-cell division. Similar
to the experiment with GKA, we injected mice with BrdU,
injected BayK8644 1 h later, and killed them after additional 7 h. Here, too, we found that approximately 60%
of BrdU" cells were cyclin D2" in BayK8644-treated
2595
mice, as opposed to 30% of BrdU" cells in
control mice. Thus, increased glucose metabolism via calcium entry can prevent the drop in
cyclin D2 in !-cells during S-G2-M phases of
the cell cycle (Fig. 6C).
To further study the basis for cyclin D2 downregulation during !-cell replication, we took advantage of a novel transgenic mouse strain that
we have recently generated. In these mice, replicating cells in the S-G2-M phases express GFP
and can be sorted live by flow cytometry for molecular analysis (Klochendler, A., N. WeinbergCorem, A. Eden, and Y. Dor, unpublished observations). Analysis of RNA extracted from
sorted islet cells showed that cyclin D1 and cyclin
D3 do not change during the cell cycle (data not
shown). However, cyclin D2 mRNA is downregulated during S-G2-M phases of the cell cycle
(Fig. 6D). Surprisingly, we found that the mRNA
of GCK was also down-regulated in replicating
islet cells (Fig. 6D). These results suggest that cyclin D2 mRNA (and protein) levels are reduced in
!-cells as they enter the S phase of the cell cycle.
They also suggest the provocative idea that the
basis for this phenomenon is a decrease in the
level of GCK in replicating !-cells, impacting a
signaling cascade as shown above for low extracellular glucose.
Discussion
We conclude that high levels of cyclin D2 in
quiescent pancreatic !-cells are maintained by
calcium entry downstream of GCK-mediated
glycolysis. Furthermore, in replicating !-cells,
cyclin D2 is down-regulated during S-G2-M phases of the
cell cycle, via a similar mechanism sensitive to glucose
metabolism. In both cases, regulation is exerted at the
mRNA level.
Cyclin D2 has been shown to be expressed at high levels
in pancreatic !-cells and to be important for !-cell replication, but how cyclin D2 expression is regulated has remained unclear. Although some reports have suggested
that cyclin D2 is found in the cytoplasm and is localized to
the nucleus upon replication (25, 27), others found that
cyclin D2 is localized in the nuclei of most !-cells (21).
Here, we have conclusively shown that cyclin D2 is constitutively localized in the nuclei of most !-cells.
Additionally, although several signaling pathways have
been shown to impact the level of cyclin D2 in !-cells (22–
24), the physiological mechanism accounting for the main-
2596
Salpeter et al.
Regulation of Cyclin D2 in Pancreatic !-Cells
Endocrinology, July 2011, 152(7):2589 –2598
levels. Moreover, we demonstrated that
!-cell calcium channels are responsible
for controlling the levels of cyclin D2,
downstream of glycolysis. Calcium channel openers are able to rescue cyclin D2
down-regulation in low glucose conditions, and calcium channel blockers are
able to lower the levels of !-cell cyclin D2
in high glucose. Our results also suggest
Insulin Cyclin D2 Brdu
Brdu
Cyclin D2
that paracrine or autocrine insulin signalB
% Cyclin D2+ Cells in Brdu- and Brdu+ Beta Cells
ing downstream of calcium influx are not
**
involved in cyclin D2 activation.
**
100
Previous studies have suggested that
80
!
-cell
cyclin D2 may be principally reg60
ulated by a posttranslational mecha40
20
nism (23, 25, 27). In contrast to these
0
reports, we show that glucose controls
Brdu 2hrs Brdu+
7 hrs Brdu+
!-cell cyclin D2 at the mRNA level,
with minimal evidence for glucose regC Effect of GKA and BayK8644 on Cyclin D2 expression in Brdu+ Cells
ulation at the protein level.
**
Interestingly, although cyclin D2 is
90
**
80
important
for !-cell proliferation, its
70
60
overexpression does not trigger !-cell
50
40
replication (27). Although it has been
30
suggested that glucose induces !-cell
20
10
replication via increased cyclin D2 lev0
BrduBrdu+
Brdu+ with GKA Brdu + with BayK8644
els, our results suggest that cyclin D2
down-regulation may be important in
Real Time PCR Cyclin D2 and Gck
D
the decline of !-cell proliferation in reExpression
sponse to hypoglycemia and decreased
1.4
1.2
intracellular calcium signaling. Further
1
studies are necessary to examine whether
0.8
0.6
overexpression of cyclin D2 can rescue the
0.4
decline of !-cell proliferation in response
0.2
to low glucose. Most importantly, it re0
GFP- GFP+
GFP GFP+
mains unknown what triggers the enCyclin D2
Glucokinase
try of quiescent !-cells into the cell
FIG. 6. Cyclin D2 is down-regulated in replicating !-cells via a glucose-sensitive mechanism.
division cycle. Our results argue that
A, Costaining for cyclin D2 and BrdU reveals that replicating !-cells, as well as replicating
acinar cells, do not express cyclin D2. Image is taken from a 1-month-old mouse, injected
in contrast to what has been sugwith BrdU 2 h before killing. B, Quantification of the fraction of cyclin D2" !-cells in BrdU#
gested, mitogen-induced induction of
!-cells in vivo and in BrdU" !-cells in mice injected with BrdU 2 or 7 h before killing. At least
cyclin D2 is unlikely to be the key trigthree animals with a minimum of 1500 !-cells (%75 Brdu" cells) were analyzed. ANOVA
ger for replication. Rather, cyclin D2
yielded P $ 0.01. C, Enhanced glucose metabolism and intracellular calcium prevents the
decrease in cyclin D2 in replicating !-cells. One-month-old mice were injected with BrdU 8 h
appears to have a permissive role; in
before killing. Seven hours before killing, mice were injected with a small molecule GKA and
other words, it is necessary but not
the calcium channel opener BayK8644. At least three animals with a minimum of 1500 !-cells
sufficient for !-cell replication. This
(%75 Brdu" cells) were analyzed. ANOVA yielded P $ 0.01. D, Islet cells during S-G2-M
phases of the cell cycle (GFP") show reduced levels of cyclin D2 and GCK mRNA.
conclusion is consistent with the findings of He et al. (27), that high levels
of cyclin D2 are not sufficient to drive
tenance of high levels of cyclin D2 remained unknown. We
show that !-cell glucose metabolism is responsible for the !-cell replication. We speculate that other components
basal level of cyclin D2 expression. Indeed, decreasing cir- of the cell cycle machinery are responsible for the rare
culating glucose levels in vivo and reducing glucose levels in mitogen-induced switch from quiescence to replication
vitro caused a dramatic down-regulation in !-cell cyclin D2 in !-cells. Interesting candidates for this key process
Relative Expression
% Cyclin D2+/Beta Cells
%Cyclin D2+/Beta Cells
A
Endocrinology, July 2011, 152(7):2589 –2598
may include the down-regulation of cyclin kinase inhibitors or the up-regulation of CDK4/6.
The significance of cyclin D2 down-regulation during
S-G2-M phases of the cell division cycle in !-cells remains
unclear. Replicating cells in the testes and ovaries showed
a similar dynamics, arguing that this is a general phenomenon (data not shown). At least in !-cells, it appears that
this process is triggered by reduced rate of glycolysis during the cell cycle, potentially due to decreased expression
of GCK mRNA. Further studies will be needed to characterize glucose metabolism during !-cell replication in
vivo, its impact on cyclin D2 expression, and the function
of cyclin D2 down-regulation during S-G2-M phases.
Although we demonstrate that glucose controls cyclin
D2 mRNA levels in !-cells via calcium channels, additional studies will be needed to determine the responsible
signaling pathway downstream of calcium. Notably, previous studies have shown that cyclin D2 in !-cells can be
controlled by calcineurin/NFAT signaling (24) as well as
STAT activity (26). Both of these pathways are likely activated by glycolysis via calcium in !-cells and thus could
represent a molecular link between blood glucose levels
and expression of !-cell cyclin D2.
endo.endojournals.org
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Acknowledgments
We thank Jake Kushner and Anil Bhushan for providing sections
of pancreata from cyclin D2#/# mice; Tatsuya Kin (Clinical Islet
Isolation Laboratory, the University of Alberta) for the preparation of human islets; and Tomer Nir, Michael Brandeis, Oded
Meyuhas, Ittai Ben-Porath, Robert Screaton, and Jens Nielsen
for discussions and for sharing reagents.
14.
15.
16.
Address all correspondence and requests for reprints to: Dr.
Yuval Dor. Department of Developmental Biology and Cancer
Research, The Institute for Medical Research Israel-Canada,
Hadassah-Hebrew University Medical Center, Jerusalem
91120, Israel. E-mail: [email protected].
This work was supported by National Institutes of Health
!-Cell Biology Consortium, Juvenile Diabetes Research Foundation, Israel Science Foundation, Israel Cancer Research Fund,
the European Union Seventh Framework Program Grant
241883, the Helmsley Foundation, and the Dutch friends of
Hebrew University.
Disclosure Summary: The authors have nothing to disclose.
21.
References
22.
1. Dor Y, Brown J, Martinez OI, Melton DA 2004 Adult pancreatic
!-cells are formed by self-duplication rather than stem-cell differentiation. Nature 429:41– 46
2. Nir T, Melton DA, Dor Y 2007 Recovery from diabetes in mice by
! cell regeneration. J Clin Invest 117:2553–2561
3. Teta M, Rankin MM, Long SY, Stein GM, Kushner JA 2007 Growth
17.
18.
19.
20.
23.
2597
and regeneration of adult ! cells does not involve specialized progenitors. Dev Cell 12:817– 826
Georgia S, Bhushan A 2004 ! Cell replication is the primary mechanism for maintaining postnatal ! cell mass. J Clin Invest 114:963–
968
Cano DA, Rulifson IC, Heiser PW, Swigart LB, Pelengaris S, German M, Evan GI, Bluestone JA, Hebrok M 2008 Regulated !-cell
regeneration in the adult mouse pancreas. Diabetes 57:958 –966
Salpeter SJ, Klein AM, Huangfu D, Grimsby J, Dor Y 2010 Glucose
and aging control the quiescence period that follows pancreatic ! cell
replication. Development 137:3205–3213
Meier JJ, Butler AE, Saisho Y, Monchamp T, Galasso R, Bhushan
A, Rizza RA, Butler PC 2008 !-Cell replication is the primary mechanism subserving the postnatal expansion of !-cell mass in humans.
Diabetes 57:1584 –1594
Sherr CJ, Roberts JM 1999 CDK inhibitors: positive and negative
regulators of G1-phase progression. Genes Dev 13:1501–1512
Sherr CJ, Roberts JM 2004 Living with or without cyclins and cyclindependent kinases. Genes Dev 18:2699 –2711
Matsushime H, Quelle DE, Shurtleff SA, Shibuya M, Sherr CJ, Kato
JY 1994 D-type cyclin-dependent kinase activity in mammalian
cells. Mol Cell Biol 14:2066 –2076
Matsushime H, Roussel MF, Ashmun RA, Sherr CJ 1991 Colonystimulating factor 1 regulates novel cyclins during the G1 phase of
the cell cycle. Cell 65:701–713
Sicinski P, Donaher JL, Geng Y, Parker SB, Gardner H, Park MY,
Robker RL, Richards JS, McGinnis LK, Biggers JD, Eppig JJ, Bronson RT, Elledge SJ, Weinberg RA 1996 Cyclin D2 is an FSH-responsive gene involved in gonadal cell proliferation and oncogenesis. Nature 384:470 – 474
Weber JD, Raben DM, Phillips PJ, Baldassare JJ 1997 Sustained
activation of extracellular-signal-regulated kinase 1 (ERK1) is required for the continued expression of cyclin D1 in G1 phase.
Biochem J 326(Pt 1):61– 68
Guttridge DC, Albanese C, Reuther JY, Pestell RG, Baldwin Jr AS
1999 NF-"B controls cell growth and differentiation through transcriptional regulation of cyclin D1. Mol Cell Biol 19:5785–5799
Shtutman M, Zhurinsky J, Simcha I, Albanese C, D’Amico M, Pestell R, Ben-Ze’ev A 1999 The cyclin D1 gene is a target of the
!-catenin/LEF-1 pathway. Proc Natl Acad Sci USA 96:5522–5527
Watanabe G, Howe A, Lee RJ, Albanese C, Shu IW, Karnezis AN,
Zon L, Kyriakis J, Rundell K, Pestell RG 1996 Induction of cyclin D1
by simian virus 40 small tumor antigen. Proc Natl Acad Sci USA
93:12861–12866
White PC, Shore AM, Clement M, McLaren J, Soeiro I, Lam EW,
Brennan P 2006 Regulation of cyclin D2 and the cyclin D2 promoter
by protein kinase A and CREB in lymphocytes. Oncogene 25:2170 –
2180
Martino A, Holmes 4th JH, Lord JD, Moon JJ, Nelson BH 2001
Stat5 and Sp1 regulate transcription of the cyclin D2 gene in response to IL-2. J Immunol 166:1723–1729
Kushner JA, Ciemerych MA, Sicinska E, Wartschow LM, Teta M,
Long SY, Sicinski P, White MF 2005 Cyclins D2 and D1 are essential
for postnatal pancreatic !-cell growth. Mol Cell Biol 25:3752–3762
Kushner JA 2006 !-Cell growth: an unusual paradigm of organogenesis that is cyclin D2/Cdk4 dependent. Cell Cycle 5:234 –237
Georgia S, Hinault C, Kawamori D, Hu J, Meyer J, Kanji M,
Bhushan A, Kulkarni RN 2010 Cyclin D2 is essential for the compensatory !-cell hyperplastic response to insulin resistance in rodents. Diabetes 59:987–996
Rulifson IC, Karnik SK, Heiser PW, Ten Berge D, Chen H, Gu X,
Taketo MM, Nusse R, Hebrok M, Kim SK 2007 Wnt signaling
regulates pancreatic ! cell proliferation. Proc Natl Acad Sci USA
104:6247– 6252
Fatrai S, Elghazi L, Balcazar N, Cras-Méneur C, Krits I, Kiyokawa
H, Bernal-Mizrachi E 2006 Akt induces !-cell proliferation by regulating cyclin D1, cyclin D2, and p21 levels and cyclin-dependent
kinase-4 activity. Diabetes 55:318 –325
2598
Salpeter et al.
Regulation of Cyclin D2 in Pancreatic !-Cells
24. Heit JJ, Apelqvist AA, Gu X, Winslow MM, Neilson JR, Crabtree
GR, Kim SK 2006 Calcineurin/NFAT signalling regulates pancreatic
!-cell growth and function. Nature 443:345–349
25. Alonso LC, Yokoe T, Zhang P, Scott DK, Kim SK, O’Donnell CP,
Garcia-Ocaña A 2007 Glucose infusion in mice: a new model to
induce !-cell replication. Diabetes 56:1792–1801
26. Friedrichsen BN, Richter HE, Hansen JA, Rhodes CJ, Nielsen JH,
Billestrup N, Møldrup A 2003 Signal transducer and activator of
transcription 5 activation is sufficient to drive transcriptional induction of cyclin D2 gene and proliferation of rat pancreatic !-cells.
Mol Endocrinol 17:945–958
27. He LM, Sartori DJ, Teta M, Opare-Addo LM, Rankin MM, Long
SY, Diehl JA, Kushner JA 2009 Cyclin D2 protein stability is regulated in pancreatic !-cells. Mol Endocrinol 23:1865–1875
28. Weinberg N, Ouziel-Yahalom L, Knoller S, Efrat S, Dor Y 2007
Lineage tracing evidence for in vitro dedifferentiation but rare proliferation of mouse pancreatic !-cells. Diabetes 56:1299 –1304
29. Grimsby J, Sarabu R, Corbett WL, Haynes NE, Bizzarro FT, Coffey
JW, Guertin KR, Hilliard DW, Kester RF, Mahaney PE, Marcus L,
Qi L, Spence CL, Tengi J, Magnuson MA, Chu CA, Dvorozniak
MT, Matschinsky FM, Grippo JF 2003 Allosteric activators of glucokinase: potential role in diabetes therapy. Science 301:370 –373
30. Bolger GT, Weissman BA, Skolnick P 1985 The behavioral effects
of the calcium agonist Bay K 8644 in the mouse: antagonism by the
calcium antagonist nifedipine. Naunyn Schmiedebergs Arch Pharmacol 328:373–377
31. Ohsugi M, Cras-Méneur C, Zhou Y, Warren W, Bernal-Mizrachi E,
Permutt MA 2004 Glucose and insulin treatment of insulinoma cells
Endocrinology, July 2011, 152(7):2589 –2598
32.
33.
34.
35.
36.
37.
38.
results in transcriptional regulation of a common set of genes. Diabetes 53:1496 –1508
Gu G, Dubauskaite J, Melton DA 2002 Direct evidence for the
pancreatic lineage: NGN3" cells are islet progenitors and are distinct from duct progenitors. Development 129:2447–2457
Postic C, Shiota M, Niswender KD, Jetton TL, Chen Y, Moates JM,
Shelton KD, Lindner J, Cherrington AD, Magnuson MA 1999 Dual
roles for glucokinase in glucose homeostasis as determined by liver
and pancreatic ! cell-specific gene knock-outs using Cre recombinase. J Biol Chem 274:305–315
Porat S, Weinberg-Corem N, Tornovsky-Babaey S, Schyr-BenHaroush R, Hija A, Stolovich-Rain M, Dadon D, Granot Z, BenHur V, White P, Girard CA, Karni R, Kaestner KH, Ashrcroft FM,
Magnuson MA, Saada A, Grimsby J, Glaser B, Dor Y 2011 Control
of pancreatic beta cell regeneration by glucose metabolism. Cell
Metab 13:440 – 449
Wang W, Walker JR, Wang X, Tremblay MS, Lee JW, Wu X,
Schultz PG 2009 Identification of small-molecule inducers of pancreatic !-cell expansion. Proc Natl Acad Sci USA 106:1427–1432
Beith JL, Alejandro EU, Johnson JD 2008 Insulin stimulates primary
!-cell proliferation via Raf-1 kinase. Endocrinology 149:2251–
2260
Baldin V, Lukas J, Marcote MJ, Pagano M, Draetta G 1993 Cyclin
D1 is a nuclear protein required for cell cycle progression in G1.
Genes Dev 7:812– 821
Lukas J, Pagano M, Staskova Z, Draetta G, Bartek J 1994 Cyclin D1
protein oscillates and is essential for cell cycle progression in human
tumour cell lines. Oncogene 9:707–718
Members receive
an email digest of endocrinology-related news
selected from thousands of sources.