TOXICOLOGICAL SCIENCES 102(2), 310–318 (2008)
doi:10.1093/toxsci/kfn004
Advance Access publication January 8, 2008
Cadmium, Vectorial Active Transport, and MT-3–Dependent Regulation
of Cadherin Expression in Human Proximal Tubular Cells
Chandra S. Bathula, Scott H. Garrett, Xu Dong Zhou, Mary Ann Sens, Donald A. Sens, and Seema Somji1
Department of Pathology, School of Medicine and Health Sciences, University of North Dakota, Grand Forks, North Dakota 58202
Received November 5, 2007; accepted December 31, 2007
Previous studies from this laboratory have implicated the expression of the third isoform of metallothionein (MT-3) in the
maintenance of proximal tubular vectorial active ion transport. It
was shown that HK-2 cells have no expression of MT-3 and do not
form domes in culture; whereas, the human proximal tubular
(HPT) cells and HK-2 cells stably transfected with MT-3 [HK2(MT-3)] form these structures. In the present study, this association was further explored by determining the effect of MT-3
expression on the expression of the E -, P -, N -, K -, and Kspcadherins. It was demonstrated that the HPT cells and HK-2(MT-3)
cells had significant elevations in the expression of messenger
RNA and protein for the E -, P -, and Ksp-cadherins compared
with that of the HK-2 cells transfected with the blank vector
[HK-2(blank vector)]. In contrast, the HK-2(blank vector) cells
had significantly elevated expression of N- and K-cadherin
compared with both the HPT and HK-2(MT-3) cell lines. These
patterns of cadherin expression provide strong evidence that
MT-3 might be involved in epithelial to mesenchymal transition
that is postulated to occur during several disease states and in
the mesenchymal to epithelial transition that occurs during
normal kidney morphogenesis. A final goal of the study was to
determine if Cd12 exposure influenced vectorial active transport
of the proximal tubular cells and if this might occur through
alterations in the expression of MT-3. It was shown that
exposure to Cd12 eliminated vectorial active transport by the
proximal tubular cell lines, but that Cd12 exposure did not
reduce the expression of the MT-3 protein. The study shows
that the level of MT-3 expression in HPT cells influences
transepithelial resistance and cadherin expression but does not
influence the Cd12-induced loss of vectorial active transport.
Key Words: active transport; proximal tubular; cadmium;
cadherins; tight junctions; metallothionein.
The third isoform of metallothionein (MT-3) was first
identified as a brain-specific MT possessing neuronal growth
inhibitory properties (Palmiter et al., 1992; Tsuji et al., 1992;
Uchida et al., 1991). Subsequent studies by this laboratory
1
To whom correspondence should be addressed at Department of
Pathology, School of Medicine and Health Sciences, University of North
Dakota, 501 N. Columbia Road, Grand Forks, ND 58202. Fax: (701) 777-3108.
E-mail: [email protected].
demonstrated that MT-3 was also expressed in the human
kidney (Garrett et al., 1999). A previous study by this laboratory has also shown that mortal cell cultures retaining properties of the human proximal tubular (HPT) cells have basal
expression of MT-3 messenger RNA (mRNA) and protein,
whereas, an HPV-immortalized model of HPT cells (HK-2)
have no basal expression of MT-3 (Kim et al., 2002). It is the
laboratory’s assumption that the HK-2 cells had lost the
expression of MT-3 due to immortalization by the E6/E7 genes
of HPV because it can be shown that MT-3 is expressed in the
human kidney in situ, and the expression is retained in mortal
cultures of HPT cells (Garrett et al., 1999). The failure of the
HK-2 cells to express MT-3 has allowed the laboratory to use
a stable transfection strategy to determine the effects
reintroduction of MT-3 expression has on the properties of
the HK-2 cell line. This strategy was used successfully to
demonstrate that MT-3 was involved in the ability of the
proximal tubular cell to maintain vectorial active transport
(Kim et al., 2002). In this study, it was shown that HPT cell
cultures form ‘‘domes’’ whereas HK-2 cells do not form these
structures (Kim et al., 2002). Domes are a hallmark of cell
cultures derived from transporting epithelium that retain the
in situ property of vectorial active transport. In this study, it was
demonstrated that stable transfection of the HK-2 cells with
MT-3, but not MT-1E, re-established dome formation by the
HK-2 cells and enhanced the epithelial appearance of the cell
monolayer. Dome formation in epithelial cell cultures is
acceptable presumptive evidence of the following processes
that are required for its expression: functional plasma membrane
polarization, formation of occluding junctions (tight junctions),
and vectorial transepithelial active ion transport. Each of these
properties has been demonstrated for the HPT cells (Sens et al.,
1999). The HK-2 cells have been shown to have two of these
requirements, but functional tight junctions have not been
identified in this cell line (Ryan et al., 1994). As such, the first
goal of the present study was to determine if MT-3
expression mediates the formation of tight junctions between
HK-2 cells. A second goal was to determine if MT-3 influenced
the expression of the cadherins and related proteins known to be
involved in the formation and maintenance of tight junctions, as
well as in the mesenchymal to epithelial transition (MET) that
Ó The Author 2008. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved.
For Permissions, please email: [email protected]
311
REGULATION OF CADHERIN EXPRESSION BY MT-3
occurs during kidney morphogenesis (Peinado et al., 2004). A
final goal of the study was to determine if Cdþ2 exposure
influenced vectorial active transport of the proximal tubular
cells and if this might occur through alterations in the
expression of MT-3.
MATERIALS AND METHODS
Cell culture. Stock cultures of HPT and HK-2 cells for use in experimental
protocols were grown using serum-free conditions as previously described by
this laboratory (Detrisac et al., 1984; Kim et al., 2002). The growth formulation
consisted of a 1:1 mixture of Dulbecco’s modified Eagles’ medium and Ham’s
F-12 growth medium supplemented with selenium (5 ng/ml), insulin (5 lg/ml),
transferrin (5 lg/ml), hydrocortisone (36 ng/ml), triiodothyronine (4 pg/ml),
and epidermal growth factor (10 ng/ml). The cells were fed fresh growth
medium every 3 days, and at confluence, the cells were subcultured using
trypsin–ethylenediaminetetraacetic acid (0.05%, 0.02%). The procedures for
the stable transfection of the HK-2 cells with the MT-3 and MT-1E coding
sequences under the control of the CMV promoter have been detailed
previously (Kim et al., 2002; Somji et al., 2004). For use in experimental
protocols, cells were subcultured at a 1:2 (HPT) and a 1:4 (HK-2) ratio, allowed
to reach confluence (9 days following subculture) and then used in the
described experimental protocols. HK-2 cells stably transfected with MT-3 and
MT-1E coding sequences are designated as HK-2(MT-3) and HK-2(MT-1E)
respectively, whereas those transfected with the blank vector are designated as
HK-2(blank vector).
siRNA-mediated gene silencing. The small interfering RNA (siRNA)
sequences used for MT-3 silencing, and the protocol used for transfection of the
HPT cells, have been described previously (Somji et al., 2006). The sequences
chosen to target reside far down the 3# untranslated region of the MT-3 mRNA.
The siRNAs were transfected into HPT cells using the Amaxa Nucleofector
apparatus with the Basic Nucleofection Kit for Primary Mammalian Epithelial
cells (Amaxa, Cologne, Germany). Dome formation and MT-3 mRNA levels
were determined 5 days after the cells had reached confluency by point
counting the number of domes in 20 low power microscopic fields and by realtime PCR, respectively.
Measurement of transepithelial resistance. HK-2(MT-3) cells were
seeded at a 2:1 ratio in triplicate onto 30-mm-diameter cellulose ester
membrane inserts (Corning) placed in six-well trays. For HPT cells, these filters
were coated with collagen I similar to that reported previously (Sens et al.,
1999). Beginning on the third day postseeding, transepithelial resistance (TER)
was measured every other day with the EVOM Epithelial Voltohmmeter
(World Precision Instruments, Sarasota, FL) with a STX2 electrode set according to the manufactures instructions. This instrument measures the resistance to an alternating current flow through the filter containing the monolayer
of cells. The resistance of the bare filter containing medium was subtracted
from that obtained from filters containing cell monolayers. Two sets of four
readings were taken at two different locations on each filter. The development
of the monolayer in parallel six-well trays was monitored for dome formation.
Development of resistance routinely occurred 4-7 days postseeding in the MT-3
expressing HK-2 or HPT cells and generally correlated to the appearance of
domes viewed in parallel cultures. The experiment was repeated twice in
triplicate and the final result is reported as the mean ± SE.
Real-time analysis of MT-3 and cadherin mRNA expression. The
measurement of MT-3 mRNA expression was assessed with real-time reverse
transcription PCR (RT-PCR) utilizing previously described MT-3 isoformspecific primers (Somji et al., 2006). The measurement of N-cadherin,
E-cadherin, P-cadherin, K-cadherin, and Ksp-cadherin was also assessed using
real-time RT-PCR and commercially available primers (Qiagen Company,
Valencia, CA). The method for the preparation of total RNA using Tri Reagent
(Molecular Research Center, Inc., Cincinnati, OH) has been described pre-
viously (Garrett et al., 1998). For analysis, 1 lg of total RNA was subjected to
complimentary DNA (cDNA) synthesis using the iScript cDNA synthesis kit
(Bio-Rad Laboratories, Hercules CA) in a total volume of 20 ll. Real-time PCR
was performed utilizing the SYBR Green kit (Bio-Rad Laboratories) with 2 ll
of cDNA, 0.2lM primers in a total volume of 20 ll in an iCycler iQ real-time
detection system (Bio-Rad Laboratories). For MT-3, amplification was monitored by SYBR Green fluorescence and compared with that of a standard curve
of the MT-3 isoform gene cloned into pcDNA3.1/hygro (þ) and linearized with
FspI. Cycling parameters consisted of denaturation at 95°C for 30 s and
annealing at 65°C for 45 s, which gave optimal amplification efficiency of each
standard. The level of MT-3 expression was normalized to that of
glyceraldehyde-3-phosphate dehydrogenase (G3PDH) assessed by the same
assay with the primer sequences being sense: TCCTCTGACTTCAACAGCGACAC and antisense: CACCCTGTTGCTGTAGCCAAATTC with a product
size of 126 base pairs. For the cadherins, amplification was monitored by
SYBR Green fluorescence. Cycling parameters consisted of denaturation at
95°C for 15 s, annealing at 55°C for 30 s and extension at 72°C for 30 s, which
gave optimal amplification efficiency of each cadherin isoform. The level of
cadherin expression was compared with that of G3PDH using the primer
sequence described above. The relative level of each cadherin gene was interpolated from a standard curve of one RNA sample (HK-2 [MT-3] except in
case of E-cadherin where one sample of HPT was used instead) prepared by
serially diluting the cDNA reaction. G3PDH was used for normalization and
each cell line was analyzed as the mean ± SE of three parallel cell culture
samples.
MT protein determination. The immunoblot protocol used for the
determination of the levels of MT-3 protein in cell lysates has been described
previously by this laboratory (Garrett et al., 1999).
Western analysis of cadherin expression. Confluent cultures were
harvested in 2% sodium dodecyl sulfate (SDS) and 50mM Tris–HCl, pH 6.8,
followed by boiling for 10 min and DNA shearing through a 23-gauge needle.
Protein concentration was determined by the bicinchoninic acid protein assay
(Pierce Chemical, Rockford, IL) before 100mM dithiotreitol was added to each
sample. Twenty micrograms of total cellular protein was separated on an SDS–
polyacrylamide gel electrophoresis gel and transferred to a hybond-P
Polyvinylidene difluoride membrane (Amersham Biosciences, UK). Membranes
were blocked in antibody dilution buffer (Tris-buffered saline containing 0.1%
Tween-20 [TBS-T] and 5% [wt/vol] nonfat dry milk) for 1 h at room
temperature. After blocking, the membranes were probed with the appropriate
primary antibody in blocking buffer: N-cadherin, 0.5 lg/ml (Zymed Laboratories, San Francisco, CA); E-cadherin, 1:250 (Santa Cruz Biotechnology, Santa
Cruz, CA); P-cadherin 1:250 (Santa Cruz Biotechnology); K-cadherin, 1:250
(Abcam, Cambridge, MA); and Ksp-cadherin, 1 lg/ml (Zymed Laboratories)
overnight. After washing three times in TBS-T, membranes were incubated with
the appropriate antimouse or anti-rabbit antibody (1:2000) in antibody dilution
buffer for one h. The blots were visualized using the Phototope-HRP Western
blot detection system (Cell Signaling Technology, Beverly, MA).
Statistical analysis. All experiments were performed in triplicate and the
results are expressed as the standard error of the mean. Statistical analyses were
performed using Systat software using separate variance t-tests, analysis of
variance with Tukey post hoc testing. Unless otherwise stated, the level of
significance was p < 0.05.
RESULTS
Inhibition of MT-3 Expression Reduces Dome Formation by
HPT Cells
The laboratory has previously shown that the reintroduction
of MT-3 by stable transfection into HK-2 cells induced dome
formation, but it had not been determined if a reduction of
312
BATHULA ET AL.
MT-3 expression would inhibit dome formation in HPT cells.
The goal of this determination was to perform this corollary
experiment and determine if the inhibition of MT-3 expression
would reduce dome formation by the HPT cells. Inhibition of
MT-3 was achieved using siRNA directed against the 3# nontranslated region of the MT-3 gene. Anti-laminin siRNA was
used as a control. The HPT cells were allowed to attain
confluency and then removed from the culture dish by trypsin
treatment and siRNA introduced by electroporation. The
treated cells were then replated at confluency and dome
formation monitored using an inverted microscope over a 7-day
period. Preliminary studies demonstrated that dome formation
reached a peak by day 4 for all treatment groups and remained
at this level for 3 additional days. At day 5, the number of
domes was determined by point counting of 20 low power
microscopic fields for each well. Following the determination
of the number of domes, the cultures were used for the isolation
of total RNA. The results demonstrated that expression of MT-3
isoform-specific mRNA was reduced 2.5-fold by anti-MT-3
siRNA treatment (Fig. 1A). The control which used anti-lamin
siRNA had no effect on the expression of MT-3 mRNA. It was
also shown that dome formation was reduced 3.0 fold by anti
MT-3 siRNA and that control siRNA had no effect on dome
formation (Fig. 1B). This experiment was made possible by the
fact that siRNA can remain effective for up to three weeks in
nondividing cells (Bartlett and Davis, 2006).
TER of HK-2(blank vector), HK-2(MT-3), HK-2(MT-1E), and
HPT Cells
The TER was determined on confluent cultures of HPT cells,
HK-2 cells transfected with the blank vector and HK-2 cells
transfected with the MT-3 and MT-1E coding sequences. The
results demonstrated that both the HPT cells and the HK2(MT-3) cells displayed TERs of 480 and 572 Ohmscm2,
respectively (Table 1). In contrast, HK-2(blank vector) and
HK-2(MT-1E) cells displayed markedly reduced values of
TER that were not significantly different from those obtained
using a filter with no cells (Table 1).
Cadherin mRNA Expression by HPT, HK-2(blank vector),
and HK-2(MT-3) Cells
Five cadherin family members were analyzed for mRNA
expression using real-time PCR and total RNA from confluent
cultures of the HPT, HK-2(blank vector), and HK-2(MT-3) cell
lines; N-cadherin, E-cadherin, P-cadherin, K-cadherin, and
Ksp-cadherin. The expression of mRNA for N-cadherin was
near the limit of detection for both the HPT and HK-2(MT-3)
cell lines (Fig. 2A); however, the HK-2(blank vector) cells
exhibited markedly increased levels of N-cadherin mRNA
compared with either the HPT or HK-2(MT-3) cells (Fig. 2A).
In contrast, the expression of E-cadherin mRNA was near the
limit of detection for HK-2(blank vector) cells (Fig. 2B). The
expression of E-cadherin mRNA was significantly increased in
FIG. 1. Inhibition of MT-3 mRNA expression reduces dome formation.
HPT cells were subjected to siRNA treatment by electroporation, seeded, and
allowed to attain confluency and form domes. Anti-lamin siRNA was used as
a control. On day 5 after plating, the number of domes was assessed in each
well; the cells were then harvested for RNA and assessed for MT-3 expression
by real-time PCR. (A) Domes per microscopic field (103 objective) measured
in triplicate wells. (B) Expression of MT-3 in transcripts of MT-3 per
transcripts of G3PDH. *Statistically significant ( p < 0.05) compared with no
siRNA based on the separate variant t-test.
the HK-2(MT-3) cells compared with the HK-2(blank vector)
cells, but significantly below the levels noted in HPT cells (Fig.
2B). The E-cadherin mRNA expression in HPT cells was
significantly elevated compared with both HK-2(blank vector)
cells and the HK-2(MT-3) cells (Fig. 2B). The expression
TABLE 1
TER of HPT, HK-2(Blank vector), HK-2(MT-3), and
HK-2(MT-1E) Cells
Cell type
HPT
HK-2 blank vector
HK-2(MT-3)
HK-2(MT-1E)
Resistance (Ohmscm2)a
480
46
572
38
±
±
±
±
19
19
42
17
Note. Values on days 3, 4, 6, 7 for each cell type were similar and not
significantly different from each other.
a
Values are for cells 5 days postconfluence.
REGULATION OF CADHERIN EXPRESSION BY MT-3
313
FIG. 2. Cadherin mRNA expression by HPT, HK-2(blank vector), and HK-2(MT-3) cells. Confluent cultures of HPT, HK-2(blank vector), and HK-2(MT-3)
were harvested for total RNA and assessed for expression of (A) N-cadherin, (B) E-cadherin, (C) P-cadherin, (D) K-cadherin, and (E) Ksp-cadherin by real-time
PCR analysis. Messenger RNA levels were calculated relative to one RNA sample of HK-2(MT-3) for all cadherins except for E-cadherin in which one RNA
sample of HPT was used as the standard for comparison. All relative levels were normalized to G3PDH as described in ‘‘Materials and Methods.’’ Statistically
significant ( p < 0.05) compared with HK-2(MT-3) and HPT (*); to blank vector and HPT (**); and compared with HK-2(blank vector) and HK-2(MT-3) (#).
pattern of P-cadherin was similar to that of E-cadherin, being
found at a very low level in HK-2(blank vector) cells, and
significantly elevated level in both HPT and HK-2(MT-3) cells,
with expression in HPT cells being significantly higher than
either that of the HK-2(blank vector) or HK-2(MT-3) cells
(Fig. 2C). The expression of K-cadherin was significantly
elevated in HK-2(blank vector) cells compared with both the
HPT and HK-2(MT-3) cells (Fig. 2D). The expression of
K-cadherin was similar between the HPT and HK-2(MT-3)
cells. The expression of Ksp-cadherin was significantly
elevated in HK-2(MT-3) cells compared with both HK-2(blank
vector) and HPT cells (Fig. 2E). The expression of Kspcadherin in HPT cells was significantly reduced compared with
the HK-2(MT-3) cells and significantly elevated compared with
HK-2(blank vector) cells.
Cadherin Protein Expression by HPT, HK-2(blank vector),
and HK-2(MT-3) Cells
The above five cadherin family members were also analyzed
for protein expression by western analysis of protein lysates
prepared from confluent cultures of HPT, HK-2(blank vector),
and HK-2(MT-3) cells. The level of N-cadherin protein was
shown to be markedly elevated in the HK-2(blank vector) cells
compared with both HPT and HK-2(MT-3) cells (Fig. 3A). In
contrast, both E-cadherin and P-cadherin protein levels were
shown to be markedly elevated in the HPT and HK-2(MT-3)
cells compared with the HK-2(blank vector) cells (Figs. 3B and
3C). The level of K-cadherin protein was elevated in the HK2(blank vector) cells compared with both the HPT cells and the
HK-2(MT-3) cells (Fig. 3D). It was also demonstrated that
314
BATHULA ET AL.
and subcultured 4 days after reaching confluency. The
number of domes and light microscopic pictures of the
monolayers were determined the day of subculture, or for the
final passage, the day the cells would have been normally
subcultured to new flasks. The results showed that exposure
to 0.45lM Cdþ2 had no effect on the ability of the HK2(MT-3) cells to form domes for the initial three subcultures,
but caused a complete loss of dome formation of the fourth
passage (Table 2). The HK-2(MT-3) cells exposed to 0.9lM
Cdþ2 exhibited reduced dome formation during the initial
exposure to Cdþ2 and no dome formation at subsequent
passages (Table 2). The TER of the HK-2(MT-3) monolayers
exposed to Cdþ2 paralleled the degree of dome formation
(Table 2). Cultures having few or no domes displayed
reduced or no TER compared with control cells and those
displaying domes had resistance values in the range of 500
Ohmscm2 similar to control cells (Table 2). The light level
morphology of the cells was recorded at the end point of
passages 1 and 4 for the control cells and those exposed to
0.45 and 0.9lM Cdþ2 (Figs. 4A-F). The light micrographs
show that the reduction in dome formation due to Cdþ2
exposure occurred even though the cells were at confluency
and had no evidence of any loss in cell viability (i.e., rounded
or floating cells). The only alteration in light level
morphology was that the cells on the highest level of Cdþ2
at passage 4 (Fig. 4F) appear to form a cell monolayer that is
less tightly packed than control cells or Cdþ2-treated cells
able to form domes.
FIG. 3. Cadherin protein expression by HPT, HK-2(blank vector), and
HK-2(MT-3) cells. Confluent cultures of HPT, HK-2(blank vector), and HK2(MT-3) were harvested in SDS-Tris buffer for total protein. Western analysis
was performed on SDS PAGE gels containing 20 lg of total cellular protein per
sample. Shown are the gel bands developed chemiluminescently for (A) Ncadherin, (B) E-cadherin, (C) P-cadherin, (D) K-cadherin, and (E) Kspcadherin. Blots were also probed for actin to correct for protein loading (F).
K-cadherin levels were elevated in HK-2(MT-3) cells compared with that found in the HPT cells. There was clear
expression of Ksp-cadherin in all three cell lines with the HK2(MT-3) cells having a higher level of expression than the
HK-2(blank vector) or HPT cells (Fig. 3E).
Effect of Cdþ2 Exposure on the Expression of MT-3 in
HK-2(MT-3) Cells
Total RNA and protein were prepared from the HK-2(MT-3)
cells exposed to 0.45 and 0.9lM Cdþ2 over the four passage
time course described above for the examination of dome formation and TER. An analysis of MT-3 mRNA expression
demonstrated that exposure to Cdþ2 had no consistent effect on
the expression of MT-3 mRNA (Figs. 5A–C). For cells at
passage 1 (P1), the MT-3 mRNA levels were not significantly
different between control and Cdþ2 exposed cells (Fig. 5A).
Effect of Cdþ2 Exposure on HK-2(MT-3) Dome Formation
and TER
The HK-2(MT-3) cells were exposed to a nontoxic dose of
Cdþ2 to determine if exposure would have an effect on dome
formation and TER of the cells. The cells were exposed to
0.45 and 0.90lM Cdþ2 for four serial passages. The cells
were fed fresh growth medium containing Cdþ2 every 3 days
TABLE 2
Dome Formation and TER for Cd12 Exposed HK-2(MT-3) Cells
0.45lM Cdþ2
Control
Passage number
1
2
3
4
Domes
9.0
7.4
9.3
8.7
±
±
±
±
0.8
0.6
0.3
1.4
TER
529
495
510
493
±
±
±
±
78
87
36
23
Note. *Statistically significantly decreased from control p < 0.05.
0.9lM Cdþ2
Domes
TER
Domes
TER
±
±
±
±
520 ± 58
503 ± 47
135 ± 25*
0
6.0 ± 0.5*
1.8 ± 0.1*
0.3 ± 0.01*
0
120 ± 21*
0
0
0
11.3
10.0
8.2
0.1
0.7
1.2
1.5
0.1*
REGULATION OF CADHERIN EXPRESSION BY MT-3
315
cells at passage 4 (P4), MT-3 mRNA was significantly increased for cells exposed to 0.9lM Cdþ2 (Fig. 5D). A
corresponding analysis of MT-3 protein expression showed
no significant differences in expression at any of the four
passages or Cdþ2 concentrations, with expression varying
between 5.10 and 7.16 ng MT-3 protein/lg total protein (data
not shown).
Effect of Cdþ2 Exposure on Dome Formation, TER, and the
Expression of MT-3 in HPT Cells
FIG. 4. Light level morphology of HK-2(MT-3) cells. Cells were cultured
with 0.45 or 0.9lM Cdþ2 for four passages, and dome formation was
monitored after the first passage (P1) (A, B, and C) and the fourth passage (P4)
(D, E, and F). (A and D) Untreated cells. (B and E) Cells cultured in 0.45lM
Cdþ2. (C and F) Cells cultured in 0.9lM Cdþ2. Arrows designate the presence
of domes (original magnification 1003).
For cells at passage 2 (P2), MT-3 mRNA was significantly
elevated in cells exposed to 0.9lM Cdþ2 (Fig. 5B). For cells at
passage 3 (P3), MT-3 mRNA was reduced significantly for
cells exposed to both concentrations of Cdþ2 (Fig. 5C). For
Previous studies from this laboratory have shown that the
level of MT-3 mRNA and protein in HPT cells is transiently
induced by exposure to Cdþ2 with a return to control values
over a 16-day period of exposure (Garrett et al., 2002). In
the present experiment, the goal was to determine if a similar
exposure of the HPT cells to Cdþ2 resulted in a loss of dome
formation and TER without any alteration in the level of
MT-3 mRNA and protein expression. The number of domes
and the TER was determined following 7 days of exposure
to 1.0, 4.5, or 9.0lM Cdþ2. The results showed that the
number of domes formed by the HPT cells was reduced
compared with control for all three concentrations of Cdþ2
(Fig. 6). The TER was also reduced compared with control
for all three concentrations of Cdþ2 (Fig. 6). A corresponding analysis of MT-3 mRNA and protein expression
confirmed the previous study which showed no reduction
in MT-3 mRNA and protein expression compared with
control over a 16-day period of Cdþ2 exposure (data not
shown).
FIG. 5. Effect of Cdþ2 exposure on the expression of MT-3 in HK-2(MT-3) cells. Total RNA was prepared from the HK-2(MT-3) cells exposed to 0.45 and 0.9lM
Cdþ2 over the four passage time course and the expression of MT-3 mRNA was determined using real-time PCR. Total RNA was prepared after the cells were confluent
for 6 days and ready to be subcultured. The expression of MT-3 mRNA was normalized to that of G3PDH. (A) Expression of MT-3 mRNA at P1. (B) Expression MT-3
mRNA at P2. (C) Expression of MT-3 mRNA at P3. (D) Expression of MT-3 mRNA at P4. *Significantly lower ( p < 0.05) than the control (untreated cells).
316
BATHULA ET AL.
FIG. 6. TER and dome formation in HTP cells exposed to cadmium. HPT
cells were exposed to the indicated concentrations of Cdþ2 for 7 days; dome
formation and TER was assessed on the seventh day. The number of domes per
microscopic field were quantified by point counting (20 fields counted), and
TER was measured on cells grown on filter inserts at the identical
concentrations of cadmium. Each measurement and observation was done on
triplicate cultures and expressed as the mean ± standard error. *Significantly
lower ( p < 0.05) than the control (untreated cells).
DISCUSSION
This laboratory has previously shown that reintroduction of
MT-3 into the HK-2 cell line leads to the formation of domes,
structures that are accepted evidence for the retainment of vectorial active ion transport. The requirements for dome formation are functional plasma membrane polarization, the presence
of occluding junctions and vectorial transepithelial active ion
transport. The HK-2 cell line was derived from primary
cultures of HPT cells and immortalized by transfection with the
HPV E6/E7 genes (Ryan et al., 1994). These cells have been
shown to be immortal, nontumorigenic, and to produce monolayer cell cultures. They have also been shown to retain many
features expected of cells derived from the proximal tubule,
including sodium dependent glucose transport, the expected
response to cyclic adenosine monophosphate stimulation by
PTH and arginine vasopressin, as well as the specialized
proteins expected to be present on the apical membrane of the
proximal tubule. The HK-2 cells have not been shown to
possess tight junctions between adjacent cells and this might
account for the inability of these cells to form domes. The
finding in the present study that stable transfection with MT-3
resulted in an increase in transepithelial electrical resistance of
the cell monolayer confirms that dome formation was due to
the re-establishment of tight junctions in the HK-2(MT-3) cell
line. The determination of TER is a well-established method to
measure tight junction presence and ionic permeability
(Diamond, 1977; Stevenson et al., 1988). It was also shown
that the transepithelial electrical resistance developed by the
HK-2(MT-3) cells was similar to that of the HPT cells. It has
been shown previously that the HPT and HK-2(MT-3) cells
express 0.9 and 8.1 ng MT-3 per lg total protein, respectively
(Somji et al., 2004). Specificity for MT-3 was also suggested
by the finding that HK-2 cells transfected with the MT-1E
coding sequence developed no transepithelial electrical resistance. That dome formation in the HPT cells is likewise
influenced by MT-3 expression was shown by the reduction in
dome formation found when MT-3 expression was inhibited by
treatment with siRNA.
The apical junction complex, which mediates paracellular
permeability and polarity of the proximal tubule, is composed
of the tight junction, the adherens junction, and the desmosome
(Miyoshi and Takai, 2005). As a first step in attempting to
define a role for MT-3 in the formation and/or maintenance of
the apical junction complex it was decided to examine the
expression of E-cadherin. The cadherins are a protein family
consisting of over 80 members and are key transmembrane
proteins of the adherens junction (Perez-Moreno et al., 2003).
E-cadherin was chosen for examination because it is primarily
expressed in epithelia and is the prototype and best characterized member of the cadherin family (Miyoshi and Takai,
2005). E-cadherin is involved in the development of the
adherens junctions and is involved in the initial cell–cell contacts, serves as a precursor for the establishment of the tight
junctions at the apical side of the adherens junctions and as
a gathering point for companion molecules in epithelial cells
(Miyoshi and Takai, 2005; Nagafuchi, 2001). The finding in
the present study that E-cadherin was not expressed in HK-2
cells, but was expressed in both HK-2(MT-3) cells and HPT
cells suggested that MT-3 might be involved in epithelial to
mesenchymal transition (EMT) that is postulated to occur
during disease states such as cancer or renal fibrosis (Lee et al.,
2006; Peinado et al., 2004) and in the MET that occurs during
normal kidney morphogenesis (Peinado et al., 2004). The
simplest view of cadherin expression and EMT is that the Eand N-cadherins are historically considered the prototypic
cadherins in epithelial and mesenchymal cells, respectively.
During development E-cadherin is maintained in all epithelial
tissues but is silenced during the process of EMT and in
established mesenchymal cells where it is replaced by the
expression of N-cadherin (Nakagawa and Takeichi, 1995).
Loss of function studies have demonstrated that E-cadherin is
crucial for early mouse development and the maintenance of
epithelial morphology (Larue et al., 1996). Similar studies on
N-cadherin have shown that it is required for cardiogenesis,
somitogenesis, and the correct development of the nervous
system (Larue et al., 1996; Radice et al., 1997). The finding the
N-cadherin was highly expressed in HK-2(blank vector) cells
but not HK-2(MT-3) and HPT cells would be consistent with
proposing a role of MT-3 in the process of EMT and MET.
This would also be consistent with the absence of tight junctions in HK-2(blank vector) cells and their less polarized
morphology when compared with the HK-2(MT-3) cells and
the HPT cells (Kim et al., 2002). However, the HK-2 cells
cannot be viewed as fully stromal (mesenchymal) because they
do retain many differentiated features of the proximal tubule.
317
REGULATION OF CADHERIN EXPRESSION BY MT-3
As such, they may also serve as a useful model in determining
the intermediate steps that occur in EMT and MET.
The expression of K-cadherin, Ksp-cadherin and P-cadherin
were also analyzed in the HK-2(blank vector), HK-2(MT-3),
and HPT cells and results were consistent with a role for MT-3
in EMT and MET. The expression of K-cadherin protein was
elevated in HK-2(blank vector) cells, moderate in HK-2(MT-3)
cells and low in HPT cells. This is in agreement with studies
showing K-cadherin to be the major adhesion molecule
involved in the conversion of mesenchymal cells into an
epithelium in the kidney with the expression induced during
the late mesenchymal stage, extending to the proximal tubule
progenitor cells and the expression down regulated in mature
proximal tubular cells (Cho et al., 1998). Apparently the
requirement for this cadherin is during the early phases of the
MET (Dahl et al., 2002; Mah et al., 2000). The expression of
K-cadherin is often induced again during renal cell carcinoma
and has been proposed as a prognostic indicator for this cancer
(Dahl et al., 2002; Peinado et al., 2004). The Ksp-cadherin has
also been shown to be involved in epithelial kidney morphogenesis and is specifically expressed in renal tubular
epithelial cells (Dahl et al., 2002). The HK-2(MT-3) and
HPT cells were shown to have enhanced expression of Kspcadherin compared with the HK-2 cells. The expression of
P-cadherin was similar to that of E-cadherin among the cell
lines and P-cadherin has been found to be coexpressed with Ecadherin in MDCK cells (Wu et al., 1993). The only major
difference noted in the expression of the five cadherins between
the HPT and HK-2(MT-3) cells was that the abundance of
mRNAs for the E- and P-cadherins were much lower in the
HK-2(MT-3) cells compared with the HPT cells. This
difference was not apparent in the expression of the respective
proteins. These results provide evidence that MT-3 may have
a yet to be defined role in EMT and MET of the human kidney.
The final goal of the study was to determine if Cdþ2
exposure reduced the TER of the proximal tubular cells, and if
so, if MT-3 expression might be involved in the reduced
transepithelial transport. Past studies have defined the effect of
Cdþ2 exposure on the expression of MT-3 mRNA and protein
in the HK-2 and HPT cells as well as the effects of exposure on
necrotic and apoptotic cell death (Garrett et al., 2002; Kim
et al., 2002; Somji et al., 2004). The results of the study clearly
demonstrated that Cdþ2 exposure did result in the loss of the
ability of the proximal tubular cells to form domes and
a corresponding loss of TER of the cell monolayers. The results
were also conclusive that the reductions in dome formation and
TER due to Cdþ2 exposure were independent of the expression
level of the MT-3 protein. The results showed that Cdþ2
exposure elicited no reduction in the expression of the MT-3
protein in either HPT cells or HK-2 cells stably transfected to
overexpress the MT-3 gene over several serial passages of
exposure to Cdþ2. In both instances, the loss of dome formation and TER occurred early in the time course of exposure.
The present study does not rule out a potential role for MT-3
that might involve the replacement of Znþ2 by Cdþ2 in the
molecule and a subsequent effect of this metal substitution on
the expression or interaction with the junctional proteins. The
MT’s are well-known for their role as metal-binding proteins
and for their protective affects against heavy metal induced
toxicity, including Cdþ2-induced nephrotoxicity (Andrews,
2000). One of the earliest signs of acute cadmium toxicity in
proximal tubular cell cultures is the separation of cells from one
another with a loss of E-cadherin from the cell-to-cell contacts
(Prozialeck and Niewenhuis, 1991a, b). These, and many
subsequent studies, have shown that acute Cdþ2 exposure can
disrupt cadherin dependent cell–cell junctions in a variety of
cells (Prozialeck, 2000). These observations have led to the
hypothesis that the cadherin–catenin complex may be a primary
target of Cdþ2-induced toxicity (Prozialeck et al., 2002).
However, the exact mechanisms by which Cdþ2 might affect
the cadherin–catenin complex have not been elucidated to date.
The current observations that MT-3 can influence the expression
of the cadherins and the EMT status of the proximal tubular
cell may provide an additional mechanism through which MT-3
can also influence the expression of E-cadherin when the cell
monolayer is exposed to Cdþ2. It has been shown previously
that MT-3 undergoes a transient induction shortly after exposure to Cdþ2 and then returns to control levels (Kim et al.,
2002). The transient induction of MT-3 by Cdþ2 also follows
closely the time scale of the corresponding induction of the
early response genes (Garrett et al., 2002). The induction of the
early response genes has also been shown to correlate with
the Cdþ2-induced reorganization of E-cadherin in renal
epithelial cells (Prozialeck et al., 2002). One can hypothesize
that the transient induction of MT-3 expression would provide
the opportunity for newly synthesized MT-3 to bind Cdþ2
instead of Znþ2. This new pool of MT-3, where Znþ2 is
replaced by Cdþ2, might affect the properties of MT-3 that
could interact with junctional proteins, and in doing so, alter
the cadherin expression and polarity of the proximal tubular
cell. This mechanism is attractive because it would provide an
intracellular route for Cdþ2 to influence E-cadherin function in
heavy metal toxicity. A recent study has defined the binding
partners of MT-3 in neural tissue (Lahti et al., 2005), however,
the testing of our hypothesis will require the definition of the
binding partners of MT-3 in the renal system.
FUNDING
National Institutes of Environmental Health Sciences,
National Institutes of Health grants (R01 ES11333, R01
ES015100).
ACKNOWLEDGMENTS
This project’s contents are solely the responsibility of the
authors and do not necessarily represent the official views of
318
BATHULA ET AL.
the National Institutes of Environmental Health Sciences,
National Institutes of Health.
REFERENCES
Andrews, G. K. (2000). Regulation of metallothionein gene expression by
oxidative stress and metal ions. Biochem. Pharmacol. 59, 95–104.
Bartlett, D. W., and Davis, M. E. (2006). Insights into the kinetics of siRNAmediating silencing from live-cell and live-animal bioluminescent imaging.
Nucleic Acids Res. 34, 322–333.
Cho, E. A., Patterson, L. T., Brookhiser, W. T., Mah, S., Kintner, C., and
Dressler, G. R. (1998). Differential expression and function of cadherin-6
during renal epithelial cell development. Development 125, 803–812.
Dahl, U., Sjodin, A., Larue, L., Radice, G. L., Cajander, S., Takeichi, M.,
Kemler, R., and Semb, H. (2002). Genetic dissection of cadherin function
during nephrogenesis. Mol. Cell. Biol. 22, 1474–1487.
Detrisac, C. J., Sens, M. A., Garvin, A. J., Spicer, S. S., and Sens, D. A. (1984).
Tissue culture of human kidney epithelial cells of proximal tubule origin.
Kidney Int. 25, 383–390.
Nakagawa, S., and Takeichi, M. (1995). Neural crest cell-cell adhesion
controlled by sequential and subpopulation-specific expression of novel
cadherins. Development 121, 1321–1332.
Palmiter, R. D., Findley, S. D., Whitmore, T. E., and Durnam, D. M. (1992).
MT-III, a brain-specific member of the metallothionein gene family. Proc.
Natl. Acad. Sci. U. S. A. 89, 6333–6337.
Peinado, H., Portillo, F., and Cano, A. (2004). Transcriptional regulation of
cadherins during development and carcinogenesis. Int. J. Dev. Biol. 48,
365–375.
Perez-Moreno, M., Jamora, C., and Fuchs, E. (2003). Sticky business:
Orchestrating cellular signals at adherens junctions. Cell 112, 535–548.
Prozialeck, W. C. (2000). Evidence that E-cadherin may be a target for cadmium toxicity in epithelial cells. Toxicol. Appl. Pharmacol. 164, 231–249.
Prozialeck, W. C., Grunwald, G. B., Dey, P. M., Reuhl, K. R., and
Parrish, A. R. (2002). Cadherins and NCAM as potential targets in metal
toxicity. Toxicol. Appl. Pharmacol. 182, 255–265.
Prozialeck, W. C., and Niewenhuis, R. J. (1991a). Cadmium (Cdþ2) disrupts
intercellular junctions and actin filaments in LLC-PK1 cells. Toxicol. Appl.
Pharmacol. 107, 81–97.
Diamond, J. (1977). Twenty-first Bowditch lecture. The epithelial junction:
Bridge, gate and fence. Physiologist 20, 10–18.
Prozialeck, W. C., and Niewenhuis, R. J. (1991b). Cadmium disrupts Caþ2
dependent cell-cell junctions and alters the pattern of E-cadherin immunofluorescence in LLC-PK1 cells. Biochem. Biophys. Res. Commun. 181,
1118–1124.
Garrett, S. H., Sens, M. A., Todd, J. H., Somji, S., and Sens, D. A. (1999).
Expression of MT-3 protein in the human kidney. Toxicol. Lett. 105,
207–214.
Radice, G. L., Rayburn, H., Matsunami, H., Knudsen, K. A., Takeichi, M., and
Hynes, R. O. (1997). Developmental defects in mouse embryos lacking
N-cadherin. Dev. Biol. 181, 64–87.
Garrett, S. H., Phillips, V., Somji, S., Sens, M. A., Dutta, R., Park, S., Kim, D.,
and Sens, D. A. (2002). Transient induction of metallothionein isoform 3
(MT-3), c-fos, c-jun and c-myc in human proximal tubule cells exposed to
cadmium. Toxicol. Lett. 126, 69–80.
Ryan, M. J., Johnson, G., Kirk, J., Fuerstenberg, S. M., Zager, R. A., and
Torok-Storb, B. (1994). HK-2: An immortalized proximal tubule epithelial
cell line from normal adult human kidney. Kidney Int. 45, 48–57.
Garrett, S. H., Somji, S., Todd, J. H., and Sens, D. A. (1998). Exposure of
human proximal tubule cells to Cdþ2, Znþ2, and Cuþ2 induces metallothionein protein accumulation, but not metallothionein isoform 2 mRNA.
Environ. Health Perspect. 106, 587–595.
Kim, D., Garrett, S. H., Sens, M. A., Somji, S., and Sens, D. A. (2002).
Metallothionein isoform 3 and proximal tubule vectorial active transport.
Kidney Int. 61, 464–472.
Sens, D. A., Detrisac, C. J., Sens, M. A., Rossi, M. R., Wenger, S. L., and
Todd, J. H. (1999). Tissue culture of human renal epithelial cells using
a defined serum-free formulation. Exp. Nephrol. 7, 344–352.
Somji, S., Garrett, S. H., Sens, M. A., Gurel, V., and Sens, D. A. (2004).
Expression of metallothionein isoform 3 (MT-3) determines the choice
between apoptotic or necrotic cell death in Cdþ2-exposed human proximal
tubule cells. Toxicol. Sci. 80, 358–366.
Lahti, D. W., Hoekman, J. D., Tokheim, A. M., Martin, B. L., and
Armitage, I. M. (2005). Identification of mouse brain proteins associated
with isoform 3 of metallothionein. Protein Sci. 14, 1115–1157.
Somji, S., Garrett, S. H., Sens, M. A., and Sens, D. A. (2006). The unique
N-terminal sequence of metallothionein-3 is required to regulate the choice
between apoptotic or necrotic cell death of human proximal tubule cells
exposed to Cdþ2. Toxicol. Sci. 90, 369–376.
Larue, L., Antos, C., Butz, S., Huber, O., Delmas, V., Dominis, M., and
Kemler, R. (1996). A role for cadherins in tissue formation. Development
122, 3185–3194.
Stevenson, B. R., Anderson, J. M., and Bullivant, S. (1988). The epithelial tight
junction: Structure, function and preliminary biochemical characterization.
Mol. Cell. Biochem. 83, 129–145.
Lee, D. B. N., Huang, E., and Ward, H. J. (2006). Tight junction biology and
kidney dysfunction. Am. J. Physiol. 290, F20–F34.
Tsuji, S., Kobayashi, H., Uchida, Y., Ihara, Y., and Miyatake, T. (1992).
Molecular cloning of human growth inhibitory factor cDNA and its downregulation in Alzheimer’s disease. EMBO J. 11, 4843–4850.
Mah, S. P., Saueressing, H., Goulding, M., Kintner, C., and Dressler, G. R.
(2000). Kidney development in cadherin-6 mutants: Delayed mesenchymeto-epithelial conversion and loss of nephrons. Dev. Biol. 223, 38–53.
Miyoshi, J., and Takai, Y. (2005). Molecular perspective on tight junction
assembly and epithelial polarity. Adv. Drug Deliv. Rev. 57, 815–855.
Nagafuchi, A. (2001). Molecular architecture of adherens junctions. Curr.
Opin. Cell Biol. 13, 600–603.
Uchida, Y., Takio, K., Titani, K., Ihara, Y., and Tomonaga, M. (1991). The
growth inhibitory factor that is deficient in Alzheimer’s disease is a 68 amino
acid metallothionein-like protein. Neuron 7, 337–347.
Wu, J.-C., Gregory, C. W., and DePhilip, R. M. (1993). P-cadherin and
E-cadherin are co-expressed in MDCK cells. Biochem. Biophys. Res.
Commun. 195, 1329–1335.