Cardiovascular Research 50 (2001) 108–114
www.elsevier.com / locate / cardiores
www.elsevier.nl / locate / cardiores
Estrogen inhibits mechanical strain-induced mitogenesis in human vascular
smooth muscle cells via down-regulation of Sp-1
Shanhong Ling a , Gang Deng d , Harlan E. Ives c , Kanu Chatterjee b , Gabor M. Rubanyi d ,
a
a,
Paul A. Komesaroff , Krishnankutty Sudhir *
a
Hormones and The Vasculature Laboratory, Baker Institute and Alfred Heart Centre, Alfred Hospital, Melbourne, Australia
b
Vascular Research Laboratory, Cardiology Division, University of California, San Francisco, CA, USA
c
Division of Nephrology, University of California, San Francisco, CA, USA
d
Berlex Biosciences, Richmond, CA 94143, USA
Received 10 May 2000; accepted 14 December 2000
Abstract
Objective: The cellular basis of the cardioprotective effects of estrogen are largely unknown. An inhibitory effect on vascular smooth
muscle (VSM) growth has been proposed. We examined the effect of 17b-estradiol (E2) on mechanical strain-induced mitogenesis in
human fetal VSM cells. Methods and results: Cells were grown on fibronectin-coated plates with silicone-elastomer bottoms, and
exposed to cyclic mechanical strain (60 cycles / min), with and without E2 (1 nmol / l), for 48 h. [ 3 H]-Thymidine incorporation was
measured during the last 6 h. Strain induced 1.5–2 fold increases in DNA synthesis that were attenuated by antibodies to platelet-derived
growth factor (PDGF) AA and BB. Strain also induced increases both in mRNA and protein levels of Sp-1, a transcription factor that
binds to the PDGF-A gene promoter site. E2 attenuated strain-induced mitogenesis, and also increases in mRNA and protein levels of
Sp-1. The estrogen receptor (ER) antagonist ICI 182,780 (100 nmol / l) reversed the inhibitory effect of E2 on strain-induced increases in
DNA synthesis and Sp-1 protein. RT-PCR analysis showed presence of both ER-a and -b in these cells. Conclusions: Estrogen inhibits
strain-induced mitogenesis in human VSM cells via an ER mediated process involving down-regulation of the transcription factor Sp-1.
 2001 Elsevier Science B.V. All rights reserved.
Keywords: Gender; Growth factors; Platelets; Smooth muscle
1. Introduction
Estrogen use is associated with a reduced incidence of
cardiovascular disease in postmenopausal women [1]. With
the recent identification of an estrogen receptor (ER) in
human vascular smooth muscle (VSM) [2] and endothelial
cells [3], a direct vascular effect of estrogen has been
proposed. Estrogen reportedly inhibits restenosis [4], and
improves outcomes [5] following balloon angioplasty. In
an experimental model of balloon injury of the rat carotid
artery, estrogen attenuated myointimal proliferation [6].
17b-Estradiol (E2) reportedly inhibits thymidine uptake by
*Corresponding address. Alfred and Baker Medical Unit, 3rd Floor,
Alfred Hospital, Commercial Road, Prahran, VIC 3181, Australia. Tel.:
161-3-9276-3263; fax: 161-3-9276-2461.
E-mail address: [email protected] (K. Sudhir).
pig left anterior descending coronary artery segments [7].
In human umbilical vein smooth muscle cells in culture,
serum and endothelin-1 induced increases in cell numbers
were attenuated 75% by estrogen [8]. The mechanisms
underlying these potentially beneficial anti-proliferative
effects of estrogen are unclear. Sullivan et al. [9] showed
that physiological levels of estrogen significantly suppressed the carotid arterial response to injury in ovariectomized normolipemic female mice. Of interest, Iafrati et
al. [10] recently reported that estrogen inhibited this
vascular injury response even in ER-a knockout (ERKO)
mice, in which the ER-a gene is disrupted. These mice
express ER-b in their vasculature, which likely mediates
the anti-proliferative effect of E2 in this model. Both ER-a
and ER-b exist widely and are distributed in most organs
Time for primary review 26 days.
0008-6363 / 01 / $ – see front matter  2001 Elsevier Science B.V. All rights reserved.
PII: S0008-6363( 01 )00200-0
S. Ling et al. / Cardiovascular Research 50 (2001) 108 – 114
including the heart and vasculature in humans, and different and organ-specific roles have been suggested for these
two receptors [11]. However, evidence for an ER-b-mediated effect of E2 in human vascular cells has not been
directly demonstrated.
Repetitive physical deformation is a feature of the
environment of VSM cells in vivo. It has previously been
shown that cyclic mechanical strain stimulates the proliferation of neonatal rat VSM cells through production and
autocrine action of platelet derived growth factor (PDGF)
[12]. Strain also causes a synergistic increase in the
response to other mitogens, such as angiotensin II, possibly
via synergy between angiotensin II and PDGF [13]. Wilson
et al. have shown that strain increases expression of the
transcription factor Sp-1, and that GC-rich regions in the
proximal 92 bp of the PDGF-A gene promoter contain
mechanical strain-responsive elements that possibly bind
Sp-1 [14]. The interaction between sex hormones and
mechanical strain is unclear. Clearly such an interaction is
relevant to the effect of estrogens on VSM cells in vivo,
both in normal physiology and in states characterized by
acute increases in stretch such as angioplasty [15], or
chronic increases such as hypertension [16]. Accordingly,
we investigated the effect of physiological concentrations
of E2 on strain-induced proliferation, as well as on
induction of Sp-1, in human fetal VSM cells. We also
characterized ER subtypes to determine the presence of
ER-a and ER-b in human vascular smooth muscle cells.
2. Methods
2.1. Application of cyclic strain to cultured cells
Human fetal VSM cells (HF 16) were cultured from the
aorta of a therapeutically aborted female fetus and generously supplied by Drs. Karen Yee and Stephen Schwartz at
the Department of Pathology, University of Washington,
Seattle [17]. Experiments were conducted in accordance
with the policies of the local ethics committees. Cells from
passage 3–7 were grown to confluence in six-well silicone
elastomer-bottomed culture plates coated with pronectin
(Flexcell, McKeesport, PA, USA), growth arrested in
serum-free DMEM (without phenol red) for 24 h in the
presence of E2 (1 nmol / l) or vehicle, and then subjected to
cyclic mechanical strain (60 cycles / min) using a Flexercel
Stress Unit (Flexcell). This unit repetitively applies vacuum (|15–20 kPa) to the rubber-bottomed dishes and a
computer system controls the frequency and the extent of
deformation (up to a maximum of 25% to the cells at the
periphery of the dishes).
2.2. Measurement of DNA synthesis
Cells were incubated with [ 3 H]-thymidine (1 mCi / well)
during the final 6 h of the strain, washed with PBS, and
109
extracted with 15% trichloroacetic acid at 48C for 30 min.
The rubber bottom of the Flex plates containing the TCAprecipitable material was removed from the plate and
placed directly into a scintillation vial with 10 ml of
scintillation solution for counting.
2.3. Isolation of total RNA and Northern blot
Total cellular RNA was isolated by an RNA STAT-60E
reagent (Tel-Test, Friendswood, TX, USA). A 10 mg
amount of the RNA was electrophoresed on 1% agarose
gels, transferred to nylon membranes (Amersham, Arlington Heights, IL, USA), and hybridized with a cDNA probe
for Sp-1 message which was labeled with [a- 32 P] dCTP
(3000 Ci / mmol; Amersham) using the random primer
method. After washing with SSC 0.1% SDS buffers,
membranes were exposed to X-ray films for 12–48 h at
2708C to obtain optimal signals. The membranes were
stripped and, for normalization, rehybridized with a
GAPDH cDNA probe using the same method. The autoradiographic signals were scanned with a PowerLook II
Scanner (Umax Data System, Taipei, Taiwan, ROC) and
the relative level of Sp-1 mRNA was normalized by
comparison to the GAPDH mRNA signal.
2.4. Isolation of total protein and Western blot
Cells were scraped from the culture plates, suspended in
0.5% SDS–PBS, and broken using a syringe with a 20 G
needle. After boiling for 10 min and centrifugation for 5
min at 48C, proteins in the supernatant were quantified
with BCA Protein Assay Reagent (Pierce Chemical,
Rockford, IL, USA) by measuring the OD at 562 nm. A 20
mg amount of the protein was electrophoresed on 7%
SDS–polyacrylamide gels and transferred to Hybond ECL
filters (Amersham). After blocking with 10% nonfat dry
milk in TBS (20 mM Tris, pH 7.5, 50 mM NaCl, and 0.1%
Tween-20) overnight, filters were incubated with primary
antibody of Sp-1 (rabbit polyclonal IgG; Santa Cruz
Biotechnology, Santa Cruz, CA, USA) for 1 h and the
HRP-conjugated secondary antibody (anti-rabbit) for 1 h.
Filters were then incubated for 1 min with enhanced
chemiluminescence reagents (Amersham) and exposed to
X-ray films for 1–10 min to obtain ideal exposure. Signals
of Sp-1 protein were scanned with a PowerLook scanner
and relative levels of the protein were estimated by
densitometry.
2.5. RT-PCR
The RT-PCR was performed by using the SuperScript
One-Step RT-PCR system (Life Technologies, Rockville,
MD, USA). A 0.5 mg amount of total RNA was added to
the RT-PCR mixture and incubated at 508C for 30 min and
then at 948C for 2 min. The reaction was amplified for 35
cycles by incubation at 928C for 30 s, 608C for 30 s, 728C
110
S. Ling et al. / Cardiovascular Research 50 (2001) 108 – 114
for 1 min, and a final incubation at 728C for 5 min in a
PCR 9600 thermocycler (Perkin-Elmer, Norwalk, CT,
USA). The oligonucleotide primers used for ER-a were
59CGCTGCGTCGCCTCTAACCTC39 and 59GGCTCGGAGACACGCTGTTG39, which amplify a 430-base pair
(bp) fragment from ER-a mRNA, and for ER-b were
59CCTGGGCACCTTTCTCCTTTAGT39 and 59GCAGAAGTGAGCATCCCTCTTTG39 to amplify a 200-bp fragment from ER-b mRNA. The primers for PDGF A chain
were 59ATGGCGTGTTACATTCCTGAAC39 and 59TTCGTCCTTACAGAACCTTTGC39, which amplify a 427-bp
fragment from PDGF A chain mRNA. The primers for
actin were obtained from Clontech (South San Francisco,
CA, USA). The PCR products along with the 100-bp
molecular weight markers were separated on a 4% polyacrylamide gel with TAE buffer and visualized by staining
with ethidium bromide.
Fig. 2. Human VSM cells were treated with E2 (1 nmol / l) and / or ICI
182,780 (ICI, 100 nmol / l) for 3 h before application of mechanical strain
(Str) for 48 h, and [ 3 H]-thymidine incorporation was measured during the
last 6 h. Three separate experiments were performed, and mean6S.E.M.
values from one representative experiment in triplicate are shown.
2.6. Statistical analysis
All data are presented as mean6S.E.M. All comparisons
were made using ANOVA, with posthoc testing by the
Student–Neumann–Keul’s test. Differences with P,0.05
were considered significant.
was significantly reduced by the ER antagonist ICI
182,780 (Fig. 2), suggesting that estrogen-induced inhibition of DNA synthesis is an ER-mediated process.
3.2. Effect of PDGF antibodies on strain-induced human
VSM proliferation
3. Results
3.1. Estrogen-induced inhibition of DNA synthesis
For assessment of DNA synthesis, experiments were
conducted for 48 h, with [ 3 H]-thymidine incorporation
during the final 6 h. E2 had no effect on DNA synthesis in
unstrained cells. Strain induced a 1.7-fold increase in DNA
synthesis, which was significantly attenuated by E2 (1
nmol / l) (30% decrease, P,0.05), but not by the vehicle
DMSO (Fig. 1). The extent of inhibition of DNA synthesis
Fig. 1. Human VSM cells grown in six-well silicone culture plates were
subjected to cyclic strain (Str, 60 cycles / min) for 48 h in the absence or
presence of E2 (1 nmol / l). [ 3 H]-Thymidine incorporation was measured,
and is expressed as mean6S.E.M. of three similar experiments, each
performed in triplicate.
To determine the contribution of PDGF to strain-induced proliferation in human VSM cells, cells were
subjected to cyclic mechanical strain in the presence and
absence of neutralizing antibodies to PDGF-AA and
PDGF-BB. Antibodies to PDGF-AA and PDGF-BB did
not influence DNA synthesis in control cells. However,
both antibodies significantly attenuated strain-induced proliferation (61.8% decrease, P,0.05. Fig. 3), confirming
Fig. 3. Human VSM cells were treated with anti-PDGF AA, BB
antibodies (Ab), or non-specific antibody (IgG) for 3 h, and subjected to
cyclic strain (Str) for 48 h. [ 3 H]-Thymidine incorporation was measured
during the last 6 h. Three separate experiments were performed, and
mean6S.E.M. values from one representative experiment in triplicate are
shown. *, P,0.05, vs. Str or Str1IgG.
S. Ling et al. / Cardiovascular Research 50 (2001) 108 – 114
111
that strain-induced proliferation in these cells is mediated
via PDGF production, as shown in previous studies in a
neonatal rat cell line [12].
3.3. Effect of E2 on mechanical strain-induced increase
in Sp-1
Sp-1 is a transcription factor that binds to the promoter
of the PDGF gene. We examined the effect of E2 on
expression of Sp-1 in human VSM cells. E2 had no effects
on Sp-1 gene expression and protein level in unstrained
cells. In cells subjected to cyclic mechanical strain, Sp-1
mRNA increased significantly at 4, 8 and 24 h in response
to the strain, and in contrast, in cells grown in the presence
of E2 (1 nmol / l), the increase in Sp-1 mRNA was
significantly attenuated compared to without E2 (Fig. 4).
Sp-1 protein increased 2.060.3 fold at 24 h and 2.260.5
fold at 48 h after strain, while in cells grown in the
presence of estrogen, strain-induced Sp-1 protein increase
was prevented (Fig. 5). The E2 effect on Sp-1 protein was
completely abolished by pretreatment with the ER antagonist ICI 182,780 (100 nmol / l), indicating an ER-mediated
effect (Fig. 6).
3.4. Estrogen receptor subtypes by RT-PCR analysis
Fig. 5. Human VSM cells were subjected to strain for 12–48 h in the
absence (S) or presence (S1E) of E2, and Western blots were performed
to analyze Sp-1 protein. Data are shown as a photograph (A) and as a bar
graph (B) which represent densitometric values from a PowerLook II
scanner, expressed as fold increase over the control value at time 0
(mean6S.E.M. of three similar experiments). *, P,0.05, vs. no E 2
groups (S).
Both ER-a and ER-b mRNA were detected in these
VSM cells by RT-PCR. ER-a expression appeared to be
upregulated nearly 2-fold by E2 treatment after 24 h (Fig.
Fig. 4. Human VSM cells were subjected to strain for 4–24 h in the
absence (S) or presence (S1E) of E2, and Northern blots were performed
to analyze Sp-1 mRNA. Data are shown as a photograph (A) and as a bar
graph (B) which represent densitometric values from a PowerLook II
scanner, expressed as fold increase over the control value at time 0
(mean6S.E.M. of four similar experiments). *, P,0.05, vs. no E 2 groups
(S).
Fig. 6. Human VSM cells were subjected to strain (Str) for 24 h in the
absence or presence of E2 with / without ICI 182,780 (100 nmol / l).
Western blots were performed to analyze Sp-1 protein. Data are shown as
a photograph (A) and as a bar graph (B) which represent densitometric
values from a PowerLook II scanner, expressed as fold increase over the
control value (mean6S.E.M. of three similar experiments). *, P,0.05, vs.
Strain or Str1E21ICI groups.
112
S. Ling et al. / Cardiovascular Research 50 (2001) 108 – 114
4. Discussion
Fig. 7. Human VSM cells were cultured with or without E2 (1 nmol / l)
for 24 h, and RT-PCR was performed to analyze ER-a and -b mRNA,
using an endometrial cancer cell line (Ishikawa) as positive control and
a-actin mRNA to normalize the loading quantity of the samples. bp, base
pair; M, DNA marker; 1, 3 and 5, without E2; 2, 4 and 6, with E2.
7). Relatively high levels of ER-b mRNA were detected in
the VSM cells (compared to the positive control of
Ishikawa cells).
3.5. PDGF gene expression by RT-PCR
Mechanical strain induced an increase in PDGF-A
mRNA, detected by RT-PCR analysis. Treatment with E2
(1 nmol / l) attenuated this strain-induced increase in
PDGF-A expression at 8 and 24 h; the effect was more
pronounced at 8 h, at which time PDGF-A expression was
35% of that observed in strained cells without E2 (Fig. 8).
However, E2 did not affect PDGF-A chain expression in
unstrained cells, or PDGF-B chain expression in either
unstrained or strained cells (data not shown).
Fig. 8. Human VSM cells were subjected to strain for 4–24 h in the
absence or presence of E2, and RT-PCR was performed to analyze PDGF
A-chain mRNA, using a-actin mRNA to normalize the loading quantity
of the samples. bp: base pare; M: 100-bp DNA marker; (C) control (no
strain); S: strain.
The present study shows that physiological concentrations of estrogen inhibit strain-induced proliferation in
human VSM cells, in company with down-regulation of the
transcription factor Sp-1. These cells express both ER-a
and ER-b, and the inhibitory effect of E2 on mechanical
strain appears to be mediated via one or both of the
estrogen receptors, as incubation with ICI 182,780 attenuates this effect.
Previous studies have shown anti-proliferative effects of
estrogen in rabbit [18], rat [19], and porcine [20] VSM
cells exposed to growth factors. In human umbilical VSM
cells, E2 had a biphasic effect on DNA synthesis: low
concentrations (0.3 nmol / l) stimulated, and higher concentrations (30 nmol / l) inhibited [ 3 H]-thymidine incorporation [21]. In human female aortic smooth muscle cells,
E2 (1 nmol / l) inhibited increases in DNA synthesis
induced by a variety of mitogens [22]; a similar inhibitory
effect was observed in smooth muscle cells from saphenous veins from both men and women in response to
concentrations of estradiol from 10 nmol / l to 1 mmol / l
[23]. The present study extends these observations, providing evidence for E2-induced inhibition of proliferation
in VSM cells subjected to mechanical strain.
We have confirmed in this study that human VSM cells
also synthesize PDGF in response to mechanical strain
since antibodies to both PDGF-AA and PDGF-BB significantly attenuated the proliferative response to strain.
PDGF has previously been implicated in the development
of atherosclerosis as a migratory and mitogenic stimulus to
VSM cells. By quantitative RT-PCR, cells in atherosclerotic lesions have been shown to express mRNA for
both PDGF A and B chains, and PDGF A appears to be
upregulated during proliferation [24]. Enhanced migratory
activity has been shown in VSM cells with high expression
of both PDGF-A and PDGF-B, with significant correlations between PDGF mRNA levels and the degree of
directional changes of VSM cells during migration, examined in vitro [25]. Of interest, in addition to cyclic
mechanical strain [12], shear stress has also been shown to
promote release of PDGF from VSM cells in culture [26],
suggesting that its production can be regulated by various
forms of mechanical stimuli. Estrogens reportedly have
anti-atherosclerotic effects [27], and attenuate myointimal
proliferation in an animal model of balloon injury [6], and
have been shown to modulate expression of both PDGF
ligand and receptor proteins in reproductive tissues, where
PDGF is a possible mediator of estrogen-induced cell
proliferation, migration and differentiation [28]. A regulatory effect of estrogens on PDGF synthesized locally in the
vascular wall might contribute to its anti-proliferative
effects in vivo.
Sp-1 is a zinc-finger transcription factor that interacts
with the PDGF-A gene promoter [29] and the PDGF-B
gene promoter [30,31]. Sp-1 binds to consensus elements
S. Ling et al. / Cardiovascular Research 50 (2001) 108 – 114
in the proximal PDGF-A gene promoter as well as to the
59-CCACCC-39 motif in the proximal PDGF-B gene
promoter. The ability of Sp-1 to bind is critical for basal
expression driven by the PDGF-A and PDGF-B gene
promoters in cultured cells. It has recently been shown that
GC-rich regions in the proximal 92 bp of the PDGF-A
gene promoter contain mechanical strain-responsive elements that possibly bind Sp-1 [14]. The present study
shows that in human VSM cells subjected to cyclic
mechanical strain, both Sp-1 gene expression and protein
levels increase, and that this increase in Sp-1 is significantly attenuated by estradiol. The relatively long delay
between the increase in Sp-1 gene expression (observed at
4 h) and protein level (24 h) may be explained by the
nuclear localization of this transcription factor. It is
possible that estrogen-induced inhibition of Sp-1 mediates
the down-regulation of PDGF, resulting in decreased cell
proliferation. This interpretation is supported by our finding of estradiol-induced attenuation of PDGF-A mRNA
expression in cells subjected to mechanical strain.
The inhibition of strain-induced proliferation by E2 was
not observed in the presence of the estrogen receptor
antagonist ICI 182,780, suggesting that the anti-proliferative effect is mediated via one or both of the ER. This is
further supported by our observation that strain-induced
increase in Sp-1 protein is attenuated by E2, but not in the
presence of ICI 182,780. While many of the effects of
estrogen are mediated via the classical ER (ER-a), it has
been suggested that the recently discovered ER-b might
also play a role in some of its vascular effects [32]. In the
ERKO mice, in which the ER-a gene is disrupted, the
anti-proliferative effect of E2 is still observed, raising the
possibility that the ER-b might mediate this effect [10].
RT-PCR analysis showed that the cells we examined in the
present study express both ER-a and ER-b. However, the
relative contribution of these receptors to the anti-proliferative effect of estrogen remains to be determined.
In summary, we have demonstrated that estrogen inhibits mechanical strain-induced increase in DNA synthesis in
human vascular smooth muscle cells by a mechanism that
involves inhibition of increases in Sp-1, possibly resulting
in a down-regulation of PDGF-A. Such an effect may
underlie the inhibitory effect of estrogens on the progression of atherosclerosis, and the beneficial effects on
restenosis observed in experimental [6] and observational
clinical studies [4]. Further studies exploring the interaction between estrogens and other transcription factors
and downstream growth factors in VSM cells are required
to fully elaborate their anti-proliferative properties.
Acknowledgements
This work was supported in part by the Foundation for
Cardiac Research, University of California, San Francisco.
K.S. is funded as a Senior Research Fellow of the National
113
Health and Medical Research Council (NH&MRC) of
Australia. S.L. is funded through a block grant from the
NH&MRC to the Baker Institute.
References
[1] Barrett-Connor E, Bush TL. Estrogen and coronary heart disease in
women. J Am Med Assoc 1991;265:1861–1867.
[2] Karas RH, Patterson BL, Mendelsohn ME. Human vascular smooth
muscle cells contain functional estrogen receptor. Circulation
1994;89:1943–1950.
[3] Kim-Schulze S, McGowan KA, Hubchak SC et al. Expression of an
estrogen receptor by human coronary artery and umbilical vein
endothelial cells. Circulation 1996;94:1402–1407.
[4] O’Brien JE, Peterson ED, Keeler GP et al. Relation between
estrogen replacement therapy and restenosis after percutaneous
coronary interventions. J Am Coll Cardiol 1996;28:1111–1118.
[5] O’Keefe JH, Kim Jr SC, Hall RR et al. Estrogen replacement
therapy after coronary angioplasty in women. J Am Coll Cardiol
1997;29:1–5.
[6] Chen SJ, Li H, Durand J et al. Estrogen reduces myointimal
proliferation after balloon injury of rat carotic artery. Circulation
1996;93:577–584.
[7] Vargas R, Wroblewska B, Rego A et al. Oestradiol inhibits smooth
muscle cell proliferation of pig coronary artery. Br J Pharmacol
1993;109:612–617.
[8] Morey AK, Pedram A, Razandi M et al. Estrogen and progesterone
inhibit vascular smooth muscle proliferation. Endocrinology
1997;138:3330–3339.
[9] Sullivan Jr TR, Karas RH, Aronovitz M et al. Estrogen inhibits the
response-to-injury in a mouse carotid artery model. J Clin Invest
1995;96:2482–2488.
[10] Iafrati MD, Karas RH, Aronovitz M et al. Estrogen inhibits the
vascular injury response in estrogen receptor a-deficient mice. Nat
Med 1997;3:545–548.
[11] Brandernberger AW, Tee MK, Lee JY et al. Tissue distribution of
estrogen receptors alpha and beta mRNA in the midgestational
human fetus. J Clin Endocrinol Metab 1997;82:3509–3512.
[12] Wilson E, Mai Q, Sudhir K et al. Mechanical strain induces growth
of vascular smooth muscle cells via autocrine action of PDGF. J
Cell Biol 1993;123:741–747.
[13] Sudhir K, Wilson E, Chatterjee K et al. Mechanical strain and
collagen potentiate mitogenic activity of angiotensin II in rat
vascular smooth muscle cells. J Clin Invest 1993;92:3003–3007.
[14] Wilson E, Vives F, Collins T et al. Strain-responsive regions in the
platelet-derived growth factor-A gene promoter. Hypertension
1998;31(part 2):170–175.
[15] Stone GW, Hodgson JM, St Goar FG et al. Improved procedural
results of coronary angioplasty with intravascular ultrasound-guided
balloon sizing: the CLOUT Pilot Trial. Clinical Outcomes with
Ultrasound
Trial
(CLOUT)
Investigators.
Circulation
1997;95:2044–2052.
[16] Safar ME, Peronneau PA, Toto-Moukouo JA et al. Pulsed doppler:
diameter, blood flow velocity, and volumic flow of the brachial
artery in sustained essential hypertension. Circulation 1981;63:393–
400.
[17] Conroy SC, Hart CE, Perez-Reyes N et al. Characterization of
human aortic smooth muscle cells expressing HPV16 E6 and E7
open reading frames. Am J Pathol 1995;147:753–762.
[18] Lou H, Zhao Y, Delafontaine P et al. Estrogen effects on insulin-like
growth factor-I (IGF-I)-induced cell proliferation and IGF-I expression in native and allograft vessels. Circulation 1997;96:927–933.
[19] Espinosa E, Oemar BS, Luscher TF. 17b-Estradiol and smooth
114
[20]
[21]
[22]
[23]
[24]
[25]
S. Ling et al. / Cardiovascular Research 50 (2001) 108 – 114
muscle cell proliferation in aortic cells of male and female rats.
Biochem Biophys Res Commun 1996;221:8–14.
Moraghan T, Antoniucci DM, Grenert JP et al. Differential response
in cell proliferation to b estradiol in coronary arterial vascular
smooth muscle cells obtained from mature female versus male
animals. Endocrinology 1996;137:5174–5177.
Somjen D, Kohen F, Jaffe A et al. Effects of gonadal steroids and
their antagonists on DNA synthesis in human vascular cells.
Hypertension 1998;32:39–45.
Suzuki A, Mizuno K, Ino Y et al. Effects of 17 b-estradiol and
progesterone on growth-factor-induced proliferation and migration
in human female aortic smooth muscle cells in vitro. Cardiovasc Res
1996;32:516–523.
Dai-Do D, Espinosa E, Liu G et al. 17b-Estradiol inhibits proliferation and migration of human vascular smooth muscle cells: similar
effects in cells from postmenopausal females and in males. Cardiovasc Res 1996;32:980–985.
Krettek A, Fager G, Lindmark H et al. Effect of phenotype on the
transcription of the genes for platelet-derived growth factor (PDGF)
isoforms in human smooth muscle cells, monocyte-derived macrophages, and endothelial cells in vitro. Arterioscler Thromb Vasc Biol
1997;17:2897–2903.
Koster R, Windstetter U, Uberfuhr P et al. Enhanced migratory
activity of vascular smooth muscle cells with high expression of
platelet-derived growth factor A and B. Angiology 1995;46:99–106.
[26] Sterpetti AV, Cucina A, Fragale A et al. Shear stress influences the
release of platelet-derived growth factor and basic fibroblast growth
factor by arterial smooth muscle cells. Winner of the ESVS prize for
best experimental paper 1993. Eur J Vasc Surg 1994;8:138–142.
[27] Adams MR, Williams JK, Clarkson TB et al. Effects of oestrogens
and progestogens on coronary atherosclerosis and osteoporosis of
monkeys. Baillieres Clin Obstet Gynaecol 1991;5:915–934.
[28] Gray K, Eitzman B, Raszmann K et al. Coordinate regulation by
diethylstilbestrol of the platelet-derived growth factor-A (PDGF-A)
and -B chains and the PDGF receptor alpha- and b-subunits in the
mouse uterus and vagina: potential mediators of estrogen action.
Endocrinology 1995;136:2325–2340.
[29] Khachigian LM, Williams AJ, Collins T. Interplay of Sp-1 and Egr-1
in the proximal PDGF-A promoter in cultured vascular endothelial
cells. J Biol Chem 1995;270:27679–27686.
[30] Khachigian LM, Fries JWU, Benz MW et al. Novel cis-acting
elements in the human platelet-derived growth factor B-chain core
promoter that mediate gene expression in cultured vascular endothelial cells. J Biol Chem 1994;269:22647–22656.
[31] Scarpati EM, DiCorleto PE. Identification of a thrombin response
element in the human platelet-derived growth factor B-chain (c-sis)
promoter. J Biol Chem 1996;271:3025–3032.
[32] Gustafsson JA. Estrogen receptor b — getting in on the action? Nat
Med 1997;3:493–494.