Technical Sheet
Reclassification of Deinococcus
xibeiensis1 as a Heterotypic Synonym
of Deinococcus wulumuqiensis1
[email protected]
www.criver.com
© 2015, Charles River Laboratories International, Inc.
Background
Genomic Analysis
The genus Deinococcus, the type genus of the family
Deinococcaceae, comprises 49 recognized species at the
time of writing (Parte, 20142). Two of the species, namely
Deinococcus wulumuqiensis and Deinococcus xibeiensis,
were proposed simultaneously in the same publication in 2010
(Wang et al., 20101). The two type strains, designated R12 T
for D. wulumuqiensis and R13 T for D. xibeiensis, were isolated
from radiation-polluted soil and resistant to gamma radiation.
According to the original descriptions,1 the two type strains
shared 58.5 % DNA-DNA relatedness, even though they showed
high (99 %) 16S rRNA gene sequence similarity. In addition,
many phenotypic properties supported the separation of the two
strains into two independent species.
PCR amplification and sequencing of the 16S rRNA gene were
performed using 5F (TGGAGAGTTTGATCCTGGCTCAG),
531R (TACCGCGGCTGCTGGCAC), 515F
(TGCCAGCAGCCGCGGTAA), 1104R
(TCGTTGCGGGACTTAACC), 1087F (GGTTAAGTCCCGCAACGA)
and 1540R (AAGGAGGTGATCCAACCGCA) primers. The 16S
rRNA gene sequences of strains DSM 28115 T and DSM 28106
T showed 100 % sequence similarity. The newly determined 16S
rRNA gene sequences were aligned together with members
of the genus Deinococcus using EzEditor3 and analyzed
phylogenetically using mega 6.06.4 Evolutionary distance was
calculated on the basis of the Jukes and Cantor model5 (and
phylogenetic trees were inferred on the basis of the neighborjoining6 and maximum-likelihood models.7 The tree topologies
were evaluated by bootstrap analyses.8 D. wulumuqiensis DSM
28115 T and D. xibeiensis DSM 28106 T formed a single phyletic
line and the next closest relative was Deinococcus radiodurans
DSM 20539 T (Fig. 1). The two strains and D. radiodurans DSM
20539 T formed a well-supported clade (bootstrap value of 100)
that was distinct from other members of the genus Deinococcus.
However, in our recent resequencing trials, the 16S rRNA
gene sequences of the two type strains were identical, which
raised the possibility that the two species might be heterotypic
synonyms. Thus, we decided to re-evaluate the taxonomic
relationship of D. xibeiensis and D. wulumuqiensis by examining
genomic and phenotypic properties.
Analysis
The type strains of the two species were obtained from DSMZ
(D. wulumuqiensis DSM 28115 T and D. xibeiensis DSM 28106 T)
and maintained on tryptone-glucose-yeast extract (TGY) medium
at 30 °C as described previously.1 The phenotypic characteristics
were examined using API 20NE and API ZYM kits. The two
test strains demonstrated exactly the same profiles in the API
galleries tested in this study. The detailed results of biochemical
tests are presented in the species description.
Fig. 1.
Neighbor-joining tree based on 16S rRNA gene sequences
showing relationships among strains D. wulumuqiensis
DSM 28115T and D. xibeiensis DSM 28106T and members
of the genus Deinococcus. Numbers at nodes are given as
percentages and represent the levels of bootstrap support
(>70%) based on neighbor-joining analyses of 1000 resampled
datasets. Filled circles indicate that the corresponding nodes
(groupings) are also recovered in the maximum-likelihood tree.
Bar, 0.01 nucleotide substitutions per position.
Biochemical Tests Description
The characteristics of this species are as described by Wang et
al.1, with the following amendment: Weakly hydrolyses gelatin,
but not aesculin. Does not reduce nitrate or ferment d-glucose.
Does not produce indole, arginine dihydrolase, urease or
β-galactosidase. Assimilates d-glucose and malic acid, but
not arabinose, mannose, mannitol, N-acetylglucosamine,
maltose, gluconate, caprate, adipate, citrate or phenylacetate.
Produces alkaline phosphatase, esterase (C4), esterase lipase
(C8), leucine arylamidase, acid phosphatase, naphthol-AS-BIphosphohydrolase and α-glucosidase, but not lipase (C14),
valine arylamidase, cystine arylamidase, trypsin, α-chymotrypsin,
α-galactosidase, β-galactosidase, β-glucuronidase,
β-glucosidase, N-acetyl-β-glucosaminidase, α-mannosidase or
α-fucosidase.
Reclassification of Deinococcus xibeiensis as a Heterotypic Synonym of Deinococcus wulumuqiensis
Technical Sheet
To re-evaluate the genomic relatedness of the two species,
the average nucleotide identity (ANI9,10) between the genome
sequences of D. wulumuqiensis R12T (APCS01000000; Xu et al.,
201311) and D. xibeiensis R13T (AXLL01000000; Hu et al., 201312)
was calculated by using jspecies 1.2.11.13 In the given pair of
genomes, the ANI was 99.9 %. An ANI of 94-96 % has been
suggested as the substitute for a 70 % DNA–DNA hybridization
value.10, 11, 13, 14, 15
MALDI-TOF Analysis
For matrix-assisted laser desorption/ionization time-of-flight mass
spectrometry (MALDI-TOF MS) analysis, bacterial extracts were
prepared from fresh colonies using the extraction procedure
recommended by the manufacturer (Bruker Daltonics). Extracts
were pipetted onto a polished steel target plate and, once airdried, overlaid with a saturated α-cyano-4-hydroxycinnamic acid
(CHCA) matrix solution. AutoXecute acquisition control software
was used to automatically acquire sample spectra (1000 spectra
per spot) on a Bruker Daltonics autoflex™ equipped with a
337 nm nitrogen laser operating in linear positive mode (delay:
170 ns; ion source 1 (IS1) voltage: 19.5 kV; ion source 2 (IS2)
voltage: 18.17 kV; lens voltage: 7 kV; mass range: 2 kDa to 20
kDa) and running flexControl 3.3. Spectra were imported into
flexAnalysis 3.3 to normalize and align mass peaks through
calibration, baseline subtraction and mass-peak smoothing
using manufacturer’s parameters. Spectra were also imported
into MALDI Biotyper 3.1 offline client software, where a gel-view
comparison of spectra was generated using default parameters.
The spectra acquired from the MALDI-TOF analysis of
D. wulumuqiensis and D. xibeiensis were compared with those
from D. radiodurans DSM 20539T and Deinococcus ficus DSM
19119T. Visual comparison of the protein profile alignment and
gel-view comparison indicate that the spectra acquired from
D. wulumuqiensis and D. xibeiensis exhibit nearly identical
patterns that match more closely to each other than to the
patterns from other closely related strains: D. radiodurans DSM
20539T T or D. ficus DSM 19119T.
Conclusion
On the basis of the genomic and phenotypic results presented
in this study, we conclude that D. xibeiensis is indistinguishable
from D. wulumuqiensis at the species level. According to Rule
42 of the Bacteriological Code,16 if two taxa of the same rank are
united and the names are of the same date, the priority of names
is determined by the author who first unites the taxa. Thus, we
propose D. wulumuqiensis should be used for the united taxon,
with D. xibeiensis as a subjective heterotypic synonym.
References
1. Wang W., Mao J., Zhang Z., Tang Q., Xie Y., Zhu J., Zhang L.,
Liu Z., Shi Y., Goodfellow M. (2010). Deinococcus wulumuqiensis
sp. nov., and Deinococcus xibeiensis sp. nov., isolated from
radiation-polluted soil. Int J Syst Evol Microbiol 60, 2006-2010.
[PubMed].
2. Parte A. (2014). List of prokaryotic names with standing in
nomenclature. http://www.bacterio.net.
3. Jeon Y. S., Lee K., Park S. C., Kim B. S., Cho Y. J., Ha S. M.,
Chun J. (2014). EzEditor: a versatile sequence alignment editor
for both rRNA- and protein-coding genes. Int J Syst Evol Microbiol
64, 689-691.
4. Sohpal V. K., Dey A., Singh A. (2010). Mega biocentric software
for sequence and phylogenetic analysis: a review. Int J Bioinform
Res Appl 6, 230-240.
5. Jukes T. H., Cantor C. R. (1969). Evolution of protein molecules.
In Mammalian Protein Metabolism, vol. 3, pp. 21-132. Edited by
Munro H. N. New York: Academic Press.
6. Saitou N., Nei M. (1987). The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Mol Biol Evol 4,
406-425.
7. Felsenstein J. (1993). phylip (phylogenetic inference package)
version 3.5c. Distributed by the author. Department of Genome
Sciences, University of Washington, Seattle, USA.
8. Felsenstein J. (1985). Confidence limits on phylogenies: an
approach using the bootstrap. Evolution 39, 783-791.
9. Goris J., Konstantinidis K. T., Klappenbach J. A., Coenye T.,
Vandamme P., Tiedje J. M. (2007). DNA-DNA hybridization values
and their relationship to whole-genome sequence similarities. Int J
Syst Evol Microbiol 57, 81-91.
10. Konstantinidis K. T., Tiedje J. M. (2005). Genomic insights that
advance the species definition for prokaryotes. Proc Natl Acad Sci
USA 102, 2567-2572.
11. Xu X., Jiang L., Zhang Z., Shi Y., Huang H. ( 2013 ). Genome
sequence of a gamma- and UV-ray-resistant strain, Deinococcus
wulumuqiensis R12. Genome Announc 1, e-00206-13.
Reclassification of Deinococcus xibeiensis as a Heterotypic Synonym of Deinococcus wulumuqiensis
12. Hu Y., Xu X., Song P., Jiang L., Zhang Z., Huang H. ( 2013 ).
Draft genome sequence of Deinococcus xibeiensis R13, a new
carotenoid-producing strain. Genome Announc 1, e00987-13.
13. Auch A. F., vonJan M., Klenk H.P., Goker M. (2010). Digital
DNA-DNA hybridization for microbial species delineation by
means of genome-to-genome sequence comparison. Stand
Genomic Sci 2, 117-134.
14. Kim M., Oh H. S., Park S. C., Chun J. (2014). Towards a
taxonomic coherence between average nucleotide identity and
16S rRNA gene sequence similarity for species demarcation of
prokaryotes. Int J Syst Evol Microbiol 64, 346-351.
15. Richter M., Rosselló-Móra R. (2009). Shifting the genomic gold
standard for the prokaryotic species definition. Proc Natl Acad Sci
USA 106, 19126-19131.
16. Lapage S. P., Sneath P. H. A., Lessel E. F., Skerman V. B. D.,
Seeliger H. P. R., Clark W. A. (editors) (1992). International Code of
Nomenclature of Bacteria (1990 Revision). Bacteriological Code.
Washington, DC: American Society for Microbiology.
[email protected]
www.criver.com
© 2015, Charles River Laboratories International, Inc.