Lesson Plan
Day:
​
​
​
​Date:
​
​
​
​
​Class: 5
th
Year
Length of class: 80 mins
​Subject: Biology – Genetics
Topic: DNA structure, replication and profiling.
Introduction: Within the topic of genetics and the structure of DNA, many misconceptions
can easily arise from prior knowledge acquired by students from social media, media and
home, and ill-directed information in lessons. This is why it is integral to the teaching of this
topic that misconceptions be addressed and fixed while building this information for students,
so that they do not leave second level to study science at third level with incorrect
information.
Previous Knowledge and Experience:For this topic, I would expect students would have
limited previous knowledge. They should be familiar with terms and concepts used within the
topic from previous biological cell lessons. For example, all students should be familiar with
cell structure and the fact that DNA is located within the nucleus of the cell, they should also
be able to recognise the difference between chromosomes and genes, and how they are
linked. With regards to genes, students should also be familiar with the concept of a genome
and gene expression, and should be able to link this to the structure of DNA throughout the
lesson. Students will also have knowledge on cell division, including the difference between
mitosis and meiosis, and how mutations such as cancer can occur from these processes.
Students should also have previous knowledge in the area of classification and heredity, and
should be familiar with the concept of variation between and within species. All of this
previous knowledge that the students should have, is outlined by the Leaving Certificate
Biology syllabus under the topic codes of: 2.1.2, 2.1.3, 2.1.4, 2.3.1, 2.3.2, 2.3.3, 2.3.4, 2.3.5,
2.3.6, 2.3.7, 2.3.8, 2.5.1, 2.5.2, 2.5.3 (NCCA 2001).
Some knowledge the students possibly have surrounding this topic that may not be linked to
specific previous lessons, may be the shape of a DNA molecule. This could be common
knowledge picked up from television, or perhaps posters found in the science room/lab. I
would expect all students to have an idea of the shape of a DNA molecule, but perhaps they
may not know the specific name – double helix.
Knowledge that I would not expect the students to be aware of would be the fact that DNA
can coil up, i.e. is not in straight lines. Also, students may not know of the detailed structure
of these strands, e.g. nucleotides, amino acids etc. I would also expect that they would not be
aware of the four bases that make up DNA, their names, and how they specifically combine –
adenine, cytosine, guanine, and thymine. I would also presume that the students would be
unaware of codons within DNA for specific amino acids, and similarly I would expect they
would not be aware of non-coding DNA.
Aims:
To introduce the topic of DNA structure, details of how these structures combine, and
the significance of these combinations.
To overcome pupils misconceptions surrounding DNA structure and its purpose.
Objectives:
Pupils should gain an understanding of how the structure of DNA is imperative to its
function in sustaining life.
Pupils should acquire an interest in and appreciation of the importance of DNA in cell
structure, and why it should be studied.
Pupils should be able to overcome any misconceptions identified in the lesson, and
form an accurate, scientific understanding of the topics covered in the lesson.
Pupils should improve their communication skills through the use of group-work in
the lesson
Pupils should improve their literacy skills in combining sequences and mastering the
spelling of the bases contained in DNA.
Subject Matter: Students will learn firstly the basic structure of DNA, double helix shape,
containing the four bases adenine (A), cytosine (C), guanine (G), and thymine (T). They will
also learn that these bases are combined in a specific sequence,A to T and C to G, and why
this sequence is so important in the formation of DNA. They will then learn a more detailed
structure of DNA, including nucleotide structure (phosphate, sugar, and nitrogen base), how
the nitrogen bases are categorised into purines (adenine and guanine) and pyrimidines
(thymine and cytosine). Students will also learn about the hydrogen bonding that occurs
between the base pairs, and the significance of the helical shape. Students will also learn
about the combinations that these bases can make, creating genetic code, and the implications
of this genetic code.
Resources: Mini whiteboards, whiteboard markers, activity
sheets, Power-point
slideshow,coloured Lego, concept cartoons, DNA sweets model materials ( 10 groups – 2
liquorice strands, white marshmallows, pink marshmallows, red gummy bears, green gummy
bears, and cocktail sticks), DNA extraction equipment (Kiwi, washing-up liquid (not the
concentrated type), blender, distilled water, sharp knife, table salt (3 g), chopping board,
protease enzyme e.g. trypsin (1%), coffee filter paper, ethanol at freezer temperature,
droppers, water bath (60 °C), spatula, ice-water bath, plastic syringe (10 cm3), 2 beakers (250
cm3), timer, boiling tube, test tube rack, graduated cylinder (100 cm3), retort stand, glass rod,
electronic balance, large funnel, weigh boat, glass stirrer, plastic syringe, disposable gloves,
thermometer.).
Assessment: To assess what the students learn successfully throughout the lesson, I will use a
mixture of higher and lower order cognitive questioning, using various levels of Bloom’s
taxonomy, at the beginning and end of the lesson. During the lesson there will be hands on
activities which will assess both knowledge obtained in the lesson, and develop and assess
psychomotor skills. By using activity sheets in conjunction with these practical activities
students’ literacy skills will also be assessed. A keyword chart will also be utilised during the
lesson as well as a homework assignment of creating a graphic organiser, through these tasks
assessment for learning will be addressed to enhance students’ learning.
Classroom Management:The main aspect to classroom management in this lesson will be
using direct instruction to avoid confusion and disruption during group-work tasks. Also
monitoring throughout the tasks by circulating the room will keep students on task, and will
allow time for evaluation of students’ progress. As usual, the seats for this class are assigned
according to the seating chart drawn up, to avoid disruption due to pairing of certain students.
To keep tasks running smoothly, and to help time keeping, an online timer is used to assign
time in which each task should be completed. A strike system will also be implemented with
the class, so that once three strikes are built up due to bad behaviour during the lesson an
extra question is added for homework.
Safety Precautions: The main safety precaution for this lesson is to have a tidy bag system, so
that every student’s bag is placed beneath their desk so when moving around during tasks no
one will trip over them. There is also a risk assessment attached for the experiment carried
out as a demonstration at the beginning of the lesson.
Time Pupil Activity
Teacher Activity
References
Goal Conception for Set Induction:
Common Misconception in relation to Set
• The basic structure of DNA – double helix, Induction:
• That DNA, in this helical structure, will
ladder like structure.
• Naming the bases contained in a molecule
stay straight and upright, that it won’t
of DNA,adenine (A), cytosine (C), guanine
coil up around itself and other DNA
(G), and thymine (T),and knowing how
molecules in order to fit in the nucleus
they match up within the molecule A to T
of the cell.
• That the bases can bond to any other
and G to C.
that they choose, that they do not follow
rules regarding bonding.
Set Induction: (50 minutes)
Pupils will observe the sample being
5 mins passed around the class in a test tube,
and make suggestions as a whole class
as to what the sample is, by raising
their hands, they will also be guided by
questioning as to what it is.
What could this substance be?
What does it remind you of?
Using the sample
prepared before the
lesson, pass the
sample of DNA
around the class for
observation, without
saying what the
sample is. Ask
questions as to what
Once identified as DNA, through class the sample could be.
discussion students will identify a way
5 mins to isolate the molecule briefly, as
By use of probing
students will have an opportunity to
questions, as listed
carry out this experiment at a later
below, get the students
lesson. From observing this sample of to draw up their own
DNA hopefully the misconception of image of what a DNA
DNA being strictly straight in nature as molecule looks like.
in diagrams will be overcome.
Then students through probing
questions will identify their prior
knowledge surrounding the structure of
DNA, which should mostly consist of a
double helix shape, which will be
drawn up on the board by the student
which suggests it.
15
mins
Then students will view a power point
presentation going through the basic
structure of DNA which should mirror
what was suggested from the previous
discussion.
Students will learn about the bases that
make up DNA, adenine (A), cytosine
(C), guanine (G), and thymine (T), and
then how they match up within the
molecule A to T and G to C. Once this
By having a hands up
to answer questions, a
general view of how
many student’s feel
confident in their
prior knowledge is
obtained.
Engage: By using a
tangible example of
the DNA sample,
student’s interest will
be sparked as to why
this substance is
deemed important.
“students are
supposed to cultivate
scientific patterns of
thinking, logical
reasoning, curiosity,
openness to new
ideas and scepticism
in the evaluation of
claims and
arguments.” – (SyhJong, 2007, p.1)
Present Power-point
slides about the helical
structure of DNA,
“develop inquiry
including the naming abilities through their
of the bases, and how own experiences with
they match up together conducting
to form the rungs of inquiry science
the DNA ladder.
(NRC, 2000).”–
is covered in the Power-point, students Then hand out activity (Morrison and Estes,
have the opportunity to answer
sheet 1, and explain 2007, p. 1)
question which may have arisen.
the task of writing a
An activity sheet 1 is then handed out matching sequence of Explain: Students’
to each student on which they match
DNA in which the
are formally
the base pairs to various sequences of students must
presented with the
DNA. When completed these sheets are understand how the
information, with the
swapped with the person beside them base pairs match up, aim of introducing
and is corrected through an answer
without the aid of the correct conception of
sheet on the Power-point.
Power-point slides.Set the topic.
a timer through the
projector so that
Explore: Through
students are aware of the activity sheet
the time remaining to student’s will have
complete the task.
the opportunity to
Circulate the room as play around with the
students complete the pairing of the bases,
activity sheet, and then and develop an
go through the
understanding of the
answers.
pattern in which the
Once this activity is complete, the
bases bond.
5 mins students will then listen to teacher
Explain the set up of
instructions about the following task, the DNA sweet model,
building an edible model of DNA
and write up chart
regarding which sweet
represents which
section of the DNA
Students will then, in pairs, build a
structure.
model of DNA, using two strands of
20
liquorice as the backbone strand, white Circulate the room as Explore: Student’s
mins marshmallows to represent adenine,
students carry out the will have the
pink marshmallows to represent
task, answering any
opportunity to create
guanine, a red gummy bear to represent questions that arise.
their own models of
thymine, and a green gummy bear to Also set a timer
DNA, thus exploring
represent cytosine, using cocktail sticks through the projector the concept of the
to represent the bonds between the
so that students are
structure of the
bases. Hopefully overcoming the
aware of the time
molecule – making
misconception that the bases will bind remaining to complete the abstract concrete.
to anything other than the allotted base the task.
pair.
Key Questions for Set Induction:
• What could this substance be?
• What does it remind you of?
• Do you think this is found in all organisms?
• Why would this substance be important in organisms?
• What function does DNA have?
• Could we live without it?
• What shape do you think DNA has?
• (Once shape is drawn on the board) Why is it that the
substance I passed around didn’t look like this?
• How could we see that kind of structure then?
• Why do those bases need to bind to specific pairs?
• If they were to bind to the wrong one what would happen?
• So using the materials here (sweets) how could we make a
model of this molecule to show other students, or even
primary school children?
Goal Conception for Development:
Common Misconception in relation to
• The detailed structure of DNA –
development:
• Structure of the nucleotides.
nucleotides (phosphate, sugar, and
nitrogen base), how the nitrogen bases are • Differences between the purines and
categorised into purines (adenine and
pyrimidines.
guanine) and pyrimidines (thymine and • Hydrogen bonding being the only type of
cytosine).
bonding that occurs in DNA molecules.
• Hydrogen bonding that occurs between • Genetic code can be read using a
the base pairs, and the significance of the
microscope.
• Genetic code is only ever found in one
helical shape.
• Genetic code, and the implications of this
sequence, without variation.
code.
Development: (20 minutes)
Using the models students have just
Present Power-point Explain:Students’
5 mins created, they will then view a Power- slides aboutthe
are formally
point presentation about the detailed
detailed structure of presented with the
structure of DNA, including the
DNA, including the
information, with the
structure of nucleotides, the presence of structure of
aim of introducing
hydrogen bonds between base pairs,
nucleotides, the
correct development
while referring to the sweet
presence of hydrogen of the topic.
models.How the nitrogen bases are
bonds between base
categorised into purines (adenine and pairs, while referring
guanine) and pyrimidines (thymine and to the sweet models.
cytosine).
15
Explore: By
mins Then by answering probing questions, Ask probing questions allowing time for
students will gather any previous
about how DNA bases students’ to explore
knowledge or knowledge they can now bind together, and if it the different
piece together about genetic code –
of any significance to combinations that the
different combinations of the base pairs the structure of DNA, Lego blocks can
leading to different traits.
if the sequence is
make to represent the
Then to develop literacy skills, students always going to be the sequencing of DNA,
will combine various colours of Lego same for every human, students will create a
blocks and make note of how many
if so what are the
concrete idea based
different combinations they can create, implications (clones). around an abstract
and write this number on their
Then once these
topic.
individual mini whiteboards. These
questions and
whiteboards are then held up once the misconceptions are
Elaborate: By
online timer runs out for this activity, addressed, Lego
explaining and
and this will hopefully address the
blocks are handed out presenting the
misconception that there is only one
and then directions are combinations created
type of sequence for DNA.
given as to how these with their Lego
blocks represent bases, pieces, students’ will
and how they bind
further develop their
together in different knowledge
sequences to form
surrounding this
DNA.
topic.
“generally studentoriented, to
working with openended tasks and
doing scientific
investigations. The
aims
of these may
generally be
described as
enhancing science
learning through
stimulating students'
interest and
excitement.” – (Kind
and Kind, 2007,p.26)
Key Questions for Development:
• What are the names of the nitrogen bases that will make up
a nucleotide?
• What do I mean when I say a hydrogen bond?
• Why isn’t it an oxygen bond?
• Find how many combination of Lego you can make
• How many were made?
• What do you think this represents in terms of DNA?
• Why is it that sequences need to vary like this?
• What does this lead to?
• Are variations in genetic code always a good/bad thing?
Conclusion: (10 minutes)
10
mins
Students will end the lesson by taking
part in a whole class activity involving
turn taking at writing on the
whiteboard, filling out DNA sequence,
and while doing this students will need
to use the abbreviation to write the
matching base sequence as well as
saying the full word in order to
familiarise themselves with the
pronunciation of the bases contained in
Direct the whole class
activity of creating the
matching DNA
sequence on the board
by calling on students
to come to the board.
During this activity
any misconceptions or
confusing surrounding
the topic that show up
Evaluate: During
this time the teacher
can see how the topic
is being perceived by
the students’ by
seeing how they can
use the information
learned to tackle the
questions put to them.
DNA. This activity will allow for the will be addressed
Elaborate: Students’
students to address any misconceptions, before the end of the will have the
and make this abstract notion concrete lesson.
opportunity to deepen
before finishing the lesson.
Similarly the use of a their understanding of
Students will also answer concept
concept cartoon here the topic area, while
cartoons surround the information
will address any
addressing
covered in the lesson using their mini misconceptions, which misconceptions and
whiteboards, which will address
will be seen by
overcoming these
possible misconceptions that may arise answers given on the through the use of
in the lessons.
mini whiteboards.
concept cartoons.
“Using concept
cartoons is one of the
ways that reveal
students’ existing
knowledge and
remedying
misconceptions about
Scientific
phenomena.” –
(Akamca, Ellez,
Hamurcu, 2009, p. 6)
Reference List
• Akamca, G. O., Ellez, A. M., Hamurcu, H. (2009) ‘Effects of computer aided concept
cartoons on learning outcomes’, Science Direct [online], 9 January 2009, p.1-6,
available: www.ul.ie/~library, [accessed 21 April 2014].
• Kind, P. M., Kind, V. (2007) 'Creativity in Science Education: Perspectives and
Challenges for Developing School Science', Studies in Science Education [online],
p.43: 1, 1 — 37, available: DOI: 10.1080/03057260708560225[accessed 21 April
2014].
• Morrison, J. A., Estes, J. C. (2007) ‘Using Scientists and Real-World Scenarios in
Professional Development for Middle School Science Teachers’, Journal of Science
Teacher Education [online], 17 January 2007, p.18:165–184, available: DOI:
10.1007/s10972-006-9034-3 [accessed 21 April 2014].
• NCCA, (2001) Leaving Certificate Biology Syllabus, Dublin, Ireland: Government of
Ireland.
• Syh-Jong, J. (2007)'A study of students' construction of science knowledge: talk and
writing in a collaborative group',Educational Research [online], 1 March 2007,
p.49:1,65 — 81, available: DOI: 10.1080/00131880701200781 [accessed 21 April
2014].
Resources
Risk Assessment:
Activity
Name of
Teacher
Hazard
identified
Isolate DNA from a plant tissue
Nature of
​
risk Who is at risk Control measure(s) to
reduce risk
Onion
Consumption
Washing-up
liquid (not the
concentrated
type)
Consumption
Blender
Laceration
Sharp knife
Laceration
Table salt (3 g)
Consumption
Protease
enzyme e.g.
Consumption
All present
Use only at bench. No
running/ walking around the
lab with glassware.
Verbally warn all students of
the nature of risk and monitor
all students at all times.
Ensure caution when using all
equipment in the lab.
Insist on the use of gloves at
all times.
trypsin (1%)
Ethanol at
freezer
temperature
Narcotic in large
quantity, Highly
Flammable
vapour,
Burns
Water bath (60
°C)
Flesh Wound
Beakers
Flesh Wound
Boiling tube
Flesh Wound
Graduated
cylinder
Flesh Wound
Glass rod
Flesh Wound
Thermometer
Additional
control
measures
Personal
protective
equipment
required
Waste disposal
Emergency
action
Teacher
signature
All spills are to be cleaned up immediately using sand where
available, and using gloves as an extra precaution
White coat, safety glasses, gloves, and appropriate footwear
Solutions will be poured down the sink with plenty of water as it is
safe to do this with the chemicals used in this experiment.
Date-
Power-point slides:
(Attached)
Activity Sheet 1:
Find the matching bases for the following:
1) AAATTGCGTCGATGATCGATAGCTGAGGAAG
2) GGCTAGATGCTAGCTAGCTAGATAGATAGCA
3) ACGCTAGCTAGTGATAGGGTTAGGAATTCGC
4) CGTAGCATGCATGCATGCTAGCATGCTAGCG
5) ATGCTGCATGCATACGATGCTGATGACTGAT
6) AAACGATTAGATAGCTATCGATCGCCGCCTA
7) GTCAGTCGATGCATCGATGCATGCTAAGAGG
Concept Cartoon:
DNA Model Activity:
Lego genetic sequence:
(https://www.google.ie/search?
q=dna+model+using+sweets&source=lnms&tbm=isch&sa=X&ei=OONcUu5BKTY7AbhmYBY&ved=0CAYQ_AUoAQ&biw=1280&bih=894#q=dna+sqeuence+lego&tbm=isch&facrc=_
&imgdii=_&imgrc=qTfWAMjqXgTo2M%253A%3BHTq6Ip_2uQGA7M%3Bhttp%253A%252F%252Fwww.four
h.purdue.edu%252Fgame%252Fimages%252FLesson3%252Flego12.gif%3Bhttp%253A%252F%252Fwww.fo
ur-h.purdue.edu%252Fgame%252Flesson3.html%3B200%3B247)