MAJOR ARTICLE
Protracted Sterile Protection
with Plasmodium yoelii Pre-erythrocytic
Genetically Attenuated Parasite Malaria Vaccines
Is Independent of Significant Liver-Stage
Persistence and Is Mediated by CD8+ T Cells
Alice S. Tarun,1 Ronald F. Dumpit,1 Nelly Camargo,1 Mehdi Labaied,1 Pu Liu,1 Akihide Takagi,1 Ruobing Wang,1
and Stefan H. I. Kappe1,2
1
Seattle Biomedical Research Institute and 2Department of Pathobiology, University of Washington, Seattle
(See the article by Jobe et al., on pages 599–607.)
Irradiation-attenuated sporozoite vaccinations confer sterile protection against malaria infection in animal
models and humans. Persistent, nonreplicating parasite forms in the liver are presumably necessary for the
maintenance of sterile immunity. A novel vaccine approach uses genetically attenuated parasites (GAPs) that
undergo arrested development during liver infection. The fate of GAPs after immunization, their persistence
in vaccinated animals, and the immune mechanisms that mediate protection are unknown. To examine the
developmental defects of genetically attenuated liver stages in vivo, we created deletions of the UIS3 and UIS4
loci in the Plasmodium yoelii rodent malaria model (Pyuis3[⫺] and Pyuis4[⫺]). The low 50% infectious dose
of P. yoelii in BALB/c mice provides the most sensitive infectivity model. We show that P. yoelii GAPs reach
the liver, invade hepatocytes, and develop a parasitophorous vacuole but do not significantly persist 40 h after
infection. A single dose of Pyuis4(⫺) sporozoites conferred complete protection, but full protection by
Pyuis3(⫺) sporozoites required at least 2 immunizations. CD8+ T cells were essential for protection, but CD4+
T cells were not. Our results show that genetically distinct GAPs confer different degrees of protective efficacy
and that live vaccine persistence in the liver is not necessary to sustain long-lasting protection. These findings
have important implications for the development of a P. falciparum GAP malaria vaccine.
Plasmodium parasite species that are transmitted by the
bite of infected anopheline mosquitoes cause malaria
in humans and other mammals. The toll malaria infection takes on the human population of developing
Received 10 November 2006; accepted 16 February 2007; electronically published 9 July 2007.
Potential conflicts of interest: S.H.I.K. is partially supported by the Bill and
Melinda Gates Foundation through the Foundation at the National Institutes of
Health Grand Challenges in Global Health Initiative. He is an inventor listed on
US Patent 7,22,179 and international patent application PCT/US2004/043023, both
titled “Live Genetically Attenuated Malaria Vaccine.” All other authors report no
potential conflicts.
Reprints or correspondence: Stefan H. I. Kappe, Seattle Biomedical Research
Institute, 307 Westlake Ave. N., Ste. 500, Seattle, Washington 98109-5219 (Stefan
[email protected]).
The Journal of Infectious Diseases 2007; 196:608–16
2007 by the Infectious Diseases Society of America. All rights reserved.
0022-1899/2007/19604-0018$15.00
DOI: 10.1086/519742
608 • JID 2007:196 (15 August) • Tarun et al.
countries is staggering, killing millions each year [1].
Mosquito-inoculated sporozoite stages of the parasite
invade the liver and undergo an intracellular replication
phase in hepatocytes to produce merozoite stages,
which initiate the erythrocytic cycle responsible for the
pathology of malaria [2]. The growth and replication
of liver stages is not associated with any clinical symptoms and in humans requires ∼7 days, which provides
a good target for anti-infection immune responses. Indeed, immunization with whole live parasites completely
protects against the initial hepatic stage. In mammals,
this was first shown using rodent malaria irradiationattenuated sporozoite immunizations, which induced
protection against challenge with infectious sporozoites
[3]. The irradiated sporozoite rodent malaria models
have made critical contributions to our understanding
of the basic immune mechanisms that mediate sterile
protection against infection [4, 5]. The success of the experimental sporozoite vaccine model led to trials with irradiated
sporozoites of Plasmodium falciparum. The trials demonstrated
complete and long-lasting sterile protection in humans as well
[6], indicating that protection by vaccination with live attenuated sporozoites is a universal principle. A vaccine based on
a single protein component of sporozoites—the circumsporozoite protein (CSP) of P. falciparum—has undergone extensive clinical testing [7] but has not achieved complete protection. Recently it was proposed that because attenuated
sporozoites remain the only fully protective experimental vaccine, their large-scale development and licensure as a deployable
malaria vaccine should be pursued [8]. Gamma irradiation
causes random damage to DNA and, when correctly dosed,
allows sporozoites to maintain their infective properties [9, 10].
DNA damage, however, likely results in cell-cycle arrest of the
replicating liver stage and, thus, in aborted development early
during infection [10]. Inactivated sporozoites alone are not
protective [11], which shows that biological functionality during the initial stages of sporozoite infection is critical for the
induction of protection. Furthermore, in P. berghei, the persistence of intrahepatocytic parasites is necessary for the maintenance of long-lasting protection [12].
Using the P. berghei model, we have recently shown that
deletion of the single-copy genes UIS3 and UIS4 leads to specific
defects in early parasite liver-stage development in in vitro hepatocyte infections [13, 14]. These studies and other work [15]
showed that attenuation of the malaria parasite by precise genetic manipulation is possible (genetically attenuated Plasmodium parasites [GAPs]). Immunization of mice with P. berghei
GAPs leads to complete protection against subsequent infectious sporozoite challenge [13–15].
To further study GAP infections in vivo and to compare the
protective efficacy of distinct GAPs, we constructed UIS3 and
UIS4 deletions in the P. yoelii rodent malaria parasite (Pyuis3[⫺]
and Pyuis4[⫺]). P. yoelii is highly infectious to BALB/c mice,
exhibiting a low ID50 of !10 sporozoites [16, 17]. This models
the high infectivity of P. falciparum sporozoites for humans [18]
better than the P. berghei model, which requires at least 10 times
more sporozoites to infect mice [16]. Hence, P. yoelii is arguably
a more relevant model for malaria vaccine studies. Here, we show
that P. yoelii GAP vaccines do not persist in the liver of immunized mice but confer sterile protection for at least 6 months.
GAP-mediated protection is strictly dependent on CD8+ T cells.
Our studies also reveal that differences in the protective efficacy
of distinct GAP vaccines are made apparent when single-dose
immunization regimens are used.
MATERIALS AND METHODS
Experimental animals and cell lines. Female Swiss Webster
(SW) and BALB/c mice (6–8 weeks old) for in vivo infection
experiments were purchased from Harlan, and BALB/c mice
(6–8 weeks old) for immunization experiments were purchased
from Jackson Laboratories. Animal handling was conducted in
accordance with Institutional Animal Care and Use Committee–approved protocols. P. yoelii 17 XNL (a nonlethal strain)
clone 1.1, Pyuis3(⫺), and Pyuis4(⫺) parasites were cycled between Anopheles stephensi mosquitoes and SW mice. Infected
mosquitoes were maintained on sugar water at 24C and 70%
humidity. Hepa1-6 (ATCC CRL-1830) and HepG2:CD81 [27]
hepatoma cells were used for in vitro assays.
Generation of Pyuis3(5) and Pyuis4(5) parasites.
Deletions of PyUIS3 and PyUIS4 were performed by constructing replacement plasmids in vector b3D.DT.H Db (provided
by Dr. A. Waters, Leiden University, Leiden, The Netherlands)
containing the pyrimethamine-resistant Toxoplasma gondii
dhfr/ts gene. Using oligonucleotide primers PY3REP1 forward
(F) and PY3REP2 reverse (R), a 500-bp fragment was amplified
encoding the 5 untranslated region (UTR) of PyUIS3, and a
similar-sized fragment encoding the 3 UTR was amplified using
PY3REP3F and PY3REP4R primers with P. yoelii genomic DNA
as the template (table 1 shows oligonucleotide primer sequences
used in the study). Two fragments were amplified using primers
PY4REP1F and PY4REP2R for the 1-kb fragment containing
the 5 UTR sequence and PY4REP3F and PY4REP4R for the
600-bp fragment containing the 3 UTR sequence of PyUIS4,
with P. yoelii genomic DNA as template. The 5 UTR fragments
were cloned into the KpnI and HindIII sites of the vector. The
3 UTR fragments were cloned into the EcoRI and BamHI sites.
The resulting plasmids were digested with KpnI and XbaI to
release the replacement fragment used for transfection. Replacement knockout parasites, as indicated above, are referred
Table 1. Polymerase chain reaction oligonucleotide primer sequences used in the study.
Sequence (5r3)
Primer
PY3REP1F
PY3REP2R
ATATGGTACCATTTAAATGTGTTAAGTGACTATGTTAGCA
ATATAAGCTTATCTTTGAGTCACAATGATAAATGTG
PY3REP3F
ATATGAATTCATTTTCTTAAAGAACAATATCAACCAAA
PY3REP4R
ATATGGATCCATGAATCATAAACACTTTTCCAGCC
PY3REP5R
PY3RTF
AAATTATCTACCATGACGTTGTATG
AACCTTTATTCCAATCATGTCTTCCT
PY3RTR
PY4REP1F
TGCCTCAATTTTTCACATGCATAA
GGGGTACCTGGATTCATTTTTTGAT
PY4REP2R
PY4REP3F
CGGGAAGCTTTTATTCAGATGTAAT
GGGAATTCATATAATTCATTATGAGGGTAATTCAG
PY4REP4R
PY4REP5R
PY4RTF
GGGGATCCAGGTTTGCATATACGG
TTGAACTCTAAGACAATATAACTTGATATATT
CTTGCTTGTATGCACCCTGAAG
PY4RTR
GGTATGGATTTTGGACTGGGC
NOTE. F, forward; R, reverse.
Complete Protection with GAP Malaria Vaccines • JID 2007:196 (15 August) • 609
Figure 1. Targeted gene disruption of Plasmodium yoelii UIS3 and UIS4 loci (PyUIS3 and PyUIS4). A, Schematic representation of the replacement
strategy to generate the Pyuis3 (⫺) and Pyuis4 (⫺) parasites. The wild-type (wt) PyUIS3 (PlasmoDB ID: PY03011 [http://www.plasmodb.org]) or PyUIS4
(gene ID: PY00204) genomic loci were targeted with a KpnI/BamHI replacement fragment containing the 5 and 3 untranslated region (UTR) sequences
of PyUIS3 or PyUIS4 and the Toxoplasma gondii dhfr/ts–positive selectable marker. A recombination event (double crossover) resulted in replacement
of the PyUIS3 or PyUIS4 open reading frame (ORF) by the selection marker. Note that this strategy completely deleted the coding sequences (indicated
by the box). wt-specific and replacement-specific test oligonucleotide primer combinations are indicated by arrows. Expected amplicons are shown as
black lines. B, Polymerase chain reaction (PCR) genotyping analysis confirmation of the expected gene replacement using oligonucleotide primer
combinations that can only amplify from the recombinant locus (test 2). The negative wt-specific PCR confirms the absence of wt parasites in the
clonal Pyuis3 (⫺) and Pyuis4(⫺) parasite populations.
to as “Pyuis3(⫺)” and “Pyuis4(⫺)” GAPs. Transfections (Nucleofector device; Amaxa), selection, and cloning by limited
dilution of Pyuis3(⫺) and Pyuis4(⫺) parasites were performed
as described elsewhere [19]. For genotypic analysis, genomic DNA was extracted from blood-stage parasites using the
DNeasy kit (Qiagen). To demonstrate the replacement of
PyUIS3 or PyUIS4 in the transformed parasite, we used the
following sets of oligonucleotide primers (table 1). Test 1 was
demonstrated using dihydrofolate reductase–thymidilate synthase (DHFR-TS) forward [13] with PY3REP4R or PY4REP4R;
test 2 replacement was demonstrated using DHFR-TS forward
[13] with PY3REP5R or PY4REP5R; wild-type (wt) contamination was demonstrated using PY3RTF and PY3RTR primers
for PyUIS3 and PY4RTR and PY4RTR primers for PyUIS4;
episomal contamination was assessed using T7 [13] with
PY3REP3F or PY4REP3F.
To evaluate transcript expression, mosquitoes infected with
1 ⫻ 10 6 wt, Pyuis3(⫺), and Pyuis4(⫺) sporozoites were collected at day 14 after a blood meal. RNA was extracted using
Trizol (Invitrogen) and treated with DNase (Invitrogen). Firststrand cDNA was synthesized using Superscript (Invitrogen)
and used as template for polymerase chain reaction (PCR) using
PY3RTF/PY3RTR and PY4RTF/PY4RTR sets of oligonucleotide
primers (table 1).
610 • JID 2007:196 (15 August) • Tarun et al.
Phenotypic analysis of Pyuis3(5) and Pyuis4(5) parasites
in mosquito and hepatoma cells. A. stephensi mosquitoes
were infected with Pyuis3(⫺) and Pyuis4(⫺) parasites and control wt parasites by blood-feeding on infected SW mice. Infected
mosquitoes were dissected at days 10 and 14 after the blood
meal to determine the degree of infection (by analysis of midgut
oocyst load) and the mean number of sporozoites per salivary
gland (using a hemocytometer). To demonstrate host cell entry
by sporozoites, the sporozoite inside/outside indirect immunofluorescence assay (IFA) was performed [20] using Hepa 1–
6 cells and anti-CSP (2F6) antibody in combination with Alexa
Fluor 594 (red) and Alexa Fluor 488 (green) secondary antibodies. Sporozoites were counted using a fluorescence-inverted
microscope (Eclipse TE2000-E; Nikon).
In vivo Plasmodium liver stage development. For in vivo
infections, 3 ⫻ 10 6 sporozoites were injected by intravenous (iv)
tail injection into BALB/c mice. Livers were harvested at different time points, and the left and median lobes were fixed
in 4% paraformaldehyde and then cut into 50-mm sections
using a vibratome (Ted Pella). The sections were immunostained with mouse monoclonal antibodies (MAbs) against P.
yoelii CSP (2F6), heat-shock protein (HSP) 70 [21], and HEP17
[22], as well as rabbit polyclonal antibodies against UIS4 [13]
and MTIP [23]. Quantification of liver stages at the 2–24-h
Figure 2. Plasmodium yoelii Pyuis3 (⫺) and Pyuis4 (⫺) sporozoites
lacking defects in mosquito salivary gland infection and mammalian
host cell invasion. A, Histogram of mean SD nos. of salivary gland
sporozoites/mosquito, obtained at day 14 after feeding for wild-type
(wt)–, Pyuis3 (⫺)–, and Pyuis4 (⫺)–infected mosquitoes from 5 independent experiments. B, Reverse-transcriptase (RT) polymerase chain reaction
analysis using locus-specific oligonucleotide primers showing that PyUIS3
or PyUIS4 transcripts are absent in the respective knockout sporozoites.
+, RT added; ⫺, RT not added. C, Hepatocyte invasion in Pyuis3 (⫺) and
Pyuis4(⫺) sporozoites. Shown are the mean SD proportions of sporozoites located inside Hepa1-6 hepatoma cells using the inside/outside
staining assay.
time points was performed by microscopically counting the
number of liver stages with CSP antibody staining observed in
10 sections, each 50 mm thick, of the left lobe of the infected
liver. Late liver stages were quantified using the same method
with antibodies against HSP70 and merozoite surface protein
(MSP) 1.
Total RNA was extracted from remaining lobes of the liver
using Trizol and treated with Turbo-free DNase (Ambion) to
remove genomic DNA. First-strand cDNA was synthesized
from 500 ng of total RNA using the Superscript III Platinum
RT kit. For PCR, cDNA equivalent to 25 ng of RNA was used
for each reaction using the P. yoelii 18S rRNA and mouse
GAPDH primers. Real-time PCR analysis was performed on
ABI prism 7300 Sequence Detection Systems using the SYBR
Green PCR Master Mix (Applied Biosystems).
Immunization and challenge experiments. BALB/c mice
were injected iv with 50,000 or 10,000 Pyuis3(⫺) or Pyuis4(⫺)
sporozoites. Booster injections were administered 2 weeks
apart. The immunized mice were challenged by iv injection
with 10,000 wt sporozoites. Blood-stage infection was determined by the presence of parasites in Giemsa-stained blood
smears prepared daily from days 3 to 15 after challenge.
T cell depletion experiments. For in vivo depletion of CD4+
or CD8+ T cells, immune mice were injected intraperitoneally
daily, 7 days before challenge, with either 1-mg doses of antiCD4 MAb GK1.5 (TIB207; American Type Culture Collection),
0.5-mg doses of anti-CD8 MAb 2.43 (TIB210; American Type
Culture Collection), or equivalent doses of control rat IgG, as
described elsewhere [24]. The dose and regimens used in this
experiment had been previously optimized for obtaining 195%
of depletion efficiency in mice (data not shown).
Sporozoite neutralization assay. A total of 50,000 green
fluorescent protein–tagged P. yoelii parasites were preincubated
with 2F6 antibody against CSP or serum from mice immunized
with uninfected mosquito extract (mock) or P. yoelii GAP sporozoites. The preincubated sporozoites were then added to subconfluent HepG2:CD81 cells that were seeded in 8-well chambered slides (Nunc) and maintained at 37C in 5% CO2. Cells
were incubated for 44 h, after which they were trypsinized and
subjected to fluorescence-activated cell sorting.
RESULTS
Generation and life cycle characterization of Pyuis3(5) and
Pyuis4(5) GAPs. Targeted disruptions of the PyUIS3 and
PyUIS4 loci were performed using a replacement strategy with
double homologous recombination (figure 1A). After transfection of parasites, drug selection, and cloning of resistant parasites
by limiting dilution, correct gene replacement in clonal parasite
populations was confirmed by PCR typing using gene replacement–specific oligonucleotide primers (figure 1B). Pyuis3(⫺)
and Pyuis4(⫺) parasites were indistinguishable from wt parasites
with regard to blood-stage replication, gametocyte formation,
exflagellation of male gametes, transmission to mosquitoes, and
midgut oocyst sporozoite development (data not shown). The
salivary gland sporozoite loads of mosquitoes infected with
Pyuis3(⫺) and Pyuis4(⫺) GAPs were similar to those of wtinfected mosquitoes at day 14 after feeding, which indicated
normal salivary gland infection capacity (figure 2A). The lack
Complete Protection with GAP Malaria Vaccines • JID 2007:196 (15 August) • 611
of PyUIS3 and PyUIS4 transcripts was confirmed by reversetranscription PCR analysis using RNA obtained from the
Pyuis3(⫺) and Pyuis4(⫺) salivary gland sporozoites (figure 2B).
We next examined, using a cell entry assay in Hepa1-6 cells,
whether Pyuis3(⫺) and Pyuis4(⫺) sporozoites were able to
initiate the invasion of host cells. No differences were observed
in the proportion of intracellular sporozoites when we compared the Pyuis3(⫺) and Pyuis4(⫺) sporozoites with wt sporozoites (figure 2C), which indicates that sporozoite host cell
entry is not affected in GAPs.
Liver infection defects and in vivo persistence of Pyuis3(5)
and Pyuis4(5) GAPs. To compare the liver infection and
liver-stage development of wt parasites and GAPs in vivo, we
injected 3 ⫻ 10 6 sporozoites each iv into BALB/c mice and harvested livers for tissue sectioning at different time points after
infection. Indirect IFAs of fixed liver sections using antibodies
against CSP and UIS4 were used to locate liver stages for quantification and analysis. We observed a 75% and 60% reduction
in the number of liver stages of Pyuis3(⫺) and Pyuis4(⫺) GAPs,
respectively, at 2 h after infection (figure 3A). The numbers of
GAP liver stages detected in sections 24 h after infection were
reduced by 195%, compared with wt sections. GAPs were not
detectable in sections obtained 40 h after infection (figure 3A).
In addition, quantitative real-time PCR using total RNA isolated from livers infected with 3 ⫻ 10 6 GAPs (300⫻ the effective
immunization dose) at 40 h after infection did not detect significant parasite persistence (figure 3B).
Pyuis3(⫺) and Pyuis4(⫺) liver stages were morphologically
similar to wt liver stages at 6 and 12 h after infection, a time
when the intrahepatocytic transformation from elongate sporozoite to spherical trophozoites commences (figure 4A and
4B). Importantly, antibody staining of Pyuis3(⫺) liver stages
for UIS4, a resident parasitophorous vacuole membrane (PVM)
protein, showed a typical circumferential pattern, which indicates that the PVM is present in these GAP (figure 4). Pyuis4(⫺)
liver stages of course did not stain for UIS4, but we confirmed
the presence of a PVM using an antibody against another resident PVM protein, HEP17 (data not shown).
At 24 h after infection, wt liver stages had developed to the
schizont stage, notable by their significant growth and progression of nuclear divisions. By contrast, the few detected
Pyuis3(⫺) and Pyuis4(⫺) liver stages remained small and appeared to be arrested at the trophozoite stage (figure 4C). As
mentioned, these arrested GAP liver stages did not persist in
the liver. In addition to CSP, UIS4, and HEP17 staining, staining
of infected liver sections 40 h after infection with antibodies
against MSP1 and HSP70 did not reveal any detectable GAPs
in the liver at time points 140 h after infection (data not
shown).
Induction of sterile protection by Pyuis3(5) and Pyuis4(5)
GAPs. We next performed a series of immunization/challenge
612 • JID 2007:196 (15 August) • Tarun et al.
experiments using different regimens to assess the immune
protection conferred by Pyuis3(⫺) and Pyuis4(⫺) GAPs (table
2). None of the mice immunized with P. yoelii GAP sporozoites
shown in table 2 developed blood-stage infection after immunization. Each challenge experiment was performed with
parallel naive mouse controls, which developed blood-stage patency 3–4 days after sporozoite challenge (data not shown). A
single immunization of BALB/c mice with 50,000 Pyuis3(⫺)
sporozoites did not confer protection against challenge with
10,000 wt sporozoites 7 days after the immunization. Two immunizations with 10,000 Pyuis3(⫺) sporozoites were needed
to achieve complete protection. Strikingly, a single immunization of BALB/c mice with 50,000 Pyuis4(⫺) sporozoites con-
Figure 3. Plasmodium yoelii Pyuis3 (⫺) and Pyuis4 (⫺) genetically attenuated parasite (GAP) liver-stage developmental arrest and persistence
in vivo. A, Mean no. of intrahepatic parasites detected by immunofluorescence assay using anti–circumsporozoite protein monoclonal antibody
(MAb; for 2–24 h) and anti–heat shock protein 70 MAb (for 40 h) in the
livers of BALB/c mice at different time points after iv injection of
3 ⫻ 106 wild-type (wt), Pyuis3 (⫺), or Pyuis4 (⫺) sporozoites. Nos. are
mean (SD) of counting parasites in 10 discontinuous liver sections (left
liver lobe) for each time point. Reduced GAP parasite nos. are detected
in infected livers at 2 h after infection, subsequently decrease in no.,
and are not detectable at 40 h after infection. Note that wt liver stages
are exhibiting an apparent initial reduction in parasite nos., but nos.
appear to be similar 12 h after infection and at later time points. B,
Injection of 3 ⫻ 106 wt and P. yoelii GAP sporozoites into mice. After 40
h, livers were harvested and subjected to total RNA extraction and realtime polymerase chain reaction using primers specific for P. yoelii 18S
rRNA and mouse GAPDH. The relative liver stage burden is calculated
as the ratio of the no. of copies of P. yoelii 18S rRNA and mouse GAPDH.
after the last immunization. However, although a triple-immunization regimen of BALB/c mice with 10,000 Pyuis3(⫺)
sporozoites conferred complete protection against challenge
with 10,000 wt sporozoites 60 days after the last immunization,
it protected 66% of the immunized mice against a challenge
180 days after the last immunization. Together, these results
indicate that genetically distinct GAPs show significant differences in their protective efficacy that can be distinguished with
variable-dose immunizations and timing of challenge.
T cell depletion as an indication of a major role for CD8+
T cells in GAP-induced protective immunity. To determine
the effector T cells involved in the Pyuis3(⫺) and Pyuis4(⫺)
GAP–induced protection against wt sporozoite challenge, 3dose immunization experiments were done. Beginning 7 days
after the last immunization, the BALB/c mice were injected
with consecutive doses of anti-CD4+ MAbs, anti-CD8+ MAbs,
or rat IgG as a negative control. All treated mice and naive
control mice were challenged with 10,000 wt sporozoites 14
days after the last immunization. Mice depleted of CD8+ T cells
became blood-stage patent 1 day later than naive mice (mice
that did not receive a GAP vaccine). CD4+ T cell–depleted mice
remained completely protected, as did mice that received the
IgG control (figure 5A and 5B). Thus, in 2 P. yoelii GAP-BALB/
c models, sterile protection against high-dose sporozoite challenge was dependent on effector CD8+ but not CD4+ cells. The
1-day delay in patency seen in CD8+ T cell–depleted mice suggests that anti-sporozoite antibodies may also have a protective
effect. In an in vitro hepatoma cell infection assay, we observed
that preincubation of infectious sporozoites with P. yoelii GAP
immune serum caused a significant decrease in infection, compared with infections with sporozoites preincubated in mockimmunized serum (figure 5C). Immune serum from P. yoelii
GAP–immunized mice showed reactivity with sporozoites in
IFA (figure 5D).
DISCUSSION
Figure 4. Fluorescence microscopy images of Plasmodium yoelii wildtype (wt), Pyuis3 (⫺), or Pyuis4 (⫺) liver stages at 6 (A), 12 (B), and 24
(C) h after infection. Right panels show staining with anti-UIS4 antibodies,
middle panels show staining with circumsporozoite protein (CSP), and left
panels show an overlay with 4,6-diamidino-2-phenylindole hydrochloride,
which stains the nuclei. Pyuis3 (⫺) or Pyuis4 (⫺) genetically attenuated
parasites have apparently similar developmental arrests at the trophozoite
stage. Note the positive vacuolar staining for UIS4 in wt and Pyuis3 (⫺)
liver stages (scale bar, 10 mm).
ferred complete protection against challenge with 10,000 wt
sporozoites 7 days after immunization. This protection was
sustained at first challenge, 30 days after immunization.
We next determined how long GAP-induced protection is
sustained. A triple-immunization regimen of BALB/c mice with
10,000 Pyuis4(⫺) sporozoites conferred complete protection
against challenge with 10,000 wt sporozoites 60 and 180 days
Sterile protection against sporozoite-induced malaria infection
across a range of Plasmodium species/host combinations is only
achieved by vaccination with live attenuated sporozoites [3, 6,
25, 26]. Here, we used the P. yoelii–BALB/c model to explore
the use of GAPs as live vaccines.
Deletion of the UIS3 and UIS4 locus in P. yoelii generated
Pyuis3(⫺) and Pyuis4(⫺) parasite lines that each showed specific defects only in productive liver infection and therefore
appeared to be phenotypically similar to our P. berghei GAPs
described elsewhere [13, 14]. However, the high infectivity of
P. yoelii sporozoites in BALB/c mice [16, 19] allowed us to
examine the persistence of GAPs in vaccinated mice quantitatively. Furthermore, to our knowledge, we provide the first
data on GAP protective efficacy against sporozoite challenge in
the P. yoelii–BALB/c model. This model’s sporozoite infectivity
Complete Protection with GAP Malaria Vaccines • JID 2007:196 (15 August) • 613
Table 2. Summary of immunization/challenge studies with Pyuis3 (⫺) and
Pyuis4(⫺) genetically attenuated parasites.
Strain, primary dose,
booster dose (day given)
Challenge dose/
days after last boost
No. protected/
no. challenged
Blood-stage
patency
0/4
4/4
4–5 days
None
Pyuis3(⫺)
50,000
None
50,000 (day 14)
10,000
10,000 (day 14)
10,000/day 7
10,000/day 7
10,000/day 7
4/4
None
10,000 (day 14)
10,000 (days 14 and 28)
10,000/day 30
10,000/day 7
4/4
4/4
None
None
10,000 (days 14 and 28)
10,000 (days 14 and 28)
10,000/day 60
10,000/day 180
4/4
8/12
None
5 days
10,000/day 7
10,000/day 30
4/4
4/4
None
None
10,000/day 7
4/4
None
10,000/day
10,000/day
10,000/day
10,000/day
4/4
4/4
4/4
8/8
None
None
None
None
Pyuis4(⫺)
50,000
None
None
50,000 (day 14)
10,000
10,000
10,000
10,000
10,000
(day 14)
(days 14 and 28)
(days 14 and 28)
(days 14 and 28)
7
7
60
180
NOTE. Each immunization group had an age-matched naive control group that all became bloodstage patent at day 3–4 after challenge (not shown).
profile [16] resembles that of P. falciparum more closely than
P. berghei and has the additional advantage of exhibiting a
specific hepatocyte tropism, which is not observed in P. berghei
infection [27]. Pyuis3(⫺) and Pyuis4(⫺) sporozoites showed
no defect in host cell entry in vitro; however, evaluation of
Pyuis3(⫺) and Pyuis4(⫺) GAP liver infections and comparison
with wt liver infection showed that Pyuis3(⫺) and Pyuis4(⫺)
GAPs were present in significantly reduced numbers as early
as 2 h after iv sporozoite injection. We currently do not know
whether this is owing to some insufficiency in initial liver infection such as sporozoite extravasation by Kupffer cell traversal
[28] or to a subsequent rapid die-off of intrahepatocytic P.
yoelii GAPs and their host hepatocytes. The Pyuis3(⫺) and
Pyuis4(⫺) GAPs that entered hepatocytes formed an apparently
normal PVM compartment in vivo. This contrasts with recent
findings using P. berghei P36p(⫺) GAPs [15]. Those parasites
showed a deficiency in PVM formation and, thus, were free in
the hepatocyte cytoplasm. P36p(⫺) GAP–infected hepatocytes
underwent apoptosis, which provides a possible explanation
for fast P36p(⫺) GAP clearance from in vitro–infected hepatoma cells [15]. However, their in vivo clearance in the livers
of infected mice was not determined. Our analysis of liver
infections at later time points revealed that Pyuis3(⫺) and
Pyuis4(⫺) GAPs developmentally arrested at the trophozoite
stage and showed no discernible phenotypic differences. Fur614 • JID 2007:196 (15 August) • Tarun et al.
thermore, Pyuis3(⫺) and Pyuis4(⫺) GAPs showed no significant persistence beyond 40 h after infection as evaluated by
IFA and confirmed by quantitative PCR. It will be of interest
to examine whether GAP-infected hepatocytes undergo programmed cell death or death by necrosis. A preliminary analysis
revealed no evidence of caspase 3 activation in Pyuis3(⫺) and
Pyuis4(⫺) GAP–infected hepatocytes in vitro and in vivo (data
not shown), which indicates that caspase-mediated apoptotic
cell death is not a major contributor, but mechanisms involved
in clearance need further detailed investigation.
Intriguingly, immunization with P. yoelii GAPs conferred
complete protection against a first challenge after 6 months,
which indicates that maintenance of immunological memory
does not depend on GAP liver-stage persistence. However, it
is of interest to note that effective protection by radiationattenuated parasites was shown to depend on parasite forms
that persisted in the liver for weeks to months [12], but this
work was done with P. berghei and may possibly reflect a phenomenon specific to this species. In addition, in the P. berghei
model it has been observed that, after sporozoite transmission
by mosquito bite, exoerythrocytic-like parasite forms are found
in the skin and lymphatic system of infected mice [29]. Whether
such parasite forms persist in the P. yoelii model and, as a
result, form an extrahepatic antigenic reservoir remains to be
determined.
Figure 5. Dependence of genetically attenuated parasite (GAP)–induced immune protection on CD8+ T cells and elicitation of antibodies against
sporozoites. Groups of 3 BALB/c mice were immunized with 50,000 Pyuis3 (⫺) or Pyuis4(⫺) sporozoites 3 times with 2-week intervals between boosts.
Antibody mediated depletion of CD8+ T cells abrogates protective immunity in Pyuis3 (⫺)–immunized (A) and Pyuis4 (⫺)–immunized (B) mice, but
depletion of CD4+ T cells has no apparent effect on sterile protection. Graphs show the percentage of protected mice after challenge with 10,000
wild-type (wt) sporozoites by iv injection. Protection was determined by evaluation of occurrence of blood-stage patency in the challenged mice. IgG
treatment was used as a depletion-negative control, and naive mice (not immunized) were used as an infection-positive control. Note the 1-day delay
in blood-stage patency observed in the CD8+ T cell–depleted group. Data are from 2 independent depletion experiments for each group. C, The
percentage inhibition of infection after preincubation of green fluorescent protein (GFP)–tagged P. yoelii parasites with P. yoelii GAP–immunized mouse
serum or anti–circumsporozoite protein (CSP) monoclonal antibody, compared with sporozoites incubated in mock-immunized mouse serum. The no. of
infected cells was obtained from the no. of GFP-positive cells in 100,000 cells sorted from 3 infections 44 h after infection. D, Immune serum from
Pyuis4(⫺)–immunized mice showing specific reactivity against wt sporozoites. The left panel shows reactivity of serum obtained from Pyuis4 (⫺)–
immunized mice; the middle panel shows staining with an antibody against the myosin tail interacting protein (MTIP), a protein localized in the inner
membrane complex of sporozoites [23]; and the right panel shows the fluorescent image overlay with the phase-contrast image.
Sterile protection by Pyuis3(⫺) and Pyuis4(⫺) GAPs was
absolutely dependent on CD8+ T cells—their depletion effectively rendered all tested mice susceptible to infectious sporozoite challenge. Depletion of CD4+ T cells did not reverse
protection. Although infection-blocking anti-sporozoite antibodies are induced after P. yoelii GAP immunization, they are
clearly not sufficient to confer sterile protection. Thus, effector
mechanisms other than CD8+ T cell–mediated elimination of
parasites are inadequate for complete protection in these P.
yoelii GAP–BALB/c models. Concerning this, our findings reveal a similar mechanism for GAP-mediated protection and radiation-attenuated sporozoite–mediated protection of BALB/c
mice [30].
We have shown that a single-dose Pyuis4(⫺) GAP vaccine
completely protects BALB/c mice against massive challenge
with 10,000 wt sporozoites. Reported single-dose vaccination
using P. yoelii radiation-attenuated sporozoites [31] did not
achieve complete protection against a similar-dose challenge,
but vaccination of mice receiving chloroquine treatment with
wt infectious sporozoites achieved protection with a single immunization [31]. Therefore, some GAP vaccines may have efficacy superior to that of irradiation-attenuated sporozoites, at
least in the P. yoelii–BALB/c model. However, conclusive evidence supporting this must come from a direct experimental
comparison of GAPs and irradiation-attenuated sporozoite efficacy studies. The genetically dissimilar Pyuis3(⫺) GAP required a minimum of 2 immunizations with 10,000 sporozoites
to achieve complete protection. This finding demonstrates that
GAP vaccines have distinct potencies.
In conclusion, our data provide evidence that GAPs are superb vaccines offering complete, long-lasting protection in a
mouse malaria model. Therefore, the search for an optimally
attenuated P. falciparum GAP should be initiated and may yield
a single-dose malaria vaccine that confers complete, long-lasting protection against initial infection. Although, selection, production, and deployment of a live attenuated malaria vaccine
Complete Protection with GAP Malaria Vaccines • JID 2007:196 (15 August) • 615
faces many formidable obstacles [32], it may ultimately provide
the only opportunity to completely protect humans against
malaria infection by vaccination.
Acknowledgments
We thank J. Whisler, M. Roberts, and Chelsea Kungkagam for expert
technical assistance with mosquito rearing and parasite infections, the Naval
Medical Research Center for providing the HEP17 monoclonal antibody,
and Lawrence Bergman for providing the merozoite surface protein 1
antibody.
15.
16.
17.
18.
19.
20.
References
1. Guinovart C, Navia MM, Tanner M, Alonso PL. Malaria: burden of
disease. Curr Mol Med 2006; 6:137–40.
2. Miller LH, Baruch DI, Marsh K, Doumbo OK. The pathogenic basis
of malaria. Nature 2002; 415:673–9.
3. Nussenzweig RS, Vanderberg J, Most H, Orton C. Protective immunity
produced by the injection of X-irradiated sporozoites of Plasmodium
berghei. Nature 1967; 216:160–2.
4. Doolan DL, Martinez-Alier N. Immune response to pre-erythrocytic
stages of malaria parasites. Curr Mol Med 2006; 6:169–85.
5. Hafalla JC, Cockburn IA, Zavala F. Protective and pathogenic roles of
CD8+ T cells during malaria infection. Parasite Immunol 2006; 28:
15–24.
6. Hoffman SL, Goh LM, Luke TC, et al. Protection of humans against
malaria by immunization with radiation-attenuated Plasmodium falciparum sporozoites. J Infect Dis 2002; 185:1155–64.
7. Alonso PL, Sacarlal J, Aponte JJ, et al. Duration of protection with
RTS,S/AS02A malaria vaccine in prevention of Plasmodium falciparum
disease in Mozambican children: single-blind extended follow-up of a
randomised controlled trial. Lancet 2005; 366:2012–8.
8. Luke TC, Hoffman SL. Rationale and plans for developing a nonreplicating, metabolically active, radiation-attenuated Plasmodium falciparum sporozoite vaccine. J Exp Biol 2003; 206:3803–8.
9. Mellouk S, Lunel F, Sedegah M, Beaudoin RL, Druilhe P. Protection
against malaria induced by irradiated sporozoites. Lancet 1990; 335:
721.
10. Silvie O, Semblat JP, Franetich JF, Hannoun L, Eling W, Mazier D.
Effects of irradiation on Plasmodium falciparum sporozoite hepatic
development: implications for the design of pre-erythrocytic malaria
vaccines. Parasite Immunol 2002; 24:221–3.
11. Alger NE, Harant J. Plasmodium berghei: heat-treated sporozoite vaccination of mice. Exp Parasitol 1976; 40:261–8.
12. Scheller LF, Azad AF. Maintenance of protective immunity against
malaria by persistent hepatic parasites derived from irradiated sporozoites. Proc Natl Acad Sci USA 1995; 92:4066–8.
13. Mueller AK, Camargo N, Kaiser K, et al. Plasmodium liver stage developmental arrest by depletion of a protein at the parasite-host interface. Proc Natl Acad Sci USA 2005; 102:3022–7.
14. Mueller AK, Labaied M, Kappe SH, Matuschewski K. Genetically mod-
616 • JID 2007:196 (15 August) • Tarun et al.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
ified Plasmodium parasites as a protective experimental malaria vaccine.
Nature 2005; 433:164–7.
van Dijk MR, Douradinha B, Franke-Fayard B, et al. Genetically attenuated, P36p-deficient malarial sporozoites induce protective immunity and apoptosis of infected liver cells. Proc Natl Acad Sci USA
2005; 102:12194–9.
Belmonte M, Jones TR, Lu M, et al. The infectivity of Plasmodium
yoelii in different strains of mice. J Parasitol 2003; 89:602–3.
Weiss WR. Host-parasite interactions and immunity to irradiated sporozoites. Immunol Lett 1990; 25:39–42.
Verhage DF, Telgt DS, Bousema JT, et al. Clinical outcome of experimental human malaria induced by Plasmodium falciparum-infected
mosquitoes. Neth J Med 2005; 63:52–8.
Tarun AS, Baer K, Dumpit RF, et al. Quantitative isolation and in vivo
imaging of malaria parasite liver stages. Int J Parasitol 2006; 36:1283–93.
Renia L, Miltgen F, Charoenvit Y, et al. Malaria sporozoite penetration:
a new approach by double staining. J Immunol Methods 1988; 112:
201–5.
Tsuji M, Mattei D, Nussenzweig RS, Eichinger D, Zavala F. Demonstration of heat-shock protein 70 in the sporozoite stage of malaria
parasites. Parasitol Res 1994; 80:16–21.
Charoenvit Y, Mellouk S, Sedegah M, et al. Plasmodium yoelii: 17-kDa
hepatic and erythrocytic stage protein is the target of an inhibitory
monoclonal antibody. Exp Parasitol 1995; 80:419–29.
Bergman LW, Kaiser K, Fujioka H, et al. Myosin A tail domain interacting protein (MTIP) localizes to the inner membrane complex of
Plasmodium sporozoites. J Cell Sci 2003; 116:39–49.
Wang R, Charoenvit Y, Corradin G, De La Vega P, Franke ED, Hoffman
SL. Protection against malaria by Plasmodium yoelii sporozoite surface
protein 2 linear peptide induction of CD4+ T cell- and IFN-gammadependent elimination of infected hepatocytes. J Immunol 1996; 157:
4061–7.
Gwadz RW, Cochrane AH, Nussenzweig V, Nussenzweig RS. Preliminary studies on vaccination of rhesus monkeys with irradiated sporozoites of Plasmodium knowlesi and characterization of surface antigens of these parasites. Bull World Health Organ 1979; 57(Suppl 1):
165–73.
Collins WE, Skinner JC, Millet P, et al. Reinforcement of immunity
in Saimiri monkeys following immunization with irradiated sporozoites
of Plasmodium vivax. Am J Trop Med Hyg 1992; 46:327–34.
Silvie O, Greco C, Franetich JF, et al. Expression of human CD81
differently affects host cell susceptibility to malaria sporozoites depending on the Plasmodium species. Cell Microbiol 2006; 8:1134–46.
Baer K, Roosevelt M, Clarkson AB Jr, van Rooijen N, Schnieder T,
Frevert U. Kupffer cells are obligatory for Plasmodium yoelii sporozoite
infection of the liver. Cell Microbiol 2007; 9:397–412.
Amino R, Thiberge S, Martin B, et al. Quantitative imaging of Plasmodium transmission from mosquito to mammal. Nat Med 2006; 12:
220–4.
Doolan DL, Hoffman SL. The complexity of protective immunity
against liver-stage malaria. J Immunol 2000; 165:1453–62.
Belnoue E, Costa FT, Frankenberg T, et al. Protective T cell immunity
against malaria liver stage after vaccination with live sporozoites under
chloroquine treatment. J Immunol 2004; 172:2487–95.
Renia L, Gruner AC, Mauduit M, Snounou G. Vaccination against
malaria with live parasites. Expert Rev Vaccines 2006; 5:473–81.