Human Molecular Genetics, 2014, Vol. 23, No. 3
doi:10.1093/hmg/ddt459
Advance Access published on September 20, 2013
730–748
Reversibility of neuropathology
in Tay–Sachs-related diseases
Marı́a-Begoña Cachón-González1,∗ , Susan Z. Wang1, Robin Ziegler2,
Seng H. Cheng2 and Timothy M. Cox1
1
Department of Medicine, University of Cambridge, Cambridge, UK and 2Genzyme, a Sanofi Company,
Framingham, MA, USA
Received August 13, 2013; Revised and Accepted September 16, 2013
The GM2 gangliosidoses are progressive neurodegenerative disorders due to defects in the lysosomal b-N-acetylhexosaminidase system. Accumulation of b-hexosaminidases A and B substrates is presumed to cause this
fatal condition. An authentic mouse model of Sandhoff disease (SD) with pathological characteristics resembling those noted in infantile GM2 gangliosidosis has been described. We have shown that expression of b-hexosaminidase by intracranial delivery of recombinant adeno-associated viral vectors to young adult SD mice can
prevent many features of the disease and extends lifespan. To investigate the nature of the neurological injury in
GM2 gangliosidosis and the extent of its reversibility, we have examined the evolution of disease in the SD
mouse; we have moreover explored the effects of gene transfer delivered at key times during the course of
the illness. Here we report greatly increased survival only when the therapeutic genes are expressed either
before the disease is apparent or during its early manifestations. However, irrespective of when treatment
was administered, widespread and abundant expression of b-hexosaminidase with consequent clearance of
glycoconjugates, a-synuclein and ubiquitinated proteins, and abrogation of inflammatory responses and neuronal loss was observed. We also show that defects in myelination occur in early life and cannot be easily resolved
when treatment is given to the adult brain. These results indicate that there is a limited temporal opportunity in
which function and survival can be improved—but regardless of resolution of the cardinal pathological features
of GM2 gangliosidosis, a point is reached when functional deterioration and death cannot be prevented.
INTRODUCTION
The GM2 (monosialoganglioside 2) gangliosidoses, Tay – Sachs
disease (TSD; OMIM 272800), Sandhoff disease (SD; OMIM
268800) (1,2) and GM2 activator protein deficiency (OMIM
272750) (3), are a heterogeneous group of rare neurodegenerative lysosomal storage diseases (LSDs), transmitted in an autosomal recessive fashion. They result from defects in the
enzyme, b-N-acetylhexosaminidase (EC 3.2.1.52) and GM2 activator protein. Absence or malfunction of these proteins leads to
lysosomal accumulation of their substrates (glycosphingolipids,
glycoproteins and glycosaminoglycans) with devastating effects
on the nervous system (4,5). There are three isoforms of
b-N-acetylhexosaminidase: b-hexosaminidase A (HEX A), a
heterodimer of a and b subunits; b-hexosaminidase B (HEX
B), a b subunit homodimer; and b-hexosaminidase S (HEX S),
an a subunit homodimer (6 – 8). Mutations in either of the
genes (HEXA and HEXB) encoding the subunits or GM2 activator protein (GM2A) can cause disease which has a very similar
clinical course. The infantile form of GM2 gangliosidosis is
the most common and invariably fatal, but attenuated adult
forms also occur (9).
The SD mouse model was generated by targeted disruption of
the Hexb gene (10). The mice appear indistinguishable from their
littermates for the first 3 months of life, but thereafter a fulminant
neurodegenerative disease develops, with death occurring at
4– 5 months of age. Stereotypic disease manifestations, which
include spasticity, muscle weakness, rigidity, tremor and
ataxia, closely resemble those seen in the acute form of human
GM2 gangliosidosis. The SD mouse has become invaluable
for testing prospective therapies, and to interrogate underlying
pathophysiological mechanisms of disease.
The genetic basis of GM2 gangliosidosis is well established,
but the molecular events leading from disease-causing mutation
∗
To whom correspondence should be addressed at: Department of Medicine, University of Cambridge, Level 5, PO Box 157, Addenbrooke’s Hospital,
Hills Road, Cambridge CB2 0QQ, UK. Tel: +44 1223336859; Fax: +44 1223336846; Email: [email protected]
# The Author 2013. Published by Oxford University Press. All rights reserved.
For Permissions, please email: [email protected]
Human Molecular Genetics, 2014, Vol. 23, No. 3
to the clinical manifestations remain obscure. Post-mortem
examination of brains from patients suffering from GM2 gangliosidosis has revealed marked variation in neuronal cell
density and the extent of gliosis (11).
Experimental evidence suggests that abnormal accumulation
of sphingolipids (SLs) disturbs endosomal transport and sorting
(12). Defective degradation of SLs is often accompanied by excessive formation of the cognate deacylated molecule, to which
additional biological effects are often attributed (13). In human
GM2 gangliosidosis, lyso-GM2 is found in excess and although
the contribution of this species to the development of the disease
is unclear, it is presumed to be damaging to neural tissue (14).
One of the pathological hallmarks of neurodegenerative
disease in GM2 gangliosidosis is the development of an inflammatory response. Wada and colleagues reported that activation
of microglia preceded acute neurodegeneration (15). However,
the question remains as to whether this response is a primary
or secondary contributor to the pathogenesis.
Phospholipid (16) and myelin lipid mass are reduced in human
and animals models of GM2 gangliosidosis (11,17), but again it
is unclear whether the observed reduction is a consequence or a
cause of neurodegeneration.
Successful use of recombinant adeno-associated vectors
(rAAV) encoding b-hexosaminidase in the treatment of severe
GM2 gangliosidoses in mice (18,19) and more recently cats
(20), clearly mandates translation of this approach to patients
with Tay – Sachs and SDs. However, since patients at different
stages of evolution of the diseases will ultimately be potential
candidates for this intervention, it is imperative to determine
the extent to which the disease can be arrested or reversed and
how much functional recovery might be accrued by gene transfer
carried out at different points in the course of the illness. Here we
present data from experimental studies in which these questions
are addressed using rAAV vectors to deliver complementing
b-hexosaminidase in the brain of SD mice.
RESULTS
Timing of rAAV injections determines extent
of preservation of function and survival
We compared therapeutic outcomes of intracranial administration of rAAV2/1a + rAAV2/1b in four cohorts of SD mice.
Mice were injected bilaterally into the striatum and cerebellum
731
at 4, 8, 10 or 12 weeks (w) of age. Controls were untreated SD
[SD (UT)] and heterozygous or wild-type (normal controls)
animals. All mice in the study were checked and weighed
daily and killed when they reached their humane end point.
Survival was analysed with the log-rank (Mantel – Cox) test.
Intracranial rAAV-mediated gene delivery of b-hexosaminidase
had a marked effect on the lifespan of this acute mouse model of
GM2 gangliosidosis (P , 0.0001), but critically, it depended on
age at the time of intervention as shown by the Kaplan – Meier
(Fig. 1A) and scatter plots (Fig. 1B). Survival of the different
age-treated groups was examined by one-way analysis of variance (ANOVA) and adjusted for multiple post hoc comparisons
by the Bonferroni’s method. Median survival was 730 days for
untreated normal controls (n ¼ 22), and 131 days for mutant
animals [SD (UT)] (n ¼ 37). In contrast, median survival of
groups of SD mice treated at four different ages was: 4w (615
days, n ¼ 22), 8w (233 days; n ¼ 5), 10w (292 days; n ¼ 5)
and 12w (126 days; n ¼ 12). Greatest longevity was attained
by the group treated at the youngest age (4w) (P , 0.0001).
Importantly, life was also extended when the treatment was
administered at 8w (P , 0.001) and 10w (P , 0.0001), but
not at 12w (P . 0.05). Although, no difference in survival
between SD mice injected at 8w and 10w was noted (P .
0.05), the evolution of neurological disease signs differed
between the two groups. While animals treated at 8w exhibited
a delay in disease onset with signs that developed slowly over
time, those injected at 10w had disease onset that resembled
that of SD (UT). Hence, to secure long-term functional rescue
in a disease with such devastating effects on the entire nervous
system, treatment should be given as early as possible. Notwithstanding, that benefit can be accrued even when treatment is substantially delayed was revealing. As predicted, a point occurs
when the putative treatment improves neither function nor survival of the recipient (Supplementary Material, Videos S1 –S5).
Abundant and widespread expression of human
b-hexosaminidase after intracranial injection
of viral vectors
In situ b-hexosaminidase activity was detected by histochemical
staining and in transduced cells by in situ hybridization (ISH)
with an antisense RNA probe against the woodchuck hepatitis
virus post-transcriptional regulatory element (WPRE)-bovine
growth hormone polyadenylation signal (BGHpA) viral
Figure 1. Lifespan of Sandhoff mice after intracranial infusions of rAAVa + rAAVb is significantly extended. SD mice were injected bilaterally into the striatum and
cerebellum at 4 (n ¼ 22), 8 (n ¼ 5), 10 (n ¼ 5) and 12 (n ¼ 12) weeks post-birth (WPB). Control groups: normal controls (n ¼ 22) and SD (UT) mice (n ¼ 37).
Kaplan–Meier survival curve, data censored at 2 years (A). One-way ANOVA and Bonferroni multiple post hoc comparisons with mean + SEM (B).
732
Human Molecular Genetics, 2014, Vol. 23, No. 3
sequence. Analysis of the brain and spinal cord of three animals
was performed for each experimental group.
Injections into the striatum and cerebellum induced widespread distribution of virus and enzyme in all age groups
tested. Consistent with our previous studies, staining for
b-hexosaminidase and viral RNA was most intense at the injection site (Fig. 2A – I), and interconnected areas such as the substantia nigra (SN)—presumably labelled by retrograde
transport as shown in a 12w injected mouse (Fig. 2J – L). Viral
dispersion was also noticeable along white matter tracts such
as corpus callosum (Fig. 2C, F and I), and choroid plexus by
leakage and/or diffusion of infusate into the ventricular system
(Fig. 2F and I). The overall pattern of b-hexosaminidase was
similar between all age groups, but the most abundant staining
was consistently seen in the 12w injected mice (Fig. 2G and H).
Periodic acid-Schiff reagent stain, a-synuclein
and ubiquitin inclusions are cleared by expression
of b-hexosaminidase
The brains and spinal cords of three animals from each age group
were stained with periodic acid-Schiff reagent (PAS) to detect
stored glycoconjugates, a hallmark of GM2 gangliosidoses.
a-Synuclein aggregates were revealed by immunohistochemistry (IHC) with two antibodies, one monoclonal and the other
polyclonal. Ubiquitin-containing inclusions were also detected
by IHC.
Pathological amounts of GM2 ganglioside and related glycoconjugates, which have been reported elevated as early as in fetal
life, appear to increase linearly over time, and by age 4w are
easily visible by PAS staining (Supplementary Material,
Fig. S1). All SD-treated animals analysed at their humane end
point, including those injected at 12w, showed undetectable or,
if at all present, small pockets of PAS-positive material throughout the neuraxis (Fig. 3). This finding shows that expression of
b-hexosaminidase rapidly clears the stored material and restores
apparent normal histology.
On the basis of reports that aggregates of the pre-synaptic
protein a-synuclein are present in the neuronal soma of SD
(UT) mice, we investigated whether gene transfer can clear
and/or prevent its accumulation. The two antibodies used for
IHC revealed an identical pattern of a-synuclein staining in
SD (UT) animals that increased in intensity over time (data not
shown). However, when brain and spinal cord tissue extracts
from animals of different ages were analysed by western blots
with the same antibodies, the amount of monomeric a-synuclein
in SD (UT) samples was decreased when compared with normal
controls (Supplementary Material, Fig. S2). IHC-staining with
the pre-synaptic protein, synaptophysin, showed a normal
pattern of staining in SD (UT) mice, and by western blotting
no discernible differences were observed between SD (UT)
and normal controls (data not shown). As shown in
Figure 4A – D, gene transfer is highly efficient at normalizing
the levels of a-synuclein in all age groups tested.
Inclusions-containing ubiquitinated proteins have been
detected in several glycosphingolipidoses, and to test whether
gene transfer can reverse this abnormality, we first established
the spatial distribution of ubiquitinated protein inclusions in
SD (UT) mice. In contrast to the staining of most neurones by
PAS and with antibodies against a-synuclein, ubiquitin
aggregates were detected only at a few anatomical sites in SD
(UT) mice; staining was weak in thalamic nuclei, deep cerebellar
nuclei, pons and medulla, but ubiquitin aggregates were prominent in the grey matter of the spinal cord (Fig. 4I). In animals
examined at their humane end points and treated at ages 4w,
8w and 10w, this pathological feature had resolved completely
(Fig. 4K), while those injected at 12w had partial clearance—
the intensity of staining was reduced compared with that in SD
(UT) mice, but the number of cells containing inclusions was
similar (Fig. 4J). In contrast, glycoconjugate accumulation was
cleared by treatment (Fig. 4N and P), compared with SD (UT)
(Fig. 4M) and normal controls (Fig. 4P).
Gene transfer ameliorates neuroinflammation in SD mice
Innate inflammatory responses are characteristic of most neurodegenerative disorders and a widely held view is that, rather than
containing the cytological injury, proliferation and activation of
microglia and astroglia may accelerate the disease process.
We investigated possible regional differences in microglia
and astroglia proliferation/activation in mouse models of SD,
and demyelinating, Krabbe disease (KD; twitcher mouse).
We compared the inflammatory response in SD (UT) and twitcher, at their humane end point of 4 months and 38 days of age, respectively, to age-matched normal controls. Abundance of
mRNA encoding chemokines Mip-1a and Rantes and microglial
and astroglial markers, Cd68 and gfap, respectively, was determined by real-time PCR (relative to b-actin). Spinal cord and
brain were analysed separately. The brain was dissected into olfactory bulb, cerebrum (neocortex, hippocampus, thalamus and
hypothalamus), and cerebellum and brain stem (superior and inferior colliculus, midbrain, pons and medulla). Twitcher and SD
(UT) mice differed in their inflammatory response. Particularly,
striking was the difference in Rantes expression between the two
models; while Rantes is highly expressed in twitcher mice, the
levels in SD (UT) tissue are similar to those noted in normal controls (Fig. 5A and B). In both models of disease, up-regulation of
markers of gliosis is more prominent in hindbrain and spinal cord
than in forebrain, coincident with white matter-rich regions
(Fig. 5A and B).
SD (UT) mice develop a stereotypic disease with onset at
13w age and tremor as the first noticeable sign of neurodegeneration. To correlate expression of markers of gliosis with
disease progression, we measured mRNA levels of Cd68 and
Gfap (relative to b-actin) by real-time PCR at different time
points in spinal cord of SD (UT) mice. In agreement with previous reports, gene expression was elevated at 1 and 2 months of
age, with the greatest increase occurring at age 13w, concomitant
with the beginning of the symptomatic phase. Thereafter, the
levels remained elevated until the animals reached the humane
end point (Fig. 5C and D).
We next examined effectiveness of gene transfer at reducing
neuroinflammation when treatment is delayed. Because detailed
anatomical differences are best revealed by IHC, staining patterns of Cd68 in brain and spinal cord sections of 4w and 12w
injected SD animals were compared with mutant and normal
controls. SD mice injected at 4w (Fig. 6G – I) had stained microglia numbers similar to normal control mice (Fig. 6J– L) and with
morphology consistent with the resting state with respect to
ramified spindly processes emanating from a central cell body
Human Molecular Genetics, 2014, Vol. 23, No. 3
733
Figure 2. Abundant and wide bio-distribution of enzyme and viral RNA is achieved by intracranial vector delivery. In situ b-hexosaminidase activity staining (hex),
red precipitate, of SD mice injected with rAAVa + rAAVb at 4w (A and B), 10w (D and E) and 12w (G, H and K) age, and killed at their humane end point. Brain
parenchyma and choroid plexus (chp) are strongly labelled. Controls were SD (UT) (N), and normal control (O) killed at 4 months of age. Viral mRNA ISH, black stain,
of consecutive sections from 4w (C), 10w (F) and 12w (I and L) injected mice is shown. Grey but also white matter (corpus callosum, cc) in brain parenchyma, and
choroid plexus were transduced. The substantia nigra (SN) from a 12w injected mouse stained with hex (K) and ISH (L). PAS staining of SN shows absence of glycoconjugate storage (J). Normal control stained with PAS (M). Caudate putamen (CPu), cerebral peduncle (cp), lateral ventricle (LV), medial lemniscus (ml) and
primary somatosensory cortex (S1). Scale bars: 2 mm (A, D, G, M, N and O); 500 mm (B, C, E, F, H, I and J–L).
734
Human Molecular Genetics, 2014, Vol. 23, No. 3
Figure 3. Glycoconjugate storage is reduced throughout the neuraxis. Sections from a representative 12w rAAVa + rAAVb injected SD mouse killed at the humane
end point of 4 months were stained with PAS (B, E, H and K). Controls were 12-week-old SD (UT) (A, D, G and J) and 4-month-old normal control (C, F, I and L).
Anatomical regions shown are hippocampus (A–C), hypothalamus (D– F), deep cerebellar nuclei (G– I) and brain stem (J– L). Arrow heads point to PAS-positive
neurones. Deep cerebellar nuclei (DCN); fields CA1(CA1) and CA3 (CA3) of hippocampus; fimbria (fi); fourth ventricle (4V); gigantocellular reticular nucleus (Gi);
granular layer of the dentate gyrus (GrDG); internal capsule (ic); lateral posterior thalamic nucleus (LP); medial amygdaloidal nucleus (Me); medial vestibular nucleus
(MVe); primary somatosensory cortex (S1); pyramidal tract (py); third ventricle (3V); ventromedial hypothalamic nucleus (VMH). Scale bar: 500 mm (A– L).
(Fig. 6O), as opposed to the amoeboid phagocytic state of microglia in SD (UT) (Fig. 6A– C, M and P). The 12w injected mice
also harboured microglia numbers and morphology similar to
normal controls, except for a few scattered cells in the VPM/
VPL (ventroposterior medial and lateral) nuclei in the thalamus,
and white matter of the spinal cord (Fig. 6D– F).
Human Molecular Genetics, 2014, Vol. 23, No. 3
735
Figure 4. Gene transfer reduces a-synuclein and ubiquitin inclusions. We show representative staining by IHC of hippocampus and thalamus of 4w (C) and 12w
(B) injected animals at their humane end points with a monoclonal antibody against a-synuclein. Controls were 12-week-old SD (UT) (A), and 4-month-old
normal control (D). Insert in (A) is a magnified view of a cell with characteristic a-synuclein inclusions. Whereas SD (UT) granular layer of the dentate gyrus
(GrDG) and lateral posterior thalamic nucleus (LP) show numerous cells with a-synuclein inclusions, treated animals had normalized staining (B and C). In SD
(UT), the number of cells containing a-synuclein inclusions and glycoconjugate storage was similar, and localized to the same regions (E), but treated SD and
normal controls had neither a-synuclein nor glycoconjugate inclusions (F –H). IHC against ubiquitin shows a small number of scattered cells intensely staining in
the grey matter of spinal cord of a 4-month-old SD (UT) (I), and absence of inclusions in normal controls (L). While staining intensity in 12w injected mice was
only reduced (J), it was fully normalized in the 4w injected group (K). PAS staining demonstrated that a larger number of cells are positive for glycoconjugate
storage than for ubiquitin in SD (UT) (M). Treated SD animals had a PAS-staining pattern (N and O) similar to normal controls (P). Inserts in (I) and (M) are magnified
views of inclusions-containing cells. Arrowheads point to stained cells. Field CA3 of hippocampus (CA3); granular layer of the dentate gyrus (GrDG); lateral posterior
thalamic nucleus (LP). Scale bars: 200 mm (A– H); 100 mm (I–P and inserts).
Neurodegeneration and death is prevented by treatment
To correlate the emergence and progression of disease signs to
particular anatomical regions, we studied the temporal and
spatial pattern of neurodegeneration in brain and spinal cord of
mutant Sandhoff mice using the chemical-development-silver
method of Gallyas (21). This method detects components of
neurons undergoing degeneration, such as lysosomes, axons
and terminals that bind silver ions with high affinity.
SD (UT) and age-matched normal control littermates were
studied at 2, 5, 8, 10w, 12w and 17w (4 months) age. Metallic
grain deposition increased with age (Fig. 7A–D). It was readily
observed as early as age 2w in mossy fibres of the hippocampus
(Fig. 7A), and neuronal processes in deep cerebella nuclei. In contrast to ramified microglia that occupied surrounding structures,
amoeboid microgliosis was associated with silver staining at
these intensely stained sites (Fig. 6A and M). By age 5w, labelling
became apparent in brain sensory pathways, including olfactory
736
Human Molecular Genetics, 2014, Vol. 23, No. 3
Figure 5. Spatial and temporal up-regulation of markers of inflammation in untreated Sandhoff and Krabbe (Twitcher) mouse models of disease by real-time PCR.
Relative mRNA expression of Cd68 and Gfap, markers of activated microglia and astrocytes, respectively, and chemokines Mip-1a and Rantes relative to b-actin were
examined in brain and spinal cord at the humane end point of 4 months in Sandhoff (A) and 38 days in twitcher mice (B). Greatest expression occurs in the hindbrain and
spinal cord of both models of disease, areas particularly rich in myelin. Temporal expression of Cd68 (C) and Gfap (D) in spinal cord of Sandhoff mice shows largest
up-regulation of these markers coincides with the start of the symptomatic phase at around age 13w. Student’s t-test; ∗ P , 0.05; ∗∗ P , 0.01; ∗∗∗ P , 0.001.
and optic tracts, auditory lateral lemniscus, lamina 1 of spinal cord
and gracile nucleus. Notably, there was no obvious staining of large
white matter tracts (Supplementary Material, Fig. S3). At 12w,
silver deposition was stronger in grey matter than in white
matter; and by the end stage of the disease at 17w, the entire
brain and spinal cord became heavily stained, with many
Human Molecular Genetics, 2014, Vol. 23, No. 3
737
Figure 6. Gene transfer reduces the number of activated microglia. IHC staining against Cd68 of brain and spinal cord from treated SD at 4w (G–I) and 12w (D– F)
mice was compared with SD (UT) (A–C and M) and normal controls (J– L and N). Treated animals and SD (UT) were killed at their humane end point and normal
control at age 4 months. The number of activated microglia was significantly reduced throughout the neuraxis at all transduced ages. Small numbers remain in the
VPM/VPL (ventroposterior medial and lateral) nuclei of the thalamus and grey, but not in white matter of spinal cord in 12w injected mice. Whereas most activated
microglia in SD (UT) hippocampus had ramified morphology (magnified view in O), those in the stratum lucidum (encircled in A, and magnified in M and P) are
amoeboid. Arrowheads and arrows point to ramified and amoeboid microglia, respectively. Field CA3 of hippocampus (CA3). Scale bars: 500 mm (C, F, I and L),
200 mm (A, B, D, E, G, H, J and K), 100 mm (M and N) and 50 mm (O and P).
738
Human Molecular Genetics, 2014, Vol. 23, No. 3
Figure 7. Neuronal degeneration increases with age and is prevented by intracranial gene transfer. SD (UT) (A–D and H) and wild-type mice (E), ages 2w –4 months,
were studied by the chemical-development-silver method of Gallyas (21). Silver deposition in the stratum lucidum of the hippocampus (∗ ) is seen at 2w and shows
increasing intensity over time. The axons of SD (UT) at the terminal stage of the disease have numerous spheroids (arrowhead) and bulbous ends (arrow) (H). SD mice
treated at 4w (F) and 12w (G) have significantly reduced staining. Field CA3 of hippocampus (CA3). Scale bars: 100 mm (A–G) and 25 mm (H).
abnormally swollen bulbous axons (axonal spheroids), typical of
advanced axonal degeneration (Fig. 7H). A conspicuous exception
was the lack of silver deposition in some cranial nerves, such as the
facial nerve (Supplementary Material, Fig. S4U–X).
Consistent with the progressive nature of GM2 gangliosidosis, we found increased metal deposition with advancing age.
However, we also learned that neurodegeneration starts early,
by age 2w is already detectable, months before disease onset
Human Molecular Genetics, 2014, Vol. 23, No. 3
becomes apparent (at 13w age), and that the time course of degeneration differs between anatomical regions. In addition,
while some structures are particularly vulnerable, others
appear to escape degeneration altogether.
We compared the effect of gene transfer given at age 5w and
12w on amelioration of neurodegeneration. Two animals per
group were sacrificed at age 17w and processed for silver staining. Whereas mutant mice injected at 12w reached their humane
end point at 17w and developed stereotypic signs of disease,
those infused at 5w had an apparent normal phenotype. Their
brains and spinal cords were removed and examined in detail.
As illustrated in Figure 7, the striking observation was that
even when given late in the development of the disease, treatment could prevent and/or reverse neurodegeneration. Prominent grain deposition remained in lamina 1 of spinal cord and
gracile nuclei in both age groups. In mice injected at the latter
time point, the internal capsule and white matter of the cerebellum had reduced but significant residual staining (Supplementary Material, Fig. S4).
We have previously reported the absence of gross neuronal
loss in murine GM2 gangliosidosis, one exception being the
VPM/VPL nuclei of the thalamus, which lose neurones progressively. We have recently reported a combined VPM/VPL neuronal loss, compared with age-matched normal controls, of 15,
37 and 50% by the ages of 2, 3 and 4 months, respectively. We
have also showed that gene transfer when given at age 4 – 5w
could prevent neuronal loss (22).
Using the VPM/VPL nuclei as a paradigm of neuronal rescue
by gene transfer, we studied lifelong preservation of neuronal
density in long surviving animals, and prevention of further
loss when treatment is delayed. NeuN-stained cells in the
VPM/VPL of SD mice, injected at 4w, 8w, 10w and 12w and
killed at their humane end points were counted (Fig. 8A – F).
Controls were SD (UT) mice killed at the humane end point of
4 months, and normal control mice at ages 4 months– 2
years. Mean (+SEM) neuronal numbers were: normal controls,
895 + 13; SD (UT), 533 + 72; injected at 4w: 1027 + 32, 8w:
806 + 33, 10w: 725 + 74 and 12w: 464 + 14. In this study,
neuronal numbers had fallen by 41% in SD (UT) at the
humane end point (P , 0.01, Bonferroni post hoc test), relative
to normal controls. In contrast to animals injected at 4w (age:
337– 730 days) whose cell density was similar to normal controls, those infused at 12w did not significantly differ from SD
(UT) (P . 0.05, Bonferroni post hoc test). Although the Bonferroni’s post hoc test for the 8w and 10w treatment groups compared with normal controls returned P . 0.05, there was a
downward trend in cell numbers; a 10 and 19% decline in neuronal cell counts was noted, respectively. Taken together, the
results indicate that rescue by gene transfer was lifelong and
that delayed treatment could still prevent further deterioration.
However, when treatment is given just before the onset of
signs of disease (12w), cell death is not preventable (Fig. 8G).
Myelin defects are present early in the course
of SD and persist after treatment
We concluded from the results described above that delayed
treatment had a marked ameliorating effect on classical
739
Figure 8. Neuronal cell death is prevented by treatment. NeuN-positive cells
were counted in the VPM/VPL thalamic nuclei of SD mice treated at 4w
(C), 8w (D), 10w (E) and 12w (F) and killed at their humane end points; SD
(UT) (B) and normal controls (A) were killed at 4 months and 4 months– 2
years, respectively. Mean + SEM for each group is represented graphically
(G). Horizontal light grey area is NeuN-positive cell numbers in normal controls.
4w injected SD mice (asymptomatic phase) had NeuN-positive cell numbers
similar to normal controls. Neuronal density in SD mice injected at age 8 –10w
(2 –3 months, early symptomatic phase) was 80–90% that of normal controls;
a loss of 15– 37% is expected to have already occurred by the time animals were
injected (22). P , 0.05 (Bonferroni post hoc test). SD (UT) mice lost 41% of neurones in this study and 50% according to our previous work (22). SD animals
injected at 12w had lost 60% of neurones by the time they reached their
humane end point. Unlike in animals injected at 8 –10w, treatment at 12w (late
symptomatic phase) did not prevent cell loss (P . 0.05).
740
Human Molecular Genetics, 2014, Vol. 23, No. 3
pathological biomarkers of disease in the mouse model of GM2
gangliosidosis. However, despite these improvements, lifespan
and neurological function was not rescued when treatment was
administered late in the course of the disease.
In a quest for other pathological changes that might explain
why the time of intervention is critical for preservation of function and to increase survival, we first investigated the integrity of
myelin in SD (UT) mice. Using the classic demyelinating twitcher mouse as a control, we studied the pattern of myelin gene expression in SD (UT) (n ¼ 3) and twitcher (n ¼ 3) mice at their
humane end point of 4 months and 38 days of age, respectively.
Abundance of mRNA of the myelin markers mag, plp and cgt
(relative to b-actin) was analysed by real-time PCR. Spinal
cord and dissected brain were measured separately. Moribund
SD (UT) and twitcher mice showed a consistent pattern of
reduced expression of myelin markers in all brain regions and
spinal cord, when compared with normal controls (Fig. 9A and
B). To explore whether the derailment of myelin integrity was
limited to the terminal phase of the disease, expression of cgt
mRNA was quantified in SD (UT) spinal cord at ages 5 – 18w.
Unexpectedly, cgt gene expression was about half that of
normal controls at all ages tested (Fig. 9C).
We next examined if myelin composition was altered by comparing myelin protein amounts of non-compacted cnpase
Figure 9. Spatial and temporal expression of myelin markers in untreated Sandhoff and Krabbe (Twitcher) mouse models of disease. Relative mRNA expression of
mag, plp and cgt relative to b-actin was examined in brain and spinal cord at the humane end point of 19w in Sandhoff (A) and 38 days in twitcher mice (B). Myelin
mRNA expression in SD (UT) is about half that of normal controls in all areas of the brain and spinal cord at the humane end point (A), and reduced expression appears
to be an early feature of the disease process (C). Western blot of SD (UT) cerebrum extracts of different ages against the non-compacted myelin marker cnpase also
suggests early myelin deficits compared with age-matched controls, while no obvious differences were seen with an antibody against the enzyme th that was probed on
the same blot.
Human Molecular Genetics, 2014, Vol. 23, No. 3
741
Figure 10. Compacted myelin proteins are reduced in SD (UT). Amounts of myelin markers Plp (A) and Mbp (C) and neuronal b-tubulin III (E) were analysed relative
to b-actin by western blot on cerebrum extracts of SD (UT) and age-matched normal controls. Densitometry analysis of protein species on western blots indicates
reduced myelin protein content (B, D), while b-tubulin III composition remains unaltered (F). Student’s t-test; ∗ P , 0.05; ∗∗ P , 0.01.
(2′ ,3′ -cyclic nucleotide 3′ -phosphodiesterase; relative to tyrosine hydroxylase (th)) (Fig. 9D), and compacted, plp and mbp
(proteolipid protein and myelin basic protein; relative to
b-actin) (Fig. 10A and C) in cerebrum extracts from SD (UT)
and normal controls. Densitometry measurements of cnpase,
plp and mbp protein species in westerns blots showed that
protein amounts are about half those of normal controls
(Fig. 10B and D), hence confirming differences in myelin composition at the level of polypeptide translation as well as gene
transcription. Although, as pointed out earlier, gross neuronal
cell death that could account for the observed myelin reduction
was not evident, to confirm that abundance of a neuron-specific
marker was unchanged, b-tubulin III content was determined by
western blotting (Fig. 10E). Densitometry measurements
revealed no significant difference in b-tubulin III expression
(relative to b-actin) between SD (UT) and brain tissue from
normal control mice (Fig. 10F). These results suggest that
early reduction in myelin protein composition occurs throughout
the entire neuraxis in the absence of gross neuronal density loss.
We then tested whether myelin protein composition was preserved after treatment was given to mutant animals at the ages of
4w, 8w and 12w. Western blot analysis of plp, mbp, b-tubulin III,
b-actin and synaptophysin protein content was performed on
cerebrum extracts from three different animals at their humane
end points: 425– 539, 384 – 532 and 127– 140 days for 4w, 8w
and 12w injected SD, respectively (Fig. 11A, C and E). As controls, age-matched wild-type mice were killed at various time
points (112 – 547 days). Densitometry measurements of plp
and mbp species (relative to b-actin) showed that animals
treated at 12w had a consistent protein loss of 60% compared
with normal controls (P , 0.05, Bonferroni post hoc test)
(Fig. 11B and D). Animals infused at the earlier time points of
4w and 8w had myelin protein content that was also reduced
compared with age-matched normal controls, but there was considerable variation between animals within the same treatment
group. To ascertain that reduction in myelin proteins was not
caused by neuronal loss after surgery, we compared the relative
amounts of neuron-specific proteins synaptophysin and
b-tubulin III with normal controls, and found no significant differences between the groups (P . 0.05, Bonferroni post hoc test)
(Fig. 11E and F). Although a larger cohort of animals needs to be
studied to confirm these findings, the data suggest that development of an abnormal composition of myelin protein is an early
event that is relatively refractory to correction by gene transfer.
DISCUSSION
The GM2 gangliosidoses Tay – Sachs and SDs are prototypical
neurodegenerative lysosomal storage disorders caused by
742
Human Molecular Genetics, 2014, Vol. 23, No. 3
b-hexosaminidase deficiency; as a consequence, lysosomal degradation of glycosphingolipids and related glycoconjugates is
impaired and accumulates progressively in lysosomes. It is
believed that this prime pathology leads to neuronal dysfunction
and disease manifestations. In the most severe infantile form,
symptoms start a few months after birth with characteristic
regression of achieved milestones, motor defects, seizures,
together with visual and hearing loss.
Mice lacking functional b-hexosaminidase display several
signs of disease that mimic the human condition. We have previously shown that many traits of the mouse phenotype, including
motor function, histopathological features and premature death,
can be prevented and/or reversed by expression of human
b-hexosaminidase mediated by gene transfer, when delivered
to the young adult mouse brain (18,19). This would suggest
that absence of HEX A and B during brain development does
not compromise brain function irreversibly. This notion is moreover, supported by findings in two inducible models of Tay –
Sachs-related diseases; when transgenic Hexb is silenced at 5w
age, disease progresses stereotypically as in the germline hexb
knockout mouse, indicating the absence of developmental
events modifying the course of the disease (23).
Often, the child with GM2 gangliosidosis is born to parents
unaware of their carrier status; without widespread screening
programmes in the general neonatal population, months and
even years may pass before the first manifestations are recognized and diagnosed. As a result, patients present with diverse
signs of disease and with varying degrees of disability: were
gene therapy or other putative treatments with strong effects to
become available, appropriate timing of the intervention is
likely to be problematic. With a potential treatment now in the
horizon, it is critically important to understand the nature of
the neuropathological features, their evolution and extent to
which they can be reversed in order to evaluate what benefits
might be accrued from gene transfer delivered at differing
stages of the disease. With these goals in mind, we co-infused
monocistronic rAAV vectors expressing both subunits of
human b-hexosaminidase, a and b, into the brains of SD mice
at 4w, 8w, 10w and 12w age.
The single-stranded DNA genome of rAAV requires conversion to the biologically active double-stranded form through
annealing of complementary plus and minus molecules in the
cell nucleus, which occurs gradually over a period of 6w
(24). The implication for our timed interventions is that the putative therapeutic effect will lag behind the injection time, and
thus, we consider that in the SD mouse model the 4w, 8 – 10w
and 12w injections broadly represent interventions at the
Figure 11. Deficits in myelin protein composition persist after therapeutic gene
transfer. Amounts of myelin proteins Plp (A) and Mbp (C) relative to b-actin and
neuronal synaptophysin relative to b-tubulin III (E) were analysed by western
blot on cerebrum extracts of SD mice treated at 4w, 8w and 12w age and
normal controls. Mutant animals were killed at their humane end point and
normal controls at a range of ages to cover for the different ages in the treatment
groups. Densitometry analysis of protein species on western blots indicates
reduced myelin protein content in treated SD (B, D), while synaptophysin relative
to b-tubulin III remained largely unchanged (F). ∗ P , 0.05; ∗∗ P , 0.01 (Bonferroni post hoc test).
Human Molecular Genetics, 2014, Vol. 23, No. 3
asymptomatic, early symptomatic and late symptomatic phases
of disease, respectively. Results here presented show that
optimal function and survival is achieved when treatment is
given during the asymptomatic phase, before signs of disease
are evident. Importantly, the lifespan of animals injected at the
early symptomatic phase was also markedly increased, and
although eventually tremor and motor deficits became apparent,
the animals remained capable of moving with ease around the
cage, long after the onset of disease signs. In stark contrast,
animals injected at the late phase of the illness showed progression of disease which was indistinguishable from that of untreated mutant mice.
Cabrera-Salazar and colleagues reported similar results for
the neurodegenerative LSD late infantile neuronal ceroid lipofuscinosis (cLINCL). In the cLINCL mouse, early intervention
was essential for enhanced therapeutic benefit, and motor function had limited recovery when treatment was started after
disease onset (25). Brooks and colleagues described recovery
of behavioural function after treatment was carried out once
functional deficits were established in murine mucopolysaccharidosis type VII; the authors point out that restoration of function
was possible because, as their data showed, neuronal impairment
was not beyond repair (26). Similarly, Heldermon and colleagues have recently reported improved outcomes in the mouse
model of Sanfilippo B when treatment is given neonatally (27).
The general consensus is that although the adult brain can
show considerable structural plasticity for most inborn errors
of metabolism with neurodegenerative effects, once a skill is
lost, recovery is unlikely. Clearly, to secure long-term functional
rescue of GM2 gangliosidosis, treatment should be given as early
as possible. Nevertheless, it was important to discover not only
that therapeutic benefit can be accrued even when rAAV infusions are delivered when the disease is clinically established
but also that a point is reached when treatment does not translate
into improved function or survival.
Our data demonstrate that viral transduction, transgene
expression and bio-distribution are not hampered by the
advancing process of neurological disease. The pattern of
b-hexosaminidase staining was similar between all age groups
tested, but the most abundant staining was consistently seen in
the 12w injected mice. We attribute the difference to the shorttime elapsed between viral infusion and killing of the animals,
compared with mice injected at earlier time points. This might
suggest loss of virus and/or enzyme activity over time. Alternatively, structural changes in the brain related to the pathological
process itself might facilitate bio-distribution of viral particles
and enzyme. The observation that virus can still be taken up
and transported retrogradely when injected at age 12w is a
strong indication that, in spite of severe disease already present
at this age, axonal integrity and transport is not fully compromised. Concomitant with widespread b-hexosaminidase activity, stored glycoconjugates were rapidly cleared and apparent
normal histology restored.
a-Synuclein is highly expressed in neurons and glia (28).
It binds to a variety of proteins (29), lipid vesicles (30) and is
involved in lipid metabolism (31). Progressive accumulation
of a-synuclein is associated with the development of numerous
neurodegenerative diseases, including Parkinson’s disease,
dementia with Lewy bodies, Alzheimer’s disease, multiple
system atrophy, multiple sclerosis and LSDs. Although the
743
molecular mechanisms linking a-synuclein accumulation and
disease manifestations are not fully understood, a known predisposing factor is increased intracellular amounts of the protein,
caused by enhanced expression or reduced degradation (32).
Mounting evidence indicates that faulty clearance of
a-synuclein is due to impairment of one or other of its principal
pathways of cellular degradation, the ubiquitin – proteosome
system (33) and autophagy – lysosomal pathway (34). Recently,
Suzuki et al. demonstrated histologically that the presence of
a-synuclein aggregates in several of human lipidoses (35). In
line with these findings, we detected extensive a-synuclein
aggregation in many areas of the brain and spinal cord of SD
mice. The aggregates are already evident at age 5w and increase
over time, and free a-synuclein forms are depleted in these
tissues. The contribution of a-synuclein pathology to the
progression and disease manifestations of GM2 gangliosidosis
remains to be defined, but it is conceivable that both phenomena, aggregation and reduced amounts of functional free
a-synuclein, contribute to pathogenesis. Gene transfer at all
ages tested was highly efficient at clearing a-synuclein accumulation from the tissues of SD mice. It has been assumed that
a-synuclein accumulation is linked to glycoconjugate storage
in neurones, but intriguingly Ashe and colleagues have shown
that a-synuclein aggregation can be cleared by treatment with
iminosugar-based glucosylceramide synthase inhibitors, while
glycosphingolipids GM2 and GA2 levels related directly to the
disease remain as high or are even higher than those in untreated
animals (36).
Post-translational ubiquitin conjugation of proteins is a key
regulator of sorting, trafficking, turnover of integral membrane
proteins and the quality-control system that targets defective
proteins to proteasomes or lysosomes for proteolysis (37).
Inclusions-containing ubiquitinated protein aggregates have
been detected in tissues of patients and animal models of
(LSDs) (38). Bifsha et al. attributed ubiquitin accumulation in
these diseases to reduced expression of ubiquitin C-terminal
hydrolase, UCH-L1 (39). While Zhan viewed ubiquitin inclusions in LSDs as a non-specific epiphenomenon of no biological
significance, Bifsha and colleagues suggest that concentrations
of monoubiquitin below a critical level might undermine proteosomal activity. We report here ubiquitin inclusions localizing to
only a few regions of the brain and spinal cord in the SD (UT)
mouse, in contrast to neuraxis-wide staining of glycoconjugates.
Gene transfer fully cleared the ubiquitin inclusions when SD
mice were injected at 4w, 8w and 10 of age. Unlike the clearance
of glycocongugates and a-synuclein, ubiquitin aggregates were
only partially resolved when mice were injected with rAAV at
age 12w. These results suggest that accumulation of ubiquitin
might occur in a distinct subcellular compartment; alternatively,
ubiquitinated proteins might be more resistant to degradation
than glycoconjugates and a-synuclein. While the biological significance of ubiquitin inclusions in SD and other LSDs remains
to be elucidated, we have demonstrated that they respond and are
cleared by gene transfer expressing relevant disease proteins.
There is overwhelming evidence that an important component
of all neurodegenerative diseases is the generation of an innate
inflammatory response within the nervous system. Microglial
and astroglial cells play a key role in the development and maintenance of this response, showing enhanced proliferation and activation. Several lines of evidence support the idea that reactive
744
Human Molecular Genetics, 2014, Vol. 23, No. 3
gliosis in these diseases negatively contributes to disease progression. Bone marrow transplantation in SD mice improved
survival, ameliorated disease signs, and suppressed expansion
of activated microglia in the absence of significant amounts of
corrective enzyme or decreased amounts of ganglioside
storage in the nervous system (15). Treatment of SD mice with
the iminosugar-based glucosylceramide synthase inhibitor
Genz-529468 increased lifespan, improved behavioural abnormalities and reduced inflammatory responses without restitution
of the missing enzyme or reduction of gangliosides in brain (36).
Similarly, deletion of the macrophage inflammatory protein
Mip-1a in SD mice resulted in improved survival and function
(40). The molecular mechanism/s underlying these observations
is unknown, but the nature of the insult to the nervous system is
believed to specifically modulate the inflammatory reaction. We
compared the expression of markers of activated microglia and
macrophage between SD and twitcher mice, classic models of
neurodegenerative and demyelinating diseases, respectively.
We found that in both models of disease up-regulated markers
were more prominent in hindbrain and spinal cord than in forebrain, coincident with regions particularly rich in white matter,
and the stronger reaction occurred in the twitcher. Particularly,
striking was the high induction of the chemokine Rantes in
twitcher mice, while it remained unaltered in SD mice. We attribute Rantes expression in the twitcher to the acute demyelinating
disease characteristic of this model of KD, presumably caused by
the toxic metabolite psychosine (41). The greatest induction of
Rantes occurred in the spinal cord, and this correlates with
prominent demyelination and infiltration of large perivascular
multinucleated macrophages, known as globoid cells.
MIP-1a and Rantes promote inflammation by chemoattraction of specific subsets of haematopoietic cells; while Mip-1a
attracts cytotoxic T cells and B lymphocytes (42), Rantes attracts
monocytes, CD4+ and CD8+ lymphocytes (43) and increases
the adherence of monocytes to endothelial cells. Of note,
whereas Ohno reported T cell infiltration in the twitcher
nervous system (44), Jeyakumar and colleagues could detect
no CD4+ and only a small number of CD8+ lymphocytes in
the thalamus of SD mice, in spite of a compromised blood –
brain barrier (45). In the demyelination model of cuprizone
intoxication, the blood– brain barrier remains intact and
up-regulation of chemokines Rantes and Mip-1a coincides
with the appearance of a few microglia and perturbation of oligodendrocytes, preceding oligodendrocyte apoptosis. Massive
microglia and astrocyte recruitment accompanies demyelination. Absence of Mip-1a delayed demyelination, reduced
microglia numbers and chemokine TNF-a in this disease
model (46). Similarly, administration of Rantes antisera attenuated both macrophage infiltration and demyelination in mouse
hepatitis virus-infected mice (47); and in experimental autoimmune neuritis, administration of anti-MIP-1a antibody suppressed clinical signs, and inhibited inflammation and
demyelination (48). Jeyakumar found up-regulation of TNFa
in SD mice with increasing age, but when they treated the
animals with bone marrow transplantation or the iminosugarbased glucosylceramide synthase inhibitor NB-DNJ expression
of TNFa, MHC class II and CD68 were drastically reduced.
We examined gliosis as a pathological correlate of disease
progression in SD mice, paying particular attention to the last
one and a half months of life, a period of precipitous
pathophysiological events resulting in death. In agreement
with findings by others (15,45), up-regulation of inflammatory
markers was already detectable by 1 month of age, but the
largest increase occurred at 13w, concomitant with the onset of
overt disease; and remained elevated until the animals reached
their humane end point. In spite of deep-seated inflammation,
and even when given during the late symptomatic phase of the
disease, gene transfer reversed these pathological features
suggesting that while the inflammatory response might modify
disease progression, it is an unlikely primary contributor.
Neuronal loss at the time of death in human GM2 gangliosidosis has been found to vary considerably between cases (11).
Huang examined two cases and identified extensive cellular
apoptosis that appeared to include all classes of cells: neurones,
oligodendrocytes, astrocytes, microglia and vascular pericytes.
In the SD mouse, a number of studies have reported neuronal
apoptosis correlating with disease progression and ultimate
demise of the animals (45,49,50). We have also described discrete and gradual loss of neurones in nuclei VPM/VPL of the
thalamus and lateral vestibular nucleus in brain stem, but could
not detect gross neuronal loss that could account for this phenomenon (22). It is possible that modest and diffused losses, difficult to
detect, are responsible for the SD stereotypic phenotype; alternatively, neuronal dysfunction, rather than massive neuronal loss,
might be the major cause of disease in mice. We studied neurones
undergoing degeneration by the exquisitely specific and sensitive
chemical-development-silver method of Gallyas (21), and consistent with GM2 gangliosidosis being a progressive neurodegenerative disease, metal deposition in soma and processes of neurons
increased with age in most areas of the brain and spinal cord.
However, we discovered that degeneration starts at a very early
age, and its time course differs between anatomical regions.
Sensory pathways are among the first sites to show signs of degeneration, followed by staining of large white matter tracts. It is especially notable that some cranial nerves appear to escape
degeneration altogether. Furthermore, the appearance of amoeboid microglia coincided with regions of greatest deposition of
silver. In line with our histological findings of early signs of degeneration in the hippocampus and cerebellum, Gulinello
reported early motor coordination and memory deficits in the
SD mouse (51), and Hu using magnetic resonance imaging
found significant alterations starting at 6–7w age (52).
When we treated animals by gene transfer at age 4w (asymptomatic) and 12w (late symptomatic), killed them at the humane
end point of the latter group and silver stained them, we saw a
remarkable clearance of labelling compared with age-matched
untreated controls. We concluded that even when given late in
the development of the disease, the treatment could prevent
and possibly reverse neurodegeneration. Although we are
unable to follow the fate of individual neurones, it is impossible
to be certain that reversion of degeneration as detected by silver
deposition has occurred; however, it is highly plausible. We
interpret the remaining silver deposition mostly as a failure to
effectively provide enough quantities of enzyme at these sites
in time. Alternatively, as proposed by Cabrera-Salazar et al.
who treated the mouse model of late infantile Batten disease,
neuronal degeneration may only be halted or slowed rather
than reversed (25).
The VPM/VPL nuclei of the thalamus are central to the relay
of sensory information from the hindbrain and spinal cord to the
Human Molecular Genetics, 2014, Vol. 23, No. 3
sensorimotor cortex. We have recently reported gradual neuronal density loss with age and prevention when gene transfer is
given at 4 – 5w age (22). Using the VPM/VPL nuclei as a paradigm of neuronal rescue, we studied lifelong preservation of
neuronal density in long surviving animals, and prevention of
further loss when treatment is delayed. We established that
when treatment is given during the asymptomatic phase of the
disease neuronal preservation last for the entire life of the
animal, and importantly, if the injections are delivered during
the early symptomatic phase further lost is prevented, but if
given during the late phase of disease, neuronal loss proceeds
unabated by treatment.
In his seminal neuropathological investigations, Bernard
Sachs already recognized that abnormalities of the white
matter occur in GM2 gangliosidosis, and since then numerous
case studies have reported varying degrees of demyelination
(11,53). Haberland and Brunngraber described one such case
as failure to myelinate, with increased ganglioside in cerebral
white matter and significant decrease in cerebrosides and glycosaminoglycans, together with derangement in glycoprotein
structure. Comparative studies of the of lipid content in mouse,
cat and human samples of GM2 gangliosidosis at the end stage
of the disease by Baek et al. demonstrated significant reduction
of myelin-enriched lipids, cerebrosides and sulphates compared
with the brain of suitable control subjects (17). Recently, the
cerebral white matter of the sheep model of TSD at 8 months
of age has been analysed histologically and shown to have
decreased myelin-specific staining (54). Opinion has been
divided as to whether myelin defects are merely a consequence
of primary neuronal disease or constitute primary changes of
maturation in myelin development.
Using the demyelinating twitcher mouse as control, we investigated myelin integrity in SD mice. Oligodendrocyte-specific
genes were down-regulated in all regions of the brain and as
early as age 5w, both at the level of transcription and translation.
Expression of cgt [uridine diphosphate (UDP)-galactose:ceramide
transferase], the key enzyme in galactolipid biosynthesis, is
down-regulated in all areas of the brain and from a young age.
Thus, reduced cerebroside and sulphatide in murine GM2 gangliosidosis can be explained, at least partly, by a reduction in this
essential protein. Taken together, our findings cannot easily be
accounted for as a consequence of neuronal loss or axonal degeneration. Kroll and colleagues examined the feline model of SD
by magnetic resonance imaging and their findings are consistent
with delayed myelination. Notably, when these authors analysed
brain tissue with the myelin-specific stain, luxol fast blue, the intensity of staining was reduced, and yet myelin ultra-structure
appeared normal (55). The crucial question immediately posed
is whether myelin composition can be preserved by gene transfer
and if so, to what extent would it be effective when carried out at
different stages during the evolution of disease. Unexpectedly,
myelin protein content was variably reduced in animals treated
during the asymptomatic and early symptomatic phases, and in
animals injected during the late symptomatic phase it appeared
no different from SD (UT) controls. Although a larger cohort
of animals needs to be studied to confirm these results, our findings indicate that early myelin defects are refractory to treatment
when this is given in adult life.
Several recent reports indicate that myelin deficits might be
a common feature among LSDs with neurodegenerative
745
features—as well as contributing an important element of
the pathogenesis early in the course of the given disorder.
Lending support to this notion are recent studies that include
cLINCL Cln8 (56), Nieman-Pick disease type A (57) and
fucosidosis (58).
We concur with the views of Haberland and colleagues that
demyelination is a central part of the development of neurological injury in SD disease, and that this is likely caused by more than
one process; the result of abnormal myelinogenesis and secondary myelin degeneration as a contributory factor (11). With the
availability of different animal models of GM2 gangliosidosis—and effective means for long-term therapeutic gene transfer
combined with a greater understanding of myelin biology—the
tools to explore these fundamental questions that have long intrigued investigators in the field are now available.
We have investigated the nature and progression of the neurological injury in GM2 gangliosidosis—testing whether it can be
prevented, halted or reversed using gene transfer delivered at key
times during the evolution of the disease. We have moreover
studied the salutary effects on survival and well-being of the
animals. The results show that there is a restricted temporal opportunity in which function and survival can be improved—but
regardless of a complete resolution of the cardinal pathological
features of GM2 gangliosidosis, a point is reached when
functional deterioration and death cannot be prevented.
MATERIALS AND METHODS
Experimental animals
The SD knockout mouse (B6;129SHexbtm1Rlp) (10) and natural
mutant KD twitcher mouse (C57BL/6J Galc twi) (59) were
obtained from The Jackson Laboratory (Bar Harbor, ME,
USA). The twitcher mouse, a classic model of demyelination,
has a mutation in the galactosylceramidase (galc) gene and is
an authentic model of infantile KD (OMIM 606890). The
animals appear normal at birth but develop an acute disease,
and die at 40 days of age. Both strains are maintained by heterozygous matings. Studies were conducted by using protocols
approved under license by the U.K. Home Office (Animals Scientific Procedures Act, 1986). Hexb and Galctwi genotyping was
determined by PCR as described elsewhere (18,60). Mice had
access to food and water ad libitum and were provided with nutritional supplements (Transgel; Charles River Laboratories) on
the cage surface. The approved humane end point applied to
mice throughout this study was defined as the loss, between 10
and 20%, of pre-symptomatic body weight for SD, and 20%
from maximum achieved weight for twitcher mice. Animals
were killed at any time if they developed clinical signs such as
visceral enlargement, tumours and self-inflicted injuries or
when they reached the age of 2 years.
Vector construction and production
Human cDNAs coding for b-hexosaminidase a and b subunits
were fused at their 3′ -ends to human immunodeficiency virus
protein transduction domain, WPRE and BGHpA, as described
(18). rAAV viruses were produced by triple plasmid
co-transfection of HEK 293 cells as described (18). Total dose
746
Human Molecular Genetics, 2014, Vol. 23, No. 3
injected was 3.2 × 1010 and 4.7 × 1010 DNAse-resistant particles) for rAAV2/1a and rAAV2/1b, respectively.
Intracranial stereotaxic infusion of rAAV vectors
SD mice were anaesthetized and placed in a stereotaxic frame
(Kopf Instruments, Tujunga, CA, USA). Burr holes were
drilled over target sites, and vector mix was delivered vertically
by using coordinates relative to bregma; striatum, AP (anterior –
posterior): 20.1 mm; ML (medial – lateral): +2.0 mm; and DV
(dorsal –ventral): 23.0 mm; and cerebellum, AP: 26.0 mm;
ML: +1.5 mm; DV: 23.0 mm. Animals received 3 ml of
vector mix per site (rAAV2/1a:rAAV2/1b:20%, w/v, mannitol;
1.1:1.1:0.8), at 0.8 ml/min infusion rate. The needle was withdrawn after 5 min. Animals were given post-operative analgesia
(Rimadyl, Large Animal Solution; Pfizer, Kent, UK) and placed
in an incubator at 378C to recover.
Tissue processing
Mice were killed by CO2 asphyxiation and organs snap-frozen
on dry-ice, or transcardially perfused with cold phosphate buffered saline (PBS) followed by PBS containing 4% paraformaldehyde (pH 7.4) for histochemical staining. Perfused tissue was
post-fixed in the same fixative for a few hours and cryoprotected
in 30% sucrose overnight at 48C. Fifteen-micrometer coronal
sections were mounted on glass slides, dried for a few hours at
room temperature (RT) and stored at 2808C.
Neurodegeneration was detected on 30 mm sections by the
chemical-development-silver method of Gallyas (21),
using the FD NeuroSilverTM Kit II (FD NeuroTechnologies,
Ellicott City, MD, USA), according to the manufactures’
recommendations.
Histological staining
For non-perfused tissue, sections were warmed at RT for
30 min and fixed in cold PBS containing 4% paraformaldehyde (pH 7.4) for 10 min before staining.
b-Hexosaminidase activity was detected with naphthol AS-BI
N-acetyl-b-glucosaminide (Sigma, Poole Dorset, UK) as
described elsewhere (61).
PAS (Leica, UK)-stained sections were counterstained with
haematoxylin (Leica). Prior to mounting in DPX (dibutyl phthalate xylene, british drug houses), sections were dehydrated and
cleared with a series of solutions of increasing concentrations
of ethanol and xylene.
Immunohistological staining was performed with primary
antibodies: rabbit polyclonal anti-a-synuclein [(C-20)-R; Santa
Cruz Biotechnologies, Inc., 1/50], mouse monoclonal antia-synuclein (42/a-Synuclein; BD Transduction LaboratoriesTM ,
1/50), mouse monoclonal anti-ubiquitin (Ubi-1; MAB1510,
Millipore, CA, USA; 1/250), rat monoclonal anti-Cd68
(MCA1957; Serotec, Oxford, UK; 1/50); mouse monoclonal
anti-NeuN (MAB377; Chemicon International, CA, USA; 1/
100); and biotinylated secondary antibodies (Vector Laboratories, UK): goat anti-rabbit (BA-1000; 1/1000), horse anti-mouse
(BA-2000; 1/1000) and rabbit anti-rat (BA-400; 1/1000). Staining was based on the avidin–biotin peroxidase technique (Vectastain ABC HP Kit; Vector Laboratories, San Francisco, CA,
USA), developed with 3′ -diaminobenzidine and counterstained
with Cresyl violet. For anti-NeuN staining, tissue was antigen
retrieved by incubating slides at 95–1008C for 20 min in
10 mM trisodium citrate, pH 6.0. They were then left to cool at
RT for 30 min. Slides were mounted with DPX.
ISH was performed with digoxigenin-labelled riboprobes
against the WPRE-BGHpA sequence, present in both rAAVa
and rAAVb vectors. ISH-positive cells were detected by colorimetric staining with alkaline phosphatase-mediated 5-bromo4-chloro-3-indolylphosphate-nitroblue tetrazolium reaction,
essentially as described (62).
Western blotting
For polyacrylamide-gel electrophoresis, after reduction and
denaturation in sodium dodecyl sulphate and 4% b-mercaptoethanol, tissue extracts were run in 4 – 15% linear gradient
gels (161 – 1122; Bio-Rad). One to 40 mg protein samples were
heated at 908C before gel loading, except for those blotted
with the anti-plp antibody. Western blots were processed with
primary antibodies: mouse monoclonal anti-cnpase (11-5B;
Sigma-Aldrich, MO, USA; 1/1000); rabbit polyclonal anti-th
(AB152; Millipore; 1/1000); chicken polyclonal anti-plp
(NB100-1608; Novus Biologicals; 1/1000); mouse monoclonal
anti-mbp (SMI-94; Calbiochem, CA, USA; 1/1000); mouse
monoclonal anti-b-actin (AC-74; Sigma-Aldrich; 1/5000);
mouse monoclonal anti-b-tubulin III (T8660; Sigma-Aldrich;
1/1000); mouse monoclonal anti-synaptophysin (SY38;
Abcam, UK; 1/1000). Horseradish peroxidase conjugated secondary antibodies were: goat anti-mouse (P0447; DakoCytomation, UK; 1/5000), goat anti-rabbit (401315; Calbiochem; 1/
5000) and goat anti-chicken (ab97135; Abcam; 1/5000). Blots
were developed with AmershamTM ECLTM western blotting
Analysis System (RPN2109; GE Healthcare, UK) following
the manufactures’ recommendations.
Real-time PCR
mRNA was extracted from 20 mg of tissue using the PNA/DNA/
Protein extraction kit (23500; Norgen Biotek Corp, Canada), and
first-strand cDNA was synthesized by reverse transcription of
300– 500 mg of mRNA in a 20-ml total volume with random
primers (205311; Qiagen) following the manufactures’ recommendations. Relative quantitation was performed by real-time
PCR on Applied Biosystems 7500 Fast Real-time PCR System
(Applied Biosystems). One microliter of reverse transcription
reaction was mixed with 300 nmol of each primer and Power
SYBR green PCR master mix (4367662; Applied Biosystems)
was added to a final volume of 20 ml. Thermal cycling conditions
were: 958C for 10 min 1×, 958C for 15 s 1× and 608C for 1 min
40×. Primers were: Mip-1a (macrophage inflammatory protein
1a) forward (F): 5′ -TCTGTACCATGACACTCTGC-3′ and
reverse (R): 5′ AATTGGCGTGGAATCTTCCG 3′ ; Rantes
(regulated on activation normal T cell expressed and secreted)
(F): 5′ -AGT GCT CCA ATC TTG CAG TC-3′ and (R):
5′ -AGC TCA TCT CCA AAT AGT TG-3′ ; Gfap (glial fibrillary
acidic protein) (F): 5′ -AGTAACATGCAAGAGACAGAG-3′
and (R): 5′ -TAGTCGTTAGCTTCGTGCTTG-3′ ; mag
(myelin-associated glycoprotein) (F): 5′ -TACAACCAGTACA
CCTTCTCGG-3′ and (R): 5′ -ATACAACTGACCTCCACT
Human Molecular Genetics, 2014, Vol. 23, No. 3
TCCG-3′ ; plp (F): 5′ -TTCCAGAGGCCAACATCAAG-3′ and
(R): 5′ -AGGAGCCATACAACAGTCAG-3′ ; cgt (UDPgalactose:ceramide galactosyltransferase) (F): 5′ -AGTTTCCA
AGACCAACGCTGC-3′ and (R): 5′ -TGTTCCTGAGCACCA
CTTACC-3′ ; Cd68 (cluster of differentiation 68) primer set:
Mm-Cd68-1-SG QuantiTect primer assay (QT00254051;
Qiagen), b-actin primer set: Mm-Actb-2-SG QuantiTect
Primer assay (QT01136772; Qiagen).
Tissue sampling and counting
Determination of relative neuronal density in VPM/VPL (ventroposterior medial and lateral) nuclei of the thalamus was
achieved by sampling three NeuN-stained sections bilaterally
at 180 mm intervals. Area of the structure and number of
neurons present on a section were determined with ImageJ software (NIH, v1.41). The statistics were analysed with one-way
ANOVA and Bonferroni multiple post hoc comparisons using
GraphPad Prism v5.0 (GraphPad Software).
Statistics
The Kaplan – Meier survival curve was analysed with the
log-rank equivalent to the Mantel– Cox test. The statistics
were analysed with one-way ANOVA and Bonferroni multiple
post hoc comparisons using GraphPad Prism v5.0 (GraphPad
Software). Values with P , 0.05 were considered significant.
The Student’s t-test was applied when comparing two samples.
∗
P , 0.05; ∗∗ P , 0.01; ∗∗∗ P , 0.001.
SUPPLEMENTARY MATERIAL
Supplementary Material is available at HMG online.
Conflict of Interest statement. None declared.
FUNDING
This work was supported by The National Institute of Health
Research University of Cambridge Biomedical Research
Centre (Metabolic theme); and an unrestricted grant from Cambridge in America.
REFERENCES
1. Sandhoff, K., Andreae, U. and Jatzkewitz, H. (1968) Deficient
hexosaminidase activity in an exceptional case of Tay-Sachs disease with
additional storage of kidney globoside in visceral organs. Life Sci., 7, 283–
288.
2. Okada, S. and O’Brien, J.S. (1969) Tay-Sachs disease: generalized absence
of a beta-D-N-acetylhexosaminidase component. Science, 165, 698–700.
3. Colzelmann, E. and Sandhoff, K. (1978) AB variant of infantile GM2
gangliosidosis: deficiency of a factor necessary for stimulation of
hexosaminidase A-catalyzed degradation of ganglioside GM2 and
glycolipid GA2. Proc. Natl. Acad. Sci. USA, 75, 3979– 3983.
4. Kolodny, E.H., Brady, R.O. and Volk, B.W. (1969) Demonstration of an
alteration of ganglioside metabolism in Tay-Sachs disease. Biochem.
Biophys. Res. Commun., 37, 526–531.
5. Sandhoff, K. (1969) Variation of beta-N-acetylhexosaminidase-pattern in
Tay-Sachs disease. FEBS Lett., 4, 351–354.
6. Robinson, D. and Stirling, J. (1968) N-Acetyl-beta-glucosaminidases in
human spleen. Biochem. J., 107, 321–327.
747
7. Beutler, E. and Kuhl, W. (1975) Subunit structure of human hexosaminidase
verified: interconvertibility of hexosaminidase isozymes. Nature (London),
258, 262– 264.
8. Srivastava, S.K., Wiktorowicz, J.E. and Awasthi, Y.C. (1976)
Interrelationship of hexosaminidases A and B: confirmation of the common
and the unique subunit theory. Proc. Natl. Acad. Sci. USA, 73, 2833– 2837.
9. Johnson, W.G. (1981) The clinical spectrum of hexosaminidase deficiency
disease. Neurology, 31, 1453–1456.
10. Sango, K., Yamanaka, S., Hoffmann, A., Okuda, Y., Grinberg, A., Westphal,
H., McDonald, M.P., Crawley, J.N., Sandhoff, K., Suzuki, K. and Proia, R.L.
(1995) Mouse models of Tay-Sachs and Sandhoff diseases differ in
neurologic phenotype and ganglioside metabolism. Nat. Genet.,
11, 170–176.
11. Haberland, C., Brunngrager, E., Witting, L. and Brown, B. (1973) The white
matter in GM2 gangliosidosis. A comparative histopathological and
biochemical study. Acta Neuropathol., 24, 43–55.
12. Puri, V., Watanabe, R., Dominguez, M., Sun, X., Wheatley, C.L., Marks,
D.L. and Pagano, R.E. (1999) Cholesterol modulates membrane traffic along
the endocytic pathway in sphingolipid-storage diseases. Nat. Cell Biol.,
1, 386– 388.
13. Settembre, C., Fraldi, A., Jahreiss, L., Spampanato, C., Venturi, C., Medina,
D., de Pablo, R., Tacchetti, C., Rubinsztein, D.C. and Ballabio, A. (2008)
A block of autophagy in lysosomal storage disorders. Hum. Mol. Genet.,
17, 119–129.
14. Neuenhofer, S., Conzelmann, E., Schwarzmann, G., Egge, H. and Sandhoff,
K. (1986) Occurrence of lysoganglioside lyso-GM2
(II3-Neu5Ac-gangliotriaosylsphingosine) in GM2 gangliosidosis brain.
Biol. Chem. Hoppe Seyler, 367, 241–244.
15. Wada, R., Tifft, C.J. and Proia, R.L. (2000) Microglial activation precedes
acute neurodegeneration in Sandhoff disease and is suppressed by bone
marrow transplantation. Proc. Natl. Acad. Sci. USA, 97, 10954– 10959.
16. Buccoliero, R., Bodennec, J., van Echten-Deckert, G., Sandhoff, K. and
Futerman, A. (2004) Phospholipid synthesis is decreased in neuronal tissue
in a mouse model of Sandhoff disease. J. Neurochem., 90, 80– 88.
17. Baek, R.C., Martin, D.R., Cox, N.R. and Seyfried, T.N. (2009) Comparative
analysis of brain lipids in mice, cats and humans with Sandhoff disease.
Lipids, 44, 197–205.
18. Cachon-Gonzalez, M.B., Wang, S.Z., Lynch, A., Ziegler, R., Cheng, S.H.
and Cox, T.M. (2006) Effective gene therapy in an authentic model of
Tay-Sachs related diseases. Proc. Natl. Acad. Sci. USA, 103, 10373–10378.
19. Cachón-González, M.B., Wang, S.Z., McNair, R., Bradley, J., Lunn, D.,
Ziegler, R., Cheng, S.H. and Cox, T.M. (2012) Gene transfer corrects acute
GM2 gangliosidosis-potential therapeutic contribution of perivascular
enzyme flow. Mol. Ther., 20, 1489–1500.
20. Bradbury, A.M., Cochran, J.N., McCurdy, V.J., Johnson, A.K., Brunson,
B.L., Gray-Edwards, H., Leroy, S.G., Hwang, M., Randle, A.N., Jackson,
L.S. et al. (2013) Therapeutic response in feline sandhoff disease despite
immunity to intracranial gene therapy. Mol. Ther., 21, 1306– 1315.
21. Gallyas, F. (1980) Chemical nature of the first products (nuclei) of the
argyrophil staining. Acta Histochem., 67, 145– 158.
22. Sargeant, T.J., Wang, S., Bradley, J., Smith, N.J., Raha, A.A., McNair, R.,
Ziegler, R.J., Cheng, S.H., Cox, T.M. and Cachón-González, M.B. (2011)
Adeno-associated virus-mediated expression of b-hexosaminidase prevents
neuronal loss in the Sandhoff mouse brain. Hum. Mol. Genet., 20,
4371–4380.
23. Sargeant, T.J., Drage, D.J., Wang, S., Apostolakis, A.A., Cox, T.M. and
Cachón-González, M.B. (2012) Characterization of inducible models of
Tay-Sachs and related disease. PLoS Genet., 8, e1002943. .
24. Miao, C.H., Nakai, H., Thompson, A.R., Storm, T.A., Chiu, W., Snyder,
R.O. and Kay, M.A. (2000) Nonrandom transduction of recombinant
adeno-associated virus vectors in mouse hepatocytes in vivo: cell cycling
does not influence hepatocyte transduction. J. Virol., 74, 3793– 3803.
25. Cabrera-Salazar, M.A., Roskelley, E.M., Bu, J., Hodges, B.L., Yew, N.,
Dodge, J.C., Shihabuddin, L.S., Sohar, I., Sleat, D.E., Scheule, R.K. and
Davidson, B.L. (2007) Timing of therapeutic intervention determines
functional and survival outcomes in a mouse model of late infantile Batten
disease. Mol. Ther., 15, 1782–1788.
26. Brooks, A.I., Stein, C.S., Hughes, S.M., Heth, J., McCray, P.M., Sauter, S.L.,
Johnston, J.C., Cory-Slechta, D.A., Federoff, H.J. and Davidson, B.L. (2002)
Functional correction of established central nervous system deficits in an
animal model of lysosomal storage disease with feline immunodeficiency
virus-based vectors. Proc. Natl. Acad. Sci. USA, 99, 6216–6221.
748
Human Molecular Genetics, 2014, Vol. 23, No. 3
27. Heldermon, C.D., Qin, E.Y., Ohlemiller, K.K., Herzog, E.D., Brown, J.R.,
Vogler, C., Hou, W., Orrock, J.L., Crawford, B.E. and Sands, M.S. (2013)
Disease correction by combined neonatal intracranial AAV and systemic
lentiviral gene therapy in Sanfilippo Syndrome type B mice. Gene Ther.,
20, 913– 921.
28. Shibayama-Imazu, T., Okahashi, I., Omata, K., Nakajo, S., Ochiai, H.,
Nakai, Y., Hama, T., Nakamura, Y. and Nakaya, K. (1993) Cell and tissue
distribution and developmental change of neuron specific 14 kDa protein
(phosphoneuroprotein 14). Brain Res., 622, 17–25.
29. Jenco, J.M., Rawlingson, A., Daniels, B. and Morris, A.J. (1998) Regulation
of phospholipase D2: selective inhibition of mammalian phospholipase D
isoenzymes by a- and b-synucleins. Biochemistry, 37, 4901–4909.
30. Cole, N.B., Murphy, D.D., Grider, T., Rueter, S., Brasaemle, D. and
Nussbaum, R.L. (2002) Lipid droplets binding and oligomerization
properties of the Parkinson’s disease protein alpha-synuclein. J. Biol. Chem.,
277, 6344– 6352.
31. Golovko, M.Y., Rosenberger, T.A., Faergeman, N.J., Feddersen, S., Cole,
N.B., Pribill, I., Berger, J., Nussbaum, R.L., Eric, J. and Murphy, E. (2006)
Acyl-CoA synthetase activity links wild-type but not mutant a-synuclein to
brain arachidonate metabolism. Biochemistry, 45, 6956– 6966.
32. Singleton, A.B., Farrer, M., Johnson, J., Singleton, A., Hague, S., Kachergus,
J., Hulihan, M., Peuralinna, T., Dutra, A., Nussbaum, R. et al. (2003)
Alphasynuclein locus triplication causes Parkinson’s disease. Science, 302,
841.
33. Olanow, C.W. and McNaught, K.S. (2006) Ubiquitin-proteasome system
and Parkinson’s disease. Mov. Disord., 21, 1806–1823.
34. Wong, E. and Cuervo, A.M. (2010) Autophagy gone awry in
neurodegenerative diseases. Nat. Neurosci., 13, 805–811.
35. Suzuki, K., Iseki, E., Katsuse, O., Yamaguchi, A., Katsuyama, K.,
Yamanaka, S. and Kosaka, K. (2003) Neuronal accumulation of a- and
b-synucleins in the brain of a GM2 gangliosidosis mouse model.
Neuroreport, 14, 551– 554.
36. Ashe, K.M., Bangari, D., Li, L., Cabrera-Salazar, M.A., Bercury, S.D.,
Nietupski, J.B., Cooper, C.G.F., Aerts, J.M.F.G., Lee, E.R. and Copeland,
D.P. (2011) Iminosugar-based inhibitors of glucosylceramide synthase
increase brain glycosphingolipids and survival in a mouse model of Sandhoff
disease. PLos ONE, 6, e21758. .
37. Bonifacino, J.S. and Traub, L.M. (2003) Signals for sorting of
transmembrane proteins to endosomes and lysosomes. Annu. Rev. Biochem.,
72, 395– 447.
38. Zhan, S.S., Beyreuther, K. and Schmitt, H.P. (1992) Neuronal ubiquitin and
neurofilament expression in different lysosomal storage disorders. Clin.
Neuropathol., 11, 251– 255.
39. Bifsha, P., Landry, K., Ashmarina, L., Durand, S., Seyrantepe, V., Trudel, S.,
Quiniou, C., Chemtob, S., Xu, Y., Gravel, R.A., Sladek, R. and Pshezhetsky,
A.V. (2007) Altered gene expression in cells from patients with lysosomal
storage disorders suggests impairment of the ubiquitin pathway. Cell Death
Differ., 14, 511– 523.
40. Wu, Y-P. and Proia, R.L. (2004) Deletion of macrophage-inflammatory
protein 1a retards neurodegeneration in Sandhoff disease mice. Proc. Natl.
Acad. Sci. USA, 101, 8425–8430.
41. Svennerholm, L., Vanier, M-T. and Mansoon, J-E. (1980) Krabbe disease: a
galactosylspingosine (psychosine) lipidosis. J. Lipid Res., 21, 53–64.
42. Schall, T.J., Bacon, K., Camp, R.D., Kaspari, J.W. and Goeddel, D.V. (1993)
Human macrophage inflammatory protein alpha (MIP-1 alpha) and MIP-1
beta chemochines attract distinct populations of lymphocytes. J. Exp. Med.,
177, 1821– 1826.
43. Schall, T.J., Bacon, K., Karen, J.T. and Goeddel, D.V. (1990) Selective
attraction of monocytes and T lymphocytes of the memory phenotype by
cytokine RANTES. Nature, 347, 669–673.
44. Ohno, M. and Komiyama, A. (1993) MHC Class II antigen expression in
the demyelinating CNS and PNS of the twitcher mouse. Brain Res., 625,
186– 196.
45. Jeyakumar, M., Thomas, R., Elliot-Smith, E., Smith, D.A., van der Spoel,
A.C., d’Azzo, A., Perry, V.H., Butters, T.D., Dwek, R.A. and Platt, F.M.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
(2003) Central nervous system inflammation is a hallmark of pathogenesis in
mouse models of GM1 and GM2 gangliosidosis. Brain, 126, 974– 987.
McMahon, E.J., Cook, D.N., Suzuki, K. and Matsushima, G.K. (2001)
Absence of Macrophage-infammatory protein-1 a delays central nervous
system demyelination in the presence of an intact blood-brain barrier.
J. Immunol., 167, 2964–2971.
Lane, T.E., Liu, M.T., Chen, B.P., Asensio, V.C., Samawi, R.M., Paoletti,
A.D., Campbell, I.L., Kunkel, S.L., Fox, H.S. and Buchmeier, M.J. (2000) A
central role for CD4+ T cells and RANTES in virus-induced central nervous
system inflammation and demyelination. J. Virol., 74, 1415–1424.
Zou, L.P., Pelidou, S.H., Abbas, N., Deretzi, G., Mix, E., Schaltzbeerg, M.,
Winblad, B. and Zhu, J. (1999) Dynamics of production of MIP-1a, MCP-1
and MIP-2 and potential role of neutralization of these chemokines in the
regulation of immune responses during experimental autoimmune neuritis in
Lewis rats. J. Neuroimmunol., 98, 168 –175.
Huang, J-Q., Trasler, J.M., Igdoura, S., Michaud, J., Hanai, N. and Gravel,
R.A. (1997) Apoptotic cell death in mouse models of GM2 gangliosidosis
and observations on human Tay-Sachs and Sandhoff diseases. Hum. Mol.
Genet., 6, 1879–1885.
Myerowitz, R., Lawson, D., Mizukami, H., Mi, Y., Tifft, C.J. and Proia, R.L.
(2002) Molecular pathophysiology in Tay-Sachs and Sandhoff diseases as
revealed by gene expression profiling. Hum. Mol. Genet., 11, 1343– 1350.
Gulinello, M., Chen, F. and Dobrenis, K. (2008) Early deficits in motor
coordination and cognitive dysfunction in a mouse model of the
neurodegenerative lysosomal storage disorder, Sandhoff disease. Behav.
Brain Res., 193, 315– 319.
Hu, L., Sun, Y., Villasana, L.E., Paylor, R., Klann, E. and Pautler, R.G.
(2009) Early changes in the apparent diffusion coefficient (ADC) in a mouse
model of Sandhoff disease occur prior to disease symptoms and behavioural
deficits. Magn. Reson. Med., 62, 1175–1184.
Haberland, C. and Brunngraber, E.G. (1970) Early infantile neurolipodosis
with failure of myelination. A chemical and histopathological study. Arch.
Neurol., 23, 481– 488.
Porter, B.F., Lewis, B.C., Edwards, J.F., Alroy, J., Zeng, B.J., Torres, P.A.,
Bretzlaff, K.N. and Kolodny, E.H. (2011) Pathology of GM2 gangliosidosis
in Jacob sheep. Vet. Pathol., 48, 807– 813.
Kroll, R.A., Pagel, M.A., Roman-Goldstein, S., Barkovich, A.J.,
D’Agostino, A.N. and Neuwelt, E.A. (1995) White matter changes
associated with feline GM2 gangliosidosis (Sandhoff disease): correlation of
MR findings with pathologic and ultrastructural abnormalities.
Am. J. Neuroradiol., 16, 1219–1226.
Kuronen, M., Hermansson, M., Manninen, O., Zech, I., Talvitie, M.,
Laitinen, T., Gröhn, O., Somerharju, P., Eckhardt, M., Cooper, J.D. et al.
(2012) Galactolipid deficiency in the early pathogenesis of neuronal ceroid
lipofuscinosis model Cln8mnd: implications to delayed myelination and
oligodendrocyte maturation. Neuropath. Appl. Neurobiol., 38, 471– 486.
Buccinnà, B., Piccinini, M., Prinetti, A., Scandroglio, F., Prioni, S.,
Valsecchi, M., Votta, B., Grifoni, S., Lupino, E., Ramondetti, C. et al. (2009)
Alterations of myelin-specific proteins and sphingolipids characterised the
brains of acid sphingomyelinase-deficient mice, an animal model of
Niemann-pick disease type A. J. Neurochem., 109, 105–115.
Fletcher, J.L., Kondagari, G.S., Wright, A.L., Thomson, P.C., Williamson,
P. and Taylor, R.M. (2011) Myelin genes are downregulated in canine
fucosidosis. Biochim. Biophys. Acta, 1812, 1418– 1426.
Duchen, L.W., Eicher, E.M., Jacobs, J.M., Scaravilli, F. and Teixeira, F.
(1980) Hereditaryleucodystrophy in the mouse: the new mutant twitcher.
Brain, 103, 695–710.
Sakai, N., Inui, K., Tatsumi, N., Fukushima, H., Nishigaki, T., Taniike, M.,
Nishimoto, J., Tsukamoto, H., Yanagihara, I., Ozono, K. and Okada, S.
(1996) Molecular cloning and expression of cDNA for murine
galactocerebrosidase and mutation analysis of the twitcher mouse, a model
of Krabbe’s disease. J. Neurochem., 66, 1118–1124.
Lacorazza, H.D. and Jendoubi, M. (1995) In situ assessment of
beta-hexosaminidase activity. BioTechniques, 19, 434–439.
Barthel, L.K. and Raymond, P.A. (2000) In situ hybridization studies of
retinal neurons. Methods Enzymol., 316, 579– 590.