Divergent Effects of BAFF on Human
Memory B Cell Differentiation into
Ig-Secreting Cells
This information is current as
of June 17, 2017.
Jaime R. Darce, Bonnie K. Arendt, Sook Kyung Chang and
Diane F. Jelinek
J Immunol 2007; 178:5612-5622; ;
doi: 10.4049/jimmunol.178.9.5612
http://www.jimmunol.org/content/178/9/5612
Subscription
Permissions
Email Alerts
This article cites 59 articles, 32 of which you can access for free at:
http://www.jimmunol.org/content/178/9/5612.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2007 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
References
The Journal of Immunology
Divergent Effects of BAFF on Human Memory B Cell
Differentiation into Ig-Secreting Cells1
Jaime R. Darce, Bonnie K. Arendt, Sook Kyung Chang, and Diane F. Jelinek2
B
cell differentiation into effector memory B (MB)3 cells or
Ig-secreting cells (ISCs) is influenced by various cytokines present in the activation milieu. In particular, members of the TNF/TNF-R superfamily have been shown to play significant roles in B cell differentiation (1). One member of this
family, B cell-activating factor belonging to the TNF family
(BAFF; also known as BLyS), is critical for the survival and homeostasis of B lymphocytes (2). BAFF was initially found to be
expressed and secreted by myeloid lineage cells in response to
IFN-␥ stimulation (3, 4). However, it is now known that BAFF is
also expressed by neutrophils, astrocytes, neoplastic, and normal B
lineage cells, and T cells from autoimmune disorders (5–12). It is
expressed as a transmembrane protein or as a soluble ligand following cleavage at the cell surface by furin convertases (13).
To date, BAFF has been shown to bind to three receptors:
BAFF-R (14), transmembrane activator and calcium-modulating
Department of Immunology, Mayo Clinic College of Medicine, Mayo Graduate
School, Rochester, MN 55905
Received for publication November 13, 2006. Accepted for publication February
20, 2007.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by National Institutes of Health Grant RO1 CA 105258
(awarded to D.F.J.) and Predoctoral Fellowship F31 AI 61838 (awarded to J.R.D.).
2
Address correspondence and reprint requests to Dr. Diane F. Jelinek, Mayo Clinic
College of Medicine, 200 First Street Southwest, Rochester, MN 55905. E-mail address: [email protected]
3
Abbreviations used in this paper: MB, memory B; 40L/c, CD40L/cytokine; anti-Ig/
40L/c, anti-Ig/CD40L/cytokine; BAFF, B cell-activating factor belonging to the TNF
family; BBR, BAFF-binding receptor; BCMA, B cell maturation Ag; cIg, cytoplasmic
Ig; CpG/c, CpG/cytokine; DPBS, Dulbecco’s PBS; FDC, follicular dendritic cell; GC,
germinal center; ISC, Ig-secreting cell; MFI, median fluorescence intensity; PB, peripheral blood; PI, propidium iodide; rhBAFF, human rBAFF; rhBCMA, human rBCMA; rhBR3, human BLyS receptor 3; SA/c, Staphylococcus aureus Cowan A plus
IL-2; TACI, transmembrane activator and calcium-modulating cyclophilin ligand interactor; TD, T cell dependent; TI, T cell independent.
Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00
www.jimmunol.org
cyclophilin ligand interactor (TACI) (15–17), and B cell maturation Ag (BCMA) (18, 19). These receptors are predominantly expressed on B lineage cells, although their expression has been observed in activated T cells and myeloid lineage cells (20 –22).
BAFF-binding receptors (BBRs) are expressed at various stages
of B cell maturation (23), implying a role for BAFF at all stages of
development. However, the role of BAFF is best understood in
relationship to post-bone marrow B cell maturation. Thus, there is
clear evidence using BAFF null mice that this molecule is critically required for the progression of B cell development beyond
the transitional type 2 stage (14, 19). BAFF also appears to be
important in B cell homeostasis, because BAFF transgenic mice
show an increase in mature B cells, which often leads to autoimmunity (24, 25). Of interest, serum BAFF levels are elevated in
autoimmune patients and some patients with mature B cell malignancies, which correlates with elevated numbers of autoreactive
and malignant B cells observed in these patients (26 –28). Moreover, readily detectable levels of serum BAFF, ranging from 5 to
10 ng/ml, are found in healthy individuals (27, 28). Despite the
known relationship between BAFF levels and B cell numbers, the
steady-state levels of BAFF receptor(s) occupancy required to
maintain B cell homeostasis remain unknown. Using an indirect
approach assessing BAFF-R occupancy, Carter et al. (29) recently
provided the first evidence that normal human B cells display prebound BAFF and that this was elevated in B cells from patients
with systemic lupus erythematosus. Their results provocatively
suggested a correlation between receptor occupancy and disease
activity. Their study highlights the lack of knowledge in this area
regarding normal human B cells. Specifically, it is unclear whether
human B cells require a certain level of BAFF receptor(s) occupancy to survive, become activated, or differentiate. Similarly, it is
unclear whether all human B cell subsets exhibit a certain degree
of baseline BBR occupancy.
Adding to this complexity, because BAFF null mice lack mature
B cells, it has been difficult to address the influence that BAFF has
at later stages of B cell development. However, recent studies have
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
B cell-activating factor belonging to the TNF family (BAFF) plays a critical role in B cell maturation, yet its precise role in B cell
differentiation into Ig-secreting cells (ISCs) remains unclear. In this study, we find that upon isolation human naive and memory
B (MB) cells have prebound BAFF on their surface, whereas germinal center (GC) B cells lack detectable levels of prebound
BAFF. We attribute their lack of prebound BAFF to cell activation, because we demonstrate that stimulation of naive and MB cells
results in the loss of prebound BAFF. Furthermore, the absence of prebound BAFF on GC B cells is not related to a lack of
BAFF-binding receptors or an inability to bind exogenous BAFF. Instead, our data suggest that accessibility to soluble BAFF is
limited within GCs, perhaps to prevent skewing of the conventional B cell differentiation program. In support of this concept,
whereas BAFF significantly enhances ISC differentiation in response to T cell-dependent activation, we report for the first time
the ability of BAFF to considerably attenuate ISC differentiation of MB cells in response to CpG stimulation, a form of T
cell-independent activation. Our data suggest that BAFF may be providing regulatory signals during specific T cell-independent
events, which protect the balance between MB cells and ISCs outside GCs. Taken together, these data define a complex role for
BAFF in humoral immune responses and show for the first time that BAFF can also play an inhibitory role in B cell
differentiation. The Journal of Immunology, 2007, 178: 5612–5622.
The Journal of Immunology
Materials and Methods
Cells
Mononuclear cells from peripheral blood (PB) of normal donors or tonsil
tissue from routine tonsillectomies were separated by Ficoll-Hypaque density-gradient centrifugation. Individuals provided written informed consent
in accordance with the Declaration of Helsinki. The Mayo Clinic Rochester institutional review board approved the protocol to obtain blood or
tonsil tissue from volunteers. B lymphocytes were enriched to ⬎98%
purity by magnetic cell separation using StemCell Technology B cell
enrichment mixture/colloid and the negative selection program on the
Robosep Separator (StemCell Technologies). GC B cells or PB B cell
subsets were stained with Abs against CD38 and/or CD27 and sorted
using a FACSVantage sorter (BD Immunocytometry Systems).
Flow cytometry
Purified B cells were stained using standard flow cytometry methodology. Briefly, cells were incubated on ice for 20 min with primary Ab,
before washing twice with cold FACS buffer (Dulbecco’s PBS (DPBS)
containing 2 mM EDTA, 0.05% sodium azide, and 2% FCS) and subsequent incubation with various secondary reagents. After washing,
cells were fixed with 1% paraformaldehyde before analysis using a
FACSCalibur flow cytometer (BD Pharmingen) and FlowJo analytical
software (Tree Star). CD27 and CD38 Abs were purchased from BD
Pharmingen; anti-BAFF-biotinylated polyclonal Abs were purchased from
Antigenix America; and an unconjugated anti-BAFF mAb specific for detecting transmembrane BAFF (Buffy-1) was purchased from Alexis Biochemicals. PE-conjugated mAbs against BAFF-R along with isotype control Abs were purchased from eBioscience; and biotinylated polyclonal
anti-TACI and anti-BCMA Abs were purchased from R&D Systems along
with goat biotinylated IgG control. PE- or allophycocyanin-labeled streptavidin (Caltag Laboratories/Invitrogen Life Technologies) and PE-conjugated rabbit anti-mouse Abs (BioSource International) were used as secondary reagents. To evaluate exogenous BAFF binding, cells were
incubated on ice for 30 min with 0.5 ␮g of human rBAFF (rhBAFF; R&D
Systems) or a long form of rhBAFF (Alexis Biochemicals; containing an
intact stalk region, wherever specified) before washing two times, and then
stained using anti-BAFF-specific or isotype control Abs. Cell turnover was
determined using CFSE (Molecular Probes/Invitrogen Life Technologies)
intercalating dye. Cells were suspended in 0.1% FCS/DPBS at a density of
20 ⫻ 106 cells/ml and labeled with 1.5 ␮M CFSE for 8 min at room
temperature. Labeling was halted by adding prewarmed FCS, and then
incubating at 37°C for 10 min to efflux excess CFSE. Cells were washed
three times with 2% FCS/DPBS and cultured in the presence or absence or
mitogen.
RT-PCR
The TRIzol reagent (Invitrogen Life Technologies) was used to isolate total
RNA from purified PB B cells and tonsillar B cell subsets. RNA was
converted into cDNA using the First-Strand cDNA Synthesis Kit (Amer-
sham Biosciences), according to the manufacturer’s instructions. BAFF
and ␤-actin cDNAs were detected by PCR amplification with HotStarTaq
(Qiagen) in steps of 1 min each at 94°C, 60°C, and 72°C for 35 cycles,
using primers previously described as being specific for BAFF (7) (5⬘GGA GAA GGC AAC TCC AGT CAG AAC and 3⬘-CAA TTC ATC
CCC AAA GAC ATG GAC). The following primers were designed using
the published cDNA nucleotide sequences for ␤-actin: 5⬘-GGA TCC GAC
TTC GAG CAA GAG ATG GCC AC and 3⬘-CAA TGC CAG GGT ACA
TGG TG.
Stripping of soluble BAFF
Purified PB B cells were cultured in polypropylene round-bottom tubes
(BD Discovery Labware) at a concentration of 10 ⫻ 106 cells/ml for 2 h at
37°C in complete medium (RPMI 1640 with 10% FCS, L-glutamine, penicillin, and streptomycin) in the presence or absence of 10 ␮g/ml human
BLyS receptor 3 (rhBR3; Antigenix America) or human rBCMA
(rhBCMA; Antigenix America). After the incubation, cells were washed
twice with FACS buffer and then stained using anti-BAFF polyclonal Abs,
as described above.
Polyclonal activation of PB B cells
PB B cells were activated with the following polyclonal stimuli: antiIg/CD40L/cytokines (anti-Ig/40L/c) (2 ␮g/ml agonistic anti-IgA, IgG,
IgM F(ab⬘)2 Abs) (Jackson ImmunoResearch Laboratories) in the presence of IL-2 (100 U/ml; Fitzgerald Industries International), IL-4 (50 ng/
ml; PeproTech), IL-10 (50 ng/ml; PeproTech), and soluble human
rCD40L/TNF-related activation protein (0.5 ␮g/ml; Fitzgerald Industries
International); CpG/cytokines (CpG/c) (oligodeoxynucleotide 2006 5⬘-TC
GTCGTTTTGTCGTTTTGTCGTT, synthesized by in-house core facility)
with IL-2 (100 U/ml) and IL-15 (10 ng/ml; PeproTech); CD40L/cytokines
(40L/c) (0.5 ␮g/ml soluble human rCD40L/TNF-related activation protein
plus IL-2 (100 U/ml) and IL-10 (50 ng/ml)). B cells were cultured at 37°C
in a 5% CO2 incubator for the indicated lengths of time in polypropylene
round-bottom tubes in the presence or absence of the above stimuli at a
concentration of 1 ⫻ 106 cells/ml complete medium. When specified, IL-4
(50 ng/ml; PeproTech) was used to improve cell viability of unactivated B
cells in long-term culture experiments.
Cell cycle analysis
PB B cells were cultured in polypropylene round-bottom tubes in the presence or absence of stimulus for the indicated lengths of time, as described
above. On day of analysis, cells were pulsed with 10 ␮M BrdU for 2 h
before harvest. BrdU incorporation was determined according to the protocol described for BrdU flow kits (BD Pharmingen). BrdU incorporation
was analyzed using a FACSCalibur flow cytometer (BD Pharmingen).
Cell viability
B cells were washed once with DPBS, resuspended in a 100-␮l vol of cold
annexin-binding buffer, and stained with annexin V-FITC (Caltag Laboratories/Invitrogen Life Technologies) on ice for 20 min. Cells were washed
once with annexin-binding buffer, and then 0.5 ␮g/ml propidium iodide
(PI) was added right before flow cytometric analysis. Cell number and
viability were also corroborated through whole cell counts of cells stained
with trypan blue exclusion dye.
Western blot analysis
Cells were lysed using radioimmunoprecipitation assay lysis buffer (50
mM Tris (pH 7.4), 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM EDTA, 15 mM sodium molybdate, and 1 mM
NaF) supplemented with protease inhibitors (10 ␮g/ml leupeptin, 10 ␮g/ml
aprotinin, 10 ␮g/ml pepstatin, 2 mM Na3VO4, and 1 mM PMSF). Lysates
were cleared of insoluble material by centrifugation for 10 min at 15,000 ⫻
g. Lysates (10 ␮g/lane) were resolved by SDS-PAGE and transferred to
Immobilon-P membranes (Millipore) for immunoblotting. Membranes
were blocked in StartingBlock TBS blocking buffer (Pierce Biotechnology)
supplemented with 0.2% Tween 20. Membranes were blotted overnight
with 0.2 ␮g/ml biotinylated anti-BAFF polyclonal Abs, followed by incubation with a 1/1000 dilution of avidin-HRP (eBioscience). Immunoreactive proteins were detected using an ECL detection system (SuperSignal;
Pierce) and autoradiography. Recombinant soluble BAFF (R&D Systems)
and lysates obtained from 293T cells transfected with a human full-length
BAFF cDNA construct (provided by R. Bram, Mayo Clinic, Rochester,
MN) were used as positive controls. The 293T cell lysates used in these
studies were significantly diluted because of the high levels of BAFF expression achieved. As a consequence, ␤-actin levels are significantly reduced and cannot be visualized on the blots.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
begun to demonstrate that BAFF can influence class switch recombination of naive murine and human B cells (30, 31) as well as
enhance survival and effector functions of in vitro generated plasmablasts (32). Nevertheless, it is clear that additional investigation
is needed to completely understand the impact BAFF has in later
stages of B cell differentiation.
In this study, we find that soluble BAFF is on the surface of
naive and memory human B cells at isolation, whereas prebound
BAFF is strikingly absent on freshly isolated germinal center (GC)
B cells. Moreover, in agreement with our GC B cell observations,
we found that B cell activation, even in the absence of proliferation, resulted in the gradual loss of prebound BAFF, yet the ability
to bind exogenous BAFF was not compromised. Furthermore, we
report that although BAFF enhances the differentiation of MB cells
into ISCs activated in a T cell-dependent (TD) manner, we unexpectedly discovered that BAFF attenuates differentiation of MB
into ISCs when activated through a T cell-independent (TI) response. Thus, for the first time, we provide evidence demonstrating
that BAFF has opposite effects on B cell differentiation depending
on the mode of B cell activation, further highlighting the complexity of this cytokine.
5613
5614
PLEIOTROPIC EFFECTS OF BAFF ON B CELL DIFFERENTIATION
Analysis of Ig secretion
Results
Ig secretion was measured using a standard Ig H chain-specific ELISA.
Briefly, 96-well microtiter plates (Nalge Nunc International) were independently coated with anti-IgA, anti-IgG, and anti-IgM Abs (BioSource
International). Plates were then blocked with 1⫻ casein (BioFX Laboratories). After several washes, culture supernatants were added to coated
plates and incubated for 2 h. Igs were detected colorimetrically using antiIgA, anti-IgG, and anti-IgM HRP-labeled Abs (BioSource International)
and a Molecular Devices microplate reader. Standard curves were generated to quantitate ELISA results using known amounts of purified human
IgA, IgG, and IgM Abs (Jackson ImmunoResearch Laboratories). The detection limit of the assays was 1 ␮g/ml-0.1 ng/ml for IgG and IgM and 2
␮g/ml-0.1 ng/ml for IgA. The o-phenylenediamine dihydrochloride ELISA
substrate for HRP along with stable peroxide substrate buffer were purchased from Pierce.
Soluble BAFF is constitutively bound to resting PB B cells
Detection of cytoplasmic Ig (cIg)
Activated B cells were mounted on glass slides via centrifugation using a
Thermo Shandon cytospin 2. Briefly, cells were fixed using 95% ethanol
for 5 min, washed with 1⫻ PBS/0.1% Tween 80 for 1 min, and then stained
with 1 ␮g/ml polyclonal FITC-conjugated F(ab⬘)2 anti-human IgA, IgG,
and IgM Ab (BioSource International). The cells were then washed and
viewed using an Olympus AX 70 fluorescence microscope (Olympus
America). Analysis of cIg-positive cells was also determined using flow
cytometry following intracellular labeling, according to the instructions
provided with the Fix and Perm cell permeabilization kit from Caltag Laboratories/Invitrogen Life Technologies.
Statistical analysis
Statistical analysis was performed using Student’s t test. Values of p ⬍
0.05 were considered statistically significant.
Evidence that BAFF is readily detectable in the serum of healthy
individuals (27, 28) prompted us to determine whether BBRs on
normal PB B cells were occupied at time of cell isolation. We
began these studies by using an anti-BAFF-specific polyclonal Ab
and assessing which cells exhibit surface BAFF detection in total
PBMC. As shown in Fig. 1A, CD19-positive B cells were the only
cells that reacted with the anti-BAFF Ab. Furthermore, purified PB
B cells obtained from several healthy individuals were all uniformly and significantly reactive with the anti-BAFF Ab (Fig. 1B).
However, the absolute levels of surface BAFF did vary between
individuals, suggestive of potential variation in the levels of serum
BAFF that can be found within healthy individuals. Moreover,
analysis of blood naive (CD27⫺) and MB (CD27⫹) cells revealed
that both of these populations have similar detection levels of surface BAFF (Fig. 1C).
Because B cell reactivity with the anti-BAFF Ab at isolation
could be a reflection of processed soluble ligand occupying BBRs
or of intrinsic B cell expression of transmembrane BAFF, we used
a Western blot approach to discriminate between these possibilities. As controls, we ran soluble rBAFF or whole cell lysates from
293T cells that were transiently transfected with a BAFF construct.
As shown in Fig. 1D, the Ab used for flow cytometry also
worked in Western blot analyses, and it was capable of recognizing both the full-length as well as the soluble forms of
BAFF. Analysis of B cell lysates obtained from five healthy
individuals revealed a prominent 17-kDa band, suggesting that
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 1. Detectable levels of prebound BAFF on the surface of resting blood
B cells. A, PBMC were stained with Abs
against BAFF and CD19. B, Freshly isolated
PB B cells from several donors were stained
with polyclonal anti-BAFF Abs. Numbers
represent the ␦ median fluorescence intensity
(MFI) measured by dividing the MFI of the
anti-BAFF Ab by the MFI of control Ab. Ig
control Ab (shaded histogram); Ag-specific
Ab (solid line histogram). C, Prebound
BAFF on PB naive CD27⫺ (solid lined histogram) and memory CD27⫹ (dotted histogram) B cells. D, Lysates from freshly isolated B cells were assessed by Western blot
using an anti-BAFF Ab. E, Expression of
BAFF and ␤-actin mRNA levels in PB B
cells isolated from different healthy donors.
sB, Human soluble rBAFF. FL-B, Fulllength BAFF. Abs against ␤-actin were used
to demonstrate equal loading of B cell
lysates.
The Journal of Immunology
5615
FIGURE 2. Assessment of PB B cell expression of the transmembrane form of
BAFF. A, 293T cells were transiently transfected with empty vector (Mock) or a vector
containing a full-length human BAFF
cDNA. Surface BAFF expression was assessed 24 h posttransfection using the antiBAFF Buffy-1 Ab. Expression of transmembrane BAFF using Buffy-1 Ab on PB B cells
in the absence (B) or presence (C) of the
long form of rhBAFF containing the stalk
domain (Alexis). D and E, Specificity of antiBAFF polyclonal Ab. PB B cells were incubated for 2 h at 37°C in medium alone or
medium containing rhBCMA or rhBR3 before determining BAFF levels using flow cytometry (D) and Western blot (E) methods.
Anti-BAFF reactivity of PB B cells primarily reflects bound
soluble BAFF
Because PB B cells expressed BAFF mRNA and there was evidence of trace levels of full-length BAFF protein in B cell lysates,
we next wished to determine whether the anti-BAFF reactivity of
B cells, revealed by flow cytometry, primarily reflected prebound
soluble BAFF or cell surface transmembrane BAFF expression. To
accomplish this, we used Abs specific for the stalk region of
BAFF, which is intact in the BAFF transmembrane glycoprotein.
The efficacy of the Ab was first assessed by staining 293T cells
transiently transfected with either a control vector (mock) or a
full-length BAFF cDNA construct. Fig. 2A demonstrates that the
Ab recognizes 293T cells transfected with the BAFF construct, but
not the empty vector. We then used this Ab to stain freshly isolated
PB B cells and found there was no reactivity with this Ab (Fig.
2B). However, reactivity was observed when B cells were previously incubated with a human rBAFF containing an intact stalk
region, thus further demonstrating the specificity of this Ab and
underscoring the observation that transmembrane BAFF levels are
undetectable in PB B lymphocytes (Fig. 2C).
Because B cells lacked reactivity with an Ab specific for the
stalk region of BAFF, it remained possible that the polyclonal
anti-BAFF Ab, used in the experiments shown in Fig. 1, lacked
specificity. To address this possibility, we used a soluble decoy
receptor approach and next preincubated B cells with rhBAFF-R
(rhBR3) before assessing reactivity with the polyclonal anti-BAFF
Ab. As shown in Fig. 2D, preincubation of B cells with rhBR3 significantly attenuated the levels of surface BAFF, whereas incubation
with rhBCMA did not. The latter observation was expected because
we anticipated that rhBCMA would not disrupt BAFF binding because it has a lower affinity to BAFF in comparison with BAFF-R
(33, 34). Because it was possible that the rhBR3 was simply masking the epitope(s) recognized by the anti-BAFF Ab, we verified by
Western blot that the rhBR3 significantly reduced the levels of
17-kDa soluble BAFF, but not the band corresponding to fulllength BAFF (⬃32 kDa). Furthermore, the levels of soluble BAFF
were not compromised in the rhBCMA-treated cells (Fig. 2E). In
results not shown, extended incubation with rhBR3 (20 –24 h) resulted in a complete loss of soluble BAFF as revealed by flow
cytometry and Western blot. Taken together, these data demonstrate that freshly isolated PB B cells do not have detectable levels
of transmembrane BAFF, but instead display significant levels of
prebound BAFF on their cell surface.
GC B cells lack baseline surface BAFF binding
Because for the most part B cells in blood comprise both resting
naive and MB cells, we wanted to determine whether BAFF receptors were also occupied in an activated B cell population.
Therefore, we next analyzed tonsillar tissue, which is a source of
activated GC B cells in addition to naive and MB cells. We found
that tonsillar naive and MB cells have uniform levels of prebound
BAFF (Fig. 3A), albeit generally at a lower level than that observed in PB B cells. Interestingly, in contrast to tonsillar naive
and MB cells, we were unable to detect BAFF on the surface of
GC B cells (Fig. 3A). These results were further confirmed by
Western blot analysis (Fig. 3B). Moreover, we found that both
populations of CD38low and CD38high B cells expressed trace levels of full-length BAFF. Therefore, as previously evaluated in
blood B cells, we looked for BAFF mRNA levels in both populations. We demonstrate that CD38low and CD38high B cells express BAFF mRNA, yet lower expression levels of BAFF mRNA
were observed in CD38high GC B cells (Fig. 3C). In addition,
similar to blood B cells, we found no detectable levels of transmembrane BAFF in either population when using flow cytometry
and the Ab specific for the stalk region of BAFF (data not shown).
Although GC B cells clearly did not express detectable levels of
prebound BAFF, we next wanted to address whether this observation reflected the inability of GC B cells to bind BAFF, i.e.,
BBRs may be down-regulated in this population of B cells. Although BBR expression of GC B cells has been documented previously by several groups (22, 35, 36), it was important to test this
possibility in the context of our studies. As shown in Fig. 3D, both
naive and MB tonsillar cells uniformly expressed BAFF-R (Fig.
3D). MB cells, but not naive B cells, uniformly expressed TACI
and low levels of BCMA. Analysis of BBRs on GC B cells revealed a uniform expression of BAFF-R and to a lesser degree
BCMA. This population also expresses low levels of surface
TACI (Fig. 3E). We next assessed whether GC B cells could
bind exogenous BAFF. As may be seen in Fig. 3F, although
BAFF receptors are unoccupied on GC B cells, they are quite
capable of binding rhBAFF (Fig. 3F). The fact that GC B cells
can bind soluble BAFF, yet they lack baseline prebound BAFF
upon isolation, suggests that GCs may contain low levels or
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
the majority of the anti-BAFF reactivity reflects binding of the
processed, soluble form of BAFF rather than expression of endogenous full-length BAFF. However, we still observed trace levels of
a 32-kDa band, a size that is consistent with full-length BAFF. To
pursue this observation, we next used RT-PCR to first assess
BAFF expression at the mRNA level, and consistent with earlier
reports (10 –12), we observed variable expression of BAFF mRNA
in human PB B cells (Fig. 1E).
5616
PLEIOTROPIC EFFECTS OF BAFF ON B CELL DIFFERENTIATION
completely lack soluble BAFF. This observation is complemented by a recent report showing that BAFF is abundantly
expressed in the extrafollicular area and to a lesser extent in GC
structures (35).
Surface-bound BAFF is lost upon B cell activation
Although it is possible that BAFF levels are naturally low or absent in GCs, our data also do not dismiss the possibility that GC B
cells, which are actively proliferating, may lose prebound BAFF
due to high cell turnover or perhaps by endocytosing and degrading prebound BAFF. To address this latter possibility, we next
monitored the levels of BAFF in PB B cells following in vitro
activation in an effort to mimic activation that may precede or
coincide with GC reactions. We chose to activate PB B cells with
two different activation schemes that were designed to mimic TD
or a form of TI B cell activation, as follows: anti-human Ig Abs in
combination with CD40L plus IL-2, IL-4, and IL-10 (TD; anti-Ig/
40L/c); or CpG plus IL-2 and IL-15 (TI-type 1 Ag; CpG/c), respectively. In addition, we also evaluated the prebound BAFF levels of resting B cells at various time points to control for gradual
loss of BAFF during long incubation times. However, because the
viability of resting B cells in medium alone is compromised during
long incubation periods, we also cultured B cells in IL-4-supplemented medium, which improves B cell viability considerably
compared with medium alone (Fig. 4A). In comparing the levels of
prebound BAFF between freshly isolated and IL-4-resting B cells,
we found no significant difference between the two populations
(Fig. 4, B and C). Of interest, even after 120 h in culture, IL-4treated B cells still possessed detectable levels of prebound BAFF
(Fig. 4C). In contrast, B cells stimulated with either activation
scheme lost detectable levels of prebound BAFF (Fig. 4C).
Moreover, our Western blot data corroborate our flow data
showing a complete loss of the 17-kDa BAFF band upon B cell
activation (Fig. 4D). Interestingly, we found that loss of prebound BAFF is not coupled with cell division, because not all
of the B cells divided at 120 h, yet all of them lost BAFF from
their surface (Fig. 4E).
Loss of soluble BAFF upon activation is not due to an inability
to bind BAFF, but instead reflects an effect of limited amounts
of BAFF in the microenvironment
We next determined whether the loss of baseline BAFF receptor
occupancy in activated B cells reflected loss in ability to bind
BAFF. As shown in Fig. 5A, similar to GC B cells, activated PB
B cells can bind exogenous BAFF despite complete loss of prebound BAFF following polyclonal activation. Because activated B
cells can bind exogenous BAFF, this implies that activation may
result in the release or internalization and intracellular degradation
of bound BAFF. However, we were unable to detect release of
prebound BAFF into the medium postactivation by ELISA (data
not shown), thereby favoring the latter possibility.
In addition, we next assessed surface BAFF levels when B cells
were activated in a BAFF-rich environment. In fact, we found that
when B cells are activated in a BAFF-rich environment, they maintain high levels of BAFF on their cell surface (Fig. 5B). These data
collectively suggest that lack of surface BAFF on GC B cells most
likely reflects a combination of two events: 1) internalization and
degradation of prebound BAFF upon activation and entry into the
GC; and 2) entry of activated B cells into a microenvironment that
has very limiting levels of soluble BAFF.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 3. Activated GC B cells lack prebound
BAFF, but can bind exogenous BAFF. A, Naive, memory, and GC B cells from tonsil were identified using
CD27 and CD38 Abs, and each population was evaluated for surface BAFF levels. In addition, CD38high B
cells also expressed CD77, a marker of GC B cells (data
not shown). B, Whole cell lysates from tonsillar B cells
further sorted into 38high (GC) and 38low (naive and
MB) populations were run on an SDS-PAGE gel and
blotted with anti-BAFF Abs. sB, Human soluble
rBAFF. FL-B, Full-length BAFF. C, Expression of
BAFF and ␤-actin mRNA in 38low and 38high populations from three different tonsil preparations. D, Expression of BAFF-R, TACI, and BCMA on tonsillar naive
(solid lined histogram) and memory (dotted histogram),
or E, GC B cells. F, Levels of BAFF binding on tonsillar CD38high GC B cells. Tonsillar B cells were cultured with or without saturating amounts of rhBAFF
and stained with anti-BAFF Abs, and data are shown
only for CD38high GC B cells. Ig control Ab (shaded
histogram); baseline BAFF (dotted line histogram); exogenous BAFF (solid line histogram). Data are representative of three independent experiments.
The Journal of Immunology
5617
FIGURE 4. Prebound BAFF is lost upon B cell activation. A, Viability
of cells cultured in medium alone or with IL-4 at 120 h. B, Prebound BAFF
on freshly isolated B cells. C, Surface BAFF levels of resting (IL-4) or
activated PB B cells determined at 24 and 120 h. D, BAFF protein levels
of freshly isolated B cells (F), or B cells activated for 120 h with anti-Ig/
40L/c (␣Ig) or CpG/c (C). sB, Soluble rBAFF. FL-B, Full-length BAFF. E,
CFSE dilution of activated B cells at 120 h. Data are representative of five
independent experiments.
Differential effects of BAFF on ISC formation are observed
during TD or TI activation of PB B cells
To date, our data show that prebound BAFF is lost upon activation,
and accessibility to soluble BAFF may be low in GCs, evidenced
by a lack of prebound BAFF on GC B cells. Both of these observations suggest a specific role for BAFF in normal human B cell
differentiation and further suggest the hypothesis that BAFF may
be playing a rate-limiting step in this process. To address this, we
next studied the role of BAFF in the activation, survival, and differentiation of PB B cells, which were activated in a TD manner,
mimicking a GC response, as well as a TI manner occurring outside GCs. Thus, the activation schemes used in these studies were
human rCD40L plus IL-2 and IL-10 (40L/c), or CpG/c, which
have been shown to efficiently promote generation of ISCs (37–
40). Of note, activation with 40L/c also results in loss of prebound
BAFF (data not shown). We found that BAFF promotes B cell
proliferation of 40L/c-activated B cells, but it does not significantly affect their viability (Fig. 6, A and B). Moreover, despite
reports demonstrating that constant activation through CD40 attenuates Ig secretion (41, 42), we were still able to detect considerable levels of Ig without removing CD40L from the culture medium. In addition, we show that BAFF significantly increased the
Ig secretion of 40L/c-activated B cells (Fig. 6C) by an average of
a 6-fold increase in IgA secretion (n ⫽ 4, p ⫽ 0.007), a 2-fold
increase in IgG (n ⫽ 4, p ⫽ 0.009), and a 3-fold increase in IgM
(n ⫽ 4, p ⫽ 0.02).
The effect of BAFF during TI B cell responses is shown in Fig.
7A. We found that exogenous BAFF modestly promoted the survival of CpG/c-activated B cells. In addition, we observed an increase in the number of cells progressing through the cell cycle
when BAFF was present in the culture, thus verifying its costimulatory properties when combined with CpG/c activation
(Fig. 7B). Unexpectedly, BAFF considerably decreased the Ig
secretion of CpG/c-activated B cells (Fig. 7C). Thus, BAFF
decreased IgA secretion by an average of 57% (n ⫽ 5, p ⫽
0.004), IgG by 54% (n ⫽ 5, p ⫽ 0.01), and IgM by 43% (n ⫽
5, p ⫽ 0.01).
Furthermore, we wanted to determine whether BAFF would
have a similar inhibitory affect upon activation with other known
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 5. Exogenous BAFF binds to activated B cells. A, Activated B
cells were treated as in Fig. 2D. Ig control Ab (shaded histogram); baseline
BAFF (dotted line histogram); exogenous BAFF (solid line histogram). B,
PB B cells were activated for 120 h in the presence or absence of exogenous BAFF. At 120 h, surface BAFF levels were assessed. Data are representative of five independent experiments.
5618
PLEIOTROPIC EFFECTS OF BAFF ON B CELL DIFFERENTIATION
TI stimuli. Therefore, we activated PB B cells with formalin-fixed
Staphylococcus aureus Cowan A plus IL-2 (SA/c), which is considered a TI-type 2 Ag, in the presence or absence of BAFF. As
previously reported by numerous groups (4, 25, 43, 44), BAFF
enhanced the proliferation and viability of SA/c-activated B cells
(data not shown). Furthermore, in support of previous observations
(4, 44), we also found that BAFF augmented Ig secretion of SA/
c-activated B cells (data not shown).
FIGURE 7. BAFF decreases Ig secretion of CpG/c-activated PB B cells. B
cells were activated for 120 h with
CpG/c in the presence or absence of
BAFF. A, B cell viability was analyzed
using annexin/PI staining. B, BrdU incorporation was used to determine cell
cycle progression. C, Supernatants were
collected and Ig secretion was measured
using an ELISA. CpG/c alone (f) and
CpG/c plus BAFF (䡺). Data are representative of five experiments.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 6. BAFF affects the proliferation and differentiation of PB B cells activated in a T cell-dependent manner. The
40L/c-activated PB B cells were cultured in
the presence or absence of BAFF for 120 h.
A, B cell viability was analyzed using annexin/PI staining. B, BrdU incorporation
was used to determine cell cycle progression. C, B cells were activated with 40L/c
for 120 h plus or minus BAFF. Supernatants
were collected and Ig secretion was measured using an ELISA. The 40L/c alone (f)
and 40L/c plus BAFF (䡺). Data are representative of three or more experiments.
The Journal of Immunology
5619
BAFF attenuates MB cell ISC differentiation induced by CpG/c
activation
Although secreted Ig levels were significantly reduced in response
to CpG/c activation in the presence of BAFF, we wanted to determine whether BAFF suppressed Ig secretion or ISC differentiation. Thus, we primarily looked at the number of cells that were
positive for cIg in response to CpG/c in the presence or absence of
BAFF. BAFF did not decrease Ig secretion per cell, but instead
appears to inhibit B cell differentiation into ISCs because the num-
ber of cIg-positive B cells decreased by 50% when B cells were
activated with CpG/c in the presence of BAFF (Fig. 8, A and B).
To determine the phenotype of the BAFF-regulated B cell, we
decided to activate naive and MB cells independently with CpG/c
in the presence or absence of BAFF. In addition, we subfractionated MB cells based on their CD38 expression, because it was
reported previously that expression of CD38 correlates with ISC
differentiation and an enhanced sensitivity to BAFF stimulation
(32, 45). We found that although naive B cells respond to CpG/c
FIGURE 9. BAFF suppresses increased expression of CD27 and up-regulation of BCMA in CpG/
c-activated B cells. Levels of CD27 (A) or BCMA
(B) were assessed after PB B cells were activated
with CpG/c with or without BAFF for 120 h. Data
are representative of three experiments.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 8. BAFF attenuates MB
cell differentiation into ISCs. PB B
cells were activated for 120 h with
CpG/c in the presence or absence of
BAFF. A, cIg staining of CpG/c-activated B cells ⫾ BAFF. The 4⬘,6⬘-diamidino-2-phenylindole staining was
used to stain nuclei. B, Flow cytometric analysis of cIg expression in activated B cells. C, Ig secretion by naive
(CD27⫺) and MB cell subsets
(CD27⫹CD38⫺ and CD27⫹CD38⫹)
activated with CpG/c (f) or CpG/c
plus BAFF (䡺). Data are representative
of three independent observations.
5620
PLEIOTROPIC EFFECTS OF BAFF ON B CELL DIFFERENTIATION
Discussion
The effects of BAFF on the development and homeostasis of mature B cells are relatively well understood in the murine system. By
contrast, our understanding of the effects of BAFF on human B
cells, particularly ISC differentiation, is quite limited. In this study,
we describe two significant findings and present data that conceptually link the two major observations. First, we demonstrate that
soluble BAFF is prebound to the surface of naive and MB cells, yet
absent from GC B cells, suggesting the possibility that these cells
do not encounter or are restricted from constant BAFF exposure.
Secondly, we reveal for the first time the divergent effects of BAFF
on ISC differentiation of MB cells engaged in a TD vs a specific
form of TI response. We find that although BAFF can enhance the
generation of ISCs in combination with 40L/c stimulation, it markedly attenuates MB cell differentiation into ISCs during CpG/c
activation. These results suggest that limited exposure to BAFF in
GCs is required to preserve the balance between generation of MB
cells vs ISCs. Conversely, accessibility to BAFF during CpG activation may control the number of MB cells that differentiate into
ISCs. Taken together, our study introduces the concept that BAFF
availability during B cell responses to diverse Ags plays a critical
role during multiple maturation/differentiation phases of human B
lineage cells.
Studies in mice have shown that mature B cells require ongoing
exposure to BAFF to maintain their position in the mature B cell
pool. However, it remains uncertain whether mature B cells, exposed to Ag in secondary lymphoid organs, require BAFF to survive or differentiate. Several reports have shown that BAFF can
participate in later stages of B cell maturation, by promoting class
switch recombination (30, 31), or inducing Ig secretion of plasmablasts (30, 32). Although BAFF was shown to influence these
maturation and differentiation events, these studies do not demonstrate that BAFF is required. In this study, we have evidence to
suggest that BAFF may not be involved in B cell differentiation
events occurring in GCs. Our ex vivo analysis of prebound BAFF
levels revealed that, unlike naive and MB cells, GC B cells were
devoid of prebound BAFF. This is not due to a lack of BBRs,
because we show that GC B cells express BAFF-R and BCMA, as
previously demonstrated by others (22, 35, 36). Moreover, GC
B cells and activated B cells maintain their ability to bind exogenous BAFF. Instead, our results demonstrating that PB B
cells lose prebound BAFF following activation provide a plausible explanation for the lack of prebound BAFF in GC B cells. Of
note, the activation-induced loss of prebound BAFF in PB B cells
may instead result from a loss of BBR expression. However, we
have evidence demonstrating that B cell activation induces the
up-regulation of BBR expression, which would promote, not discourage, BAFF binding (J. R. Darce, B. K. Arendt, X. Wu, and
D. F. Jelinek, manuscript in preparation). Because clearance of
prebound BAFF may represent an important mechanism by which
BAFF-mediated signaling in B cells is regulated in soluble BAFFrestricted environments, it will be important to determine the
mechanism(s) by which this occurs, and studies of this nature are
in progress. In support of our hypothesis, a recent report demonstrated that GC structures display low to no detectable levels of
BAFF (35).
Although our data suggest that GCs lack soluble BAFF, we
cannot exclude the possibility that transmembrane forms of BAFF
may be expressed on cells found within these structures. There is
a suggestion that GC-resident follicular dendritic cells (FDC) are a
source of BAFF. However, currently the expression of BAFF by
FDCs is controversial. One group discovered that a transmembrane
form of BAFF is expressed by primary human FDCs as well as a
human FDC cell line (46). Meanwhile, another group found that
mouse FDCs are not a major source of BAFF (47). This discrepancy in BAFF expression could be explained by intrinsic differences between species. Of interest, GCs can form in the absence of
BAFF, although the longevity and retention of GC structures are
lost following initial formation (48).
Even though GC B cells lack prebound BAFF, naive and MB
cells from PB and tonsil tissue have significant levels of this ligand
on their cell surface. Moreover, PB B cells exhibited higher levels
of prebound BAFF than tonsillar B cell populations. This was unexpected because we assumed that B cells would encounter higher
levels of BAFF in peripheral organs. However, in consideration of
our results, we hypothesize that the level of prebound BAFF is
directly related to the availability of soluble BAFF. Chiu et al. (35)
recently demonstrated that BAFF is abundantly found in the extrafollicular area, where naive and MB cells can reside (49). These
data suggest that tonsillar naive and MB cells have accessibility to
BAFF within these niches. Yet, in addition to B cells, other BAFFbinding cells can be found within this extrafollicular space, such as
activated T cells and myeloid lineage cells (21, 22). Therefore, B
cells trafficking through peripheral lymphoid tissue may encounter
greater competition for soluble BAFF. In contrast, our analysis of
whole PBMCs revealed that only B cells reacted with the antiBAFF Ab, implying that B cells do not compete for BAFF with
other cells in PB. Furthermore, soluble BAFF is readily available
to PB B cells, because it has been estimated that BAFF levels in
the serum of healthy individuals average between 5 and 10 ng/ml
(27, 28). Finally, the precise source of the soluble BAFF bound to
B cell BBRs remains to be determined. Indeed, it is quite possible
that soluble BAFF may be derived from B cells themselves. Previous reports have demonstrated BAFF expression in human B
lymphocytes at the mRNA and protein levels (10 –12), and we
corroborate the mRNA and protein data when assaying total cell
lysates. However, our results extend these previous studies by
demonstrating that normal human B cells lack detectable cell surface transmembrane BAFF expression. Because it is currently
thought that soluble BAFF is only produced following extracellular proteolytic processing of transmembrane BAFF (13), we consider it unlikely that the prebound BAFF derives from B cells
themselves. Alternatively, BAFF processing may uniquely occur
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
activation by proliferating (data not shown), these cells do not
yield detectable levels of secreted Ig (Fig. 8C), consistent with data
from a previous report (40). In contrast, MB cells secreted high
levels of all three Ig subclasses, regardless of their CD38 status and
BAFF-attenuated Ig secretion in both populations (Fig. 8C).
In addition to cIg expression, we looked for increased expression of CD27 along with up-regulation of BCMA, two markers
that are induced upon ISC differentiation of MB cells (32, 45). As
shown in Fig. 9A, activation of B cells with 40L/c or CpG/c resulted in the appearance of MB cells exhibiting increased expression of CD27. Moreover, addition of BAFF to 40L/c-activated B
cells resulted in an even further increase in the percentage of cells
expressing high density surface CD27 (Fig. 9A). In contrast, we
observed that BAFF decreased the percentage of CD27high MB
cells by 50%, a percentage of inhibition that is similar in magnitude to BAFF-mediated inhibition of cIg-positive cells generated
in response to CpG/c (Figs. 8 and 9A). In addition to increased
CD27 expression, we observed that both activation schemes induced BCMA expression on MB cells. Moreover, as observed with
CD27 expression, BAFF increased the number of BCMA-positive
cells in response to TD activation, but decreased the number of
BCMA-positive cells upon CpG/c activation (Fig. 9B).
The Journal of Immunology
shown) (4, 25, 43, 44). Moreover, BAFF was shown to enhance in
vivo humoral immune responses in mice challenged with a TI
polyvalent vaccine (58). The mechanism(s) by which BAFF differentially affects CpG or SA/c ISC differentiation remains to be
determined and is a topic of current investigation. Because both of
these stimuli assert their effects through different signal transduction pathways, it is possible that the BAFF signaling pathway
could inhibit or synergize with TLR9 and BCR signals, respectively. Furthermore, a recent report investigating the signals that
can negatively regulate CpG-stimulated generation of ISCs revealed that constant signaling through the BCR, via the ERK
MAPK pathway, blocks CpG-induced ISC differentiation (59). It is
therefore possible that a similar type of signal transduction antagonism is occurring between CpG and BBRs in MB cells. Regardless of mechanism, our studies demonstrate for the first time an
inhibitory property of BAFF.
In contrast with our data demonstrating that BAFF negatively
regulates ISC differentiation, He et al. (55) reported that BAFF in
the presence of IL-10 augments CpG-induced IgG production by
human IgD⫹IgM⫹ blood B cells. Although our CpG activation
protocol included IL-2 and IL-15, we still observed BAFF-mediated suppression of B cell differentiation when cells were activated
with CpG and IL-10 (results not shown). Other experimental differences that may explain the discrepant results include differences
in CpG concentration and differences in cell isolation. With respect
to the latter, He et al. (55) positively selected naive B cells using
magnetic bead-conjugated Abs to IgD, a method that could have
impacted subsequent responsiveness.
In summary, our results demonstrate that BAFF has pleiotropic
effects on mature human B cells. Although BAFF may be required
to establish and maintain a mature B cell pool, the need to limit
BAFF signaling within GCs exists. In addition, BAFF could also
play a critical role outside of GCs, and under some circumstances
of B cell activation, may actually attenuate ISC differentiation.
Finally, our data underscore the complex nature of this cytokine
and its divergent influences on human B lymphocytes.
Acknowledgment
We thank Dr. Xiaosheng Wu for his experimental advice as well as for
critically reading this manuscript.
Disclosures
The authors have no financial conflict of interest.
References
1. Locksley, R. M., N. Killeen, and M. J. Lenardo. 2001. The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104: 487–501.
2. Mackay, F., and J. L. Browning. 2002. BAFF: a fundamental survival factor for
B cells. Nat. Rev. Immunol. 2: 465– 475.
3. Craxton, A., D. Magaletti, E. J. Ryan, and E. A. Clark. 2003. Macrophage- and
dendritic cell-dependent regulation of human B-cell proliferation requires the
TNF family ligand BAFF. Blood 101: 4464 – 4471.
4. Nardelli, B., O. Belvedere, V. Roschke, P. A. Moore, H. S. Olsen, T. S. Migone,
S. Sosnovtseva, J. A. Carrell, P. Feng, J. G. Giri, and D. M. Hilbert. 2001.
Synthesis and release of B-lymphocyte stimulator from myeloid cells. Blood 97:
198 –204.
5. Mackay, F., and H. Leung. 2006. The role of the BAFF/APRIL system on T cell
function. Semin. Immunol. 18: 284 –289.
6. Scapini, P., B. Nardelli, G. Nadali, F. Calzetti, G. Pizzolo, C. Montecucco, and
M. A. Cassatella. 2003. G-CSF-stimulated neutrophils are a prominent source of
functional BLyS. J. Exp. Med. 197: 297–302.
7. Novak, A. J., R. J. Bram, N. E. Kay, and D. F. Jelinek. 2002. Aberrant expression
of B-lymphocyte stimulator by B chronic lymphocytic leukemia cells: a mechanism for survival. Blood 100: 2973–2979.
8. Novak, A. J., J. R. Darce, B. K. Arendt, B. Harder, K. Henderson, W. Kindsvogel,
J. A. Gross, P. R. Greipp, and D. F. Jelinek. 2004. Expression of BCMA, TACI,
and BAFF-R in multiple myeloma: a mechanism for growth and survival. Blood
103: 689 – 694.
9. Krumbholz, M., D. Theil, T. Derfuss, A. Rosenwald, F. Schrader,
C. M. Monoranu, S. L. Kalled, D. M. Hess, B. Serafini, F. Aloisi, et al. 2005.
BAFF is produced by astrocytes and up-regulated in multiple sclerosis lesions
and primary central nervous system lymphoma. J. Exp. Med. 201: 195–200.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
intracellularly in B lineage cells. Presently, there are no data disputing this possibility, and moreover, the biological significance of
B cell-derived BAFF remains unclear.
Our observations of prebound BAFF levels prompted us to determine the influence of BAFF during B cell activation. The lack
of prebound BAFF on GC B cells indicated to us that BAFF is
absent in GCs perhaps to prevent disruption of the differentiation
program that occurs within these structures. This theory is plausible becaused loss of BAFF-mediated signaling in the GC would
place greater emphasis on selection via the newly remodeled BCR,
rather than promoting the survival of all BCR-stimulated B cells,
possibly even those acquiring autoreactivity (50). Moreover,
within GCs, centrocytes re-express CD40 and receive constant signals from this receptor, thus enhancing their viability and promoting their differentiation into MB cells (51, 52). As we demonstrated in our in vitro activation of PB B cells, BAFF enhanced
CD40-induced B cell proliferation and ISC differentiation. Although previous reports suggest that ISC differentiation is compromised by constant signals through CD40 (41, 42), in this study
we demonstrate that activation through CD40 alone drives B cell
differentiation, evidenced by moderate levels of Ig secretion. Furthermore, unlike other studies that show the effects of BAFF on
preactivated B cells post-CD40L stimulation (32), we reveal its
effects during constant exposure to CD40L, because it may occur
during a GC reaction. Therefore, because we find that BAFF enhances ISC differentiation in response to CD40L stimulation, we
believe that access to BAFF in GCs may potentially derail the
balance between ISC and MB cell generation.
Furthermore, we also evaluated the effects of BAFF during TI
activation of B cells, which occurs outside of GCs, in BAFF-rich
zones (35). TI responses are critical in initiating early immune
responses to invading pathogens. Bacterial and viral products are
examples of one type of TI stimuli that activate B cells through
pattern recognition receptors, such as TLRs, resulting in the differentiation of short-lived and long-lived ISCs (53). CpG is recognized by the TLR9 on activated B cells and has been shown to
significantly affect the survival of all B cells as well as induce the
ISC differentiation of MB cells (40, 54, 55). Given that it has been
suggested that autoreactive clones arise from MB cell subsets (56)
and that TLR9 expression is elevated in MB cells from SLE patients with active disease (57), CpG stimulation is currently viewed
as an important factor in autoimmunity. These observations collectively predict that BAFF would augment CpG-mediated activation and differentiation of B cells, especially because BAFF transgenic mice develop autoimmune disease. Indeed, we demonstrate
that BAFF augments the survival and proliferation of CpG-activated B cells. However, in contrast, we found that BAFF significantly decreased CpG-mediated ISC differentiation revealed by
marked decreases in IgA, IgG, and IgM secretion. As mentioned
above, CpG activation has been shown to drive ISC differentiation
of MB cells only (40). Our results are consistent with these reports,
because activation of naive B cells did not yield detectable levels
of secreted Ig. Furthermore, we demonstrate that reduced ISC generation is accompanied by a restriction of MB cell differentiation
evidenced by a decrease in numbers of cIg-positive, CD27high, and
BCMA-positive cells.
The inhibitory effects of BAFF on CpG-mediated ISC differentiation are quite interesting and suggest a new mechanism by
which B cell responses to hypomethylated DNA, a highly potent B
cell polyclonal activator, are regulated. However, although CpG is
a TI B cell activator, not all TI Ags are subject to negative regulation by BAFF. For example, we found that BAFF enhanced the
proliferation and Ig secretion of B cells activated with SA/c, an
observation consistent with other published reports (data not
5621
5622
PLEIOTROPIC EFFECTS OF BAFF ON B CELL DIFFERENTIATION
34. Hymowitz, S. G., D. R. Patel, H. J. Wallweber, S. Runyon, M. Yan, J. Yin,
S. K. Shriver, N. C. Gordon, B. Pan, N. J. Skelton, et al. 2005. Structures of
APRIL-receptor complexes: like BCMA, TACI employs only a single cysteinerich domain for high affinity ligand binding. J. Biol. Chem. 280: 7218 –7227.
35. Chiu, A., W. Xu, B. He, S. R. Dillon, J. A. Gross, E. Sievers, X. Qiao, P. Santini,
E. Hyjek, J. W. Lee, et al. 2006. Hodgkin lymphoma cells express TACI and
BCMA receptors and generate survival and proliferation signals in response to
BAFF and APRIL. Blood 109: 729 –739.
36. Shulga-Morskaya, S., M. Dobles, M. E. Walsh, L. G. Ng, F. MacKay, S. P. Rao,
S. L. Kalled, and M. L. Scott. 2004. B cell-activating factor belonging to the TNF
family acts through separate receptors to support B cell survival and T cellindependent antibody formation. J. Immunol. 173: 2331–2341.
37. Maliszewski, C. R., K. Grabstein, W. C. Fanslow, R. Armitage, M. K. Spriggs,
and T. A. Sato. 1993. Recombinant CD40 ligand stimulation of murine B cell
growth and differentiation: cooperative effects of cytokines. Eur. J. Immunol. 23:
1044 –1049.
38. Tangye, S. G., D. T. Avery, and P. D. Hodgkin. 2003. A division-linked mechanism for the rapid generation of Ig-secreting cells from human memory B cells.
J. Immunol. 170: 261–269.
39. Liang, H., Y. Nishioka, C. F. Reich, D. S. Pisetsky, and P. E. Lipsky. 1996.
Activation of human B cells by phosphorothioate oligodeoxynucleotides. J. Clin.
Invest. 98: 1119 –1129.
40. Bernasconi, N. L., E. Traggiai, and A. Lanzavecchia. 2002. Maintenance of serological memory by polyclonal activation of human memory B cells. Science
298: 2199 –2202.
41. Arpin, C., J. Dechanet, C. Van Kooten, P. Merville, G. Grouard, F. Briere,
J. Banchereau, and Y. J. Liu. 1995. Generation of memory B cells and plasma
cells in vitro. Science 268: 720 –722.
42. Tarte, K., J. De Vos, T. Thykjaer, F. Zhan, G. Fiol, V. Costes, T. Reme,
E. Legouffe, J. F. Rossi, J. Shaughnessy, Jr., et al. 2002. Generation of polyclonal
plasmablasts from peripheral blood B cells: a normal counterpart of malignant
plasmablasts. Blood 100: 1113–1122.
43. Moore, P. A., O. Belvedere, A. Orr, K. Pieri, D. W. LaFleur, P. Feng, D. Soppet,
M. Charters, R. Gentz, D. Parmelee, et al. 1999. BLyS: member of the tumor
necrosis factor family and B lymphocyte stimulator. Science 285: 260 –263.
44. Stewart, D. M., M. J. McAvoy, D. M. Hilbert, and D. L. Nelson. 2003. B lymphocytes from individuals with common variable immunodeficiency respond to B
lymphocyte stimulator (BLyS protein) in vitro. Clin. Immunol. 109: 137–143.
45. Avery, D. T., J. I. Ellyard, F. Mackay, L. M. Corcoran, P. D. Hodgkin, and
S. G. Tangye. 2005. Increased expression of CD27 on activated human memory
B cells correlates with their commitment to the plasma cell lineage. J. Immunol.
174: 4034 – 4042.
46. Zhang, X., C. S. Park, S. O. Yoon, L. Li, Y. M. Hsu, C. Ambrose, and Y. S. Choi.
2005. BAFF supports human B cell differentiation in the lymphoid follicles
through distinct receptors. Int. Immunol. 17: 779 –788.
47. Lesley, R., Y. Xu, S. L. Kalled, D. M. Hess, S. R. Schwab, H. B. Shu, and
J. G. Cyster. 2004. Reduced competitiveness of autoantigen-engaged B cells due
to increased dependence on BAFF. Immunity 20: 441– 453.
48. Rahman, Z. S., S. P. Rao, S. L. Kalled, and T. Manser. 2003. Normal induction
but attenuated progression of germinal center responses in BAFF and BAFF-R
signaling-deficient mice. J. Exp. Med. 198: 1157–1169.
49. Liu, Y. J., S. Oldfield, and I. C. MacLennan. 1988. Memory B cells in T celldependent antibody responses colonize the splenic marginal zones. Eur. J. Immunol. 18: 355–362.
50. Dorner, T., C. Heimbacher, N. L. Farner, and P. E. Lipsky. 1999. Enhanced
mutational activity of V␬ gene rearrangements in systemic lupus erythematosus.
Clin. Immunol. 92: 188 –196.
51. Casamayor-Palleja, M., J. Feuillard, J. Ball, M. Drew, and I. C. MacLennan.
1996. Centrocytes rapidly adopt a memory B cell phenotype on co-culture with
autologous germinal centre T cell-enriched preparations. Int. Immunol. 8:
737–744.
52. Tuscano, J. M., K. M. Druey, A. Riva, J. Pena, C. B. Thompson, and J. H. Kehrl.
1996. Bcl-x rather than Bcl-2 mediates CD40-dependent centrocyte survival in
the germinal center. Blood 88: 1359 –1364.
53. Krieg, A. M. 1996. An innate immune defense mechanism based on the recognition of CpG motifs in microbial DNA. J. Lab. Clin. Med. 128: 128 –133.
54. Yi, A. K., M. Chang, D. W. Peckham, A. M. Krieg, and R. F. Ashman. 1998.
CpG oligodeoxyribonucleotides rescue mature spleen B cells from spontaneous
apoptosis and promote cell cycle entry. J. Immunol. 160: 5898 –5906.
55. He, B., X. Qiao, and A. Cerutti. 2004. CpG DNA induces IgG class switch DNA
recombination by activating human B cells through an innate pathway that requires TLR9 and cooperates with IL-10. J. Immunol. 173: 4479 – 4491.
56. Jonsson, R., K. A. Brokstad, P. E. Lipsky, and M. Zouali. 2001. B-lymphocyte
selection and autoimmunity. Trends Immunol. 22: 653– 654.
57. Papadimitraki, E. D., C. Choulaki, E. Koutala, G. Bertsias, C. Tsatsanis,
I. Gergianaki, A. Raptopoulou, H. D. Kritikos, C. Mamalaki, P. Sidiropoulos, and
D. T. Boumpas. 2006. Expansion of Toll-like receptor 9-expressing B cells in
active systemic lupus erythematosus: implications for the induction and maintenance of the autoimmune process. Arthritis Rheum. 54: 3601–3611.
58. Do, R. K., E. Hatada, H. Lee, M. R. Tourigny, D. Hilbert, and S. Chen-Kiang.
2000. Attenuation of apoptosis underlies B lymphocyte stimulator enhancement
of humoral immune response. J. Exp. Med. 192: 953–964.
59. Rui, L., C. G. Vinuesa, J. Blasioli, and C. C. Goodnow. 2003. Resistance to CpG
DNA-induced autoimmunity through tolerogenic B cell antigen receptor ERK
signaling. Nat. Immunol. 4: 594 – 600.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
10. He, B., N. Raab-Traub, P. Casali, and A. Cerutti. 2003. EBV-encoded latent
membrane protein 1 cooperates with BAFF/BLyS and APRIL to induce T cellindependent Ig heavy chain class switching. J. Immunol. 171: 5215–5224.
11. He, B., A. Chadburn, E. Jou, E. J. Schattner, D. M. Knowles, and A. Cerutti.
2004. Lymphoma B cells evade apoptosis through the TNF family members
BAFF/BLyS and APRIL. J. Immunol. 172: 3268 –3279.
12. Kern, C., J. F. Cornuel, C. Billard, R. Tang, D. Rouillard, V. Stenou, T. Defrance,
F. Ajchenbaum-Cymbalista, P. Y. Simonin, S. Feldblum, and J. P. Kolb. 2004.
Involvement of BAFF and APRIL in the resistance to apoptosis of B-CLL
through an autocrine pathway. Blood 103: 679 – 688.
13. Schneider, P., F. MacKay, V. Steiner, K. Hofmann, J. L. Bodmer, N. Holler,
C. Ambrose, P. Lawton, S. Bixler, H. Acha-Orbea, et al. 1999. BAFF, a novel
ligand of the tumor necrosis factor family, stimulates B cell growth. J. Exp. Med.
189: 1747–1756.
14. Thompson, J. S., S. A. Bixler, F. Qian, K. Vora, M. L. Scott, T. G. Cachero,
C. Hession, P. Schneider, I. D. Sizing, C. Mullen, et al. 2001. BAFF-R, a newly
identified TNF receptor that specifically interacts with BAFF. Science 293:
2108 –2111.
15. Gross, J. A., J. Johnston, S. Mudri, R. Enselman, S. R. Dillon, K. Madden,
W. Xu, J. Parrish-Novak, D. Foster, C. Lofton-Day, et al. 2000. TACI and BCMA
are receptors for a TNF homologue implicated in B-cell autoimmune disease.
Nature 404: 995–999.
16. Xia, X. Z., J. Treanor, G. Senaldi, S. D. Khare, T. Boone, M. Kelley, L. E. Theill,
A. Colombero, I. Solovyev, F. Lee, et al. 2000. TACI is a TRAF-interacting
receptor for TALL-1, a tumor necrosis factor family member involved in B cell
regulation. J. Exp. Med. 192: 137–143.
17. Yan, M., S. A. Marsters, I. S. Grewal, H. Wang, A. Ashkenazi, and V. M. Dixit.
2000. Identification of a receptor for BLyS demonstrates a crucial role in humoral
immunity. Nat. Immunol. 1: 37– 41.
18. Thompson, J. S., P. Schneider, S. L. Kalled, L. Wang, E. A. Lefevre,
T. G. Cachero, F. MacKay, S. A. Bixler, M. Zafari, Z. Y. Liu, et al. 2000. BAFF
binds to the tumor necrosis factor receptor-like molecule B cell maturation antigen and is important for maintaining the peripheral B cell population. J. Exp.
Med. 192: 129 –135.
19. Schiemann, B., J. L. Gommerman, K. Vora, T. G. Cachero, S. Shulga-Morskaya,
M. Dobles, E. Frew, and M. L. Scott. 2001. An essential role for BAFF in the
normal development of B cells through a BCMA-independent pathway. Science
293: 2111–2114.
20. Von Bulow, G. U., and R. J. Bram. 1997. NF-AT activation induced by a CAMLinteracting member of the tumor necrosis factor receptor superfamily. Science
278: 138 –141.
21. Chang, S. K., B. K. Arendt, J. R. Darce, X. Wu, and D. F. Jelinek. 2006. A role
for BLyS in the activation of innate immune cells. Blood 108: 2687–2694.
22. Ng, L. G., A. P. Sutherland, R. Newton, F. Qian, T. G. Cachero, M. L. Scott,
J. S. Thompson, J. Wheway, T. Chtanova, J. Groom, et al. 2004. B cell-activating
factor belonging to the TNF family (BAFF)-R is the principal BAFF receptor
facilitating BAFF costimulation of circulating T and B cells. J. Immunol. 173:
807– 817.
23. Mackay, F., and C. Ambrose. 2003. The TNF family members BAFF and APRIL:
the growing complexity. Cytokine Growth Factor Rev. 14: 311–324.
24. Mackay, F., S. A. Woodcock, P. Lawton, C. Ambrose, M. Baetscher,
P. Schneider, J. Tschopp, and J. L. Browning. 1999. Mice transgenic for BAFF
develop lymphocytic disorders along with autoimmune manifestations. J. Exp.
Med. 190: 1697–1710.
25. Khare, S. D., I. Sarosi, X. Z. Xia, S. McCabe, K. Miner, I. Solovyev, N. Hawkins,
M. Kelley, D. Chang, G. Van, et al. 2000. Severe B cell hyperplasia and autoimmune disease in TALL-1 transgenic mice. Proc. Natl. Acad. Sci. USA 97:
3370 –3375.
26. Stohl, W., S. Metyas, S. M. Tan, G. S. Cheema, B. Oamar, D. Xu, V. Roschke,
Y. Wu, K. P. Baker, and D. M. Hilbert. 2003. B lymphocyte stimulator overexpression in patients with systemic lupus erythematosus: longitudinal observations. Arthritis Rheum. 48: 3475–3486.
27. Novak, A. J., D. M. Grote, S. C. Ziesmer, M. P. Kline, M. K. Manske, S. Slager,
T. E. Witzig, T. Shanafelt, T. G. Call, N. E. Kay, et al. 2006. Elevated serum
B-lymphocyte stimulator levels in patients with familial lymphoproliferative disorders. J. Clin. Oncol. 24: 983–987.
28. Groom, J., S. L. Kalled, A. H. Cutler, C. Olson, S. A. Woodcock, P. Schneider,
J. Tschopp, T. G. Cachero, M. Batten, J. Wheway, et al. 2002. Association of
BAFF/BLyS overexpression and altered B cell differentiation with Sjogren’s syndrome. J. Clin. Invest. 109: 59 – 68.
29. Carter, R. H., H. Zhao, X. Liu, M. Pelletier, W. Chatham, R. Kimberly, and
T. Zhou. 2005. Expression and occupancy of BAFF-R on B cells in systemic
lupus erythematosus. Arthritis Rheum. 52: 3943–3954.
30. Litinskiy, M. B., B. Nardelli, D. M. Hilbert, B. He, A. Schaffer, P. Casali, and
A. Cerutti. 2002. DCs induce CD40-independent immunoglobulin class switching through BLyS and APRIL. Nat. Immunol. 3: 822– 829.
31. Castigli, E., S. A. Wilson, S. Scott, F. Dedeoglu, S. Xu, K. P. Lam, R. J. Bram,
H. Jabara, and R. S. Geha. 2005. TACI and BAFF-R mediate isotype switching
in B cells. J. Exp. Med. 201: 35–39.
32. Avery, D. T., S. L. Kalled, J. I. Ellyard, C. Ambrose, S. A. Bixler, M. Thien,
R. Brink, F. Mackay, P. D. Hodgkin, and S. G. Tangye. 2003. BAFF selectively
enhances the survival of plasmablasts generated from human memory B cells.
J. Clin. Invest. 112: 286 –297.
33. Day, E. S., T. G. Cachero, F. Qian, Y. Sun, D. Wen, M. Pelletier, Y. M. Hsu, and
A. Whitty. 2005. Selectivity of BAFF/BLyS and APRIL for binding to the TNF
family receptors BAFFR/BR3 and BCMA. Biochemistry 44: 1919 –1931.