DIRECTED SELECTION AND CHARACTERIZATION OF HIGH-AFFINITY
SYNERGISTIC ANTIBODIES
AN ABSTRACT
SUBMITTED ON THE TENTH DAY OF OCTOBER 2007
TO THE INTERDISCIPLINARY PROGRAM IN
MOLECULAR AND CELLULAR BIOLOGY
IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
OF THE GRADUATE PROGRAM IN BIOMEDICAL SCIENCES
OF TULANE UNIVERSITY SCHOOL OF MEDICINE
FOR THE DEGREE
OF
DOCTOR OF PHILOSOPHY
BY
______________________________
Elizabeth Rachael Abboud
Approved:
______________________________
Diane A. Blake, Ph.D.
Chairman
______________________________
______________________________
Mark A. James, Ph.D.
Lucia Cardenas-Freytag, Ph.D.
______________________________
______________________________
Cindy A. Morris, Ph.D.
Deborah E. Sullivan, Ph.D.
Abstract
Antibody selection strategies can be devised to select antibodies that bind to
specific epitopes, to proteins with unusual reaction kinetics or to particular protein
conformations. In this work we initially validated a previously designed selection strategy
to isolate an antibody with a fast on-rate. The success of this selection strategy was
verified by measuring the bimolecular association rate constants of the newly selected
antibody for two mouse IgG molecules already available in the Blake Laboratory.
A selection strategy was then designed to select for pairs of monoclonal
antibodies that bound with synergy to their target antigen. A hybridoma library was
created from the splenocytes of mice immunized with human IgA and screened for
monoclonal antibodies that bound to human IgA. A secondary screen permitted the
identification of antibody pairs that bound to distinct epitopes on the antigen. One of
these pairs (14A7 and 5F5) was chosen for further studies to verify that this pair did
exhibit the desired synergistic binding characteristics.
The equilibrium dissociation constants were measured for the independent
binding of 5F5 and 14A7 to human IgA; these Kds were 0.17 nM and 555 nM,
respectively. By taking advantage of the >3,000-fold difference in the affinity of 5F5 and
14A7 for IgA, experiments were designed whereby the 14A7 antibody was allowed to
interact almost exclusively with the 5F5-IgA complex. Under these conditions, 14A7
bound with 8-fold higher affinity to the complex than to free IgA. It was therefore
concluded that a pair of antibodies that bound with synergy to the target antigen had been
successfully selected using this novel strategy.
DIRECTED SELECTION AND CHARACTERIZATION OF HIGHAFFINITY SYNERGISTIC ANTIBODIES
A DISSERTATION
SUBMITTED ON THE TENTH DAY OF OCTOBER 2007
TO THE INTERDISCIPLINARY PROGRAM IN
MOLECULAR AND CELLULAR BIOLOGY
IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
OF THE GRADUATE PROGRAM IN BIOMEDICAL SCIENCES
OF TULANE UNIVERSITY SCHOOL OF MEDICINE
FOR THE DEGREE
OF
DOCTOR OF PHILOSOPHY
BY
______________________________
Elizabeth Rachael Abboud
Approved:
______________________________
Diane A. Blake, Ph.D.
Chairman
______________________________
______________________________
Mark A. James, Ph.D.
Lucia Cardenas-Freytag, Ph.D.
______________________________
______________________________
Cindy A. Morris, Ph.D.
Deborah E. Sullivan, Ph.D.
UMI Number: 3291482
UMI Microform 3291482
Copyright 2008 by ProQuest Information and Learning Company.
All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
ProQuest Information and Learning Company
300 North Zeeb Road
P.O. Box 1346
Ann Arbor, MI 48106-1346
For Nadia and Jacob.
Love,
Dr. Mom
Acknowledgements
Elizabeth Abboud was supported by grants from CREST via LUMCON and a GRO
graduate fellowship (MA-916574-01) from the US Environmental Protection Agency.
I would like to thank the following people for all their help and support throughout the
duration of my thesis work:
Dr. Diane Blake – she is a highly dedicated and professional scientist, a wonderful
mentor, and a fabulous “science mom”.
My thesis committee, Dr. Mark James, Dr. Cindy Morris, Dr. Lucy Cardenas-Freytag and
Dr. Debbie Sullivan, who have all been more than helpful and accommodating
throughout this entire process.
My husband, John Joffe, for his everlasting (yet sometimes and understandably
frustrated) support of my extended academic career.
My children, Nadia and Jacob, for forcing me to learn how to multi-task better than I ever
had before, and for changing my perspective as a mother-scientist.
My family, for their continued support with anything and everything as I made my way
through not only graduate school, but having two babies while doing so.
My fellow members of the Blake lab – Haini “Birdie” Yu, Scott “Robot” Melton, Marcia
“B” Henry, my post-doctoral assistant Nurretin Sahiner and our two new post-doctoral
fellows, Mehnaaz “a trois” Ali and Xiaoxia Zhu.
Jessica Marks, who has been a wonderful friend, a trusted idea consultant, fellow
commiserating student, and an awesome drinking buddy.
And although she is long gone to Australia, I must thank Alison Kriegel, my former
senior graduate student, who taught me much of what I learned in the lab, and also how
to have fun while still working for a living.
ii
Table of Contents
Chapter 1:
Acknowledgements
ii
List of Tables
vii
List of Figures
viii
List of Abbreviations
x
Introduction to Thesis Work
1
I. Antibody Structure and Immunoglobulin A
2
1. Function of Immunoglobulins in the Body
2
2. Types of Immunoglobulins
3
3. Structure of Immunoglobulins
4
4. Immunoglobulin A
5
5. Rationale for Using Immunoglobulin A
6
II. Synergistic Antibodies
6
III. Phage Display
8
IV. Monoclonal Antibodies
9
V. Screening Strategies: Phage Display
VI. Screening Strategies: Monoclonal Antibodies
iii
10
11
VII. Rationale for Using Monoclonal Antibodies
11
VIII. Selection of a Fast On-rate Antibody: RH131
12
IX. Hypothesis
15
X. Specific Aims
Chapter 2:
16
Binding Kinetics of a Fast On-Rate Antibody
(RH131)
24
Introduction
25
Materials and Methods
27
1. Materials
27
2. Chain Specificity of RH131
27
3. Determination of Bimolecular Association Rate Constants
28
4. Determination of Equilibrium Dissociation Constants
29
30
Results
Chapter 3:
1. Chain specificity of RH131
30
2. Bimolecular Association Rate Constants and Equilibrium
Dissociation Constants
30
Discussion
33
Steps in the construction of an scFv Phage library to
Immunoglobulin A
40
Introduction
41
Materials and Methods
43
1. Materials
43
iv
2. Rabbit Immunizations and Spleen Harvest
43
3. Rabbit Serum Titers and Competitive ELISAs
44
4. RNA Isolation and cDNA Preparation
45
5. Primary PCR
45
6. Restriction Digests
46
7. Vector Preparation
46
8. Ligations and Transformations
47
48
Results
Chapter 4:
1. Rabbit Serum Titers and Competitive ELISAs
48
2. RNA Isolation and pSD3 Preparation
49
3. SfiI Restriction Digests
50
4. Ligations and Transformations
50
Discussion
51
Construction, Directed Selection and Molecular
Characterization of Synergistic Antibodies from a
Hybridoma Library
64
Introduction
65
Materials and Methods
67
1. Materials
67
2. Mouse Immunizations and Spleen Harvest
67
3. Mouse Serum Titers
68
4. Hybridoma Fusion and Cell Culture
69
5. Hybridoma Screening
69
v
6. Protein Purification
70
7. Additivity Assay
71
8. Determination of Individual Equilibrium Dissociation
Constants
71
9. Determination of Synergistic Equilibrium Dissociation
Constants
72
73
Results
Chapter 5:
1. Mouse Serum Titers
73
2. Mouse Serum Competitive ELISAs
73
3. Selected Hybridomas
74
4. Additivity Assay
75
5. Selected Antibodies
76
6. Determination of Individual Equilibrium Dissociation
Constants
77
7. Determination of Synergistic Equilibrium Dissociation
Constants
78
Discussion
81
Discussion of Thesis Work
95
List of References
99
vi
List of Tables
Chapter 1:
Introduction to Thesis Work
Table 1-1:
Different isotypes of immunoglobulins.
Chapter 2:
Binding Kinetics of a Fast On-Rate Antibody
(RH131)
Table 2-1:
Equilibrium, association and dissociation constants for RH131
binding to two different IgG1 molecules
Chapter 3:
Construction of an
Immunoglobulin A
Table 3-1:
Primer sequences for primary PCR
52
Table 3-2:
Primer combinations and PCR cycles for primary PCR
53
Table 3-3:
Ligation reaction conditions
54
Table 3-4:
Transformation results
55
vii
scFv
17
Phage
library
37
to
List of Figures
Chapter 1:
Introduction to Thesis Work
Figure 1-1:
Schematic diagram of an IgG1 molecule
18
Figure 1-2:
Schematic diagram of heavy and light chain B cell DNA
19
Figure 1-3:
Schematic diagram of sIgA
20
Figure 1-4:
Results of primary screening of rat hybridomas
21
Figure 1-5:
Kinetics of RH131 binding to mouse Fc and mouse IgG1
22
Figure 1-6:
RH131 specificity for different purified monoclonal antibodies
23
Chapter 2:
Binding Kinetics of a Fast On-Rate Antibody
(RH131)
Figure 2-1:
Western blot of mouse IgG detected with RH131
38
Figure 2-2:
Representative fluorescent traces and binding curves for
bimolecular association rate constant measurements
39
Chapter 3:
Construction of an scFv Phage library to
Immunoglobulin A
Figure 3-1:
Rabbit serum titer, 29 days post-immunization
56
Figure 3-2:
Rabbit serum titer, 137 days post-immunization.
57
Figure 3-3:
Rabbit serum competitive ELISA, 137 days post-immunization.
58
Figure 3-4:
Rabbit serum IC50s
59
Figure 3-5:
RNA purification products
60
Figure 3-6:
Vector preparation gel
61
Figure 3-7:
SfiI-digested vector preparations
62
Figure 3-8:
SfiI-digested inserts
63
viii
Chapter 4:
Construction, Directed Selection and Molecular
Characterization of Synergistic Antibodies from a
Hybridoma Library
Figure 4-1:
Checkerboard additivity screen
83
Figure 4-2:
Mouse serum titer, 73 days post-immunization
84
Figure 4-3:
Mouse serum titer, 107 days post-immunization.
85
Figure 4-4:
Mouse serum competitive ELISA, 107 days post-immunization.
86
Figure 4-5:
Mouse serum IC50s
87
Figure 4-6:
Secondary ELISA screen of hybridoma supernatants
88
Figure 4-7:
Activity assay with selected antibodies
89
Figure 4-8:
Additivity screen of monoclonal antibodies
90
Figure 4-9:
5F5 and 14A7 activity assay curves
91
Figure 4-10:
Equilibrium dissociation constant for 5F5 binding to human IgA 92
alone
Figure 4-11:
Equilibrium dissociation constant for 14A7 binding to human IgA 93
alone
Figure 4-12:
Equilibrium dissociation constant for 14A7 binding to 5F5-human 94
IgA complex
ix
List of Abbreviations
12F6, mouse monoclonal antibody to UO22+(U(VI))-DCP
14A7, mouse monoclonal antibody to human IgA
15B4, mouse monoclonal antibody to Ni-/Zn-/Co-DTPA
5F5, mouse monoclonal antibody to human IgA
DCP, 2.9-Dicarboxyl-1-10-phenanthroline
HBS, Hepes-buffered saline
Ig, Immunoglobulin
IgA = immunoglobulin A
RH131, rat monoclonal antibody to mouse IgG1
KD, equilibrium dissociation rate constant
koff, dissociation rate constant
kon, association rate constant
x
1
Chapter 1:
Introduction to Thesis Work
I. Antibody Structure and Immunoglobulin A
1.
2.
3.
4.
5.
Function of Immunoglobulins in the Body
Types of Immunoglobulins
Structure of Immunoglobulins
Immunoglobulin A
Rationale for using Immunoglobulin A
II. Synergistic Antibodies
III. Phage Display
IV. Monoclonal Antibodies
V. Screening Strategies: Phage Display
VI. Screening Strategies: Monoclonal Antibodies
VII. Rationale for using Monoclonal Antibodies
VIII. Selection of a Fast On-rate Antibody: RH131
IX. Hypothesis
X. Specific Aims
2
I. Antibody Structure and Immunoglobulin A
1. Function of Immunoglobulins in the Body
The fundamental physiological purpose of antibodies is to recognize foreign
molecules and mediate an immune response. Immunoglobulins are found as membranebound proteins on B-cells as well as soluble proteins (secreted by plasma cells) in serum.
The biological properties of the five different classes (IgG, IgM, IgA, IgE and IgD) vary.
IgG is the main antibody found in serum and the Fc portion of the molecule binds to
either the first component of the classical pathway complement cascade or Fc receptors
on host cells to mediate the immune response (except for IgD, whose function is as of yet
unknown) (1). IgM is the first antibody in an immune response to an antigen and the IgM
monomer is the B-cell receptor. IgA is primarily a secretory antibody (but is also found in
serum) and is particularly important in fighting respiratory and gastrointestinal infections.
IgE is the primary antibody involved in immune responses and parasitic infections. The
function of IgD is as yet unkown.
The typical immunoglobulin population in a human has undergone selection to
remove antibodies that recognize self-antigens and has attained some level of tolerance to
the environmental stimuli. An individual’s antibody population can be altered and
therefore his/her immunity, by passive, natural and artificial immunization. The earliest
form of passive immunity occurs when a mother transfers her IgG population to her fetus
in utero (via cross-placental transport). Immediately following birth, her natural flora is
then transferred to her offspring. When a mother breastfeeds her child she passes
immunoglobulins (predominantly sIgA) to the child in her milk. The immuno-molecular
3
population in breastmilk can change according to infant need and exposure to various
pathogens (2). Later in life, natural and artificial alteration of the immune system comes
from natural encounters with antigens in the environment and artificial vaccinations
given as a series (usually) to elicit immune responses to particular antigens (antigens that
have proven to be problematic to public health over time) (3).
2. Types of Immunoglobulins
There are five distinct classes of immunoglobulins, as well as sub-classes within
two of these classes. There are nine immunoglobulin isotypes as shown in Table 1-1. IgG
is the predominant immunoglobulin (70-75% of total Ig) in serum, and it is found as a
monomer composed of two heavy chains and two light chains. IgA is found
predominantly in seromucoid secretions, and will be discussed further herein (4).
IgM and IgD are also found in serum, but in very small amounts, 10% and <1%
of total Ig, respectively. IgM is found as a pentameric structure, held together by intermolecular disulfide bonds and a central J-chain. It is a potent activator of the classical
complement pathway once bound to its target antigen. The only known function of IgD is
as a transmembrane antigen receptor on mature B cells (5). IgE levels are extremely low
in serum; however, basophils and mast cells are continuously saturated with IgE due to
their expression of a high-affinity IgE-specific receptor. IgE is thought to have evolved as
a defense against parasitic infections, and it is also commonly associated with allergic
diseases (6).
4
3. Structure of Immunoglobulins
Immunoglobulins are composed of four chains – two identical heavy chains and
two identical light chains as shown in Figure 1-1. Each light chain has a variable region
(VL) and a constant region (CL). Each heavy chain is composed of a variable region (VH)
and three constant regions (CH1, CH2 and CH3). The different regions (domains) and the
chains are linked together by interchain and intrachain disulfide bonds. The variable
domains are found at the N-terminal end of the protein and make up the antigen binding
sites; the constant domains make up the C-terminal portion of the molecule.
The primary sequence of amino acids varies from one antibody to another, but the
basic pattern is the same. In humans, the heavy chains undergo recombination to yield a
functional gene product consisting of a variable (V) gene segment followed by D and J
segments. The light chains are produced to yield final gene products consisting of either
V and C or V and C segments. Examples of heavy and light chain gene products are
depicted in Figure 1-2.
The secondary structure of immunoglobulins is primarily beta-pleated sheets. The
seven sheets are arranged in an anti-parallel -sandwich so that they are packed fairly
tightly within the individual domains. The variable domains have two extra sheets, but
the basic folding is much the same as the constant domains. The complementarity
determining regions of the molecule (CDRs) are responsible for antigen binding and are
located at the outermost surface of the variable regions. They are composed of the
hypervariable regions of the variable chains, and are linked together by the framework
regions, which keep them folded in the optimal position for antigen binding. This area is
5
the primary interaction site between the antigen and its epitope, making it highly specific
for target recognition (7).
4. Immunoglobulin A
The function of IgA in the body is two-fold. It is the main antibody found in
mucosal epithelial tissues (i.e. the lining of the gut) and it is also secreted in serum. When
it is secreted by the mucosal epithelium, the IgA is in the secretory form. The
connectivity protein - the J chain - links the tail pieces of the heavy chains together and
the secretory component is bound at the middle region of the dimer. Thus, sIgA consists
of two IgA monomers linked via the J chain and the secretory component (~70 kDa), and
this structure is more resistant to cleavage in the gut than the monomeric form. The role
of the secretory form of IgA (sIgA) is to protect the lining of the gastrointestinal,
respiratory and reproductive tracts, where it forms a protective barrier at the “front line of
defense” against invading pathogens. Figure 1-3 shows a schematic diagram of the two
IgA monomers linked via the intermolecular J chain and the attached secretory
component.
The structure of IgA in serum is primarily monomeric (80% in humans, much less
in other mammals). The concentration of sIgA is very low in serum. The secretory
(dimeric) form of IgA is the predominant antibody in fluid secretions such as mucus,
tears, saliva and breast milk. The secretory component of the molecule assists in getting
the dimer secreted from the cells of the mucosal membranes. It is responsible for
mounting a secondary immune response via Fc cellular receptors (8).
6
5. Rationale for using Immunoglobulin A
Immunoglobulin A was chosen for these studies for two reasons. The secondary
structure of the protein is predominantly beta-pleated sheet, and the majority of proteins
for which synergistic antibodies have been previously identified have been composed of
primarily alpha-helical structure.
The studies described herein were initiated to determine if the phenomena of
synergism in antibody binding was a general one that could be extended to any kind of
protein. In addition, there is also a potential use for IgA as a marker of fecal coliform
contamination in environmental water sources. As the primary immunoglobulin found in
epithelial tissue, it is shed by the lining of the gut and secreted. Levels of IgA have been
correlated with coliform contamination levels in environmental water sources (9).
II. Synergistic Antibodies
The binding of a monoclonal antibody to a protein antigen will sometimes induce
a conformational change in the antigen that facilitates the binding of a second
monoclonal antibody at a distinct epitope. Such synergistic antibody pairs bind to their
antigen with a higher affinity than do the individual antibodies that bind to the antigen
independently. These pairs of antibodies have been termed “oligoclonal antibodies” (10)
because of their characteristic combination of two-four monoclonal antibodies in
solution. These combinations of monoclonal antibodies bind with increased affinity for
their target antigen compared to single monoclonal antibodies; hence they are more
effective in antigen neutralization.
7
Oligoclonal antibodies have been demonstrated to bind synergistically to a
number of target antigens. Volk et al found that mixtures of two, three and four different
monoclonal antibodies in different combinations elicited a synergistic effect on tetanus
toxin neutralization to the extent of approximately 200-fold more than the individual
monoclonals alone (11). In the case of human chorionic gonadotropin (hCG), Klonisch et
al found that two antibodies binding to distinct epitopes on the hCG molecule resulted in
synergistic binding (12). In this work, antibodies were immobilized (via the Fc region) to
different substrates. Comparison of their results showed that capturing with either protein
G or polyclonal serum to mouse Fc versus polystyrene allowed the researchers to use 10fold lower concentrations of the synergistic pairs to achieve maximal binding of the
analyte. This suggests that some flexibility in the antigen allows for more synergistic
activity to be seen with the antibodies.
The synergistic neutralization of HIV isolates has been less dramatic. Zwick et al
found a weak synergistic effect of combinations of antibodies on HIV-1 isolates, but
these did not increase the neutralization titers by more than 10-fold in antibody
combinations (13). In the most quantitative study to date, Nowakowski et al found that
they could get a 90-times greater potency against botulinum toxin using recombinant
oligoclonal antibodies than with human hyperimmune globulin (10). This increase in
botulinum toxin neutralization was due to a large increase in functional antibody binding
affinity when the oligoclonals were used as opposed to the individual monoclonals alone.
8
III. Phage Display
Phage display of antibody fragments is a relatively new technology; however, the
field has rapidly developed since the first scFv was expressed as a phage pIII fusion
protein (14). Phage display is a powerful technique that allows researchers to display
proteins of their choice on the surface of filamentous bacteriophage and select, from a
library of proteins, those that bind most efficiently to their target antigen. The selection
process mimics antibody affinity maturation that occurs in B-cells of the immune system,
using antigen-based selection strategies to isolate phage clones that contain the DNA that
encodes antibody fragments that bind with highest affinity to their antigens. Careful
design of the selection process allows one to isolate rare scFvs from a large pool of (104 –
1010) of phage-antibodies.
Single-chain antibody fragments (scFvs) are antibody fragments that consist of
the variable regions of the antibody heavy and light chains (VH and VL) joined by a
flexible peptide linker, which facilitates proper folding of the molecule and stabilizes the
protein for antigen binding. Proteins are expressed as fusions of the phage protein III
(pIII) of which there are 3-5 copies per phage particle. Antibodies can either be selected
from immunized or non-immunized (naïve) libraries. Immunized libraries offer the
advantage of target-directed scFvs, whereas naïve libraries contain scFvs that have not
undergone selection by the immune system. Immunized libraries offer more high affinity
scFvs, but it is possible to isolate scFvs of similar high affinity (KD = 10-8 – 10-10 mol/L)
from naïve libraries, if the library is of sufficient size (15).
9
IV. Monoclonal Antibodies
Monoclonal antibodies originate from undifferentiated B cell lineages, originally
expressed as a membrane-bound antibody. Once the antibody encounters an antigen to
which it can bind, the B-cell undergoes differentiation and either becomes a plasmasecreting cell (into a polyclonal serum antibody population) or a memory B-cell. Upon
repeated encounters with the antigen, the process of B-cell affinity maturation results in
an increase in antibody affinity for its target antigen.
In the laboratory setting, it is possible to take advantage of the process of
monoclonal antibody production by harvesting the splenocytes (site of B-cell production)
of animals that have been immunized with a particular antigen. An animal’s immune
response to our antigen can be boosted by subsequent immunizations, thus increasing the
affinity of our animals’ antibody population to our antigen. Once a sufficient immune
response has been attained (as measured by ELISA or other suitable technique) the
splenocytes can be harvested and fused with parental myeloma cells (lymphomas that
propagate continuously in culture), creating hybridomas. Those hybridomas that secrete
antibody to the antigen of interest can then be selected from the original polyclonal
antibody population.
In the experiments described herein, we chose to use monoclonal antibodies to
determine if we could design a selection strategy to identify antibodies that bind to
distinct epitopes on the target antigen (IgA in this case) and that display synergism when
binding as a complex, as an oligoclonal antibody pair. A critical component of this type
of experiment is the ability to measure the outcome, i.e. whether or not we have selected
synergistic antibodies.
Thus, our final experiments show that we can obtain a
10
quantitative increase in affinity when we bind the oligoclonal antibodies to the antigen as
opposed to the single monoclonals.
V. Screening Strategies: Phage Display
Development of the immune response to an antigen is often dominated by a few
immunodominant epitopes on the antigen, resulting in a pool of polyclonal antibodies
that is largely populated by antibodies that recognize a single epitope on the antigen.
Antibodies to other epitopes are generated; however, they are more rare than the
antibodies directed towards the immunodominant epitopes. Because of the skewed
representation of the different epitopes on the molecule, traditional phage library
selection procedures tend to identify antibodies directed only to the immunodominant
epitopes.
Epitope blocking is a screening technique that allows isolation of rare scFvs from
a large pool of antibodies to a single antigen. Epitope blocking strategies have been used
to select antibodies that bind to distinct epitopes on human respiratory syncitial virus
(RSV) (16) and HIV-1 gp120 (17) from phage display antibody libraries. This strategy
involves blocking an immunodominant epitope on the antigen so that rare antibodies that
might be present in lower concentrations in the population can be identified. ScFvs
selected in the initial screening steps are used to block the immunodominant epitopes in
subsequent screening steps. By blocking the immunodominant epitope, antibodies that
bind to that area on the molecule are prevented from binding and the less common
antibodies have a better chance at binding at additional sites on the antigen. This
11
technique would not only facilitate selection of rare antibodies from a library, but also
inherently selects for combinations of antibodies that bind to distinct epitopes on the
same molecule. Since this is a fundamental requirement for synergistic binding activity,
the selected antibody combinations are more likely to display synergy upon binding to
the antigen as a pair than not.
VI. Screening Strategies: Monoclonal Antibodies
The epitope blocking strategy described above can be applied to monoclonal
antibodies as well. Friguet et al described a similar strategy to identify antibodies that
bound to distinct epitopes on the 2-subunit of E. coli tryptophan synthase (18). They
screened a number of antibodies and used an “additivity index” to assess which
antibodies were binding additively to the antigen. Additivity was taken to mean that the
antibodies were binding to distinct, non-overlapping epitopes, or possibly epitopes that
were newly revealed by the binding of another antibody to the antigen.
The additivity assay used by Friguet et al is essentially the same as the epitope
blocking strategy described above and should be effective in identifying monoclonal
antibodies that bind to different epitopes on a particular antigen. It may also prove to be
useful as an initial screen for antibody synergy.
VII. Rationale for using Monoclonal Antibodies
Because phage display mixes and matches L and H chains, we cannot be sure that
synergistic pairs isolated by screening strategies described above did not occur solely
12
because of these random matches. A monoclonal antibody pool represents a truer
measure of the animal’s response to antigenic stimulation. An increase in antibody
affinity for the target antigen essentially decreases the amount of antibody needed to
detect the antigen. This increases the efficiency of an individual’s immune response,
making the recognition and elimination of the antigen more efficient. In an analytical
laboratory, synergistic antibodies increase the sensitivity of the assay, lower the limits of
detection and decrease the quantity of reagents needed for the particular assay. Because
the basic requirement for a synergistic antibody interaction involves antibodies that bind
to distinct epitopes, the selectivity of the immunoassay is virtually doubled, as not one
but two antibodies must bind to the antigen in order to achieve the desired antibodyantigen complex. Thus, synergistic interactions between antibodies and their antigens can
be exploited to increase both the sensitivity and selectivity of immunoassays.
VIII. Selection of a Fast On-rate Antibody: RH131
Fundamental to our theory, that we can drive a selection strategy towards a
particular characteristic of an antibody-antigen complex, is being able to systematically
measure the effects of our efforts. As described in Chapter 2, the first problem addressed
as part of my thesis work was to complete the work on a selection strategy designed to
isolate an antibody with a fast on-rate. In a previous set of experiments performed in the
Blake laboratory, a kinetic screen was set up to select for such a monoclonal antibody
(Darwish, I.A., unpublished data). An antibody (RH131) that was available in the Blake
laboratory had been produced by immunization of rats with a mixture of mouse IgG1 and
Fc followed by subsequent boosts with only the Fc portion. The result was an
13
immunodominant response to the Fc portion of the mouse IgG1 molecule. Figure 1-3
shows the results of an ELISA screen of various hybridomas isolated as a result of these
experiments. All of the antibodies in this study had the ability to recognize mouse IgG1;
however, only ~1/2 (8/15) recognized the Fc portion of the molecule. The antibody
secreted by clone RH131 resulted in the second highest color signal for IgG1, and almost
equally high for the Fc fragment. RH391 actually resulted in a greater color signal for
both antigens, but later was found to bind more slowly to the immobilized antigens than
RH131. This experiment was designed as an initial screen to identify antibodies that
would react with both whole IgG1 and Fc. Subsequent screens were designed to select
those antibodies that bound the fastest to the analytes in the assays.
Antibodies identified in the first screen were subjected to a secondary screen to
determine which bound most rapidly to the antigen. Shown in Figure 1-4, RH131 reached
maximum binding within the first five minutes of the incubation. This antibody also
recognized different mouse IgG1 molecules with different binding affinities. Figure 1-5
shows RH131’s specificity for different IgG1 monoclonal antibodies developed in the
Blake laboratory. Of the IgG1 molecules tested, 12F6 was the most effective capture
agent, and 15B4 was among the next group that showed similar abilities (5B1A4 and
2A81G5). RH131 showed the least affinity for mouse monoclonal antibodies 5B1E5 and
5B2.
In order to confirm that our selection strategy had resulted in an antibody with a
fast on-rate, we decided to perform equilibrium binding and rate constant studies on
RH131 and two of its antigens, 12F6 and 15B4. We expected that the on-rate for RH131
binding to these would be faster than average, based on the selection strategy used for the
14
monoclonal production. As the data in Chapter 2 will demonstrate, this was found to be
true, thus validating our assumption that we can design a selection strategy that will allow
us to identify antibodies with particular binding properties and then measure the effect of
our strategy on the antibodies selected.
15
IX. Hypothesis
The overall objective of these studies is to determine whether we can directly
select for synergistic antibodies to a particular antigen by survey of a large population of
existing monoclonal or scFv antibodies. Directed selection would allow for investigators
to exploit specific structural characteristics of protein molecules in order to design
antibodies that can detect such molecules with higher-than-normal affinity. Such
capabilities would significantly enhance the available technology so that molecules that
were undetectable by traditional methods could now be detected by simple, yet elegant
assays.
Our hypothesis is that these synergistic antibodies are an inherent part of the
normal physiological polyclonal antibody population of an animal, generated in
response to an antigen, and we should be able to select them using directed
screening strategies.
16
X. Specific Aims
Specific Aim 1:
Construct either an scFv phage display library from immunized
rabbits or a mouse “hybridoma library” from the splenocytes of
mice immunized with human IgA.
Specific Aim 2:
Screen the library from Aim 1 to look for combinations of
antibodies that bind to human IgA at distinct epitopes.
Specific Aim 3:
Perform equilibrium binding studies on the selected antibody
combinations to characterize the molecular interactions between
the antibodies and antigen.
17
Class Subclasses
Heavy
Chain
Light
Chain
Location
IgG
IgG1
1
or • Serum (high concentration)
IgG2
2
or IgG3
3
or IgG4
4
or IgA1
1
or IgA
• Mucosal epithelium (sIgA)
• Serum (low concentration)
IgA2
2
or IgM
None
or • Serum (low concentration)
IgD
None
or • Serum (low concentration)
• Fluid secretions (high
concentration)
• B-cells membrane
IgE
None
or • Serum (very low
concentration)
• Basophils and Mast cells
(saturation levels)
Table 1-1. Different isotypes of immunoglobulins.
18
Figure 1-1. Schematic diagram of an IgG1 molecule. Grey bars indicate interchain
disulfide bonds. Intrachain disulfide bonds are not shown.
19
A)
B)
C)
Figure 1-2. Schematic diagram of heavy and light chain B cell DNA. A) The variable
heavy chain DNA results from recombination between ~80 V genes, 23 DH segments and
6 JH segments. B) The kappa light chain DNA results from differentiation of B cells,
during which germline V regions are joined to J regions. The C segment follows the V
and J segments. C) The lambda light chain DNA results from a similar process to that of
the kappa light chains, but the J and C segments are “matched” in the germline DNA, so
a J2 segment will be combined with a C2 segment.
20
Figure 1-3. Schematic diagram of sIgA. The J chain (grey) joins the two monomer units
together via the C-terminal ends of the CH3 regions. The secretory component is attached
via disulfide bonding to the CH2 region of one of the IgA monomers.
21
Figure 1-4. Results of primary screening of rat hybridomas. Microwell plates were
coated with 0.5 g/ml of mouse Fc (open bars) or IgG1 (solid bars) and blocked with 3%
bovine serum albumin in HBS. Supernatants were diluted 1:2 in HBS and added to the
coated and blocked wells. After 1 hour incubation at 25°C, the plates were washed and
color was developed by sequential incubations with an HRP-labeled anti-rat antibody
(1:2000) and peroxidase substrate. (Darwish, I.A., unpublished data)
22
Figure 1-5. Kinetics of RH131 binding to mouse Fc and mouse IgG1. A) Hybridoma
supernatants were incubated for the indicated periods of time on plates coated with 0.5
g/mL of mouse IgG1. Binding of the rat monoclonal was detected using a 1:2000
dilution of HRP anti-Rat IgG. Color was developed by incubation with TMB substrate for
20 minutes for antibodies RH131, RH280 and RH391 or 30 minutes for RH89 and
RH353. B) Hybridoma supernatants were incubated for the indicated times on plates
coated with 0.5 g/mL of mouse Fc fragment. Signal was developed as described in
Panel A using TMB substrate and HCl. (Darwish, I.A., unpublished data)
23
Figure 1-6. RH131 specificity for different purified monoclonal antibodies. ELISAs
were performed as described in Khosraviani et al using plates coated with saturating
concentrations of each antibody’s particular ligand: Cd-EDTA-BSA (antibodies 2A81G5,
5B1A4, and 5B1E5), Pb-DTPA-BSA (antibodies 5B2 and 15B4) or U(VI)-DCP-BSA
(antibody 12F6). RH131 was added and the wells were incubated for varying times, as
shown. An enzyme-labeled anti-rat antibody was added and color was developed (19).
(Darwish, I.A., unpublished data)
24
Chapter 2:
Binding Kinetics of a Fast On-Rate
Antibody (RH131)
25
Introduction
ELISAs are a fundamental tool of immunologists and are used for a variety of
clinical diagnostic and environmental applications. Any ELISA has three essential
components: an antibody specific for the molecule of interest, a solid phase to capture the
antibody-antigen complex and an enzyme-mediated colorimetric detection system (20).
There are several variations of ELISA methodology, including the sandwich and
competitive immunoassay, and many of these assays rely upon the use of commercially
available enzyme-labeled anti-species antibodies, which add an additional step to the
assay procedure but avoid the time-consuming and often problematic conjugation of the
primary antibody to an appropriate enzyme (21).
While many of the critical factors influencing immunoassay performance,
including choice of primary antibody (22), solid phase (23), fluid phase (pH, ionic
strength) (24) and enzyme substrate have been examined in some detail, little attention
has been given to the enzyme-labeled anti-species antibody preparations used in these
analyses. The enzyme-labeled polyclonal anti-species antibodies (secondary antibodies)
used in many immunoassay formats typically require an hour of incubation in the plate
for maximum color yield (4). Since the binding of the secondary antibody to the primary
antibody is dictated in part by the association rate constant of the secondary antibody, we
hypothesized that using an antibody with a fast on-rate could significantly reduce the
time required for this step of the ELISA.
In previous work from the Blake laboratory (see pp 12-14 of this thesis), rat
immunizations were initiated by the injection of whole mouse IgG, followed by boosts
26
with a mixture of mouse IgG and Fc. This immunization strategy resulted in rats whose
polyclonal antisera response included antibodies that bound to both intact mouse IgG and
Fc fragment. Hybridomas were generated from the spleen cells of the rat with the highest
antibody titre to mouse IgG and Fc.
Primary screening led to five clones that bound to both the whole IgG molecule
and the Fc fragment (Darwish, I.A., unpublished data). These five clones were then
subjected to a second round of screening (kinetic screen) in which they were incubated
for varying times (1-60 minutes) in microwells coated with either mouse IgG1 or the Fc
fragment. This experiment revealed a single clone, RH131, which provided the highest
color yield in the shortest amount of time. In fact, the binding of RH131 to the
immobilized antigens appeared to be complete by the earliest time point in these
experiments (1 minute; see Figure 1-4 in the Introduction).
In an effort to learn more about the specificity of the RH131 antibody, its ability
to bind to six different monoclonal antibodies of the IgG1 subclass already available in
our laboratory was tested (see Figure 1-5 in Chapter 1). Although RH131 bound to all
mouse IgG1 molecules tested, it displayed the highest reactivity with 12F6, an
intermediate binding to 15B4, 5B1A4 and 2A81G5 and the lowest reactivity with 5B1E5
and 5B2 Of these antibodies, all but 5B2 contained a light chain (25-29).
In the following experiments, the binding kinetics for antibody RH131 were
measured for two monoclonal antibodies (12F6 and 15B4) to determine if they correlated
to the faster-than-average binding as seen in previous ELISA experiments.
27
Materials and Methods
Materials
A monoclonal antibody isotyping kit was purchased from Serotec (Raleigh, NC).
The KinExA 3000™ instrument and polystyrene beads were obtained from Sapidyne
Instruments, Inc. (Boise, ID). Mouse antibodies 15B4 and 12F6 were available from
previous studies (25, 27). Mouse IgG and goat anti-rat IgG for the Western blot, as well
as the Cy5-labeled antibody to rat IgG for the kinetic studies were obtained from Jackson
ImmunoResearch Laboratories, Inc. (West Grove, PA). The MultiMark® multi-colored
protein molecular weight standards, Tris-Glycine SDS sample buffer and nitrocellulose
transfer membrane were purchased from Invitrogen Corporation (Carlsbad, CA).
Diaminobenzadine (DAB) substrate was obtained from BD Biosciences (Franklin Lakes,
NJ).
Chain Specificity of RH131
A Western blot was used to determine whether RH131 bound to the light or heavy
chain of mouse IgG. Westerns were performed essentially as described by (30) with
minor modifications. Pooled mouse IgG (10 g) was resolved on a 10% Tris-Glycine
SDS-PAGE denaturing gel under reducing conditions. Following electrophoresis,
proteins were transferred from the gel to a nitrocellulose membrane for 1.5 hours at 25
mAmps. Non-specific binding sites were blocked in 5% non-fat milk/PBS + 0.05%
Tween-20 (milk/PBS-T) for 1 hour at room temperature, with agitation. The blot was
washed with six changes of wash buffer (PBS + 0.05% Tween-20), and then incubated
28
with 1 g/mL of RH131 diluted in milk/PBS-T with agitation for 1 hour at room
temperature. The blot was washed again as described above, and then incubated with a
1:5,000 dilution of peroxidase-conjugated goat anti-rat secondary antibody diluted in
milk/PBS-T. The blot was washed in five changes of wash buffer, and then antigenantibody complexes were detected with DAB peroxidase substrate according to the
manufacturer’s instructions.
Determination of Bimolecular Association Rate Constants
Association rate constants were determined using the KinExA 3000™.
Polystyrene beads (200 mg) were coated with 0.1 mg/mL of purified IgG1 (15B4 or 12F6
monoclonal antibody) diluted into 1.0 mL Hepes-buffered saline (137 mM NaCl, 3.0 mM
KCl, 10 mM sodium 2-hydroxyethylpiperazine-N’-2-ethanesulfonate, pH 7.4, HBS). The
beads were gently agitated for 1 hr at 37°C, centrifuged, and the supernatant solutions
were removed. Non-specific binding sites on the beads were blocked by incubation in 3%
BSA in HBS for 1 hr at 37°C.
The coated, blocked beads were automatically packed into the observation cell of
the KinExA 3000 as previously described (31). Each bead pack consisted of a 4 mm
column of polystyrene beads with IgG1 (15B4 or 12F6) immobilized on the surface.
Equal volumes (500 L) of RH131 and soluble IgG1 were mixed and the mixture was
passed over the coated beads at a flow rate of 0.5 mL/min. The binding reaction occurred
during the time period required for the solution to reach the bead column (7 s). Upon
reaching the column, primary antibody with no soluble IgG1 in its binding site was able
to bind to the immobilized antigen on the beads, and the fraction of primary antibody that
29
was not bound by the antigen was washed away by a subsequent HBS wash step. Bound
primary antibody was detected when 1 mL of fluorescently labeled secondary antibody
solutions was flowed over the bead column (500 L/min), followed by a wash with HBS
(600 L/min).
Determination of Equilibrium Dissociation Constants
Bimolecular equilibrium constants were determined using the KinExA 3000™.
Polystyrene beads (200 mg) were coated with 0.1 mg/mL of purified IgG1 (15B4 or 12F6
monoclonal antibody) diluted into 1.0 mL of HBS. The beads were gently agitated for 1
hr at 37°C, centrifuged, and the supernatant solutions were removed. Non-specific
binding sites on the beads were blocked by incubation in 3% BSA in HBS for 1 hr at
37°C.
The coated, blocked beads were automatically packed into the observation cell of
the KinExA 3000 as previously described (31). Each bead pack consisted of a 4 mm
column of polystyrene beads with IgG1 (15B4 or 12F6) immobilized on the surface.
Varying concentrations of soluble IgG1 were mixed with RH131 and the solutions were
allowed to come to equilibrium (15 – 20 minutes). The solutions were passed over the
coated beads at a flow rate of 0.5 mL/min. Upon reaching the column, primary antibody
(RH131) with no soluble IgG1 in its binding site was able to bind to the immobilized
antigen on the beads, and the fraction of primary antibody that was not bound by the
antigen was washed away by a subsequent HBS wash step. Bound primary antibody was
detected when 1 mL of fluorescently labeled secondary antibody solutions was flowed
over the bead column (500 L/min), followed by a wash with HBS (600 L/min).
30
Results
Chain Specificity of RH131
In order to confirm that RH131 was binding to the heavy chain of the mouse IgG
molecule, we performed a Western blot with pooled mouse IgG, as shown in Figure 2-1.
The mouse IgG was resolved by SDS-PAGE under reducing conditions to separate the
heavy and light chains, and then incubated sequentially with RH131, enzyme-labeled
anti-rat antibody and colorimetric substrate. RH131 bound exclusively to the heavy chain
of mouse IgG (~50 kDa); no bands were observed at the position of migration of the light
chain (~25 kDa). Control experiments where the RH131 antibody was omitted from
staining of blots showed no reactivity (data not shown). We subsequently chose the
purified monoclonal antibodies 12F6 and 15B4 as ligands for molecular binding assays
designed to measure the association rate of RH131.
Bimolecular Association Rate Constants and Equilibrium Dissociation Constants
The KinExA 3000TM was used to elucidate the kinetics of the binding interactions
between RH131 and antibodies 12F6 and 15B4. Data was acquired using a computer
interfaced to the KinExA 3000 and software provided by Sapidyne Instruments, Inc.
Fluorescence was recorded each second immediately after the bead pack routine was
finalized (just prior to the RH131 antibody-mouse IgG solution flow step). Data was
imported into Microsoft Excel and SlideWrite and analyzed using linear and non-linear
regression curves (31) executed by those programs.
31
The primary data (shown in Figure 2-2A and 2-2B) was used to determine the
difference in fluorescence at the beginning and end of each experiment (delta signal).
This delta was subsequently plotted versus ligand concentration to show how the number
of available antibody binding sites changed in response to a change in the concentration
of free ligand (Figure 2-2C and 2-2D). The delta signals were graphed as a function of
ligand concentration. At any concentration of ligand x, the dependence of the delta
fluorescence on ligand concentration can be defined as:
yA = a0+a1*e(-a2x)
(eq. 2-1)
where yA = delta signal at a particular concentration of ligand, a0 = fluorescence at an
infinite concentration of ligand x, a1 = maximum delta fluorescence, x = the
concentration of 15B4 or 12F6, and a2 = kon*t.
The curve defined by equation 2-1, above, was then normalized by subtracting the
background fluorescence (a0 from equation 2-1) from the delta fluorescence (yA in
equation 2-1) and dividing by the maximum delta signal (a1 from equation 2-1) as shown
in the following equation:
yB = (yA-a0)/a1
(eq. 2-2)
where yB = fraction of unoccupied binding sites.
The normalized data was then plotted as a function of ligand concentration to
reveal how the fraction of unoccupied binding sites decreased as ligand concentration
increased. This data was fit using the following equation:
yB = e(-a0*x)
(eq. 2-3)
where yB = fraction of unoccupied binding sites (whose values range from 1-0), a0 =
kon*t and x = ligand concentration.
32
Evaluation of that curve for y = 0.5 and solving for kon yields the association rate
constant. The solution to that equation is shown below:
yB = e(-a0*x)
(ln) yB = e(-a0*x) (ln)
(take the ln of each side)
(ln) yB = -a0*x
(divide both sides by x and -1)
-(ln) yB/x = a0 = kon*t
(divide both sides by t)
(-(ln) yB/x)/t = kon
Using these equations and the KinExA data, we measured the association rate constants
for RH131 interaction with both 15B4 and 12F6.
In a second series of experiments, we also measured the equilibrium dissociation
constants for the binding interaction between RH131 and the 12F6 and 15B4 monoclonal
antibodies (primary data and calculations not shown, see Blake, 1996 for details of the
method) (32). Comparison of the data obtained in equilibrium binding experiments and in
the determination of the on-rate indicated that the binding of RH131 to 12F6 had already
reached equilibrium in the 7 seconds allowed for binding in the KinExA 3000. Because
of this very rapid binding, only a lower limit for the association rate constant (>5.5 x 107
M-1 sec-1) could be calculated. Association rate constants, equilibrium dissociation
constants and the dissociation rate constants (calculated using the relationship KD =
koff/kon) are shown in Table 2-1.
33
Discussion
The use of rats to generate monoclonal antibodies to mouse immunoglobulins is
not a new concept. As early as 1981, Yelton and colleagues generated two rat anti-mouse
monoclonal antibodies, one with binding specificity for both mouse kappa light chains
and the other for gamma heavy chains (33). The monoclonal antibody that bound kappa
light chains, clone 187.1.10, was studied further in 1984 by Ware et al (34). These
investigators reported an avidity constant of 2.3 x 109 L/mole for mouse IgGs containing
a kappa light chains, and essentially no detectable interaction with IgGs containing
lambda light chains. Utilization of the 187.1.10 monoclonal antibody decreased nonspecific background in immunoprecipitations and radioimmunoassays. A similar
reduction in non-specific binding was also reported by Brodin et al (35), who generated a
rat monoclonal (RAMOL-1) that appeared to bind with primary specificity to mouse
kappa light chains. This antibody showed superior signal-to-noise ratios in flow
cytometry and immunohistochemistry when compared to commercially available
polyclonal rabbit anti-mouse antibodies. Similar work was reported by Reed (36), who
reported the isolation and characterization of rat monoclonal antibodies that bound with
high affinity (Kds 2.3 x 10-9 to 2.4 x 10-10 M) to mouse kappa light chains.
In this study, rat antibodies to mouse IgG molecules were subject to a kinetic
selection process that allowed us to isolate a single monoclonal antibody, RH131, which
bound with a faster-than-normal on-rate. To our knowledge, this is the first kinetically
selected secondary antibody to be reported. The kinetic screening methods described
herein were effective in producing a monoclonal antibody that bound to its target, mouse
34
IgG1, with a very fast on-rate. This antibody recognized both intact IgG and the Fc
fragment, which suggests that its epitope resides in the heavy chain of the IgG1 molecule.
However, the epitope recognized by RH131 does not appear equally accessible on all
mouse IgG1 monoclonal antibodies, since this antibody showed some variability in its
ability to recognize different mouse monoclonal IgG1 antibodies in an ELISA screen.
Not surprisingly, RH131 reacted exclusively with the heavy chain of mouse IgG in a
Western blot. This was expected due to the immunization protocol, (primary
immunization with intact IgG and subsequent boosts with Fc). The antibody light chain
does not extend into the Fc portion of the molecule; thus, this region was unavailable as a
target of the immune response after the initial immunization. The exact nature of the
epitope recognized by RH131 is under further investigation in our laboratory; clearly,
even the 6 purified IgG1 molecules examined in this study showed variability in their
reactivity with RH131.
The affinity of RH131 toward IgG1 molecules, (Kd, 2.27 x 10-9 to 8.3 x 10-10 M)
was comparable to those exhibited by the monoclonal antibodies reported by other
investigators (36). Association rate constants were not available from this literature (3336); however, typical association rates for antibodies vary from 105 – 106 M-1s-1 (37, 38),
with the measured upper limit being on the order of 106. Kinetic measurement of the
bimolecular association rate constant for RH131 binding to different monoclonal
antibodies showed that the kon for binding to one monoclonal (15B4) was 3.02 ± 0.31 x
106 M-1s-1 , while the kon for binding to the other monoclonal (12F6) was faster than
could be measured by our current instrumentation (lower limit, >5.5 ± 0.19 x 107 M-1s-1).
These association rates are at the upper limit of the measured range of association rates
35
for antibody molecules, thus, the kinetic screening protocol described herein was
effective in selecting a secondary antibody with a faster-than-average on-rate.
As shown in Table 2-1, the equilibrium binding constants of RH131 for two
different monoclonal IgGs are on the range of 10 -9 M and the association rate constants
are between 106 and 107 M-1 sec-1. The calculated dissociation rate constants thus imply
half lives of ~1 to 5 minutes for antibody-antigen complexes in solution. Such fast offrates could be interpreted as rendering the RH131 antibody unsuitable for ELISA
procedures, since the half-lives of the RH131- mouse IgG1 complexes would be too short
to survive most washing steps used in immunoassays. However, the immunoassay format
used in our study immobilized the antigen onto a solid phase, and bivalent nature of the
RH131 antibody was most likely increasing the stability of the antibody-antigen complex
on this solid phase.
It is generally recognized that multiple binding sites on an antibody molecule lead
to a gain in functional affinity (avidity) for target antigens (39, 40). The effect of
bivalence on the antibody binding to a solid phase was quantified in 1994 by Dill and
coworkers (41). They derived a series of equations that suggested there was positive
cooperativity in the binding of bivalent antibodies to antigens immobilized on a solid
support and that bivalency increased the apparent binding affinity of the antibody for
immobilized antigen by 2-4-fold, as compared to a monovalent Fab. Further studies on
the effect of valence on binding to an immobilized ligand have also been reported (42).
This second study utilized lectins that were mono-, bi-, tri- and tetravalent for a specific
carbohydrate residue (-linked N-acetylgalactosamine) on the surface of erythrocytes.
The interaction of monovalent lectin with the surface of erythrocytes was virtually
36
identical to its interaction with a soluble glycoside (1-O-methyl-N-acetylgalactosamide).
However, the affinity of the lectin for erythrocyte-bound glycoside increased with the
increased valency of the lectin. The magnitude of the increase (3-5 fold for each
additional binding site) was similar to that reported by Dill et al (41). Like the earlier
antibody study, these data showed positive cooperativity in the binding of the multivalent
lectins to the cell surface; the authors suggested that the observed positive cooperativity
may be due to the lectin being held in proximity to the cell surface by the first binding
event, which then rendered the binding at the second site more favorable. The increased
affinity was attributed to a decrease in the apparent dissociation rate constant; the authors
reasoned that only a single binding event was necessary to bring the lectin to the cell
surface, while dissociation required the simultaneous breaking of two interactions. These
studies thus rationalize the ability of the RH131 antibody to remain bound to its
immobilized target during wash steps in ELISA, even though these complexes may have
very limited half-lives in solution.
While its preferential binding to certain mouse antibodies may a limitation to its
usefulness of RH131 as universal secondary antibody reagent, RH131 could be a very
effective reagent for use in many immunoassay formats that employ mouse monoclonal
antibodies as the primary recognition element.
The kinetic data obtained in the on-rate studies indicates that RH131 does, in fact,
have a faster than average on-rate, which was the desired quality sought in the selection
strategy designed for these experiments. These data validate our ability to drive a
selection strategy to suit out purposes, and verify that we can systematically measure the
outcome of such a strategy.
37
Antibody
Equilibrium
Dissociation
Constant, KD (M)
Association Rate
Constant, kon (M-1
sec-1)
Dissociation Rate
Constant, koff (sec-1)
15B4
0.83 ± 0.08 x 10-9
3.02 ± 0.31 x 106
2.51 x 10-3
12F6
2.27 ± 0.46 x 10-9
>5.5 ± 0.19 x 107
<12.49 x 10-2
Table 2-1. Equilibrium, association and dissociation constants for RH131 binding to
two different IgG1 molecules. Dissociation rate constants were calculated using the
formula KD = koff/kon.
38
Figure 2-1. Western blot of mouse IgG detected with RH131. Pooled murine IgG (10
g, Lane 1) was resolved on a 10% acrylamide gel (Tris-Glycine-SDS) under reducing
conditions and the resolved heavy and light chains were transferred to a nitrocellulose
membrane. The blot was incubated sequentially with purified RH131 (1 g/mL),
followed by goat anti-rat-HRP (1:5,000 dilution). Antigen-antibody complexes were
detected by incubation with diaminobenzidine (DAB) peroxidase substrate for ~1 minute,
and size was determined by comparison with pre-stained molecular weight markers
resolved and transferred simultaneously (Lane 2, molecular weights expressed as kDa).
39
Figure 2-2. Representative fluorescent traces and binding curves for bimolecular
association rate constant measurements. Polystyrene beads were coated with 0.1
mg/mL of mouse anti-metal antibody (15B4 or 12F6) and non-specific binding sites were
blocked with 3% BSA. RH131 and mouse antibody solutions, (Panel A, traces 1-4 = 0,
2.5, 25 and 100 nM 15B4, respectively and panel B, traces 1-4 = 0, 1, 2.5 and 50 nM
12F6, respectively) were mixed and flowed over the bead column to allow antibody
molecules with unoccupied binding sites to bind to the immobilized ligand. RH131
antibody concentration was kept constant at 1 nM. Bound RH131 was detected using a
fluorescently labeled anti-species secondary antibody at a 1:800 dilution of stock. Data
was analyzed as previously described (Blake, 1999) and the bimolecular association rate
constants were determined from the curves shown in Panels C and D, as described in the
Results section.
40
Chapter 3:
Steps in the construction of an scFvphage library to Immunoglobulin A
41
Introduction
With the advent of antibody phage display technology, large libraries of
antibodies can be assembled from which synergistic pairs could be selected (see
Bradbury and Marks, 2004 for a comprehensive review of phage display) (43). Directed
selection of synergistic antibodies from a phage-displayed scFv library would allow for
isolation of antibody combinations with higher affinity for the antigen than could
ordinarily be selected. While it is possible that traditional selection strategies could lead
to the isolation of antibodies that bind synergistically, a selection strategy that is
purposely designed to isolate pairs of synergistic antibodies would not only save time but
also directly select for pairs that bind synergistically and increase the chances of
identifying such pairs.
Immunoassays are used for a wide variety of purposes; thus, the potential impact
of this technology is significant.
The development of a method that is capable of
enhancing the affinity of immunology-based detection systems could be of great interest
to the research community. Because the potential outcomes of this project have such a
broad applicability, this project addresses not only an interesting basic science question,
but also one that has far-reaching practical applications.
In the following experiments, we attempted to produce an scFv phage library
from the RNA of immunized rabbits. We harvested the RNA from the spleens of
immunized rabbits, synthesized first strand cDNA and then amplified heavy and light
chain library fragments from the cDNA. We attempted to ligate and transform these light
chain library fragments into the pSD3 phagemid vector, but we were unable to attain a
library of sufficient size (diversity) to pan for antibodies that bound to IgA. While these
42
attempts were only partially successful, the light chain libraries described herein could
serve as a basis for scFv libraries in the future. Had we obtained a library of sufficient
size, we would have screened it using the epitope-blocking strategy described in the
Introduction.
43
Materials and Methods
Materials
Rabbits were obtained from Myrtle’s Rabbitry, Inc. (Thompson Station, TN).
Human IgA and the peroxidase-conjugated goat anti-species antibody to rabbit IgG were
purchased from Jackson ImmunoResearch Labs (West Grove, PA). The TiterMax Gold
(adjuvant) as well as the dNTP mix were purchased from Sigma-Aldrich (St. Louis, MO).
RNAlater, the RNeasy Protect Maxi purification kit, the Gel Extraction kit and the
Plasmid Midi-prep kit were purchased from QIAGEN (Valencia, C A). The First-strand
cDNA Synthesis kit was purchased from Amersham Biosciences (via GE Healthcare,
Piscataway, NJ). High Fidelity Taq polymerase, all molecular weight markers (100 bp
and 1 kb), and the competent cells (BL21 (DE3)pLysS and Max Efficiency DH10B) were
obtained from Invitrogen (Carlsbad, CA). All primers were ordered from Integrated DNA
Technologies (Coralville, IA) and the pSD3 vector was obtained from Gary Whitelam’s
lab (44). High Concentration T4 DNA ligase was purchased from USB (via GE
Healthcare, Piscataway, NJ) and the electroporator and cuvettes were obtained from
BioRad (Hercules, CA). TMB substrate was purchased from KPL (Gaithersburg, MD).
Rabbit Immunizations and Spleen Harvest
Four 3-4 month old female New Zealand white rabbits were immunized with
purified human IgA. All immunogens were emulsified in TiterMax Gold adjuvant and
administered intramuscularly at 3-week intervals. A pre-immune blood sample was taken
prior to the first immunization, and then the rabbits were injected with 300 g of IgA
44
emulsified with an equal volume of TiterMax Gold. Further injections were performed on
days 22, 43, 64 and 120 with 300 g, 300 g, 100 g and 200 g of human IgA,
respectively, emulsified in the TiterMax Gold adjuvant. Test bleeds were performed on
days 29, 49, 71 and 127 and the animals were sacrificed on day 137. The spleens were
placed in RNAlater solution (1 mg of spleen to 10 L of solution), stored overnight at
4°C and then stored at -20°C in the solution until RNA purification.
Rabbit Serum Titers and Competitive ELISAs
Rabbit serum titers were checked after each test bleed by indirect ELISA.
Microwells were coated with 5 g/mL of human IgA, at 37°C for I hour. Non-specific
binding sites were blocked with 3% BSA in HBS, and then the serum samples were
serially diluted directly into the microwells. Following a 1-hour incubation period, the
bound antibodies were incubated with a peroxidase-conjugated goat anti-species antibody
(1:10,000 dilution) to rabbit IgG at RT for 1 hour. Color signal was developed by adding
TMB peroxidase substrate for 3 minutes and stopping the reaction with 1 N HCl. The
plates were read in a spectrophotometer and the signal data was plotted as a function of
serum dilution.
The competitive ELISAs were performed as described above, with one exception.
The serum samples were mixed (at a fixed concentration) with decreasing concentration
of soluble human IgA prior to being added to the microwell plate. The mixtures were
then added to the wells and the soluble antibodies in the serum were allowed to bind to
either the free ligand in solution or the immobilized ligand on the plate. Bound
complexes were detected as described above.
45
RNA Isolation and cDNA Preparation
RNA was purified from the rabbit spleens using according to the instructions in
the manufacturer’s RNeasy kit. Briefly, spleen tissue pieces were homogenized in a
Polytron homogenizer using 15 mL of guanidine isothiocyanate buffer (1 mg of tissue).
Total RNA was bound to the silica gel membrane of an RNeasy column, contaminants
were washed away and RNA was eluted from the column in RNase-free water. The
quality of the RNA was assessed by resolution on a 1.2% formaldehyde-agarose
electrophoresis gel (Sambrook and Russell, 2001).
First-strand cDNA synthesis was performed on the purified RNA according to the
manufacturer’s protocol. The reaction was catalyzed by MMLV reverse transcriptase,
which was contained in a bulk first-strand cDNA reaction mix. RNA (5 g) was added to
a reaction with the random hexadeoxynucleotide (pd(N)6) primer set in a total volume of
33 L. The products of this reaction (double-stranded RNA:cDNA heteroduplex) was
used directly in downstream applications as a template for primary PCR reactions.
Primary PCR
The cDNA products prepared as described above were used as a template for the
primary PCR reactions. All primers contained restriction sites for either SfiI (light chains)
or PflMI (heavy chains). Primary PCR reactions were performed with each animal’s
cDNA separately, and then the products were combined later. There were a total of eight
primary PCR reactions per animal; two separate light chain and two separate heavy chain
reactions and each of those reactions were performed using two different annealing
temperatures. The primer sequences are shown in Table 3-1. The primer combinations are
46
and PCR reaction cycles are shown in Table 3-2. PCR reactions were performed as
described by the manufacturer, using 5 L of cDNA:RNA template in 0.2 mM dNTP
mix, 1 M forward and reverse primers and 1.25 units of High Fidelity Taq polymerase
in a total reaction volume of 50 L.
Following combination of each animal’s heavy and light chain PCR products, the
products were purified on a TAE agarose gel using a gel extraction kit according to the
manufacturer’s protocol. The gel-extracted DNA bound to each QIAquick column and
then was eluted with 30-50 L of water or elution buffer. Each animal’s light and heavy
chain mixtures required multiple columns to extract, but the eluted DNA from each
animal was combined at the end of the procedure.
Restriction Digests
Rabbit light chain mixes were digested with SfiI at 50°C. The digested inserts
were purified on an agarose gel as described above using the QIAquick Gel Extraction
kit. A portion of each digested, gel- purified insert was resolved on a 1.5% agarose gel.
Concentration was measured by spectrophotometry at a wavelength of 260 nm.
Vector Preparation
The pSD3 vector was transformed into in BL21 cells (dcm- strain) and prepped
using QIAGEN’s Plasmid Midi-prep kit. Plasmid DNA quality was assessed by gel
electrophoresis on a 1% TAE agarose gel, and following gel purification, the vector was
digested with SfiI as described above. Following the restriction digest with SfiI the
47
vectors were resolved on a 1% agarose gel to ensure that we had attained digestion with
the reaction.
Ligations and Transformations
The SfiI-digested pSD3 vector (20-40 ng) was ligated with SfiI-digested rabbit
light chains (12 ng) using a high concentration T4 DNA ligase (10 units) in a final
volume of 50 L. The different ligation reaction conditions that we tried are shown in
Table 3-3. Reactions were ligated at 16°C for 16 hours, and then the T4 ligase was
inactivated. Following each ligation the products were both diluted 1:100 in water and
ethanol precipitated. Ligation products were combined with 20 g of glycogen, 0.2
volumes of 3M sodium acetate (pH 5.2) and 2.5 volumes of ethanol. The mixture was
incubated on ice for 15 minutes, then centrifuged for 10 minutes at 15,000 rpm. The
pellets were washed with 70% ethanol, allowed to dry and then resuspended in TE buffer.
Precipitated and diluted ligation reactions from rabbits 1 and 4 were transformed
into 20 L of DH10B electrocompetent E. coli using an electroporator and 0.1 cm gap
cuvettes. Transformations were performed according to the manufacturer’s protocol for
the cells and following recovery in S.O.C. media the transformation products for each
animal were combined and plated on solid 2TY (supplemented with 100 g/mL
ampicillin and 1% glucose) titer plates and BIOAssay dishes. Plates were incubated
overnight at 37°C and then transformation efficiency was calculated the following day
using the pUC19 control titer plates (control vector included with the DH10B competent
cells).
48
Results
Rabbit Serum Titers and Competitive ELISAs
Following test bleed #1 (day 29 of inoculation series) the serum was assayed for
binding activity with immobilized human IgA. The pre-immune serum was also assayed
at this time to ensure that we had achieved a specific response to the immunogen. The
pre-immune serum showed no activity in the assay (data not shown), while the serum
antibodies from all four rabbits showed binding activity to human IgA in the indirect
ELISA (Figure 3-1). The final bleed was taken at the time of sacrifice (day 137) and the
results of that serum titer are shown in Figure 3-2. These data were plotted as percent of
maximum signal versus 1/serum dilution and fit using the following equation:
y = a3+(a0-a3)/(1+(x/a2)a1)
(eq. 3-1)
where x = antibody concentration (1/serum dilution) a0 = minimum data point, a1 =
antibody-dependent change in fluorescence a2 = x value which results in 50% of
maximum signal (EC50) and a3 = maximum data point. In order to compare the immune
response to the antigen over time, the curves were then evaluated at y = 50%. Based on
these evaluations (EC50), the serum from all four rabbits became more reactive with the
immobilized IgA as the immunization progressed from 29-137 days (data not shown).
The curve (for the final test bleed) was also evaluated (prior to transformation to percent
of maximum signal) at y = 1 for each of the serum samples and that concentration of
serum (1/dilution factor) was used in the competitive ELISAs that followed.
49
Rabbit Serum Competitive ELISAs
Competitive ELISA on the final serum samples was performed as described in the
Methods section, using concentrations of serum determined in the previous indirect
ELISAs. The absorbance data was transformed to percent of maximum signal and plotted
as a function of soluble IgA concentration (Figure 3-3). The data was fit using the
following equation:
y=a0-((a0-a1)*(x/(a2+x)))
(eq. 3-2)
where x = concentration of soluble IgA (competitive inhibitor) a0 = minimum y data
point, a1 = maximum y data point and a2 = x-value at which the signal is inhibited by
50% (IC50) (45). The resulting curve was evaluated at y = 50% to obtain an IC50 for each
serum sample. The IC50 is the concentration of IgA at which 50% of the antibody binding
sites are occupied. The serum IC50s for each animal are shown in Figure 3-4. The IC50s
were as follows: R1 = 1.1 nM, R2 = 1.7 nM, R3 = 1.4 nM and R4 = 2.8 nM.
RNA Isolation and pSD3 Preparation
Following purification with the RNeasy kit, the samples were resolved on a
formaldehyde agarose gel to assess the integrity of the products. The gel picture is shown
in Figure 3-5. The 28S and 16S ribosomal RNA bands are very clear, and there is little if
any smearing in the lanes. The low resolution of the bands is due to the lack of a
denaturation step in the sample preparation prior to loading the wells. The concentrations
of the RNA preparations ranged from 315 g/mL to 815 g/mL.
50
The pSD3 vector was prepared in BL21 cells, and the plasmid DNA was resolved
on an agarose gel to check its quality. The gel picture is shown in figure 3-6. The fastermigrating band in lane 1 is the band that was gel-purified for SfiI digestion.
SfiI Restriction Digests
Following SfiI digestion, the vector and light chains were resolved on a 1.5% gel
to check for complete digestion. Figure 3-7 shows the digested vector preparations and
lanes 7 – 9 show the digested and undigested pSD3 vector from BL21 cells that were
used in subsequent purification and ligation steps. Figure 3-8 shows the undigested and
digested inserts for each rabbit.
Ligations and Transformations
The results of the four transformations that were performed are shown in Table 34. It is obvious that although we had high-efficiency control transformations, we had very
low transformation of the rabbit light chain libraries.
51
Discussion
Although our attempt at producing an scFv phage library to human
immunoglobulin A was unsuccessful, the resulting vector, light and heavy chains can still
be used in the future to troubleshoot these experiments and possibly produce a highdiversity library.
Diversity of phage libraries is an ongoing problem throughout the entire
construction process; therefore, it is of great importance that one pays careful attention to
the quantity and quality of all products (light and heavy chains and vectors) so that the
greatest chance of attaining a high diversity is maintained. The greatest loss probably
occurs at the point of ligation and transformation of the chains into the vector, which is
where we had the most trouble. It should be noted that this was a second attempt at this
project, as the first libraries were lost in the thaw that followed hurricane Katrina. We
had similar trouble with the diversities in that original library, but at the point of heavy
chain insertion as opposed to light chain insertion as with this second one.
One way to avert the problem of diversity is to use a naïve library, but then one
risks losing the high-affinity antibodies that result from the immunization process and the
artificial “affinity maturation” of the light and heavy chain DNA. One could also attempt
to shuffle the chains of a small immune library to attain a higher diversity (15), but we
were nowhere near the level of clones needed to do such experiments.
Because of the problems that we encountered, and the chance that using an
“artificial” library would result in fewer, if any, combinations of synergistic antibodies,
we decided to stop the library construction and switch to a “monoclonal antibody library”
as a source for potential antibody synergism.
52
Primer
(original name
shown in italics)
r5’ kappa 1
5’-primer
(rbbk_1)
Nucleotide sequence
(restriction sites shown in italics)
Purpose
r3’ kappa j1
3’-primer
(rbfw_j1)
TATATATATAATTATGGCCTCCC’TG reverse light chain
GCCT(A/C/T)(G/T)GA(C/T)(C/G/T)(A/T) (SfiI)
C(C/T)A(C/G)(A/C/T)(A/T)(C/T)GGTCC
C
r5’ lambda
5’-primer
(rbbk_)
TAAGTCAATTTCAATGGCCCAAC’CG
GCCATGGCTCAGCCTGTGCTGACTC
AGTCG
forward light chain
(SfiI)
r3’ lambda j
3’-primer
(rbfw_j)
r5’ heavy 3a
5’-primer (rh3a)
TATATATATAATTATGGCCTCCC’TG
GCCTTTAGTCTCCAGCTTGGTCTC
reverse light chain
(SfiI)
AATGAATAATGAAAACCAAGGAGTG
GGTTCTCAGTCG(C/G/T)TG(A/G)AGG
AGTCC(A/G)(A/G)G
forward heavy chain
(PflMI)
r5’ heavy 3b
AATGAATAATGAAAACCAAGGAGTG
5’-primer (rh3b) GGTTCTCAG(C/G)AGCAGCTGG(A/T)
GGAGTCCGG
forward heavy chain
(PflMI)
r3’ heavy 4
3’-primer (rh4)
reverse heavy chain
(PflMI)
TAAGTCAATTTCAATGGCCCAAC’CG forward light chain
GCCATGG(A/C)C(A/C)(C/T)(C/T)G(A/T (SfiI)
)(G/T)(A/C)TGACCCAGACTCC
AAGAAATGATAAAAACCACCAACTG
GCTGACTGA(C/T)GGAGCCTTAGGTT
GC
Table 3-1. Primer sequences for primary PCR. Primer sequences were used as
described in Li et al (44).
53
PCR Cycle 1
PCR Cycle 2
Rabbit Light
Chain Primers
kappa 1 primers
lambda primers
Rabbit Heavy
Chain Primers
Heavy 3a and 4
primers
Heavy 3b and 4
primers
Rabbit Light
Chain Primers
kappa 1 primers
lambda primers
Rabbit Heavy
Chain Primers
Heavy 3a and 4
primers
Heavy 3b and 4
primers
Temp.
Stage 1:
denaturation
Stage 2:
cycle 5X
Stage 3:
cycle 25X
Stage 4:
extension
Temperature Time
(min:sec)
95°C
2:00
53°C
Time
(min:sec)
2:00
Stage 1:
denaturation
0:30
Stage 2:
cycle 5X
0:30
72°C
0:45
94°C
0:30
55°C
95°C
94°C
94°C
0:30
55°C
0:30
72°C
0:45
94°C
0:30
0:30
57°C
0:30
72°C
0:45
72°C
0:45
72°C
10:00
72°C
10:00
Stage 3:
cycle 25X
Stage 4:
extension
Table 3-2. Primer combinations and PCR cycles for primary PCR.
54
Ligation #
Vector:Insert
Insert, ng
pSD3, ng
Other treatment(s)
1
1:3
12
40
2
1:6
12
20
3
~1:3.33
~1:1.67
1:6
~0.24
~0.24
12
~0.80
~0.40
20
ethanol precipitated;
diluted 1:100 prior to
transformation
ethanol precipitated;
diluted 1:100 prior to
transformation
1:50 dilution of #1
and #2
heat treated at 60°C
for 10 minutes prior
to addition of ligase;
ethanol precipitated;
diluted 1:100 prior to
transformation
4
Table 3-3. Ligation reaction conditions. Different ligation reaction conditions were
used in an attempt to achieve higher transformation efficiencies of the light chain
libraries. The Vector:Insert ratios were varied in ligations #1 and #2. In ligation #3 we
diluted the previous two ligations to decrease the amount of DNA being transformed (10
pg DNA per L). We finally tried the 1:6 ratio as in #1, but also pre-heat-treated the
vectors and inserts prior to addition of the ligase to get rid of any concatamers that might
have formed.
55
Transformation
Colonies on R1
BioAssay dish
Colonies on R1
BioAssay dish
1
Transformation
efficiency, CFU/g
DNA
1010
73
108
2
1010
0
38
3
1010
8
4
4
1010
0
0
Table 3-4. Transformation results. Transformations were performed as described in the
Methods sections using a high efficiency strain (DH10B) of electrocompetent E. coli
cells.
56
Figure 3-1. Rabbit serum titer, 29 days post-immunization. Plates were coated with
0.5 g/mL of human IgA. Serum samples were added (triplicates) to the wells and
serially diluted from a 1:500 dilution. Bound antibodies were detected with HRP-goat
anti-rabbit IgG (1:10,000 dilution). Signal was developed using TMB colorimetric
substrate (3 minutes at 25°C). Color signal was measured by spectrophotometry at 450
nm. Plotted data points represent the mean (n=3) ± S.D.
57
Figure 3-2. Rabbit serum titer, 137 days post-immunization. Plates were coated with
0.5 g/mL of human IgA. Serum samples were added (triplicates) to the wells and
serially diluted from a 1:500 dilution. Bound antibodies were detected with HRP-goat
anti-mouse IgG (H+L) (1:10,000 dilution). Signal was developed using TMB
colorimetric substrate (3 minutes at 25°C). Color signal was measured by
spectrophotometry at 450 nm. Plotted data points represent the mean (n=3) ± S.D.
58
Figure 3-3. Rabbit serum competitive ELISA, 137 days post-immunization. Plates
were coated with 0.5 g/mL of human IgA. Sera from the four rabbits, diluted in 1%
BSA/HBS, were added at the following dilutions: 1:39,133, 1:104,047, 1:79,452 and
1:57,464 (1 thru 4, respectively) to the wells. Soluble IgA was then added at 250 nM and
serially diluted down to 0 nM. Bound antibodies were detected with HRP-goat antimouse IgG (H+L) (1:20,000 dilution). Signal was developed using TMB colorimetric
substrate (5 minutes at 25°C). Color signal was measured by spectrophotometry at 450
nm. Plotted data points represent the mean (n=3) ± S.D.
59
Figure 3-4. Rabbit serum IC50s. Rabbit serum IC50s were derived from the previous
mouse serum competitive ELISA’s curve data. The curves were fit as described in the
Results section. The curves were evaluated at y = 50% and those values were plotted for
each rabbit. Each IC50 is a relative measure of the affinity of the antibody for the antigen,
and is inversely related to the affinity.
60
28S
16S
Figure 3-5. RNA purification products. The RNA purification products were resolved
on a 1.2% formaldehyde-agarose (FA) gel. Each well contained 9 L of RNA and 1 L
of Invitrogen BlueJuice 10X gel loading buffer. Samples were run for ~2 hours at 6 V/cm
in 1X FA gel running buffer. The 28S and 16S RNA bands are denoted to the right of the
gel. Each of the samples corresponds to a particular rabbit and preparation batch of RNA
(1A-1B = Rabbit 1; 2A-2D = Rabbit 2; 3A-3D = Rabbit 3 and 4A - 4B = Rabbit 4).
61
Figure 3-6. Vector preparation gel. The plasmid DNA from the vector preparations was
resolved on a 1% agarose electrophoresis gel. The first lane shows the vector prepped
from BL21 cells, the second from DH5 cells, the third from the same cells (DH5), but
an earlier preparation (which was used to transform the BL21 cells) and the last lane is a
High DNA mass ladder (5 L) from Invitrogen, with the 3 kb band noted (the band is
above the notation). The concentrations of the first two vector preparations are 165
g/mL and 76 g/mL, respectively.
62
Figure 3-7. SfiI-digested vector preparations. Vector samples were digested as
described in the Methods section. The samples were resolved on a 1.5% agarose
electrophoresis gel. Lane assignments were as follows: 1) Invitrogen 1 kb molecular
weight marker, 2) pSD3 from DH5 cells, 3) pSD3 from BL21 cells, 4) SfiI-digested
pSD3 from DH5 cells, 5) PflMI-digested pSD3 from DH5 cells, 6) gel-purified pSD3
from DH5 cells, 7) SfiI-digested pSD3 from BL21 cells (large reaction), 8) SfiI-digested
pSD3 from BL21 cells (small reaction) and 8) undigested, gel-purified pSD3 from BL21
cells. The samples from lanes 7 and 8 were pooled for the subsequent ligation steps.
63
Figure 3-8. SfiI-digested inserts. Light chain inserts were digested as described in the
Methods section. The samples were resolved on a 1.5% agarose electrophoresis gel. Lane
assignments were as follows: 1) Invitrogen 1 kb molecular weight marker, 2) Rabbit 1
undigested, gel-purified light chain DNA, 3) Rabbit 1 SfiI-digested, light chain DNA
(small reaction), 4) Rabbit 1 SfiI-digested, light chain DNA (large reaction), 5) Rabbit 2
undigested, gel-purified light chain DNA, 6) Rabbit 2 SfiI-digested, light chain DNA
(small reaction), 7) Rabbit 2 SfiI-digested, light chain DNA (large reaction), 8) Rabbit 3
undigested, gel-purified light chain DNA, 9) Rabbit 3 SfiI-digested, light chain DNA
(small reaction), 10) Rabbit 3 SfiI-digested, light chain DNA (large reaction), 11) Rabbit
4 undigested, gel-purified light chain DNA, 12) Rabbit 4 SfiI-digested, light chain DNA
(small reaction), 13) Rabbit 4 SfiI-digested, light chain DNA (large reaction). There is a
small yet visible shift in band size between the undigested and SfiI-digested samples for
each rabbit.
64
Chapter 4:
Construction, Directed Selection and
Molecular Characterization of Synergistic
Antibodies from a Hybridoma Library
65
Introduction
In assays that employ immunoreagents, it is often useful to have a high specificity
of recognition between the detection antibody and the target antigen, in addition to high
affinity. In order to determine of we could develop a selection strategy for antibody pairs
that had both a high affinity and specificity, we chose to apply our strategy to a mouse
“monoclonal library” directed towards immunoglobulin A. Antibody synergism with high
affinity antibodies can both increase the affinity and specificity of the detection system,
thus we chose to look for synergistic antibodies to human IgA.
Immunoglobulin A was chosen for these studies for two reasons. The secondary
structure of the protein is predominantly beta-pleated sheet, and the majority of proteins
for which synergistic antibodies have been previously identified have been composed of
primarily alpha-helical structure. This is also the first report of a selection strategy that
was directed as opposed to the serendipitous discovery of antibody synergy. The studies
described herein were initiated to determine if the phenomena of synergism in antibody
binding was a general one that could be extended to any kind of protein.
Previously identified synergistic antibodies have been found by surveying large
populations of pre-existing monoclonal or scFv phage antibodies. Mixtures of synergistic
antibodies to tetanus toxin have been found to increase toxin neutralization by
approximately 200-fold, as compared to the individual monoclonals alone (11).
Synergistic antibodies to hCG have also been identified and their synergy can be
increased when the target is immobilized on a flexible substrate such as Protein G or
polyclonal serum to Fc (12). Zwick et al found a weak synergistic effect of combinations
of antibodies on HIV-1 isolates, but these did not increase the neutralization titers by
66
more than 10-fold in antibody combinations (13). Synergistic antibodies to botulinum
neurotoxin have also been found to result in 90-times greater neutralization potency than
human hyperimmune globulin. This increase in botulinum toxin neutralization was due to
a large increase in functional antibody binding affinity when the oligoclonals were used
as opposed to the individual monoclonals alone (10).
In the studies described herein, we immunized BABLB/c mice with human IgA
and made hybridomas from their splenocytes. This study will detail the selection strategy
subsequently developed to identify potential synergistic pairs from these clones.
Molecular interactions between these antibodies and their antigen will also be described.
By measuring the binding constants, we were able to determine the degree to which the
interactions were affected; therefore we could specifically assess the efficacy of this
method of selection for the identification of such synergistic antibody pairs.
Our goal was based on the hypothesis that synergistic antibodies are an inherent
part of the polyclonal antibody population produced during the immune response to an
antigen and that they can be selected from this population. As this study will demonstrate,
the antibody combinations isolated using this strategy displayed higher affinity for their
target antigen than did the individual antibodies that did not bind synergistically.
67
Materials and Methods
Materials
Mice were obtained from Charles River Laboratories, (Wilmington, MA). Human
IgA, the peroxidase-conjugated goat anti-species antibody to mouse IgG (H+L) and the
Cy5-labeled goat anti-mouse IgG (Fc specific) were purchased from Jackson
ImmunoResearch Labs (West Grove, PA). The Ribi Adjuvant System and TiterMax Gold
were purchased from Sigma-Aldrich (St. Louis, MO). The ClonaCell™ - HY Hybridoma
Cloning kit was obtained from StemCell Technologies (Vancouver, BC) and the SP2/0
myeloma cells came from American Type Culture Collection (Manassas, VA). Cell
culture freezing media was obtained from Invitrogen (Carlsbad, CA). TMB substrate was
purchased from KPL (Gaithersburg, MD). The PD-10 desalting columns were purchased
from Amersham via GE Healthcare (Piscataway, NJ); the Melon Gel purification system
and the Handee centrifuge tubes were obtained from Pierce Biotechnology (Rockford,
IL). The YM-30 centrifuge concentration columns were purchased from Millipore
(Billerica, MA).
Mouse Immunizations and Spleen Harvest
Six 4-5 week old male BALB/c mice were immunized with purified human IgA.
All immunogens were emulsified in either the MPL + TDM Ribi adjuvant system or
TiterMax Gold and administered intraperitoneally at 3-week intervals. A pre-immune
blood sample was taken prior to the first immunization, and then the mice were injected
with 60 g of IgA emulsified with an equal volume of TiterMax Gold. Two subsequent
68
injections were performed at days 17 and 23 (3 mice on each of those days) and then day
39 with 60 g and 50 g IgA, respectively, emulsified in TiterMax Gold. All subsequent
injections (days 60, 81 and 98) were performed with IgA (50 g, 50 g, 50 g,
respectively) emulsified in Ribi adjuvant system. Test bleeds were performed on days 73,
91, 107 and the animals were sacrificed on day 126, following a final IV tail vein boost
(for mice 3 and 4) on day 123 with 100 g of IgA in saline. The spleens from mice 3 and
4 were placed on ice until the fusion and the spleens from the rest of the immunized
animals were placed in RNAlater solution (1 mg of spleen to 10 L of solution), stored
overnight at 4°C and then stored at -20°C in the solution until RNA purification.
Mouse Serum Titers
Mouse serum titers were checked after each test bleed by indirect ELISA as
described in Chapter 3. Microwells were coated with 5 g/mL of human IgA, at 37°C for
1 hour. Non-specific binding sites were blocked with 3% BSA in HBS, and then the
serum samples were serially diluted directly into the microwells. Following a 1 hour
incubation period, the bound antibodies were incubated with a peroxidase-conjugated
goat anti-mouse antibody (H+L) (1:15,000 dilution) at RT for 1 hour. Color signal was
developed by adding TMB peroxidase substrate for 3 minutes and stopping the reaction
with 1 N HCl. The plates were read in a spectrophotometer and the signal data was
plotted as a function of serum dilution.
69
Hybridoma Fusion and Cell Culture
Splenocytes were fused according to the manufacturer’s protocol. Briefly,
parental myeloma cells were cultured prior to the fusion at approximately 95% viability
(recommended by the manufacturer) and a final cell suspension was prepared that
contained at least 2 x 107 cells. The splenocytes (from mice 3 and 4) were desegregated
into a single cell suspension and counted. Spleen cells (1 x 108) were fused with 2 x 107
myeloma cells and allowed to incubate overnight at 37°C in a 5% CO2 incubator. The
following day the cells were transferred to a semi-solid media and plated in sterile Petri
dishes (approximately 9.5 mL cell suspension per plate). Ten days later the plates were
examined for visible colonies, and these colonies were isolated by picking them into
individual wells of a 96-well tissue culture plate. The plates 96-well plates containing
hybridomas were incubated at 37°C in 5% CO2 until the medium in the wells began to
turn yellow. Once the media in a particular well had turned yellow, the supernatant was
assayed by indirect ELISA and either expanded (+ result) or discarded (- result).
Hybridoma Screening
When a particular clone’s supernatant was found to be active in the ELISA, that
clone was expanded to a larger well (i.e. from a 96 well to 48 well plate) and incubated at
37°C with 5% CO2. Once the cultures had been expanded to at least 2 x 106 cells, the
cells were counted and frozen in cell culture storage media. Of the original 1056 colonies
picked, 3.5% (36 of 1056) were antibody producers to human IgA. We selected eight
final clones from which to purify proteins for further studies.
70
The hybridomas that were selected in the first round of screening were maintained
in culture to select the clones that were making antibodies with the highest binding
capabilities for IgA. Those clones were subjected to a second round of indirect ELISAs
and the clones (12) whose supernatants provided the highest signals in those experiments
were selected for protein purification and further study.
Protein Purification
Proteins were initially separated from low molecular weight components in the
culture medium using the PD-10 desalting columns. These columns were equilibrated
with Melon Gel buffer (see below), and then supernatant solutions were applied. Small
molecules (< 10 kDa) were retained in the column and the protein fraction was eluted in 6
mL of buffer. Those samples were immediately used in a subsequent purification step.
The sample was mixed with the Melon Gel purification resin (proprietary materials) and
centrifuged to release the IgG; the other contaminating proteins were retained by the
resin. Following the purification step, the protein samples were concentrated and bufferexchanged in a YM-30 molecular weight cutoff centrifuge column. The final protein
samples were stored in HBS; the concentrations were measured via spectrophotometry at
280 nm, and the amount of IgG in each sample was calculated using a molar extinction
coefficient of 1 A280 = 1.4 mg/mL IgG (46).
The purified proteins were checked for activity by indirect ELISA, and from those
experiments, near-saturating concentrations were determined for each protein to be used
in the following additivity assay.
71
Additivity Assay
The additivity assay was performed with the purified supernatants as described by
Friguet et al (18). This assay was used to identify antibodies that recognized distinct
epitopes on the antigen, much like the epitope-blocking assay described in the
Introduction. Binding to distinct (non-overlapping) epitopes on the antigen is a
requirement for synergistic activity; therefore, identification of those antibodies that
recognized different epitopes was an pre-requisite for subsequent experiments. Each of
the eight antibodies selected was added to the wells in one row and one column of a 96well plate (at the concentrations determined from the previous ELISA experiment) to
form a checkerboard assay as shown in Figure 4-1. The subsequent steps of the assay
were performed as for the regular indirect ELISA described above, and then calculations
were performed to determine binding additivity for each combination of antibodies. The
antibodies that showed the highest additivity were selected for the kinetic binding studies.
Determination of Individual Equilibrium Dissociation Constants
Equilibrium constants were determined using the KinExA 3000™. Azlactone
beads (50 mg) were coated with 0.1 mg/mL of purified human IgA diluted into 1.0 mL of
50 mM sodium carbonate buffer (pH 9.0). The beads were gently agitated overnight at
4°C, centrifuged, and the supernatant solutions were removed. Non-specific binding sites
on the beads were blocked by incubation in 1 M Tris (pH 8.5, 10 mg/mL BSA) for 1 hr at
25°C.
The coated, blocked beads were automatically packed into the observation cell of
the KinExA 3000 as previously described (31). Each bead pack consisted of a 4 mm
72
column of Azlactone beads with human IgA immobilized on the surface. Varying
concentrations of soluble IgA were mixed with either 14A7 or 5F5 and the solutions were
allowed to come to equilibrium (10 minutes and 1 hour at 25°C, respectively). The
solutions were passed over the coated beads at a flow rate of 0.25 mL/min. Upon
reaching the column, primary antibody (14A7 or 5F5) with no soluble IgA in its binding
site was able to bind to the immobilized antigen on the beads, and the fraction of primary
antibody was not bound by the antigen was washed away by a subsequent HBS wash
step. Bound primary antibody was detected when 1 mL of fluorescently-labeled
secondary antibody solutions (1:2,000 dilution in HBS) was flowed over the bead column
(500 L/min), followed by a wash with HBS (500 L/min).
Determination of Synergistic Equilibrium Dissociation Constants
The synergy experiment with both antibodies was conducted much the same as
that for the individual antibodies; however, in these experiments we pre-equilibrated 5F5
with human IgA and used the complex as the ligand to for 14A7.
Azlactone beads were coated with 100 g/mL of human IgA. 5F5 (5, 15 and 45
nM) was mixed with IgA (20, 60, 180 nM), respectively, and allowed to come to
equilibrium, then 14A7 (10 nM) was added to the equilibrated solutions. The solutions
were passed over the coated beads at a flow rate of 0.25 mL/min. Upon reaching the
column, primary antibody (14A7) with no soluble 5F5-IgA complex in its binding site
was able to bind to the immobilized antigen on the beads, and the fraction of primary
antibody that was not bound by the antigen was washed away by a subsequent HBS wash
step. Bound primary antibody was detected when 1 mL of fluorescently-labeled
73
secondary antibody solution (1:2,000 dilution) was flowed over the bead column (500
L/min), followed by a wash with HBS (500 L/min).
Data was analyzed as previously described (Blake, 1999) and the equilibrium
dissociation constants were determined as described in the Results section.
Results
Mouse Serum Titers
Following test bleed #1 (73 days after the first immunization) the serum was
assayed for binding activity with immobilized human IgA. The pre-immune serum was
also assayed at this time to ensure that we had achieved a specific response to the
immunogen. The pre-immune serum showed no activity in the assay (data not shown),
while the serum antibodies from all six mice showed binding activity to human IgA in the
indirect ELISA (Figure 4-2). Following a test bleed 107 days after the first immunization
the serum samples were assayed again by indirect ELISA and the results of these serum
titers are shown in Figure 4-3. These data were plotted as percent of maximum signal
versus 1/serum dilution and fit using the following equation:
y = a3+(a0-a3)/(1+(x/a2)a1)
(eq. 4-1)
where x = antibody concentration (1/serum dilution), a0 = minimum data point, a1 =
antibody-dependent change in fluorescence, a2 = x value which results in 50% of
maximum signal (EC50) and a3 = maximum data point. In order to compare the immune
response to the antigen over time, the curves were then evaluated at y = 50%. Based on
these evaluations (EC50), the serum from all six mice became more reactive with the
74
immobilized IgA as the immunization progressed from 73- 107 days (data not shown).
The curve (for the final test bleed) was also evaluated (prior to transformation to percent
of maximum signal) at y = 1 for each of the serum samples and that concentration of
serum (1/dilution factor) was used in the competitive ELISAs that followed.
Mouse Serum Competitive ELISAs
Competitive ELISA on the serum samples collected 107 days post immunization
was performed as described in the Methods section to determine which of the serum
antibodies from the mice were showing the highest affinity for human IgA.
Concentrations of serum used in the competitive ELISA were determined in the previous
indirect ELISAs. The absorbance data was transformed to percent of maximum signal
and plotted as a function of soluble IgA concentration (Figure 4-4). The data was fit using
the following equation:
y=a0-((a0-a1)*(x/(a2+x)))
(eq. 4-2)
where x = concentration of soluble IgA (competitive inhibitor), a0 = minimum y data
point, a1 = maximum y data point and a2 = x-value at which the signal is inhibited by
50% (IC50). The resulting curve was evaluated at y = 50% to obtain an IC50 for each
serum sample. The IC50 is the concentration of IgA at which 50% of the antibody binding
sites are occupied. The serum IC50s for each animal are shown in Figure 4-5.
We chose the two mice (3 and 4) with the lowest IC50s for the fusion, since that is
an indirect measure of affinity for the antigen. The IC50s for each animal were as follows:
M1 = 37.36 nM, M2 = 33.87 nM, M3 = 11.66 nM, M4 = 16.52 nM, M5 = 77.22 nM and
M6 = 42.84 nM.
75
Selected Hybridomas
A total of 1056 colonies were selected from the semi-solid growth medium for
culture in 96-well plates. An initial screen of these colonies yielded 36 (3.5%) that were
selected for further analysis. The following criteria were used in the selection of those 36
clones: a) absorbance readings over 0.3 during the initial screen, b) the ability to survive
culture expansion and c) the ability to demonstrate consistent binding ability in the
ELISAs. During continued cell culture after freezing, ~2/3 of the originally preserved
clones failed to bind to IgA (i.e., to yield an Absorbance >0.3 in the indirect ELISA).
Those 24 clones were not studied further. We suspect that the loss of this many originally
selected clones was due to the less stringent criteria for selection used at the beginning of
the selection process. As the selection process neared the end we became more stringent
with our requirements for a “good” clone (i.e., consistent Absorbencies above 0.3), thus
many (2/3) were eliminated from the pool when they failed to meet the higher selection
criteria.
The 12 clones shown in Figure 4-6 were chosen for further study. The activity of
each secreted antibody was measured again after purification of IgG from the
supernatant; the final eight antibodies were selected based on binding activity of the
purified IgG in ELISA.
Once these eight antibodies had been selected and purified, they were subjected to
activity assays to determine the near-saturation point on each antibody’s binding curve.
The results of the activity assays are shown in Figure 4-7. These data was transformed to
percent of maximum binding signal and plotted as a function of antibody concentration
using the following equation:
76
y = a3+(a0-a3)/(1+(x/a2)a1)
(eq. 4-1)
where x = antibody concentration, a0 = minimum data point, a1 = antibody-dependent
change in fluorescence, a2 = x value which results in 50% of maximum signal (EC50) and
a3 = maximum data point. The curve was then evaluated at y = 0.95-0.99 for each of the
purified IgG samples and that concentration of purified IgG was used in the additivity
assay that followed.
Additivity Assay
The additivity assay (18) mentioned earlier in the Introduction appeared to be a
valid method for identifying the degree to which these combinations of 8 antibodies (28
combinations) bound to distinct, non-overlapping epitopes. As a pre-requisite for
antibody synergism, we used this assay as a “pre-screen” for possibly synergistic pairs of
antibodies.
The additivity assay was performed as previously described by Friguet, et al (18).
The assay was set up in a checkerboard style ELISA as depicted in Figure 4-1. Each
antibody was assayed alone, and in a paired combination with all the other antibodies in
the group. The total number of combinations was 28 and there were 8 individual
measurements of activity in the screen as a result of the checkerboard design. The data
was analyzed using the following equation to calculate additivity:
A.I. = [A1+2 – ((A1 + A2)/2)]/[A1 + A2 – ((A1 + A2)/2)] x 100
A.I. = [((2A1+2)/(A1 + A2))-1] x 100
(eq. 4-3)
77
where A.I. is the additivity index (between 1 and 100) A1+2 = the signal with both
antibodies in combination, A1 = the signal with antibody 1 alone and A2 = the signal with
antibody 2 alone.
The additivity index (A.I.) was plotted versus each combination of antibodies, and
those results are shown in Figure 4-8. These results were sorted in ascending order, and
then we set a cut-off value at 30% to identify the combinations that showed higher
additivity. The combinations 2C10 + 14A7, 2C10 + 1A8, 2C10 + 5C11, 5F5 +14A7,
2C10 + 3D4, 1A8 + 14A7, 5C11 + 14A7, and 3D4 +14A7 are all above the cut-off value
of 30%. Based on these results, we chose the pair 14A7 and 5F5. In future work we
would like to investigate the interactions with the other following combinations that
showed additivity.
Selected Antibodies
All of the purified antibodies, except for 14A7, showed normal exponential
binding curves in the indirect ELISA performed following protein purification. 14A7,
however, showed almost a linear curve, reaching saturation at a much lower
concentration of antibody as shown in Figure 4-9. 14A7’s curve was the only one that
had to be evaluated at 95% as opposed to 99%, since it never reached the absorbance
levels that the other seven antibodies did. There are two scenarios that can explain what
we observed in these curves. 5F5 has either a very high affinity for IgA or a highly
accessible epitope. The reverse is true for the 14A7 curve (low affinity for IgA or hidden
epitope). In order to determine which was true, we measured the affinities of each of the
individual antibodies in solution as described.
78
Determination of Individual Equilibrium Dissociation Constants
The KinExA 3000TM was used to elucidate the strength of the binding interactions
between antibodies 5F5 and 14A7 and their target antigen, human IgA. Data was
acquired using a computer interfaced to the KinExA 3000 and software provided by
Sapidyne Instruments, Inc. Fluorescence was recorded each second immediately after the
bead pack routine was finalized (just prior to the mouse antibody-human IgA solution
flow step). Data was imported into Microsoft Excel and SlideWrite and analyzed using
linear and non-linear regression curves (31) executed by those programs.
The primary data (not shown; see Figures 2-2A and 2-2B of this thesis for an
example) was used to determine the difference in fluorescence at the beginning and end
of each experiment (delta signal). These deltas was subsequently plotted versus ligand
concentration to show how the number of available antibody binding sites decreased in
response to an increase in the concentration of free ligand (Figures 4-10 and 4-11). At
any concentration of ligand x, the dependence of the delta fluorescence on ligand
concentration can be defined as:
yA = a0-(a1*x)/a2+x)
(eq. 4-4)
where yA = delta signal at a particular concentration of ligand, a0 = fluorescence at an
infinite concentration of ligand x, a1 = magnitude of change (maximum – minimum data
points), x = the concentration of IgA, and a2 = [ligand] at 50% inhibition or the apparent
KD.
79
The curve defined by equation 4-2, above, was then normalized by subtracting the
delta fluorescence (yA in equation 4-2) from the “maximum fluorescence” (a0 from
equation 4-2) and dividing by the magnitude of change in signal (a1 from equation 4-2)
as shown in the following equation:
yB = (a0-yA)/a1
(eq. 4-5)
where yB = fraction of occupied binding sites (ranging from 0-1).
The normalized data was then plotted as a function of ligand concentration to
reveal how the fraction of occupied binding sites increased as the ligand concentration
increased. This data was fit using the following equation:
yB = (a0*x)/(a1+x)
(eq. 4-6)
where yB = fraction of occupied binding sites, a1 is the apparent Kd (32). Using this
method, the Kd for antibody 5F5 was determined to be 0.17 nM. As predicted from the
ELISA data, 14A7 bound to IgA with a much lower affinity; the calculated Kd was 555
nM.
Determination of Synergistic Equilibrium Dissociation Constants
In order to measure the synergistic binding reactions, we used similar methods to
those described above, but we treated the 5F5-human IgA complex as the antigen. These
experiments were constrained by the equilibrium dissociation constants determined for
the two antibodies under study (0.17 and 555 nM for 5F5 and 14A7, respectively) and by
the stability of the 14A7 protein.
Because 5F5 has such a high affinity for the antigen, it required approximately 1
hour for the 5F5-complex to come to equilibrium at 25°C in solution. Antibody 14A7
80
bound with much lower affinity, but degraded in solution over time. We avoided these
problems by pre-incubating 5F5 and IgA for 1 hour before adding 14A7, approximately
10 minutes before the start of the KinExA experiment. We also took advantage of the
>3000-fold difference in the affinity of 5F5 and 14A7 for IgA to chose concentrations of
IgA that would completely saturate the binding sites of the 5F5 antibody while having a
negligible effect on the binding of 14A7. We could then assume that the delta signal we
observed in these synergy experiments was due solely to interaction of the 5F5-IgA
complex with the 14A7 antibody, since the concentrations of free IgA in these
equilibrium binding mixtures were too low to have significant effects on 14A7 binding.
We measured binding signals for 5F5 binding independently to human IgA as
well as for 14A7 binding independently to human IgA. We then took these values and
added them together to get the expected “additive” signal for these two antibodies
binding in combination to IgA.
We knew that when we did the experiment in
combination, if we saw an actual signal less than the expected additive signal, we would
be observing a synergism in the combination of antibodies binding to IgA the antigen.
The results of this experiment are shown in Figure 4-12.
We subtracted the actual delta signal for the antibodies binding in combination
from the calculated or additive signal and plotted that as a function of ligand (in this case,
5F5-IgA complex) and used the following equation:
yA = a0*x/(a1+x)
(eq. 4-6)
where yA = the difference between the expected and actual delta signals, a0 = the
difference between the expected and actual delta signals at an infinite concentration of
ligand concentration (x) and a1 = the apparent Kd.
81
The data was transformed to fraction of occupied binding sites (ranging from 0-1)
by subtracting yA from a0 (from equation 4-5) and plotting that versus ligand
concentration. That data was curve-fit using equation 4-5, and the Kd (70 nM) was taken
from that curve.
82
Discussion
In this set of experiments, we constructed a monoclonal antibody “library” from
the splenocytes of immunized mice. After multiple rounds of selection, we narrowed our
pool of antibodies from 1056 to 8 (<1%) that bound with a relatively high affinity for
IgA. By screening for those antibodies that bound to distinct epitopes on the antigen, we
set ourselves up for identifying combinations of antibodies that bound synergistically to
IgA.
Once we had identified a number of antibodies that appeared to be binding to nonoverlapping epitopes on IgA we chose a pair to investigate further with solution binding
experiments. 5F5 and 14A7 proved to bind synergistically to IgA in these experiments.
We have verified that our selection strategy worked, and that we were able to
quantitatively measure the synergistic interaction between 14A7 and the 5F5-IgA
complex. The equilibrium binding experiments described herein demonstrate that 14A7
binds 8-fold more tightly to the 5F5-IgA than it does to IgA alone.
If the low to high affinity change is actually taking place in the natural polyclonal
antibody population, what then is the molecular mechanism for such an interaction? This
stands out as the most logical next step in elucidating all of the aspects of this
phenomenon. We hypothesize that there is a conformational change that takes place in
the antigen when the first antibody binds (5F5) that reveals an epitope that the second
antibody (14A7) binds to with higher affinity than it would have had 5F5 not already
bound the antigen. Obviously, for this to be proven one must be able to measure a
conformational change in the protein of interest. This would be a good the next step in
this project to elucidate the mechanism of synergism.
83
Practical applications of this technology are in the construction of sandwich
immunoassays. It is always useful to have a high-specificity and high affinity antibodies
as primary detectors for the target antigen, and this selection strategy provides for both of
those criteria. By requiring the antigen to be bound by two antibodies as opposed to one,
the specificity has increased, and the affinity has also been increased because of the
synergy between the two antibodies.
One example of a practical application specific to our research program is the use
of IgA as a marker of fecal coliform contamination in environmental water sources. As
the primary immunoglobulin found in epithelial tissue, it is shed by the lining of the gut
and secreted in human waste. Levels of IgA have been correlated with coliform
contamination levels in environmental water sources (9). In order to construct an
immunoassay for the detection of IgA in water sources, the affinity and specificity of the
detection antibodies must be very high due to the (likely) low concentration of IgA in the
sample and the multitude of contaminants, respectively. The strategy described in this
thesis could be applied to designing a system for detection of any low concentration
antigen found in highly contaminated solutions.
84
1A8 1G4 2C10 3D4 5C11 5F5 10D4 14A7 1A8
1A8
1A8
1A8
1G4
1A8
2C10
1A8
3D4
1A8
5C11
1A8
5F5
1A8
10D4
1A8
14A7
1G4
2C10
3D4
5C11
5F5
10D4
14A7
1A8
1G4
1A8
2C10
1A8
3D4
1A8
5C11
1A8
5F5
1A8
10D4
1A8
14A7
1G4
1G4
2C10
1G4
1G4
3D4
1G4
5C11
1G4
5F5
1G4
10D4
1G4
14A7
1G4
2C10
2C10
2C10
2C10
3D4
2C10
5C11
2C10
5F5
2C10
10D4
2C10
14A7
1G4
3D4
2C10
3D4
3D4
3D4
3D4
5C11
3D4
5F5
3D4
10D4
3D4
14A7
1G4
5C11
2C10
5C11
3D4
5C11
5C11
5C11
5C11
5F5
5C11
10D4
5C11
14A7
1G4
5F5
2C10
5F5
3D4
5F5
5C11
5F5
5F5
5F5
5F5
10D4
5F5
14A7
1G4
10D4
2C10
10D4
3D4
10D4
5C11
10D4
5F5
10D4
10D4
10D4
10D4
14A7
1G4
14A7
2C10
14A7
3D4
14A7
5C11
14A7
5F5
14A7
10D4
14A7
14A7
14A7
Figure 4-1. Checkerboard additivity screen set up. The additivity assay was set up as
shown in the figure above. Wells were coated with 5 g/mL of IgA, and each of the eight
antibodies was added to one entire column and row. Bound antibodies were detected with
HRP-conjugated goat anti mouse IgG (1:50,000 dilution) incubated for one hour at 25°C.
The color signals were developed with TMB peroxidase for 5 minutes at 25°C substrate
as previously described.
85
Figure 4-2. Mouse serum titer, 73 days post-immunization. Plates were coated with
0.5 g/mL of human IgA. Serum samples were added (triplicates) to the wells and
serially diluted from a 1:100 dilution. Bound antibodies were detected with HRP-goat
anti-mouse IgG (1:2,500 dilution). Signal was developed using TMB colorimetric
substrate (2 minutes at 25°C). Color signal was measured by spectrophotometry at 450
nm. Plotted data points represent the mean (n=3) ± S.D.
86
Figure 4-3. Mouse serum titer, 107 days post-immunization. Plates were coated with
0.5 g/mL of human IgA. Serum samples were added (triplicates) to the wells and
serially diluted from a 1:100 dilution. Bound antibodies were detected with HRP-goat
anti-mouse IgG (1:2,500 dilution). Signal was developed using TMB colorimetric
substrate (2 minutes at 25°C). Color signal was measured by spectrophotometry at 450
nm. Plotted data points represent the mean (n=3) ± S.D.
87
Figure 4-4. Mouse serum competitive ELISA, 107 days post-immunization. Plates
were coated with 0.5 g/mL of human IgA. Serum samples were added (triplicates) to the
wells at the following dilutions: Mice 1-4 = 1:3,000, Mouse 5 = 1:1,000 and Mouse 6 =
1:2,000. Varying concentrations of human IgA ((1 M – 2.5 nM) were diluted into the
serum samples. Bound antibodies were detected with HRP-goat anti-mouse IgG
(1:10,000 dilution). Signal was developed using TMB colorimetric substrate (3 minutes
at 25°C). Color signal was measured by spectrophotometry at 450 nm and plotted as
percent of maximum signal. Plotted data points represent the mean (n=3) ± S.D.
88
Figure 4-5. Mouse serum IC50s. Mouse serum IC50s were derived from the previous
mouse serum competitive ELISA’s curve data. The curves were fit as described in the
Results section. The curves were evaluated at y = 50% and those values were plotted for
each mouse. Each IC50 is a relative measure of the affinity of the antibody for the antigen,
and is inversely related to the affinity.
89
Figure 4-6. Secondary ELISA screen of hybridoma supernatants. Plates were coated
with human IgA (5 g/mL) and incubated for 1 hour at 37°C. Supernatants collected
(cells were grown in complete D-MEM/10% FBS) were diluted 1:10 in 0.1% BSA/HBS
and added to the wells to incubate for 1 hour at 25°C. (Negative controls were diluent HBS/BSA - and purified media; positive control was polyclonal serum from the two mice
whose spleens were used in the fusion – M3/4.) Bound antibodies were detected using
HRP-conjugated goat anti-mouse IgG (1:10,000 dilution). Color signal was developed
with TMB substrate as described above for 5 minutes at 25°C. Plotted data points
represent the mean (n=3) ± S.D.
90
Figure 4-7. Activity assay with selected antibodies. Plates were coated with of human
IgA (5 g/mL). Antibodies (purified IgG) were serially diluted in 1% BSA/HBS (from
250 nM) into the wells at the concentrations shown in the graph and allowed to bind for 1
hour at 25°C. Bound antibodies were detected with HRP-conjugated goat anti-mouse IgG
(1:10,000 dilution). Color signal was developed as described in Methods with TMB HRP
substrate for 5 minutes at 25°C. Plotted data points represent the mean (n=3) ± S.D.
91
Figure 4-8. Additivity screen of monoclonal antibodies. Plates were coated with
human IgA (5 g/mL). Each antibody (25 L) was added to its particular well and
column at the pre-determined concentration (250 nM). A second antibody was then added
(25 L) to the same well (see checkerboard assay in Figure 4-1 of this thesis) and they
were allowed to incubate for 1 hour at 25°C. Bound antibodies were detected with HRPconjugated goat anti-mouse IgG (1:50,000 dilution). Color signal was developed as
described previously using TMB peroxidase substrate for 5 minutes at 25°C. The
antibodies were given numbers in the assay for the sake of clarity, but the names of each
of the eight antibodies as follows: 1 = 1A8, 2 = 1G4, 3 = 2C10, 4 = 3D4, 5 = 5C11, 6 =
5F5, 7 = 10D4, 8 = 14A7. Plotted data points represent the average of duplicate
measurements.
92
Figure 4-9. 5F5 and 14A7 activity assay curves. Plates were coated with 5 g/mL of
human IgA. Antibodies (purified IgG) were serially diluted in 1% BSA/HBS (from 250
nM) into the wells at the concentrations shown in the graph and allowed to bind for 1
hour at 25°C. Bound antibodies were detected with HRP-conjugated goat anti-mouse IgG
(1:10,000 dilution). Color signal was developed as described in Methods with TMB HRP
substrate for 5 minutes at 25°C. Values plotted represent mean ± S.D. (n=3).
93
Figure 4-10. Equilibrium dissociation constant for 5F5 binding to human IgA alone.
Azlactone beads were coated with 100 g/mL of human IgA. 5F5 (1.25 nM) was mixed
with varying concentrations of IgA and allowed to come to equilibrium. These solutions
were flowed over the bead column to allow antibody molecules with unoccupied binding
sites to bind to the immobilized ligand. Bound 5F5 was detected using a fluorescently
labeled anti-species secondary antibody at a 1:8,000 dilution of stock. Data was analyzed
as previously described (31) and the equilibrium dissociation constant was determined as
described in the Results section.
94
Figure 4-11. Equilibrium dissociation constant for 14A7 binding to human IgA
alone. Azlactone beads were coated with 100 g/mL of human IgA. 14A7 (10 nM) was
mixed with varying concentrations of IgA and allowed to come to equilibrium. These
solutions were flowed over the bead column to allow antibody molecules with
unoccupied binding sites to bind to the immobilized ligand. Bound 14A7 was detected
using a fluorescently labeled anti-species secondary antibody at a 1:2,000 dilution of
stock. Data was analyzed as previously described (Blake, 1999) and the equilibrium
dissociation constant was determined as described in the Results section.
95
Figure 4-12. Equilibrium dissociation constant for 14A7 binding to 5F5-human IgA
complex. Azlactone beads were coated with 100 g/mL of human IgA. 5F5 (5, 15 and 45
nM) was mixed with IgA (20, 60, 180 nM), respectively, and allowed to come to
equilibrium. 14A7 (10 nM) was added to the equilibrated solutions, and these solutions
were flowed over the bead column to allow 14A7 antibody molecules with unoccupied
binding sites to bind to the immobilized ligand. Bound 14A7 was detected using a
fluorescently labeled anti-species secondary antibody at a 1:2,000 dilution of stock. Data
was analyzed as previously described (Blake, 1999) and the equilibrium dissociation
constant was determined as described in the Results section.
96
Chapter 5:
Discussion of Thesis Work
97
In the body, antibodies are initially produced by B cells, which display them on
the surface of their membrane. The primary sources of B cells are the spleen, the lymph
nodes and the mucosa-associated lymphoid tissues (MALT). Upon antigen binding, that
B-cell undergoes proliferation and maturation to become either an antibody-secreting
plasma cell or a memory B cell. The plasma cells are the antibody producers that account
for the high concentration of antibodies in serum.
In the studies described herein, we have demonstrated that we can drive a
selection strategy to isolate antibodies with particular desirable characteristics, in our
case, binding synergism. We have also shown that these synergistic pairs are a part of the
natural polyclonal population, as they were selected from a “monoclonal library” as
opposed to a synthetic, phage-displayed library.
One of our antibodies, 14A7, showed low affinity (555 nM) when binding
independently to the antigen. A second antibody, 5F5, showed high affinity (170 pM)
when binding to the same antigen. When we bound them in combination, we saw a shift
in 14A7’s affinity for IgA 70 nM, a nearly 8-fold increase. While the increase is not as
dramatic as some have reported in other studies (10), it is still enough of an increase to
demonstrate that a) these antibodies were a part of a large polyclonal population of
antibodies in immunized mice; b) they are binding to human IgA with synergy; and c)
that our selection strategy was effective in identifying synergistic antibody pairs. As has
been shown in other experimental systems (10) additional synergy in binding may be
observed when we bind additional antibodies to the IgA molecule. While such
experiments are beyond the scope of this thesis project, they will be pursued by other
members of the Blake laboratory.
98
The difference in affinity between the two antibodies we studied begs the
question: why would the body keep low affinity antibodies (14A7) in the affinity-matured
population, when such higher affinity antibodies are available (5F5)?
If we take in account the process of affinity maturation, each time a B-cell comes
into contact with the antigen it is recognized by the previously selected cell-surface
antibodies. In vitro, we normally determine the strength of an interaction by studying a
single antibody’s binding with its antigen. As demonstrated in this and other studies,
there are significant differences in antibody affinities within a given antibody population.
We have shown in this in vitro study, however, that some antibodies are capable of
binding more tightly with their antigen when another antibody is already bound, and it is
quite likely that this phenomenon is also occurring (and probably more efficiently) in
vivo.
It is quite possible that this mechanism of synergistic antibodies is a natural way
of preserving “low-affinity” antibodies in the polyclonal population. While these
antibodies appear to be low affinity to researchers that are looking at them binding
individually to an antigen, they are probably binding in combinations in vivo, therefore
they are “higher affinity” in vivo. While it is counter-intuitive to think that low affinity
antibodies would be preserved, the work described in Chapter 4 demonstrates that they
are actually a part of the polyclonal population and can bind with higher affinity when
combined with another antibody.
If we can explain how the antibodies are preserved, can we explain why they are
preserved? As seen in the Nowakowski paper (10), the combinations of antibodies that
were used to neutralize botulinum neurotoxin were much more effective than single
99
antibodies alone or even than hyperimmune globulin. Considering the other reports of
antibody synergy as well, it is reasonable to suggest that this phenomenon is one of the
body’s mechanisms of defense against pathogenic antigens.
Another possible scenario is that these lower affinity antibodies are propagated to
recognize particular conformations of a particular antigen. The complex to which the low
affinity antibody binds might not necessarily be an antibody-antigen complex, but it
could be another protein-protein complex that is in an intermediate conformational state.
This conformational state might only be recognized by the combination of the first
protein in the complex and the low affinity antibody, which recognizes the complex with
higher affinity once it is in that intermediate conformational and complexed state.
The aforementioned theories are both plausible explanations for why these lower
affinity antibodies are maintained in the natural polyclonal antibody population. It will be
interesting to see if the work described herein and the planned continuation of the work
with the other additive antibodies leads to further investigation of this phenomenon and
elucidation of the mechanisms by which these antibodies are maintained.
100
List of References
1. Burton, D and Woof, JM. 1992. Human Antibody Effector Function. Advances in
Immunology 51:1-84.
2. Bryan, D.-L., Hart, P.H., Forsyth, K.D. and Gibson R.A. 2007. Immunomodulatory
Constituents of Human Milk Change in Response to Infant Bronchiolitis.
Pediatric Allergy Immunology 18:495-502.
3. Fearon, D.T. and Locksley, R. M. 1996. The Instructive Role of Innate Immunity in
the Acquired Immune Response. Science 272:50-53.
4. Harlow, E. and Lane, D., ed. 1998. Antibodies: A Laboratory Manual. Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY.
5. Male, D., Brostoff, J., Roth, D.B. and Roitt, I. 2006. Immunology. Elsevier Limited.
6. Gould, H.J., Sutton, B.J., Beavil, A.J., Beavil, R.L., McCloskey, N., Coker, H.A., Fear,
D. and Smurthwaite, L. 2003. The Biology of Ige and the Basis of Allergic
Disease. Annual Review of Immunology 21:579-628.
7. Branden, C., and Tooze, J. 1999. Introduction to Protein Structure. Garland
Publishing, New York, NY.
8. Almogren, A., Senior, B.W., Loomes, L.M. and Kerr, M.A. 2003. Structural and
Functional Consequences of Cleavage of Human Secretory and Human Serum
Immunoglobulin A1 by Proteinases from Proteus Mirabilis and Neisseria
Meningitidis. Infection and Immunity 71:3349-3356.
9. Griffis, N., Barrilleaux, A., Middlebrooks, B.L. and Ellender, R.D. 1992. Iga as a
Species Specific Indicator of Fecal Pollution of Environmental Waters. American
Society of Microbiology, Abstracts 94th Annual Meeting Session Q221:427.
10. Nowakowski, A., Wang, C., Powers, D.B., Amersdorfer, P., Smith, T.J.,
Montgomery, V.A., Sheridan, R., Blake, R, Smith, L.A. and Marks, J.D. 2002.
Potent Neutralization of Botulinum Neurotoxin by Recombinant Oligoclonal
Antibody. PNAS 99:11346-11350.
11. Volk, W.A., Bizzini, B., Snyder, R.M., Bernhard, E. and Wagner, R.R. 1984.
Neutralization of Tetanus Toxin by Distinct Monoclonal Antibodies Binding to
Multiple Epitopes on the Toxin Molecule. Infection and Immunity 45:604-609.
101
12. Klonisch, T., Panayotou, G., Edwards, P., Jackson, A.M., Berger, P., Delves, P.J.,
Lund, T. and Roitt, I.M. 1996. Enhancement in Antigen Binding by a
Combination of Synergy and Antibody Capture. Immunology 89:165-171.
13. Zwick, M.B., Wang, M., Poignard, P. Stiegler, G., Katinger, H., Burton, D.R. and
Parren P.W.H.I. 2001. Neutralization Synergy of Human Immunodeficiency
Virus Type 1 Primary Isolates by Cocktails of Braodly Neutralizing Antibodies.
Journal of Virology 75:12198-12208.
14. McCafferty, J., Griffiths, A.D., Winter, G. and Chiswell, D.J. 1990. Phage
Antibodies: Filamentous Phage Displaying Antibody Variable Domains. Nature
348:552-554.
15. Vaughan, T.J., Williams, A.J., Pritchard, K., Osbourn, J.K., Pope, A.R., Earnshaw,
J.C., McCafferty, J., Hodits, R.A., Wilton, J. and Johnson, K.S. 1996. Human
Antibodies with Sub-Nanomolar Affinities Isolated from a Large Non-Immunized
Phage Display Library. Nature Biotechnology 14:309-314.
16. Tsui, P., Tornetta, M.A., Ames, R.S., Bankosky, B.C., Griego, S., Silverman, C.,
Porter, T., Moore, G. and Sweet, R.W. 1996. Isolation of a Neutralizing Human
Rsv Antibody from a Dominant, Non-Neutralizing Immune Repertoire Be
Epitope-Blocked Panning. Journal of Immunology 157:772-780.
17. Ditzel, H.J.Ditzel, H.J., Binley, J.M., Moore, J.P., Sodroski, J., Sullivan, N., Sawyer,
L.S., Hendry, R.M., Wei-Ping, Y., Barbas, C.F. III and Burton, D.R. 1995.
Neutralizing Recombinant Human Antibodies to a Conformational V2- and Cd4Binding Site-Sensitive Epitope of Hiv-1 Gp120 Isolated by Using an Epitope –
Masking Procedure. Journal of Immunology 154:893-906.
18. Friguet, B., Djavadi-Ohaniance, L., Pages, J., Bussard, A. and Goldberg, M. 1983. A
Convenient Enzyme-Linked Immunosorbent Assay for Testing Whether
Monoclonal Antibodies Recognize the Same Antigenic Site. Application to
Hybridomas Specific for the 2-Subunit of Escherichia Coli Tryptophan
Synthase. Journal of Immunological Methods 60:351-358.
19. Khosraviani, M., Pavlov, A.R., Flowers, G.C and Blake, D.A. 1998. Detection of
Heavy Metals by Immunoasay: Optimization and Validation of a Rapid, Portable
Assay for Ionic Cadmium. Environmental Science and Technology 32:137-142.
20. Lai, Y., Feldman, K.L. and Clark, R.S.B. 2005. Enzyme-Linked Immunosorbent
Assay (Elisas). Critical Care Medicine 33.
21. Nakane, P.K. and Pierce, G.B. Jr. 1967. Enzyme-Labeled Secondary Antibodies for
Light and Electron Microscropic Localization of Tissue Antigens. Journal Cell
Biology 33.
22. Crowther, J.R., ed. 2001. The Elisa Guidebook. Humana Press, Towowa, NJ.
102
23. Butler, J.E., ed. 1991. Immunochemistry of Solid-Phase Immunoassay. CRC Press,
Boca-Raton, FL.
24. Goldblatt, D., van Etten, L., van Milligen, F. J., Aalberse, R. C. and Turner, M. W.
1993. The Role of Ph in Modified Elisa Procedures Used for the Estimation of
Functional Antibody Affinity. Journal of Immunological Methods 166.
25. Blake, D.A., Blake, R.C. II, Khosraviani, M. and Pavlov, A.R. 1998. Immunoassays
for Metal Ions. Analytica Chimica Acta 376.
26. Blake, R.C.II, Delehanty, J.B, Khosraviani, M., Yu, H., Jones, R.M. and Blake, D.A.
2003. Allosteric Binding Properties of a Monoclonal Antibody and Its Fab
Fragment. Biochemistry 42.
27. Blake, R.C. II, Pavlov, A.R., Khosraviani, M., Ensley, H.E., Kiefer, G.E., Yu, H., Li,
X. and Blake, D.A. 2004. Novel Monoclonal Antibodies with Specificity for
Chelated Uranium (Iv): Isolation and Binding Properties. Bioconjugate Chemistry
15.
28. Delehanty, J.B., Jones, R.M., Bishop, T.C. and Blake, D.A. 2003. Identification of
Important Residues in Metal-Chelate Recognition by Monoclonal Antibodies.
Biochemistry 42.
29. Jones, R.M., Yu, H., Delehanty, J.B. and Blake, D.A. 2002. Monoclonal Antibodies
That Recognize Minimal Differences in the Three-Dimensional Structures of
Metal-Chelate Complexes. Bioconjugate Chemistry 13.
30. Sambrook, J., Fritsch, E.F. and Maniatis, T., ed. 1989. Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
NY.
31. Blake, R.C. II, Pavlov, A.R. and Blake, D.A. 1999. Automated Kinetic Exclusion
Assays to Quantify Protein Binding Interactions in Homogeneous Solution.
Analytical Biochemistry 272.
32. Blake, D.A., Chakrabarti, P., Khosraviani, M., Hatcher, F.M., Westhoff, C.M.,
Goebel, P., Wylie, D.E. and Blake, R.C. II. 1996. Metal Binding Properties of a
Monoclonal Antibody Directed toward Metal-Chelate Complexes. Journal
Biological Chemistry 271:27677-27685.
33. Yelton, D.E., Desaymard, C. and Scharff, M.D. 1981. Use of Monoclonal AntiMouse Immunoglobulin to Detect Mouse Antibodies. Hybridoma 1.
34. Ware, C.F., Reade, J.L. and Der, L.C. 1984. A Rat Anti-Mouse Kappa Chain Specific
Monoclonal Antibody, 187.1.10: Purification, Immunochemical Properties and Its
Utility as a General Secondary Antibody Reagent. Journal Immunological
Methods 74.
103
35. Brodin, N.T., Jansson, B., Hedlund, G. and Sjogren, H.O. 1989. Use of a Monoclonal
Rat Anti-Mouse Ig Light Chain (Ramol-1) Antibody Reduces Background
Binding in Immunochemical and Fluorescent Antibody Analysis. Journal of
Histochemistry and Cytochemistry 37.
36. Reed, G.L. 1992. Generation of Species-Specific, Rat Monoclonal Antibodies That
Bind to the Kappa Chain of Mouse Immunoglobulin. Journal of Immunological
Methods 147.
37. Northrup, S.H. and Erikson, H.P. 1992. Kinetics of Protein-Protein Association
Explained by Brownian Dyanamics Computer Simulation. Proceedings of the
National Academy of Sciences USA 89.
38. Raman, C.S., Jemmerson, R., Nall, B.T. and Allen, M.J. 1992. Diffusion-Limited
Rates for Monoclonal Antibody Binding to Cytochrome C. Biochemistry 31.
39. Dimitriev, D.A., Massine, Y.S., Segal, O.L., Smirnova, M.B., Kolyaskina, G.I.,
Pavlova, E.V., Osipov, A.P., Egorov, A.M. and Dmitriev, A.D. 2001. The
Comparison of the Ability of Monoclonal Antibodies Directed toward Different
Proteins (Human Igg, Human Myoglobin and Hrp) and Bispecfic Antibodies
Derived Thereof to Bind Antigens Immobilized on a Surface of a Solid Phase.
Clinica Chemica Acta 309.
40. Kortt, A.A., Dolezal, O., Power, B.E. and Hudson, P.J. 2001. Dimeric and Trimeric
Antibodies: High Avidity Scfvs for Cancer Targeting. Biomolecular Engineering
18:95-108.
41. Dill, K., Lin, M., Poteras, C., Hafeman, D.G., Owicki, J.C. and Olson, J.D. 1994.
Antibody-Antigen Binding Constants Determined in Solution-Phase with the
Threshold Membrane-Capture System: Binding Constants for Anti-Fluorescein,
Anti-Saxitoxin, and Anti-Ricin Antibodies. Analytical Biochemistry 217:128-138.
42. Knibbs, R.N., Takagaki, M., Blake, D.A. and Goldstein, I.J. 1998. The Role of
Valence on the High-Affinity Binding of Griffonia Simplicifolia Isolectins to
Type a Human Erythrocytes. Biochemistry 37:16952-16957.
43. Bradbury, A.R.M. and Marks, J.D. 2004. Antibodies from Phage Antibody Libraries.
Journal of Immunological Methods 290:29-49.
44. Li, Y., Cockburn, W., Kilpatrick, J.B. and Whitelam G.C. 2000. High Affinity Scfvs
from a Single Rabbit Immunized with Multiple Haptens. Biochemical and
Biophysical Research Communications 268:398-404.
45. Darwish, I.A. and Blake, D.A. 2002. Development and Validation of a One-Step
Imunoassay for Determination of Cadmium in Human Serum. Analytical
Chemistry 74:52-58.
104
46.
Gill, S.C. and von Hippel, P.H. 1989. Calculation of Protein Extinction
Coefficients from Amino Acid Sequence Data. Analytical Biochemistry 182:319326.
Biography
Elizabeth Rachael Abboud was born on September 22, 1978 in New Orleans, LA.
She attended Eleanor McMain Magnet High School and the New Orleans Center for
Creative Arts, graduating in 1995. She graduated from the University of New Orleans in
May of 2001 where she received a Bachelor of Science degree in Biology. Elizabeth
entered graduate school in the fall of 2001 in the Interdisciplinary Molecular and Cellular
Biology Program at Tulane University Health Sciences Center. She joined the lab of Dr.
Diane Blake in May of 2002. In December of 2007 she earned a Doctor of Philosophy
degree in Molecular and Cellular Biology under the guidance of Dr. Diane Blake. Her
research focused on selecting synergistic antibodies from populations of polyclonal
antibodies generated towards human Immunoglobulin A.
She married her husband John Joffe just after graduating from college (June 2,
2001) and after a fabulous honeymoon in Tuscany, she began her graduate career at
Tulane in the fall. She donned her “Supermom” cape when she birthed two babies Nadia, 9.30.2003 and Jacob, 8.30.2005 (he in a Baton Rouge hotel room as New Orleans
flooded the day after Hurricane Katrina) during her tenure as a graduate student. She
breastfed and pumped for them for four years straight, all while learning to multi-task
better than she ever could before.