BOR Papers in Press. Published on November 12, 2008 as DOI:10.1095/biolreprod.108.073197
1
ADP-Ribosylation Factor 1 Regulates Asymmetric Cell Division in Female Meiosis in the
Mouse1
Shufang Wang 3, 4, Jianjun Hu 3, Xinzheng Guo 3, Johne X. Liu 5 and Shaorong Gao 2, 3
3 National Institute of Biological Sciences (NIBS), Beijing 102206, P.R. China
4 College of Life Science, Beijing Normal University, Beijing 100875, P.R. China
5 Ottawa Health Research Institute (OHRI), University of Ottawa, Ottawa K1N 6N5, Canada
Summary sentence: Microinjection of a dominant negative mutant form of ADP-ribosylation
factor 1 (Arf1 T31N) mRNA into mouse oocytes causes symmetric cell division in both meiosis I and
II.
Running title: ARF1 regulates asymmetric cell division in oocyte meiosis
Keywords and Topic Category
Oocyte meiosis, polarity, ARF1, asymmetric division
1 Supported by National High Technology Project 863 (2005AA210930).
2 Correspondence:
Shaorong Gao, Ph.D. #7 Science Park Road, Zhongguancun Life Science Park, Beijing
102206, P.R. China. Tel: (86)-10-80728967; Fax: (86)-10-80727535
E-mail address: [email protected]
ABSTACT
Mouse oocytes undergo two successive meiotic divisions to generate one large egg with two small
polar bodies, which is essential for preserving the maternal resources to support embryonic
development. Although previous studies have shown that some small GTPases, such as RAC,
RAN and CDC42, play important roles in cortical polarization and spindle pole anchoring, no
oocytes undergo cytokinesis when the mutant forms of these genes are expressed in mouse oocytes.
Here we show that the ADP-ribosylation factor 1 (ARF1) plays an important role in regulating
asymmetric cell division in mouse oocyte meiosis. Microinjection of mRNA of a dominant
negative mutant form of Arf1 (Arf1T31N) into fully grown germinal vesicle oocytes led to
symmetric cell division in meiosis I, generating two metaphase II (MII) oocytes of equal size.
Subsequently, the two MII oocytes of equal size underwent the second round of symmetric cell
division to generate a 4-cell embryo (zygote) when activated parthenogenetically or via sperm
injection. Furthermore, inactivation of MAPK, but not MDK (also known as MEK), has been
discovered in the ARF1 mutant oocytes, and further demonstrated that ARF1, MAPK pathway
plays an important role in regulating asymmetric cell division in meiosis I. Similarly,
ARF1T31N–expressing superovulated MII oocytes underwent symmetric cell division in meiosis II
when activation was performed. Rotation of MII spindle for 90 degree was prohibited in ARF1T31N
expressing MII oocytes. Taken together, our results suggest that ARF1 plays an essential role in
regulating asymmetric cell division in female meiosis.
Copyright 2008 by The Society for the Study of Reproduction.
2
INTRODUCTION
Asymmetric cell division refers to a mother cell dividing into two daughter cells with different cell
fates and it is involved in multiple biological processes. Asymmetric cell division is crucial for
generating diversity of development and for self-renewal of stem cells. In early embryo
development in mammals, the totipotent blastomeres undergo asymmetric cell divisions to
generate the earliest cell lineage differentiation. During adult stem cells division, one daughter cell
maintains pluripotent and the other daughter cell differentiates into specific cell type through
asymmetric cell division. Asymmetric cell division can be manifested by symmetric spindle
positioning coupled with asymmetric distribution of cell fate determinants to generate two
equal-sized daughter cells with different fates; or asymmetric spindle positioning to generate two
unequal sized daughter cells with different fates. The asymmetric cell division in mouse oocyte
meiosis belongs to the second situation. In mammalian female meiosis, the oocyte undergoes
typical asymmetric cell divisions to generate a large oocyte and two small polar bodies with
different destinations. It has been demonstrated previously that PAR proteins and small G proteins
function in this process [1-4]. The oocyte polarity is acquired along with spindle positioning and
anchoring to the cortex, which is controlled by actin and tubulin [5].
Female meiosis in mammals is characterized by the generation of a single large haploid oocyte and
two small polar bodies through two successive asymmetric cell divisions without intervening
DNA replication. Fertilization unites a haploid sperm with the large oocyte to initiate early embryo
development. The mechanism responsible for driving this extremely asymmetric cell division in
female meiosis is poorly understood. Immature mammalian oocytes within ovarian follicles are
arrested in prophase I with a centrally located large nucleus called germinal vesicle (GV). In
response to a LH (luteinizing hormone) surge in the animal, or when isolated from the ovarian
follicles, the oocyte will undergo asymmetric cell division to release the first polar body and arrest
at metaphase II. In mature oocytes, the metaphase II spindle is oriented parallel to the cortex and,
upon fertilization or parthenogenetic activation, rotation of the MII spindle for 90 degree by an
unknown mechanism facilitates the extrusion of the second polar body [6].
Several recent studies have indicated that small GTPases, such as RAN, RAC, CDC42, likely play
important roles in metaphase spindle assembly, anchoring of the spindle to the cortex and polar
body extrusion. However, when these GTPases are inhibited, the affected oocytes either exhibit
abnormal spindle assembly [7-9] or fail cytokinesis [10]. Therefore, it remains unclear if any of
these GTPases are directly involved in asymmetric spindle positioning.
Here we provide evidence that ADP-ribosylation factor 1 (ARF1), one small GTPase, plays an
important role in regulating asymmetric cell division in female meiosis in mouse. By expressing
the dominant negative mutant form ARF1T31N in both GV and MII oocytes, we found a large
proportion of oocytes underwent symmetric cell division and generated two oocytes with equal
size. Furthermore, MAP kinase was inactivated in ARF1T31N expressing oocytes; however, MDK
activity was not influenced. We propose ARF1-MAPK pathway regulates the asymmetric cell
division in meiosis I, which is similar to previous findings that MOS (c-Mos)-MDK-MAPK [11,
12] functions in asymmetric cell division in meiosis I, but regulation of MAPK activity by ARF1
was first demonstrated in the present study. Inhibition of MII spindle rotation for 90 degree was
found in ARF1T31N expressing MII oocytes when activation was induced via pathenogenetic
3
activation or sperm injection. These data strongly indicate that ARF1 regulates asymmetric cell
division in female meiosis in mammals.
MATERIALS AND METHODS
Animals, oocytes collection, chemical treatment, parthenogenetic activation and intracytoplasmic
sperm injection (ICSI)
The specific pathogen-free (SPF) grade hybrid mice B6D2F1 (C57BL/6×DBA/2) were housed in
the animal facility of the National Institute of Biological Sciences. All studies adhered to
procedures consistent with the National Institute of Biological Sciences Guide for the care and use
of laboratory animals. All inorganic and organic compounds were purchased from Sigma
Chemical Company (St. Louis, MO) unless otherwise stated.
Fully grown germinal vesicle (GV) oocytes were collected from four- to eight- week old B6D2F1
female mice 44-48 h post eCG injection. The antral follicles were punctured by 30 gauge needles
and the GV oocytes enclosed by several layers of cumulus cells were selected for the following
experiments. The cumulus cells were mechanically removed and the denuded oocytes were
cultured in Waymouth’ medium supplemented with 10% fetal bovine serum and 0.23 mM
pyruvate acid at 37°C under 5% CO2 [13].
The chemicals used for destroying Golgi apparatus of oocytes were brefeldin A (BFA) and Exol,
and the concentration used was 5 μM and 20 μM, respectively. To inhibit spontaneous GV
breakdown, 10 μM of mirilnone was supplemented in the culture medium.
The MII oocytes were collected from oviducts of 8-10 weeks old female mice administrated with
eCG and HCG. Parthenogenetic activation of MII oocytes were performed by culture of the
oocytes in calcium free CZB medium supplemented with 10 mM strontium. ICSI was performed
according to previous report [14], a single sperm head was microinjected into the MII oocyte
assisted by piezo-drill micromanipulator at room temperature.
Construction of Arf1T31N, Arf1Q71L, Arf3T31N and Arf6T27N mutants and microinjection
The mRNA of GV oocytes were extracted with Dynabeads mRNA DIRECT Kit (Invitrogen).
Sequences of all plasmid clones were sequence verified. To investigate the expression of Arf1
mRNA in mouse oocytes and early stage embryos, PCR was performed with forward primer F3
gaagatctATGGGGAATATCTTTGCAAACCTC and reverse primer R5 ccgctcgagCTTCTG
GTTCCGGAGCTG. For construction of dominant negative mutant form of Arf1 (Arf1T31N), the
first PCR was performed with forward primer F3 and reverse primer R3
GTTTGTATAGAATTGTgtTCTTCCC. The other PCR employed forward primer F4
GGGAAGAacACAATTCTATACAAAC and reverse R5. The italic ac represents the mutated
bases. Both PCR products were gel purified before use as templates for the second PCR with
primers F3 and R5 to synthesize full-length ARF1T31N. PCR product was digested with BglII and
XhoI and ligated into vector that had been digested with BglII and XhoI.
For construction of the dominant active form of Arf1 (Arf1Q71L), reverse primer R3
CAGGGGCCGGATCTTGTCCAGGCCGCCCACATCCC and forward primer F4
GGGATGTGGGCGGCCTGGACAAGATCCGGCCCCTG were used. In vitro RNA synthesis
was performed using mMESSAGE mMACHINE T3 (Ambion) and stored at -80°C. Equal
4
quantities of mRNAs were microinjected into the cytoplasm of oocytes using Eppendorf Femtojet
microinjector.
The method used for construction of Arf3 dominant negative mutant (Arf3T31N) is essentially the
same as Arf1. The forward primer F3 is gaagatctATGGGCAATATCTTTGGGAACC and the
reverse primer R5 is ccgctcgagCTTCTTGTTTTTGAGCTGATTGGCC. The forward primer F4 is
GGGAAGAaCACCATCCTCTACAAGC and the reverse primer R3 is
GCTTGTAGAGGATGGTGtTCTTCCC.
For construction of Arf6 dominant negative mutant (Arf6T27N), the method is the same as Arf1
except the enzyme used is xhoI and sacI. The forward primer F3 is
CATCTCGAGATGGGGAAGGTGCTATCC and the reverse R5 is
CATGAGCTCGGATTTGTAGTTAGAGGTT. The forward primer F4 is
CGCAGCCGGCAAGAATACGATCCTGTACAAGTTG, the reverse R3 is
CAACTTGTACAGGATCGTATTCTTGCCGGCTGCG.
Western blotting
To investigate MAPK activity in the oocytes from different treatments, proteins from 150 oocytes
were collected in the SDS sample buffer and boiled at 100°C for 5 min. After cooling on ice and
centrifuging at 12000×g for 5 min, the samples were kept at -80°C until use. The total proteins
were separated by SDS-PAGE and electrophoretically transferred to the PVDF membrane at 4°C.
The transferred PVDF membrane was then blocked in the TBST buffer containing 5% non-fat
milk at 4°C overnight. To detect the phosphorylated MAPK, the blocked PVDF membrane was
incubated with 1:500 rabbit anti-phosphorylated MAPK (Promega) overnight at 4°C. After three
times of washing with TBST, the membrane was incubated with HRP-conjugated goat anti-rabbit
second antibody (Amersham Pharmacia) for 2 h at room temperature. The membrane was
extensively washed with TBST for three times and then processed with the ECL detection system
(Amersham).
To re-probe the membrane with the anti-MAPK1 antibody to detect the existence of total MAPK,
the membrane was washed in the stripping buffer (100 mM β-mercaptoethanol, 20% SDS, and
62.5 mM Tris, [pH6.7]) at 50°C for 30 min to strip off the bound antibodies after first ECL
detection. The stripped membrane was then re-probed with the polyclonal rabbit anti-MAPK1
antibody (Santa Cruz Biotechnology) using the procedures described above. All western blot
experiments were repeated at least three times. The methods used for detection of MDK activity
were essentially the same as active MAPK and MAPK1 was detected as internal control. The first
antibody to phosphorylated-MDK was purchased from SAB Signalway Antibody Company.
Immunocytochemistry staining and confocal microscopy
The method used for indirect immunofluorescence staining was modified according to previous
reports. All steps were performed at room temperature, unless otherwise mentioned. The collected
oocytes were fixed with 4% paraformaldehyde for at least 20 min, and then permeabilized for 30
min with 0.2% Triton X-100 in PBS. After three times of washing, all samples were incubated in
the blocking solution (10% normal goat serum and 0.05% Tween-20 in PBS) overnight at 4°C.
Oocytes were incubated with anti-α-tubulin first antibody with a dilution of 1:1500 (Sigma) or
anti-phosphorylated MAPK with dilution of 1:500 (Promega) for 2 h at 37°C. After three times of
washing, the oocytes were incubated with a fluorescein isothiocyanate (FITC) conjugated goat
5
anti-mouse second antibody (Jackson ImmunoResearch, dilution 1:2000) for 1 h for tubulin, or
goat anti-rabbit conjugated to Alexa 594(Sigma, dilution 1:2000) for phosphorylated MAPK.
After washing, the oocytes were incubated with rhodamin phalloidin (Molecular Probes) to detect
the microfilaments (actin). Finally, the DNA was stained with 4’, 6-diamidino-2-phenylindole
(DAPI, 1 μg/ml) and all the samples were mounted in anti-fade solution. Detection of Golgi
morphology in GV oocytes was performed using the anti-GM130 antibody (BD). At least ten
oocytes were processed for each separate sample and the experiments were replicated for at least
three times. Stained oocytes mounted on slides were observed on a LSM 510 META confocal
microscope (Zeiss, Germany) using Plan Neofluar 63×/1.4 Oil DIC objective and excitation
wavelengths of 488 nm, 405 nm and 594nm. Collection of each channel signal was done
sequentially. For each experiment, the same detector gain, amplifier offset and pinhole parameters
were used. All collected images were assembled using Adobe Photoshop software (Adobe
Systems, San Joes, CA) without any adjustment of contrast and brightness to the images.
RESULTS
ARF1T31N expression causes symmetric cell division in meiosis I
Recently, a study reported that ARFGEF1 (also known as brefeldin A, BFA)-treated oocytes could
undergo symmetric cell division to generate two metaphase II oocytes with similar size, instead of
a large oocyte alongside a polar body [15]. ARFGEF1 could cause ARF1 inactivation [16], leading
to Golgi collapse [17, 18]. To address if the symmetric cell division in ARFGEF1 treated oocytes
is the result of Golgi collapse, we treated the immature GV oocytes with another drug, exo1, which
destroys the Golgi apparatus via a different mechanism [19]. Exol did not affect ARF1-GTP
loading step. Our results indicated that all the Exol-treated oocytes underwent normal meiosis,
producing a large oocyte alongside a polar body, although disruption of Golgi could be clearly
observed in the treated oocytes (Supplemental Fig. 1S, and all other supplemental data, is available
online at www.biolreprod.org). After excluding Golgi collapse as responsible for asymmetric
oocyte division, following experiments were performed to address whether ARF1 was indeed the
target of ARFGEF1 in converting polar body extrusion to symmetric cell division in mouse oocyte
meiosis.
First, RT-PCR was performed to investigate if Arf1 is expressed in oocyte. Our results indicated
that Arf1 mRNA is ubiquitously expressed at all the stages of oocytes and early embryos (Fig. 1A),
which is consistent with previous report in which Arf1 expression in mouse oocytes was detected
by microarray [20]. Subsequently, we expressed GFP tagged ARF1Q71L, via mRNA microinjection,
in immature oocytes to determine its subcellular localization during oocyte maturation, since no
specific antibodies are available to recognize the endogenous active form of ARF1 protein. Active
form ARF1Q71L-GFP derived from the injected mRNA was found evenly distributed in the
cytoplasm before and after GV breakdown (GVBD). ARF1 was found concentrated at the
contractile ring and co-localized with F-actin during polar body extrusion (Fig. 1B).
Over-expression of ARF1 in oocytes showed no adverse effects on spindle anchoring to the cortex
and polar body extrusion.
To address whether inhibition of ARF1 in GV oocytes will result in symmetric cell division in
meiosis I, mRNA encoding a dominant negative mutant form of Arf1 (Arf1T31N) was microinjected
into the cytoplasm of GV oocytes in the presence of mirilnone, which is a phosphodiesterase
6
inhibitor and can inhibit spontaneous GVBD [21]. GV oocytes expressing ARF1T31N were allowed
to undergo maturation. In contrast to control oocytes which produced a large oocyte alongside a
polar body (Fig. 2A), oocytes expressing ARF1T31N underwent symmetric cell division and
generated two half-sized oocytes (Fig. 2B). To investigate cytokinesis in meiosis I in more detail,
we carried out immunocytochemistry staining of the oocytes at various stages of maturation. As
shown in Fig. 2C, following GVBD, chromatins condensed into chromosomes and microtubules
organized into a barrel shaped MI spindle, the MI spindle migrated to the cortex and the actin cap
formed subsequently in the control oocyte. Then one pole of the MI spindle was attached to the
cortex (rotation of the MI spindle for 90 degree might occur in this process), and the first polar
body was extruded. In contrast, ARF1T31N-expressing oocytes exhibited two phenotypes, both of
which resulted in generating two half-sized MII oocytes. In the first category, the MI spindle
remained at the center of the oocyte at the time of anaphase initiated and furrowing progressed,
which resulted in a cleavage midway through the oocyte. Both half-sized oocytes then progressed
to metaphase II and arrested at this stage (Fig. 2D). Most ARF1T31N-expressing oocytes falling into
this category, the failure of spindle migration was found in 88.6%±2% (n=320) of the
ARF1T31N-expressing oocytes. In the second category, the MI spindle migrated to the cortex,
accompanied by the appearance of an actin cap close to the cortically localized spindle. However,
the MI spindle could not attach to the cortex to extrude polar body. Instead, a cleavage furrow
started to form from the cortex close to the MI spindle, along with the cleavage furrow falling
inside, the MI spindle moved to the opposite side of the cortex. The other cleavage furrow was
induced and the oocyte symmetrically divided consequently (Fig. 2E). Very small proportion of
ARF1T31N-expressing oocytes fallen into this category with only 11.3%±2% (n=320) of oocytes
were observed.
ARF1T31N causes symmetric cell division in meiosis II
To investigate if ARF1 is also involved in asymmetric cell division in the second meiosis,
superovulated MII oocytes were injected with Arf1T31N mRNA and then were subjected to
parthenogenetic activation or intra-cytoplasmic sperm injection (ICSI). Apparently, the control
MII oocytes extruded second polar body following parthenogenetic activation (Fig. 3A), in the
contrast, the ARF1T31N-expressing MII oocytes underwent symmetric cell division, producing two
cells of similar size following parthenogenetic activation (Fig. 3B). Subsequently, a pronucleus
was observed in each of the two cells, suggesting successful egg activation. Immunocytochemistry
staining was performed to investigate the cytoskeletal dynamics in this process. Following
parthenogenetic activation, the metaphase II spindle in the control oocyte rotated 90 degree to
become perpendicular to the cortex. Subsequently, a polar body was extruded and a pronucleus
was observed in the egg (Fig. 3C). In contrast, in the ARF1T31N-expressing MII oocytes, the
spindle did not rotate and remained parallel to the cortex at the time of anaphase initiated. Two
actin caps were induced by the two sets of sister chromatids and a cleavage furrow started to form
and ingress. Following the cell cycle progressing, the spindle was extensively stretched and the
cleavage furrow fallen further into the oocyte to push the spindle to the opposite cortex.
Subsequently, the oocyte cleaved into two oocytes of equal size and each oocyte exhibited one
visible pronucleus (Fig. 3D).
To determine if fertilization of the ARF1T31N-expressing MII oocytes could also result in
symmetric cell division, ICSI was performed according to previous report [14]. As shown in
Supplemental Figure 2S, the control MII oocyte released second polar body and two pronuclei
7
were observed following ICSI. In striking contrast, the ARF1T31N-expressing MII oocyte
underwent symmetric cell division, similar to that observed in parthenogenetic activation (Fig.
3D). However, two pronuclei (one from the sperm) could be observed in one daughter oocyte
whereas the other oocyte contained only one pronucleus. Following culture in vitro, the ICSI
produced embryos could develop to blastocysts efficiently, whereas the ARF1T31N expressing
oocytes derived embryos could not undergo mitosis (Supplemental Fig. 3S).
Generation of a “4-cell” zygote from one ARF1T31N expressing GV oocyte
To investigate if the two MII oocytes of equal size generated from the ARF1T31N expressing GV
oocyte could undergo the second round of symmetric cell division in meiosis II, parthenogenetic
activation and ICSI were performed as described above. As shown in Fig. 4A, most 2-cell MII
oocytes underwent the second round symmetric cell division and generated a 4-cell
parthenogenetically activated oocyte 6 h after activation. Next, ICSI was performed to microinject
a sperm head into each MII oocyte generated in meiosis I to investigate if the sperm triggered
activation could lead to the same consequence. As shown in Fig. 4B, both MII oocytes survived
after ICSI did undergo symmetric cell division after sperm injection, which is similar to what we
observed in parthenogenetic activation.
ARF1T31N expression causes mitosis failure
Next, we sought to address if the mutant embryos generated from either ARF1T31N expressing GV
oocytes or MII oocytes could undergo mitosis and develop to blastocyst stage. The results
indicated that no embryos could undergo normal mitosis and all the embryos were
developmentally arrested (Supplemental Fig. 3S). Our results were coincided with a previous
report in which expression of ARF1T31N in root meristem of Arabidopsis caused cell cytokinesis
defects [22]. However, the symmetrically divided oocytes generated from AEFGEF1 treatment
could undergo normal mitosis and develop to blastocyst stage once ARFGEF1 was removed
(unpublished data), which might provide a useful approach to investigate if the two sets of
homologous chromosomes are equivalent in development.
ARF3 and ARF6 dominant negative mutant, ARF1 constitutive active mutant does not cause
symmetric division in meiosis.
To investigate if other members of the Arf family play similar roles in regulating asymmetric cell
division in meiosis, Arf3 and Arf6 were selected. ARF3 is 97% identical to ARF1 in amino acid
sequence. On the other hand, ARF6 is thought to be an important regulator of the actin
cytoskeleton [23]. However, we found that neither dominant negative mutant form of ARF3T31N
nor that of ARF6T27N expression affected the first polar body extrusion (of oocytes) or the second
polar body extrusion (of superovulated eggs) (data not shown). And the constitutive active form of
ARF1 (ARF1Q71L) expressing oocytes protruded the polar body resembling to the control oocytes
(data was shown in the first paragraph of the results).
ARF1 dominant negative mutant causes MAPK inactivation.
Since microtubules organization appeared abnormal in the ARF1T31N expressing oocytes at MI
stage, in which the spindle was diffused compared to normal MI spindle (Fig. 5). Therefore, we
focused on the pathways correlated with microtubules organization, subsequently. It has been
reported that MOS-MDK-MAPK pathway plays essential role in spindle organization [24, 25],
cell cycle progression in meiosis [12, 26-28]. Moreover, small proportion of the oocytes collected
8
from Mos knockout mice generated large polar bodies during meiosis [12], which is similar to the
phenomena observed in ARF1T31N oocytes. Results from previous study have shown that ARF6,
the ARF family number, could regulate MDK/MAPK signaling pathway[29]; and moreover,
ARFGEF1, the ARF1 inhibitor, could inhibit MAPK activity in some cell line[30]. Furthermore,
most Mos mutant oocytes will undergo parthenogenetic activation spontaneously [26-28]. Based
on these previous findings, we investigated MAPK activity in the symmetrically divided
ARF1T31N oocytes. As expected, we found phosphorylated MAPK in MII oocytes but not in GV
oocytes (Fig. 6A). Surprisingly, we found significantly reduced phosphorylated MAPK in the
symmetrically divided ARF1T31N oocytes, compared to control MII oocytes (Fig. 6A, compare the
second and third lanes). To further observe if the symmetrically divided ARF1T31N MII oocytes
contain the similar localization of phosphorylated MAPK to normal MII oocytes, we performed
immunocytochemistry staining. Our results showed that localization of phosphorylated MAPK in
the metaphase spindle could be clearly observed in the control MII oocytes. However, no active
phosphorylated MAPK could be detected on the metaphase spindle in the symmetrically divided
ARF1T31N MII oocytes (Fig. 6B). Although the symmetrically divided ARF1T31N MII oocytes were
arrested at metaphase (Fig. 2), they appeared more easily undergoing spontaneous activation in
vitro. After 9 hours of culture, pronuclei were observed in most symmetrically divided ARF1T31N
oocytes. However, very few control MII oocytes were spontaneously activated under the same
conditions (Fig. 6C). We further investigated if MDK activity could be inactivated in ARF1T31N
expressing oocytes during meiosis I and the western blot results indicated that MDK activity was
not affected at all (Fig. 6D). Therefore, our results indicated that ARF1 regulates MAP kinase
activity without affecting the upstream kinases of MOS pathway. In contrast to ARF1T31N,
ARF6T27N or ARF3T31N injection into the oocytes did not cause down-regulation of MAPK activity
and the oocytes could undergo normal maturation (Supplemental Fig. 4S)
DISCUSSION
Asymmetric cell division plays an essential role in mammalian female meiosis to preserve
maternal resources in the large oocyte generated to support further embryonic development.
However, the mechanism underlying is poorly understood. Previous studies show that some small
GTPase play important roles in maintaining polarity of oocyte. In the present study, we provided
evidence indicating that another small GTPase, ADP-ribosylation factor 1 (ARF1), plays an
essential role in regulating asymmetric cell division in oocyte meiosis in mouse. By expressing the
dominant negative mutant form of ARF1 (ARF1T31N) in GV or MII oocytes, we found the oocytes
will undergo symmetric cell division to generate two oocytes with equal size both in meiosis I and
meiosis II. Inactivation of MAP kinase has been observed in the symmetrically divided MII
oocytes generated in meiosis I, which indicated that ARF1 might regulate asymmetric cell division
through regulating MAPK activity in meiosis I. Inhibition of metaphase II spindle rotation has
been observed in ARF1T31N expressing MII oocytes during meiosis II.
Regulation of MAPK activity by ARF1 in meiosis I was discovered in the present study, which did
not work through MOS-MDK-MAPK parthway. It has been shown previously that oocytes
collected from Mos knockout mice could occasionally release large polar bodies during maturation.
Since MAPK is regulated by MDK, the downstream of MOS, we further analyzed the MDK
activity as well in the ARF1T31N expressing oocytes. Our results indicated that the MDK activity
was not affected and indicated that ARF1 regulates MAPK activity independently from the
MOS-MDK-MAPK pathway. Our results demonstrated that MAPK activity could be regulated by
9
ARF1 in mouse oocytes and this pathway is a separate pathway from the MOS pathway. However,
it remains unsolved if ARF1 interacts with MAPK directly or indirectly, if indirectly, through
which molecule regulating MAPK activity. Coincided with our finding, the results from a previous
study have indicated that ARFGEF1 treatment could cause inactivation of MAPK in some cell
lines [30]. It deserves to further investigate the direct targets of ARF1, through which regulating
MAPK activity and cytokinesis in mammalian oocytes. Interestingly, oocytes treated with
ARFGEF1 exhibit active MAPK [15]. However, as ARFGEF1-treated oocytes exhibited both one
cell and two cell phenotypes (roughly 50% each) and that MAPK was analyzed on the mixture, it is
possible that the “one cell” oocytes were largely responsible for the active MAPK signal [15].
Prohibition of MII spindle rotation for 90 degree was observed in ARF1T31N expressing MII
oocytes and the oocytes symmetrically divided following pathenogenetic activation or sperm
injection. Regulating spindle rotation by ARF1 was suggested responsible for asymmetric cell
division in meiosis II. When active form of ARF1 was expressed in mouse oocytes, localization of
ARF1 dynamically changed from even distribution in the cytoplasm of GV oocytes to
predominant distribution in the contraction ring of oocytes undergoing cytokinesis.
Co-localization of ARF1 with actin was observed in the oocyte extruding polar body and the
results suggested that ARF1 might regulate spindle rotation through regulating actin organization
or interaction with microtubules. However, further experiments need to be performed to verify the
direct interaction between ARF1 and microfilament during spindle rotation in meiosis.
Besides our findings, ARF1 has been found affecting cell polarity and the rotation of Fucus zygote
division plane [31]. In Arabidopsis, Apical-basal polarity of epidermal cells, reflected by the
position of root hair outgrowth, is also affected when ARF1 mutants are expressed [22].
Unlike ARF1T31N expressing oocytes, the symmetrically divided oocytes generated by ARFGEF1
treatment could undergo early embryo development after pathenogenetic activation or sperm
injection if ARFGEF1 removed (unpublished data). It could provide us an invaluable system to
investigate if the two sets chromosomes are developmentally equivalent after homologous
recombination and separation, although a previous study has indicated that first polar body could
be used to generate live animals [32]. However, it could not exclude the possibility that the defect
chromosomes could be selectively separated into the small polar body during meiosis I.
Recently, parthenogenetic embryos derived embryonic stem cells have been proposed as a useful
seed cell resource for providing MHC-competent ES cells for transplantation based treatment of
certain disease [33]. The symmetrically divided oocytes generated from BFA treatment would be
able to produce ES cells containing all MHCs inherited from the oocyte. Further studies are
proposed to investigate if these ES cells generated could indeed widen the application scale.
In summary, the present study indicated that ARF1 plays a critical role in regulating asymmetric
cell division in female meiosis both in meiosis I and meiosis II. Regulation of MAPK activity by
ARF1 might be involved in asymmetric cell division in meiosis I. Regulating of MII spindle
rotation and anchoring by ARF1 is proposed in the meiosis II.
Acknowledgments:
The work is supported by National High Technology Project 863 (2005AA210930). We thank the
10
lab members for helpful comments on the manuscript.
Author contributions: S.W., J.X.L., and S.G. designed research; S.W., J.H., X.G., and S.G.
performed research; S.W., and S.G. analyzed data; and S.W., J.X.L., and S.G. wrote the paper.
REFERENCES:
1. Betschinger J, Mechtler K, Knoblich JA. The Par complex directs asymmetric cell division by
phosphorylating the cytoskeletal protein Lgl. Nature 2003; 422: 326-330.
2. Gonczy P. Mechanisms of asymmetric cell division: flies and worms pave the way. Nat Rev Mol Cell
Biol 2008; 9: 355-366.
3. Couwenbergs C, Labbe JC, Goulding M, Marty T, Bowerman B, Gotta M. Heterotrimeric G protein
signaling functions with dynein to promote spindle positioning in C. elegans. J Cell Biol 2007; 179: 15-22.
4. Goldstein B, Macara IG. The PAR proteins: fundamental players in animal cell polarization. Dev Cell
2007; 13: 609-622.
5. Sun QY, Schatten H. Regulation of dynamic events by microfilaments during oocyte maturation and
fertilization. Reproduction 2006; 131: 193-205.
6. Edwards RG. Maturation in vitro of mouse, sheep, cow, pig, rhesus monkey and human ovarian
oocytes. Nature 1965; 208: 349-351.
7. Deng M, Suraneni P, Schultz RM, Li R. The Ran GTPase mediates chromatin signaling to control
cortical polarity during polar body extrusion in mouse oocytes. Dev Cell 2007; 12: 301-308.
8. Halet G, Carroll J. Rac activity is polarized and regulates meiotic spindle stability and anchoring in
mammalian oocytes. Dev Cell 2007; 12: 309-317.
9. Na J, Zernicka-Goetz M. Asymmetric positioning and organization of the meiotic spindle of mouse
oocytes requires CDC42 function. Curr Biol 2006; 16: 1249-1254.
10. Ma C, Benink HA, Cheng D, Montplaisir V, Wang L, Xi Y, Zheng PP, Bement WM, Liu XJ. Cdc42
activation couples spindle positioning to first polar body formation in oocyte maturation. Curr Biol 2006;
16: 214-220.
11. Verlhac MH, Lefebvre C, Guillaud P, Rassinier P, Maro B. Asymmetric division in mouse oocytes:
with or without Mos. Curr Biol 2000; 10: 1303-1306.
12. Choi T, Fukasawa K, Zhou R, Tessarollo L, Borror K, Resau J, Vande Woude GF. The
Mos/mitogen-activated protein kinase (MAPK) pathway regulates the size and degradation of the first polar
body in maturing mouse oocytes. Proc Natl Acad Sci U S A 1996; 93: 7032-7035.
13. Eppig JJ, O'Brien MJ. Development in vitro of mouse oocytes from primordial follicles. Biol Reprod
1996; 54: 197-207.
14. Kimura Y, Yanagimachi R. Mouse oocytes injected with testicular spermatozoa or round spermatids
can develop into normal offspring. Development 1995; 121: 2397-2405.
15. Wang L, Wang ZB, Zhang X, FitzHarris G, Baltz JM, Sun QY, Liu XJ. Brefeldin A disrupts asymmetric
spindle positioning in mouse oocytes. Dev Biol 2008; 313: 155-166.
16. Randazzo PA, Yang YC, Rulka C, Kahn RA. Activation of ADP-ribosylation factor by Golgi
membranes. Evidence for a brefeldin A- and protease-sensitive activating factor on Golgi membranes. J
Biol Chem 1993; 268: 9555-9563.
17. Lippincott-Schwartz J, Yuan L, Tipper C, Amherdt M, Orci L, Klausner RD. Brefeldin A's effects on
endosomes, lysosomes, and the TGN suggest a general mechanism for regulating organelle structure and
membrane traffic. Cell 1991; 67: 601-616.
18. Lippincott-Schwartz J, Yuan LC, Bonifacino JS, Klausner RD. Rapid redistribution of Golgi proteins
into the ER in cells treated with brefeldin A: evidence for membrane cycling from Golgi to ER. Cell 1989;
56: 801-813.
19. Feng Y, Yu S, Lasell TK, Jadhav AP, Macia E, Chardin P, Melancon P, Roth M, Mitchison T,
Kirchhausen T. Exo1: a new chemical inhibitor of the exocytic pathway. Proc Natl Acad Sci U S A 2003;
100: 6469-6474.
11
20. Hamatani T, Carter MG, Sharov AA, Ko MS. Dynamics of global gene expression changes during
mouse preimplantation development. Dev Cell 2004; 6: 117-131.
21. De La Fuente R, Viveiros MM, Wigglesworth K, Eppig JJ. ATRX, a member of the SNF2 family of
helicase/ATPases, is required for chromosome alignment and meiotic spindle organization in metaphase II
stage mouse oocytes. Dev Biol 2004; 272: 1-14.
22. Xu J, Scheres B. Dissection of Arabidopsis ADP-RIBOSYLATION FACTOR 1 function in epidermal
cell polarity. Plant Cell 2005; 17: 525-536.
23. D'Souza-Schorey C, Chavrier P. ARF proteins: roles in membrane traffic and beyond. Nat Rev Mol
Cell Biol 2006; 7: 347-358.
24. Tong C, Fan HY, Chen DY, Song XF, Schatten H, Sun QY. Effects of MEK inhibitor U0126 on meiotic
progression in mouse oocytes: microtuble organization, asymmetric division and metaphase II arrest. Cell
Res 2003; 13: 375-383.
25. Verlhac MH, Kubiak JZ, Clarke HJ, Maro B. Microtubule and chromatin behavior follow MAP kinase
activity but not MPF activity during meiosis in mouse oocytes. Development 1994; 120: 1017-1025.
26. Hashimoto N, Watanabe N, Furuta Y, Tamemoto H, Sagata N, Yokoyama M, Okazaki K, Nagayoshi M,
Takeda N, Ikawa Y, et al. Parthenogenetic activation of oocytes in c-mos-deficient mice. Nature 1994; 370:
68-71.
27. Araki K, Naito K, Haraguchi S, Suzuki R, Yokoyama M, Inoue M, Aizawa S, Toyoda Y, Sato E.
Meiotic abnormalities of c-mos knockout mouse oocytes: activation after first meiosis or entrance into third
meiotic metaphase. Biol Reprod 1996; 55: 1315-1324.
28. Colledge WH, Carlton MB, Udy GB, Evans MJ. Disruption of c-mos causes parthenogenetic
development of unfertilized mouse eggs. Nature 1994; 370: 65-68.
29. Tague SE, Muralidharan V, D'Souza-Schorey C. ADP-ribosylation factor 6 regulates tumor cell
invasion through the activation of the MEK/ERK signaling pathway. Proc Natl Acad Sci U S A 2004; 101:
9671-9676.
30. Shome K, Xu XQ, Romero G. Brefeldin A inhibits insulin-dependent receptor redistribution in HIRcB
cells. FEBS Lett 1995; 357: 109-114.
31. Shaw SL, Quatrano RS. The role of targeted secretion in the establishment of cell polarity and the
orientation of the division plane in Fucus zygotes. Development 1996; 122: 2623-2630.
32. Wakayama T, Yanagimachi R. The first polar body can be used for the production of normal offspring
in mice. Biol Reprod 1998; 59: 100-104.
33. Kim K, Lerou P, Yabuuchi A, Lengerke C, Ng K, West J, Kirby A, Daly MJ, Daley GQ.
Histocompatible embryonic stem cells by parthenogenesis. Science 2007; 315: 482-486.
Figure Legends:
FIG. 1. Expression and localization of ARF1 in mouse oocytes. (A) RT-PCR analysis of
expression of Arf1 mRNA in oocytes and early embryos. (B) Localization of dominant active
ARF1 (ARF1Q71L) in mouse oocyte during maturation. Top panel: ARF1 was distributed evenly in
the cytoplasm of GV oocyte; Mid-panel: ARF1 was evenly in the cytoplasm of GVBD oocyte;
Bottom panel: Localization of ARF1 was concentrated at the contractile ring during polar body
extrusion (arrow); scale bar, 10 μm.
FIG. 2. Expression of dominant negative mutant form of ARF1 (ARF1T31N) in GV oocytes
caused symmetric cell division in meiosis I. (A) Control oocytes released first polar body after
maturation; scale bar, 50 μm. (B) ARF1T31N expressing oocyte underwent symmetric cell division
and generated two oocytes with equal size in meiosis I; scale bar, 50 μm. (C)
Immunocytochemistry staining and confocal microscopy showing detailed cytoskeletal dynamics
in meiosis I in control oocytes; scale bar, 10 μm. (D) Cytoskeletal dynamics in ARF1T31N
expressing oocytes in meiosis I, first phenotype: the MI spindle located in the center, migration is
12
prohibited and two actin caps formed simultaneously, the oocyte divided into two MII oocytes
with equal size. More than 85% of ARF1T31N expressing oocytes shoed this phenotype; scale bar,
10 μm. (E) Cytoskeletal dynamics in ARF1T31N expressing oocytes in meiosis I, second phenotype:
the MI spindle migrated to the cortex and one actin cap induced firstly, then the oocyte divided into
two MII oocytes. Only less than 15% of ARF1T31N expressing oocytes showed this phenotype;
scale bar, 10 μm.
FIG. 3. Expression of dominant negative mutant form of ARF1 (ARF1T31N) in MII oocytes
resulted in symmetric cell division in meiosis II following activation. (A) Parthenogenetically
activated MII oocytes released second polar body with visible pronuclei present in the oocytes;
scale bar, 50 μm. (B) ARF1T31N expressing MII oocytes underwent symmetric cell division with
one pronucleus formed in each daughter cell; scale bar, 50 μm. (C) Cytoskeletal dynamics in
control MII oocytes following parthenogenetic activation, rotating 90 degree of the metaphase
spindle could be observed; scale bar, 10 μm. (D) Cytoskeletal dynamics in ARF1T31N expressing
MII oocytes following activation, the metaphase spindle could not rotate and the oocyte
symmetrically divided; scale bar, 10 μm.
FIG. 4. Generation of a 4-cell zygote from one ARF1T31N expressing GV oocyte. (A) 4-cell
oocytes generated via parthenogenetic activation of two MII oocytes with equal size; scale bare, 50
μm. (B) Two 4-cell zygotes generated from symmetrically divided MII oocytes via ICSI; scale bar,
20 μm.
FIG. 5. Spindle organization in ARF1T31N expressing MI oocyte. (A) A control MI oocyte
contained an intact spindle; scale bar, 10 μm. (B) The MI spindle was diffused in ARF1T31N
expressing oocyte; scale bar, 10 μm.
FIG. 6. MAP kinase and MDK activity in ARF1T31N expressing oocytes. (A) Left lane, MAP
kinase was inactive in GV oocytes; Right lane, MAP kinase was active in control MII oocytes;
Middle lane, MAP kinase activity was greatly reduced in ARF1T31N expressing oocytes (2-cell MII
oocytes). (B) Localization of phosphorylated MAPK in the symmetrically divided ARF1T31N
expressing oocytes. Top panel: normal MII oocyte, localization of phosphorylated MAPK on the
spindle could be observed; Bottom panel: no phosphorylated MAPK could be observed on the
spindle of ARF1T31N expressing oocytes; scale bar, 10 μm. (C) Spontaneous activation occurred in
ARF1T31N expressing oocytes with pronuclei formed, whereas, no spontaneous activation occurred
in control MII oocytes; scale bar, 50 μm. (D) MDK activity in ARF1T31N expressing oocytes by
western blot; similar MDK activity could be observed in both normal MII and ARF1T31N
expressing oocytes.