Journal of Heredity 2011:102(2):228–236
doi:10.1093/jhered/esq107
Advance Access publication October 14, 2010
Ó The American Genetic Association. 2010. All rights reserved.
For permissions, please email: [email protected].
Assignment of 3 Genetic Linkage Groups
to 3 Chromosomes of Narrow-Leafed
Lupin
_
KAROLINA LESNIEWSKA, MICHAŁ KSIA˛ ZKIEWICZ
, MATTHEW N. NELSON, FRÉDÉRIC MAHÉ,
ABDELKADER AÏNOUCHE, BOGDAN WOLKO, AND BARBARA NAGANOWSKA
Address correspondence to Karolina Lesniewska at the address above, or e-mail: [email protected].
Abstract
The legume genus, Lupinus, has many notable properties that make it interesting from a scientific perspective, including its
basal position in the evolution of Papilionoid legumes. As the most economically important legume species, L. angustifolius
L. (narrow-leafed lupin) has been subjected to much genetic analysis including linkage mapping and genomic library
development. Cytogenetic analysis has been hindered by the large number of small morphologically uniform chromosomes
(2n 5 40). Here, we present a significant advance: the development of chromosome-specific cytogenetic markers and
assignment of the first genetic linkage groups (LGs) to chromosomal maps of L. angustifolius using the bacterial artificial
chromosome (BAC)–fluorescence in situ hybridization approach. Twelve clones produced single-locus signals that ‘‘landed’’
on 7 different chromosomes. Based on BAC-end sequences of those clones, genetic markers were generated. Eight clones
localized on 3 chromosomes, allowed these chromosomes to be assigned to 3 LGs. An additional single-locus clone may be
useful to combine an unassigned group (Cluster-2) with main LGs. This work provides a strong foundation for future
identification of all chromosomes with specific markers and for complete integration of narrow-leafed lupin LGs. This
resource will greatly facilitate the chromosome assignment and ordering of sequence contigs in sequencing the L. angustifolius
genome.
Key words: BAC-FISH, BEST marker, chromosome marker, linkage map, Lupinus angustifolius
Lupinus species belong to the legume family (Fabaceae),
one of the 3 largest Angiosperm families, and have features
typical of the family, most notably the ability to fix
nitrogen symbiotically with bacteria known as rhizobia
(e.g., Rhizobium or Bradyrhizobium) (Howieson et al. 1998).
Four Lupinus species are grain crops, with the most
important being L. angustifolius L. (narrow-leafed lupin).
Various Old and New World lupins have been the subject
of cytogenetic analyses including chromosome counting
and measuring (Naganowska and qadoń 2000; Maciel
and Schifino-Wittmann 2002; Conterato and SchifinoWittmann 2006) and genome size estimation (Naganowska
et al. 2003; Naganowska et al. 2006). Fluorescence in situ
228
hybridization (FISH) has been applied to many plant
genomes as a useful tool for chromosome analysis
(Kulikova et al. 2001; Pedrosa et al. 2002, 2003; Pagel
et al. 2004; Jiang and Gill 2006). Ribosomal DNA (rDNA)
FISH probes have been used in a number of lupin species
(Naganowska and Zielińska 2002; Hajdera et al. 2003;
Naganowska and Zielinska 2004; Kong et al. 2009).
Nuclear genome of L. angustifolius is partitioned into many
chromosomes (2n 5 40), which are small and morphologically uniform, making cytogenetic analysis and identification challenging (Kaczmarek et al. 2009). FISH analysis
using rDNA probes has proved unsuccessful in identifying
all L. angustifolius chromosomes.
Downloaded from http://jhered.oxfordjournals.org/ at UB Kaiserslautern on December 22, 2012
From the Laboratory of Structural Genomics, Institute of Plant Genetics, Polish Academy of Sciences, 60-479 Poznan,
Poland (Lesniewska, Ksia˛z_ kiewicz, Wolko, and Naganowska); the Department of Plant Anatomy and Cytology, Faculty of
Biology and Environmental Protection, University of Silesia, Jagiellonska 28, 40-032 Katowice, Poland (Lesniewska); the
School of Plant Biology, Faculty of Natural and Agricultural Sciences, The University of Western Australia, Crawley, Australia
(Nelson); the Centre for Legumes in Mediterranean Agriculture, Faculty of Natural and Agricultural Sciences, The
University of Western Australia, Crawley, Australia (Nelson); and the Unité Mixte de Recherche Centre National de la
Recherche Scientifique 6553 Ecobio, Equipe Mécanismes à l’Origine de la Biodiversité, Campus de Beaulieu, Université de
Rennes-1, Rennes, France (Mahé and Aı̈nouche).
Lesniewska et al. Towards Map Integration in Narrow-Leafed Lupin
Material and Methods
Seeds of L. angustifolius cv. Sonet were obtained from the
Polish Lupinus Gene Bank in the Breeding Station Wiatrowo
(Poznan Plant Breeders Ltd, Poland). Seeds of mapping
population consisting of 89 F8 recombinant inbred lines
(RILs) of a cross between a breeding line 83A:476 and
a wild-type P27255 (Boersma et al. 2005) were kindly
provided by Huaan Yang, Department of Agriculture and
Food, Western Australia.
BAC clones were originated from the library of
L. angustifolius cv. Sonet nuclear genome (Kasprzak et al.
2006). Clones used for LG/chromosome assignment analysis
are listed in Supplementary Table 1.
Additionally, the AntjM2 marker encoded the nucleotide
binding site sequence GLPLAL. Subsequently, the specific
primer pairs were designed to avoid incorporation of these
repetitive motives into probe sequences: AntjM1F:TGGTTTGTGCATTAGCATTTG, AntjM1R:CAACACATATGGTAAGAATCTAAG, AntjM2F:CTAAATTTCCTGGAACAAAAA, AntjM2R:AAACTCTATTTACTCATGTGTCAA, Ph258M2F:GTTCAATTCTGGTACTGAAC, Ph258M2R:GTAGTGACTGAAGAAACTTACAC, RustM1F:TAACATTCCTACCTTCTT, and RustM1R:AACACTAGTGCTTCAAAAA.
In addition, one hybridization probe was constructed on
the basis of the symbiotic receptor kinase gene sequence
fragment (SymRK ), which is one of the key genes of the
common signaling cascade involved in plant–microbial
symbiotic associations, such as arbuscular mycorrhiza and
nodulation (Endre et al. 2002; Stracke et al. 2002) The
primer pair used was as follows: SRK-F1:CTGCAACTGAAGGGTTTGAGAGCA and SRK-R5: CTTAACCTAACCTTGGTCAAGGC.
All probes were amplified by polymerase chain reaction
(PCR) using L. angustifolius cv. Sonet genomic DNA as
a template. The PCR products were purified by QIAquick
PCR Purification Kit (Qiagen, Hilden, Germany) and
radiolabeled by random priming HexaLabel DNA Labeling
Kit (Fermentas, Ontario, Canada) with the presence of
50 lCi [a-32P]-deoxycytidine 5#-triphosphate.
BAC Library Screening
High-density DNA macroarrays on Hybond-Nþ 22.2 22.2 cm nylon filters (Kasprzak et al. 2006) were hybridized
with probes for 16 h at 65 °C in a hybridization solution
composed of 5 standard saline citrate (SSC) (0.75 M NaCl,
0.075 M sodium citrate), 5 Denhardt’s solution (0.1% w/v
Ficoll-400, 0.1% w/v polyvinylpyrrolidone, 0.1% w/v
bovine serum albumin [BSA]), and 0.5% w/v sodium
dodecyl sulfate (SDS). Three high stringency washes in 0.1
SSC and 0.1% SDS at 65 °C for 30 min were conducted. For
RustM1 and Ph258M2 probes, the temperature of washes
was reduced to 60 °C. After hybridization, macroarrays were
exposed for 24–48 h to BAS-MS 2340 imaging plates
(Fujifilm) and scanned using a FLA-5100 phosphoimager
(Fujifilm). Verification of clones that gave positive hybridization signals was performed by PCR using the same sets of
primers that were applied for probe amplification.
Selection of BAC Clones
Hybridization probes for BAC library screening were
prepared based on DNA sequences originated from genetic
markers closely linked to disease resistance genes: AntjM1
and AntjM2 markers linked to anthracnose resistance gene,
Lanr-1 (Yang et al. 2004; You et al. 2005), Ph258M2,
a marker linked to Phomopsis stem blight resistance gene,
Phr-1 (Yang et al. 2002), and RustM1, a marker linked to
lupin rust resistance trait (Sweetingham et al. 2005). As the
markers were developed by MFLP technique (Yang et al.
2001), they contained microsatellite motifs: (TTG)6 in
AntjM1, (AAC)6 in Ph258M2, and (GA)7 in RustM1.
BAC DNA Isolation
BAC DNA was isolated from single Esherichia coli colonies
by a miniprep method using QIAprep Spin Miniprep Kit
(Qiagen) according to the protocol of Farrar and Donnison
(2007) and digested using restriction enzyme NotI (Roche
Diagnostics, Basel, Switzerland). The quality and size of
inserts were estimated by pulsed field gel electrophoresis
(PFGE). To estimate insert size, Lambda ladder PFG marker
(New England Biolabs, Ipswich, MA) and O#GeneRuler
1 kb Plus DNA Ladder, ready-to-use (Fermentas) were used
as fragment size markers.
229
Downloaded from http://jhered.oxfordjournals.org/ at UB Kaiserslautern on December 22, 2012
One solution may be to conduct FISH using bacterial
artificial chromosome (BAC) clones as probes (a procedure
known as BAC-FISH) that enables physical localization of
relatively large fragments of nuclear DNA directly on
chromosomes. BAC probes can serve various purposes,
such as obtaining chromosome-specific landmarks and
assignment of genetic linkage groups (LGs) to corresponding chromosomes (Islam-Faridi et al. 2002). However, BAC
clones of L. angustifolius have not so far been used for LG
and chromosome assignment.
Over the last decade, intensive efforts have been made to
construct lupin genetic maps. For L. angustifolius, maps were
established based on microsatellite fragment length polymorphism (MFLP) (Boersma et al. 2005) and gene-based
markers (Nelson et al. 2006). Recently, Nelson et al. (2010)
constructed a consensus genetic map consisting of .1100
loci based on combined data from the previous 2 maps. This
new reference map for L. angustifolius comprises 20 main
LGs (narrow leafed lupins [NLLs]) and 3 small unlinked
groups (Clusters), which together with the BAC library of
L. angustifolius genome constructed by Kasprzak et al. (2006)
provides the resources required for detailed integrative
genome analysis of narrow-leafed lupin using the BACFISH approach. In this study, we established a set of BACbased cytogenetic landmarks that allowed unambiguous
identification of 7 L. angustifolius chromosomes. Additionally, these BACs were used for generation of genetic
markers to find LGs corresponding to particular chromosome pairs.
Journal of Heredity 2011:102(2)
Mitotic Chromosome Preparation
Fluorescence In Situ Hybridization
FISH was carried out according to the protocol of Jenkins
and Hasterok (2007) with minor modifications. BAC DNA
was labeled with digoxygenin-11-dUTP and/or tetramethylrhodamine-5-dUTP (Roche Diagnostics) by nick translation
reaction as described by Jenkins and Hasterok (2007). In
brief, the slides were pretreated with RNase (100 lg/ml) in
2 SSC in a humid chamber at 37 °C for 1 h, washed
3 times in 2 SSC at room temperature (RT), and treated
with pepsin (50 mg/ml) at 37 °C for 12 min. Slides were
dehydrated in ethanol series (50, 70, ;100%) and dried at
RT. Hybridization mixture (50% deionized formamide, 10%
dextran sulfate, 2 SSC, 0.5% SDS, sonicated salmon sperm
DNA in 25–100 excess of the probe, 75–200 ng probe per
slide) was denatured at 90 °C for 9 min, then applied to the
chromosome preparation, and denatured together at 78 °C
for 10 min using thermal cycler for in situ hybridization
(Twin Tower, PTC-200, MJ Research). Hybridization was
carried out in a humid chamber at 37 °C for 20–24 h.
Posthybridization washes were conducted in 15% demonized formamide in 0.1 SSC at 42 °C, which is the
equivalent of 82% stringency (Schwarzacher and HeslopHarrison 2000). Immunodetection of digoxigenated DNA
probes was carried out with fluorescein isothiocyanateconjugated antidigoxigenin primary antibodies (Roche
Diagnostics). Chromosomes were counterstained with
2 lg/ml 4#,6-diamidino-2-phenylindole (Sigma) in Vectashield antifade mounting medium (Vector Laboratories,
Burlingame, CA). Slides were examined with an OLYMPUS
BX 60 microscope using Cell_F software, the images were
captured using a CCD monochromatic camera, tinted in
230
Genomic DNA Isolation
Genomic DNA of individual plants of mapping population
and parental lines was extracted from the young leaf tissue
(3–4 leaves) using a DNeasy Plant Mini Kit (Qiagen) and the
protocol provided by the manufacturer.
BEST Markers
BAC-ends were sequenced in both 3# and 5# directions.
These sequences approximately 500 bp long have been
submitted to GenBank and are available under accession
numbers GS887821–GS887832. Primer pairs for BEST
marker generation were designed basing on end sequences
using free website software http://www.ncbi.nlm.nih.gov/
tools/primer-blast/index.cgi?LINK_LOC5BlastHomeAd.
The PCR profiles were optimized for parental lines of
mapping population 83A:476 and P27255 using temperature
gradient or touchdown PCR methods to detect polymorphism (length or present/absent type). In the case of
monomorphic product, the genomic DNA of both parental
lines was purified by the QIAquick PCR Purification Kit
(Qiagen), PCR performed, and the amplicons directly
sequenced (Faculty of Biology, Adam Mickiewicz University,
Poznan, Poland), using the forward primer as the sequencing
primer. Single nucleotide polymorphism (SNP) was detected
using Sequencher 4.7 software (Gene Codes Corporation,
Ann Arbor, MI). Digestion with specific restriction enzyme
(Fermentas) was used to generate cleaved amplified polymorphic sequence (CAPS) markers, in order to distinguish
parental alleles. Restriction enzymes were chosen using
Sequencher 4.7 and NEBCutter program (Vincze et al. 2003).
Segregation of polymorphic markers among 89 F8 RILs
of the mapping population was tested using electrophoretic
separation of DNA fragments in 2% agarose gel with
O#Range Ruler 100 kbp DNA Ladder as a size marker
(Fermentas) and visualized by ethidium bromide staining.
Sequences of BEST markers are accessible under accession
numbers GF102179–GF102183 in GenBank.
Linkage Mapping
The new BEST markers were localized in the LGs of
recently constructed genetic map of L. angustifolius genome
(Nelson et al. 2010). Segregation data of new markers were
introduced to the framework marker data set of the existing
map, and LGs were reconstructed using Map Manager
QTXb20 software (Manly et al. 2001). The LGs were drawn
in MapChart software (Voorrips 2002).
Results
Identification of Individual Chromosomes
The L. angustifolius BAC library was subjected to several
independent hybridization procedures with probes designed
Downloaded from http://jhered.oxfordjournals.org/ at UB Kaiserslautern on December 22, 2012
Chromosome preparations were made from the root
meristem tissue according to the protocol for mitotic
chromosome squashes provided by Jenkins and Hasterok
(2007) with minor modifications resulting from specificity of
the narrow-leafed lupin material. To synchronize and
accelerate germination, the seeds were aired in tap water at
25 °C overnight prior to transfer on moistened filter paper
in petri dishes at 25 °C. Seedlings with 1.5–2.0 cm root
length were treated in chilled tap water (2–3 °C) for 24 h to
accumulate cells at metaphase. Excised roots were drained
and immediately fixed in freshly made 3:1 ethanol:glacial
acetic acid mixture and stored at 20 °C until use. Roots
were digested in enzyme solution comprising 40% (v/v)
pectinase (Sigma, St. Louis, MO), 3% (w/v) cellulase
(Sigma), and 1.5% (w/v) cellulase ‘‘Onozuka R-10’’ (Serva,
Heidelberg, Germany) for 3–4 h at 37 °C. Chromosome
preparations were made from dissected meristematic tissue
on alcohol-cleaned slides in one drop of 60% acetic acid and
frozen. Preparations were postfixed in 3:1 ethanol:glacial
acetic acid, dehydrated in 99.8% ethanol for 20 min, and
then air-dried. The slides were quality-controlled under
a phase-contrast microscope (BX41, Olympus) and used for
FISH.
Wasabi (Hamamatsu Photonics), and superimposed using
Micrografx (Corel) Picture Publisher 8 software.
Lesniewska et al. Towards Map Integration in Narrow-Leafed Lupin
noting that in 2 chromosomes more than one chromosomespecific BAC clones were mapped. Thirty-one clones,
representing 72% of the total, hybridized to multiple sites
across most or all chromosomes (examples shown on
Figure 2e,f ). These clones were excluded from analysis of
assignment of LGs to particular chromosomes.
Genetic Markers and Assignment of LGs to Particular
Chromosomes
The 12 BAC-based cytogenetic markers were assessed as
genetic markers. Dominant polymorphisms (i.e., amplified
product present or absent) were identified for 3 BEST
markers (44J16_3, 142D13_3, and 1M23_5). Of the
remaining 9 BEST markers, PCR amplified fragments
derived from parental DNAs were found to contain SNPs
in 2 cases (111G03_5 and 3B18_3). Based on these SNPs,
CAPS markers were developed. No more sequence polymorphisms were found in the remaining 7 parental
products, even though BAC-end sequences were extended
using the same forward primer as for amplification of PCR
product in the parental lines (Table 2). The 5 BEST markers
developed were localized to 3 main LGs (NLL-06, NLL-08,
and NLL-17) and one cluster (Cluster-2) of the reference
L. angustifolius genetic map of Nelson et al. (2010) (Table 2,
Figure 3d1–4).
Discussion
FISH with clones containing large inserts of nuclear DNA,
such as BACs, has proved to be an effective method for
chromosome identification in many plants, including
genomes with small morphologically undistinguished chromosomes, for example, Solanum tuberosum (Dong et al. 2000)
and Brassica oleracea (Howell et al. 2002) or with high
chromosome number, for example, Gossypium hirsutum
(Wang et al. 2007). Moreover, BAC clones can be
successfully used as markers to integrate chromosomal
and genetic maps (Jiang and Gill 2006).
Among the 43 clones screened, we obtained 12 BACs
that were found to be useful as cytogenetic markers. The
largest number of BACs mapped to the same chromosome
arm was 4 (84D22, 111B08, 142C04, and 142D13).
Figure 1. PFGE of insert DNA from selected clones from Lupinus angustifolius BAC library. Clones were digested using the
restriction enzyme, NotI. M1—Lambda ladder PFG marker and M2—O#GeneRuler 1 kb Plus DNA Ladder fragment size markers.
231
Downloaded from http://jhered.oxfordjournals.org/ at UB Kaiserslautern on December 22, 2012
on the basis of the SymRK gene sequence and sequences of
genetic markers linked to resistance genes for anthracnose
(AntjM1 and AntjM2), lupin rust (RustM1), and Phomopsis
stem blight (Ph258M2). Positive hybridization signals were
verified by PCR, using primers specific for each probe and
insert DNA from the selected BAC clones as a template.
For each probe, analyzed PCR products with appropriate length and sequence complementary to the probe
sequence were amplified. From among selected clones,
18 BACs identified using the markers linked to disease
resistance genes and 4 BACs identified using the SymRK
probe were chosen for FISH mapping. In addition, 21
BACs were randomly chosen from the library (Supplementary Table 1). All 43 BACs were separated by PFGE
to estimate the size of inserts and the number of NotI
restriction sites (examples of clones shown on Figure 1).
Insert size ranged from 20 to 160 kbp with average size
77 kbp. Most clones possess no restriction sites for NotI
within the insert with the exceptions of the 3B18 and 3N20
clones, each contain one site (Supplementary Table 1).
The BAC-FISH experiments for all tested clones were
performed at the same stringency conditions, without using
fast-denaturing DNA fractions such as C0t DNA (often
applied to suppress weak or nonspecific hybridization
signals). BAC probes that produced one strong signal
without background were selected for FISH and used at
least thrice in duplicate experiments to ensure that clones
were localized specifically in a given chromosome. From
a total number of 43 BACs, 12 clones (i.e., 7 carrying
molecular markers and 5 randomly chosen) hybridized to
single locus per genome, that is, giving unique FISH pattern
on mitotic chromosomes and were defined as cytogenetic
markers. The single locus BACs were colocalized by
multiple dual or triple-color FISH experiments in various
clone combinations (Table 1). All the chromosome-specific
clones map to terminal or subterminal regions of chromosomes (Figure 2a–d and Figure 3a–c,e–f). Four clones
(84D22, 111B08, 142C04, and 142D13) landed on the same
chromosome arm (Figure 3b,c). The clones 111G03 and
136C16 hybridized to one arm of another chromosome,
whereas clone 3B18 hybridized to the opposite arm of the
same chromosome (Figure 3e). The 5 remaining cytogenetic
markers were mapped as is shown in Table 1. It is worth
Journal of Heredity 2011:102(2)
Table 1
111G03
136C16
44J16
84D22
111B08
142C04
142D13
1M23
2B03
3B18
6E05
8C03
Pairs of BACs used for FISH to obtain chromosome-specific markers in Lupinus angustifolius
111G03
136C16
44J16
84D22
111B08
142C04
142D13
1M23
2B03
3B18
6E5
8C03
—
y
n
n
n
n
n
n
n
y
n
n
y
—
n
n
n
n
n
n
n
y
n
n
n
n
—
n
n
n
n
n
n/a
n
n/a
n/a
n
n
n
—
y
y
y
n
n
n
n/a
n/a
n
n
n
y
—
y
y
n
n
n
n/a
n/a
n
n
n
y
y
—
y
n
n
n
n/a
n/a
n
n
n
y
y
y
—
n
n
n
n/a
n/a
n
n
n
n
n
n
n
—
n
n
n
n/a
n
n
n
n
n
—
n
n
n
y
y
n
n
n
n
n
n
n
—
n
n
n
n
n/a
n/a
n/a
n/a
n/a
n/a
n
n
—
n
n
n
n/a
n/a
n/a
n/a
n/a
n
n
n
n
—
n/a
n
y, pairs of BAC clones hybridized to the same chromosome pair; n, pairs of BAC clones hybridized to different chromosome pairs; n/a, not analyzed.
Figure 2. Localization of selected BAC clones on Lupinus
angustifolius chromosomes using FISH; (a) 111B08 (green),
(b) 84D22 (red), (c) 142D13 (green) and 2B3 (red), (d) 6E05
(green), (e) 119M19 (green), and (f) 120E23 (red), both carrying
repetitive DNA sequences widespread in the genome.
Chromosomes counterstained with 4#,6-diamidino-2phenylindole (blue). Bars: 5 lm.
232
sents one of a few examples in L. angustifolius where 2 single
locus BAC clones enabled unambiguous discrimination of
2 chromosomal termini. However, such precise cytogenetic
mapping is not uncommon in some other plant species, for
example, for all chromosomes in Cucumis sativus (Ren et al.
2009), 4 of 10 Sorghum bicolor chromosomes (Kim et al. 2005)
although only 2 of 26 in the allopolyploid G. hirsutum (Wang
et al. 2007). The chromosome colocalization of the 5
remaining single locus BAC clones was not tested for all
combinations. Further simultaneous FISH mapping of
various BAC combinations should establish more precisely
their chromosomal localization. However, it has to be accepted that due to the relatively high chromosome number
and lack of clear morphometrical markers, establishing
a BAC-based L. angustifolius cytogenetic map will not be as
straightforward as it was in species with considerably lower
chromosome number and more asymmetric karyotype,
such as for example Brachypodium distachyon (Hasterok et al.
2006).
A striking feature of all single locus BACs mapped in
this study is their localization to distal chromosomal regions.
A similar pattern of single-locus BAC localization was
observed in Medicago truncatula (Kulikova et al. 2001) and
Lotus japonicus (Pedrosa et al. 2002). It may be attributed to
tendency of subterminal and terminal regions of chromosomes in many species to be the most gene dense, with
lowest concentrations of repetitive DNA sequences
(Schmidt and Heslop-Harrison 1998). The findings of Ito
et al. (2000), who revealed that cDNA-based hybridization
probes preferentially mapped in the distal regions of
Lo. japonicus chromosomes, seem to support this hypothesis.
In the present study, 2 BAC clones, that is, 111G03 and
136C16, known to carry SymRK gene sequence, were also
found to hybridize with a distal, predominantly euchromatic,
chromosome region.
The single-locus BACs contrast with those which
produce multiple hybridization signals along all chromosomes in the complement of L. angustifolius (Figure 2e,f).
Although these clones cannot be utilized as chromosomespecific markers, they contribute to general characterization
of the L. angustifolius genome. Such dispersed signals of
Downloaded from http://jhered.oxfordjournals.org/ at UB Kaiserslautern on December 22, 2012
Moreover, these clones were used in physical mapping for
contig assembly (Ksia˛ z_ kiewicz et al. 2008).
Cytogenetic mapping of the 4 clones mentioned above
supported the preliminary results of physical mapping.
Mapping of BAC clones containing the same sets of MFLPderived markers for disease resistance genes on different
chromosomes can be explained that these sequences in
L. angustifolius genome are present in relatively high copy
number due to repetitive elements and only a part of them
can be linked to analyzed traits (Ksia˛ z_ kiewicz et al. 2008).
However, the analysis of structure and organization of
disease resistance regions in L. angustifolius genome was not
investigated in our study. Three other BACs landed on
another chromosome. Two of them (111G03 and 136C16)
hybridized to the same arm; the third clone (3B18) was
localized in the opposite arm. This chromosome repre-
Lesniewska et al. Towards Map Integration in Narrow-Leafed Lupin
hybridization are most likely produced by repetitive DNA
sequences, widely distributed in the genome. They were also
commonly observed in other legume plants, such as
Phaseolus vulgaris (Pedrosa-Harand et al. 2009) and Glycine
max (Lin et al. 2005). Use of specific fast-denaturing DNA
fractions, such as C0t DNA, to suppress hybridization of the
probe components containing repetitive DNA was found
effective in some species, for example B. oleracea (Howell
et al. 2002) and G. hirsutum (Wang et al. 2007). This
procedure increased the number of BAC clones producing
effectively single-locus signals and thus facilitated the
process of cytogenetic mapping. On the other hand,
the blocking efficiency of C0t DNA fractions depends on
the amounts of repetitive DNA within certain BACs (Dong
et al. 2000) and therefore can be insufficient in some
experiments (Kim et al. 2002). However, it may be
worthwhile to consider that about 25% of BACs used in
this study produced single-locus signals without any
sophisticated suppression of potential cross-hybridization.
Linkage maps display a linear order of markers and the
frequency of recombination between them. However,
because of unequal distribution of crossover frequency
along chromosome arms, genetic distance does not simply
reflect physical distance (Harper and Cande 2000). BAC
clones containing genetic markers were used for integration
or assigning LGs and chromosomal maps for many
important crop species, for example, S. tuberosum (Tang
et al. 2009) and Zea mays (Danilova and Birchler 2008). The
relationship between the genetic and chromosome map of
L. angustifolius has not been analyzed so far. Recently, Nelson
et al. (2010) published a reference map of L. angustifolius,
which provides the foundation to assign LGs to their
chromosomes. In this study, we present the first use of
BEST markers to link genetic and cytogenetic maps of
narrow-leafed lupin. We assigned 3 LGs (NLL-06, NLL-08,
and NLL-17) and one small cluster (Cluster-2) to 4
chromosomes. This approach was focused on generating
BAC-based chromosome-specific physical markers and
233
Downloaded from http://jhered.oxfordjournals.org/ at UB Kaiserslautern on December 22, 2012
Figure 3. Lupinus angustifolius mitotic chromosomes with BAC clones determined by FISH as chromosome-specific markers: (a)
clone 44J16 (green), clone 142C04 (red); (b) 84D22 (green), 142C04 (red), and 142D13 (yellow); (c) 84D22 (green) and 111B08
(red). d1–d4: reciprocal assignment of 3 main LGs (NLL-06, NLL-08, and NLL-17) plus one small cluster (Cluster-2) to
chromosomes of Lupinus angustifolius (LANG 06, LANG 08, LANG 17, LANG—unassigned chromosome, respectively) using
BAC clones as FISH probes and templates for BEST markers. (e) 111G03 (green), 136C16 (red), and 3B18 (green, mapped in
opposite arm of the chromosome), (f) 1M23 (green), 3B18 (red), and 8C03 (yellow, arrows). Chromosomes counterstained with
4#,6-diamidino-2-phenylindole (blue). Bars: 5 lm.
Journal of Heredity 2011:102(2)
Table 2 BAC clones used for developing BEST markers and characteristics of the markers used to assign LGs to chromosomes of
Lupinus angustifolius (LANG)
LGa
LANG
GenBank
accession
17
—
P1: 231 þ 33
GF102179
Yes
17
17
—
17
P1: 364
—
—
—
P1: 360
P1: 442
—
—
—
GF102182
No
Yes
Yes
Yes
No
No
Yes
Yes
Yes
6
8
8
8
8
Cluster-2
—
—
—
BEST marker
Marker type
Marker length (bp)
111G03
111G03_5
P1: 256 þ 197
P2: 453
136C16
3B18
No
—
3B18_3
P2: 264
44J16
84D22
111B08
142C04
142D13
1M23
2B03
6E05
8C03
No
44J16_3
—
—
—
142D13_3
1M23_5
—
—
—
Codominant
CAPS (SduI)
17
—
Codominant
CAPS (TaqI)
17
Dominant
—
—
—
Dominant
Dominant
—
—
—
6
8
8
8
8
?
?
?
?
GF102183
—
—
—
GF102180
GF102181
—
—
—
P1: parental line 83A/476; P2: parental line P27255.
a
LG designation according to Nelson et al. (2010).
BEST-based genetic markers to relate the chromosomes
with respective LGs. To date, chromosome nomenclature
was not associated with any genetic maps of L. angustifolius.
We propose to number individual narrow-leafed lupin
chromosomes (defined as LANG) according to numbers of
their corresponding LGs. We use the most comprehensive
L. angustifolius genetic map (Nelson et al. 2010) that not only
combines the data from 2 previous maps (Boersma et al.
2005; Nelson et al. 2006) but is also enriched by 200 new
markers. In the genetic part of the current research, 5 BEST
markers were developed. Mapping dominant marker
44J16_3 in NLL-06 assigns this LG to chromosome LANG
06 (Figure 3a). The largest number of BACs, that is, 84D22,
111B08, 142C04, and 142D13 was mapped to LANG 08.
The BEST marker generated from clone 142D13 was
mapped to NLL-08, where the Lentus gene, responsible in
part for pod-shattering phenotype, was also mapped. Two
of 4 BACs carrying SymRK sequence (111G03 and 136C16)
were colocalized to the same chromosome arm, opposite to
that in which clone 3B18 was mapped. Using codominant
CAPS markers 111G03_5 and 3B18_3, we linked LG NLL17 to chromosome LANG 17 (Figure 3e). This chromosome contains very important genes, for example, the
SymRK gene mentioned above that is required for successful
plant–microbial interactions with fungi and/or rhizobial
bacteria, but also Mollis, a gene responsible for water
permeability of seeds, which is a key domestication trait.
There were 3 small clusters of markers on the L. angustifolius
genetic map of Nelson et al. (2010), and the marker 1M23_5
was mapped within Cluster-2. This strongly supports the
location of this cluster in one of L. angustifolius chromosomes
(carrying the 1M23 clone). Identification of a BAC-FISH
marker at the opposite end of chromosome LANG 17 would
be valuable for bringing the genetic map of L. angustifolius
closer to completion. It would be equally valuable to do the
234
same for Cluster-1 and Cluster-3 of the genetic map (Nelson
et al. 2010).
Development of cytogenetic mapping has demonstrated
that the integrative approach is a prerequisite for better
understanding of L. angustifolius genome organization. For
example, LGs NLL-06, NLL-08, and NLL-12 were used to
study synteny between L. angustifolius and legume model
plant, Lo. japonicus (Nelson et al. 2010). Based on both
Nelson et al. (2010) and presented here results, it can be
inferred that L. angustifolius chromosomes LANG 06 and
LANG 08 show homology to Lo. japonicus chromosome Lj2
and Lj5, respectively.
In this study, a set of chromosome-specific BACs was
developed to assign 3 main LGs to particular chromosomes
of L. angustifolius genome. This can be considered as
a starting point to assign the remaining LGs to the relevant
chromosomes and eventually to construct a complex,
integrated map of L. angustifolius genome, which can be
useful for the lupin community in a variety of applications.
It has to be stressed, however, that for species with high
chromosome numbers, such an approach is laborious and
time consuming, as in the case of G. hirsutum (Wang et al.
2006; Wang et al. 2007). Clones from the BAC library of
L. angustifolius nuclear genome used in this study can be
potentially an effective tool for comparative analysis of
other Lupinus species and can be helpful in a genome
sequencing project, particularly in the characterization of
clones containing genes controlling agricultural traits. The
importance of narrow-leafed lupin as a crop plant and the
relative wealth of data concerning its genome lead to
a potential role as a useful model species within the genus
Lupinus. Preliminary experiments using heterologous landing
of L. angustifolius BACs on chromosomes of related Lupinus
species support this possibility (Lesniewska, unpublished
data).
Downloaded from http://jhered.oxfordjournals.org/ at UB Kaiserslautern on December 22, 2012
Extended
sequence
BAC clone
Lesniewska et al. Towards Map Integration in Narrow-Leafed Lupin
Supplementary Material
Supplementary material can be found at http://www.jhered
.oxfordjournals.org/.
Funding
Polish Ministry of Science and Higher Education within the
framework of projects No. N301 084 32/3234 and No. N
N301 165635.
Islam-Faridi MN, Childs KL, Klein PE, Hodnett G, Menz MA, Klein RR,
Rooney WL, Mullet JE, Stelly DM, Price HJ. 2002. A molecular cytogenetic
map of sorghum chromosome 1: fluorescence in situ hybridization analysis
with mapped bacterial artificial chromosomes. Genetics. 161:345–353.
Ito M, Miyamoto J, Mori Y, Fujimoto S, Uchiumi T, Abe M, Suzuki A,
Tabata S, Fukui K. 2000. Genome and chromosome dimensions of Lotus
japonicus. J Plant Res. 113:435–442.
Jenkins G, Hasterok R. 2007. BAC ‘landing’ on chromosomes of
Brachypodium distachyon for comparative genome alignment. Nat Protoc.
2:88–98.
Jiang J, Gill BS. 2006. Current status and the future of fluorescence in situ
hybridization (FISH) in plant genome research. Genome. 49:1057–1068.
The authors thank Prof. Jolanta Maluszynska, Prof. Robert Hasterok
(University of Silesia, Katowice, Poland), and Dr Tim Langdon
(Aberystwyth University, UK) for their critical reading and valuable
comments on the manuscript.
Kasprzak A, Safar J, Janda J, Dolezel J, Wolko B, Naganowska B. 2006. The
bacterial artificial chromosome (BAC) library of the narrow-leafed lupin
(Lupinus angustifolius L.). Cell Mol Biol Lett. 11:396–407.
References
Boersma JG, Pallotta M, Li C, Buirchell BJ, Sivasithamparam K, Yang H.
2005. Construction of a genetic linkage map using MFLP and identification
of molecular markers linked to domestication genes in narrow-leafed lupin
(Lupinus angustifolius L.). Cell Mol Biol Lett. 10:331–344.
Conterato IF, Schifino-Wittmann MT. 2006. New chromosome numbers,
meiotic behaviour and pollen fertility in American taxa of Lupinus
(Leguminosae): contributions to taxonomic and evolutionary studies. Bot
J Linn Soc. 150:229–240.
Danilova TV, Birchler JA. 2008. Integrated cytogenetic map of mitotic
metaphase chromosome 9 of maize: resolution, sensitivity, and banding
paint development. Chromosoma. 117:345–356.
Dong F, Song J, Naess SK, Helgeson JP, Gebhardt C, Jiang J. 2000.
Development and applications of a set of chromosome-specific cytogenetic
DNA markers in potato. Theor Appl Genet. 101:1001–1007.
Endre G, Kereszt A, Kevei Z, Mihacea S, Kalo P, Kiss GB. 2002.
A receptor kinase gene regulating symbiotic nodule development. Nature.
417:962–966.
Farrar K, Donnison IS . 2007. Construction and screening of BAC libraries
made from Brachypodium genomic DNA. Nat Protoc. 2:1661–1674.
Hajdera I, Siwinska D, Hasterok R, Maluszynska J. 2003. Molecular
cytogenetic analysis of genome structure in Lupinus angustifolius and Lupinus
cosentinii. Theor Appl Genet. 107:988–996.
Harper LC, Cande WZ. 2000. Mapping a new frontier; development of
integrated cytogenetic maps in plants. Funct Integr Genomics. 1:89–98.
Hasterok R, Marasek A, Donnison IS, Armstead I, Thomas A, King IP,
Wolny E, Idziak D, Draper J, Jenkins G. 2006. Alignment of the genomes
of Brachypodium distachyon and temperate cereals and grasses using bacterial
artificial chromosome landing with fluorescence in situ hybridization.
Genetics. 173:349–362.
Howell EC, Barker GC, Jones GH, Kearsey MJ, King GJ, Kop EP, Ryder CD,
Teakle GR, Vicente JG, Armstrong SJ. 2002. Integration of the cytogenetic and genetic linkage maps of Brassica oleracea. Genetics. 161:
1225–1234.
Howieson JG, Fillery IRP, Legocki AB, Sikorski MM, Stepkowski T,
Minchin FR, Dilworth MJ. 1998. Nodulation, nitrogen fixation and nitrogen
balance. In: Gladstones JS, Atkins C, Hamblin J, editors. Lupins as crop
plants: biology, production and utilization. Wallingford (UK): CAB
International. p. 149–180.
Kim JS, Childs KL, Islam-Faridi MN, Menz MA, Klein RR, Klein PE,
Price HJ, Mullet JE, Stelly DM. 2002. Integrated karyotyping of sorghum
by in situ hybridization of landed BACs. Genome. 45:402–412.
Kim JS, Klein PE, Klein RR, Price HJ, Mullet JE, Stelly DM. 2005.
Chromosome identification and nomenclature of Sorghum bicolor. Genetics.
169:1169–1173.
Kong F, Rudloff E, Snowdon RJ, Wang YP. 2009. Chromosomal
distribution of 18S-25S rDNA in four Lupinus species visualized by
fluorescence in situ hybridization. Genetika. 45:1148–1152.
Ksia˛ z_ kiewicz M, KarŁowski W, Yang H, Wolko B. 2008. Physical and
genetic analysis of genome region conferring resistance to fungal pathogens
in the narrow-leafed lupin. In: Palta JA, Berger JD, red, editors. Lupins for
health and wealth. Fremantle (Australia): Proceedings of the 12th
International Lupin Conference. p. 263–266.
Kulikova O, Gualtieri G, Geurts R, Kim DJ, Cook D, Huguet T, de Jong JH,
Fransz PF, Bisseling T. 2001. Integration of the FISH pachytene and genetic
maps of Medicago truncatula. Plant J. 27:49–58.
Lin JY, Jacobus BH, SanMiguel P, Walling JG, Yuan Y, Shoemaker RC,
Young ND, Jackson SA. 2005. Pericentromeric regions of soybean (Glycine
max L. Merr.) chromosomes consist of retroelements and tandemly
repeated DNA and are structurally and evolutionarily labile. Genetics.
170:1221–1230.
Maciel HS, Schifino-Wittmann MT. 2002. First chromosome number
determinations in south-eastern South American species of Lupinus L.
(Leguminosae). Bot J Linn Soc. 139:395–400.
Manly KF, Cudmore RH Jr, Meer JM. 2001. Map Manager QTX, crossplatform software for genetic mapping. Mamm Genome. 12:930–932.
Naganowska B, qadoń D. 2000. Chromosomes of Lupinus hispanicus subsp.
hispanicus Boiss. et Reut., L. luteus L. and their hybrids. J Appl Genet. 41:167–170.
Naganowska B, Wolko B, Sliwinska E, Kaczmarek Z. 2003. Nuclear DNA
content variation and species relationships in the genus Lupinus (Fabaceae).
Ann Bot. 92:349–355.
Naganowska B, Wolko B, Śliwińska E, Kaczmarek Z, Schifino-Wittmann M.
2006. 2C DNA variation and relationships among New World species of the
genus Lupinus (Fabaceae). Plant Syst Evol. 256:147–157.
Naganowska B, Zielińska A. 2002. Physical mapping of 18S-25S rDNA and
5S rDNA in Lupinus via fluorescent in situ hybridization. Cell Mol Biol Lett.
7:665–670.
Naganowska B, Zielinska A. 2004. Localisation of rDNA in the Lupinus
genome during the cell cycle. J Appl Genet. 45:189–193.
Nelson MN, Moolhuijzen PM, Boersma JG, Chudy M, Lesniewska K,
Bellgard M, Oliver RP, Swiecicki W, Wolko B, Cowling WA, et al. 2010.
235
Downloaded from http://jhered.oxfordjournals.org/ at UB Kaiserslautern on December 22, 2012
Acknowledgments
Kaczmarek A, Naganowska B, Wolko B. 2009. Karyotyping of the narrowleafed lupin (Lupinus angustifolius L.) by using FISH, PRINS and computer
measurements of chromosomes. J Appl Genet. 50:77–82.
Journal of Heredity 2011:102(2)
Aligning a new reference genetic map of Lupinus angustifolius with the
genome sequence of the model legume, Lotus japonicus. DNA Res. 17:73–83.
Nelson MN, Phan HT, Ellwood SR, Moolhuijzen PM, Hane J, Williams A,
O#Lone CE, Fosu-Nyarko J, Scobie M, Cakir M, et al. 2006. The first gene-based
map of Lupinus angustifolius L.-location of domestication genes and conserved
synteny with Medicago truncatula. Theor Appl Genet. 113:225–238.
Pagel J, Walling JG, Young ND, Shoemaker RC, Jackson SA. 2004.
Segmental duplications within the Glycine max genome revealed by
fluorescence in situ hybridization of bacterial artificial chromosomes.
Genome. 47:764–768.
Pedrosa A, Sandal N, Stougaard J, Schweizer D, Bachmair A. 2002.
Chromosomal map of the model legume Lotus japonicus. Genetics.
161:1661–1672.
Pedrosa A, Vallejos CE, Bachmair A, Schweizer D. 2003. Integration of
common bean (Phaseolus vulgaris L.) linkage and chromosomal maps. Theor
Appl Genet. 106:205–212.
Ren Y, Zhang Z, Liu J, Staub JE, Han Y, Cheng Z, Li X, Lu J, Miao H,
Kang H, et al. 2009. An integrated genetic and cytogenetic map of the
cucumber genome. PLoS One. 4:e5795.
Schmidt T, Heslop-Harrison JS. 1998. Genomes, genes and junk: the largescale organization of plant chromosomes. Trends Plant Sci. 3:195–199.
Schwarzacher T, Heslop-Harrison JS. 2000. Practical in situ_ hybridization.
Oxford: BIOS Scientific Limited, BIOS Scientific Publishers.
Stracke S, Kistner C, Yoshida S, Mulder L, Sato S, Kaneko T, Tabata S,
Sandal N, Stougaard J, Szczyglowski K, et al. 2002. A plant receptor-like
kinase required for both bacterial and fungal symbiosis. Nature.
417:959–962.
Sweetingham MW, Yang H, Buirchell BJ, Shea G, IS . 2005. Resistance to
rust in narrow-leafed lupin and development of molecular markers. In:
In van Santen E, Hill GD, editors. 11th International Lupin Conference.
Jalisco (Mexico): Proc of 11th International Lupin Conference. p. 14–16.
236
Vincze T, Posfai J, Roberts RJ. 2003. NEBcutter: a program to cleave DNA
with restriction enzymes. Nucleic Acids Res. 31:3688–3691.
Voorrips RE. 2002. MapChart: software for the graphical presentation of
linkage maps and QTLs. J Hered. 93:77–78.
Wang K, Guo W, Zhang T. 2007. Development of one set of chromosomespecific microsatellite-containing BACs and their physical mapping in
Gossypium hirsutum L. Theor Appl Genet. 115:675–682.
Wang K, Song X, Han Z, Guo W, Yu J, Sun J, Pan J, Kohel R, Zhang T.
2006. Complete assignment of the chromosomes of Gossypium hirsutum L. by
translocation and fluorescence in situ hybridization mapping. Theor Appl
Genet. 113:73–80.
Yang H, Boersma JG, You M, Buirchell BJ, Sweetingham MW. 2004.
Development and implementation of a sequence-specific PCR marker
linked to a gene conferring resistance to anthracnose disease in narrowleafed lupin (Lupinus angustifolius L.). Mol Breed. 14:145–151.
Yang H, Shankar M, Buirchell J, Sweetingham W, Caminero C, Smith C.
2002. Development of molecular markers using MFLP linked to a gene
conferring resistance to Diaporthe toxica in narrow-leafed lupin (Lupinus
angustifolius L.). Theor Appl Genet. 105:265–270.
Yang H, Sweetingham MW, Cowling WA, Smith PMC. 2001. DNA
fingerprinting based on microsatellite-anchored fragment length polymorphisms, and isolation of sequence-specific PCR markers in lupin
(Lupinus angustifolius L.). Mol Breed. 7:203–209.
You M, Boersma JG, Buirchell BJ, Sweetingham MW, Siddique KH, Yang H.
2005. A PCR-based molecular marker applicable for marker-assisted selection
for anthracnose disease resistance in lupin breeding. Cell Mol Biol Lett.
10:123–134.
Received July 14, 2010; Revised August 30, 2010;
Accepted September 7, 2010
Corresponding Editor: Brian Murray
Downloaded from http://jhered.oxfordjournals.org/ at UB Kaiserslautern on December 22, 2012
Pedrosa-Harand A, Kami J, Gepts P, Geffroy V, Schweizer D. 2009.
Cytogenetic mapping of common bean chromosomes reveals a less
compartmentalized small-genome plant species. Chromosome Res.
17:405–417.
Tang X, de Boer JM, van Eck HJ, Bachem C, Visser RG, de Jong H. 2009.
Assignment of genetic linkage maps to diploid Solanum tuberosum pachytene
chromosomes by BAC-FISH technology. Chromosome Res. 17:899–915.