Insect Science (2014) 21, 301–312, DOI 10.1111/1744-7917.12113
ORIGINAL ARTICLE
Evolutionary relationships of Pemphigus and allied genera
(Hemiptera: Aphididae: Eriosomatinae) and their primary
endosymbiont, Buchnera aphidicola
Lin Liu1,2 , Xing-Yi Li1,2 , Xiao-Lei Huang1 and Ge-Xia Qiao1
1 Key
Laboratory of Zoological Systematics and Evolution, Institute of Zoology, Chinese Academy of Sciences, and 2 University of Chinese
Academy of Sciences, Beijing, China
Abstract Aphids harbor primary endosymbionts, Buchnera aphidicola, in specialized
cells within their body cavities. Aphids and Buchnera have strict mutualistic relationships in nutrition exchange. This ancient association has received much attention from
researchers who are interested in endosymbiotic evolution. Previous studies have found
parallel phylogenetic relationships between non-galling aphids and Buchnera at lower taxonomic levels (genus, species). To understand whether relatively isolated habitats such as
galls have effect on the parallel relationships between aphids and Buchnera, the present
paper investigated the phylogenetic relationships of gall aphids from Pemphigus and allied genera, which induce pseudo-galls or galls on Populus spp. (poplar) and Buchnera.
The molecular phylogenies inferred from three aphid genes (COI, COII and EF-1α) and
two Buchnera genes (gnd, 16S rRNA gene) indicated significant congruence between
aphids and Buchnera at generic as well as interspecific levels. Interestingly, both aphid and
Buchnera phylogenies supported three main clades corresponding to the galling locations
of aphids, namely leaf, the joint of leaf blade and petiole, and branch of the host plant.
The results suggest phylogenetic conservatism of gall characters, which indicates gall
characters are more strongly affected by aphid phylogeny, rather than host plants.
Key words codivergence, gall, parallel evolution, phylogenetic conservatism
Introduction
Bacterial symbionts play important roles on the diversification and evolution of many insect groups. Some endosymbionts provide their hosts with essential nutrients,
especially insect hosts that feed on plant sap (Moran &
Telang, 1998; Baumann et al., 2013). About 10%–20 %
of insect species depend on intracellular bacterial mutualists for their viability and reproduction (Douglas, 1989).
Correspondence: Ge-Xia Qiao and Xiao-Lei Huang, Key
Laboratory of Zoological Systematics and Evolution, Institute of
Zoology, Chinese Academy of Sciences, 1 Beichen West Road,
Beijing 100101, China. Tel: +86 10 64807133; fax: +86 10
64807099; email: [email protected]; [email protected]
Such endosymbionts (also called P-endosymbionts) live
inside insect specialized cells and undergo maternal transmission to developing eggs or embryos (Buchner, 1965;
Moran et al., 2008). With the establishing long-term,
mutualistic processes, consistent with this stable transmission, the phylogenies of P-endosymbionts may match
those of their insect hosts (Munson et al., 1991a; Moran
et al., 1993; Thao et al., 2000; Spaulding & von Dohlen,
2001; Baumann & Baumann, 2005; Rosenblueth et al.,
2012). To date, the cospeciation of hosts and symbionts
from various environments has been analyzed to disclose
their symbiotic history (Aanen et al., 2002; Noda et al.,
2007; Liu et al., 2013).
Aphids are plant sap-feeding insects that harbor primary
endosymbionts, Buchnera aphidicola, in specialized cells
within their body cavity. Buchnera can provide their aphid
301
C 2014
Institute of Zoology, Chinese Academy of Sciences
302
L. Liu et al.
hosts with essential amino acids poorly represented in the
plant phloem sap (Moran et al., 2003; Baumann et al.,
2013). The mutualistic relationship between aphid and
Buchnera is a well-known example of symbiosis. This
ancient association, which evolved from about 80–150
million years ago (Moran et al., 1993), has received much
attention from researchers who are interested in symbiotic
evolution.
Considerable phylogenetic congruence observed at
deeper evolutionary levels (e.g., distantly related taxa)
may not adequately expose the biological processes underlying them (Moran et al., 1993; Baumann et al., 1999;
Clark et al., 2000; Funk et al., 2000), because the horizontal transfer of symbionts occurs more easily among
closely related hosts (Jousselin et al., 2009). In studies
of distantly related taxa, evolutionary congruence may be
overestimated when the horizontal transfer could not be
detected (Chen et al., 1999; Wernegreen & Riley, 1999).
Thus, most studies on aphid–Buchnera relationships have
been focused on lower taxonomic levels (Clark et al.,
2000; Funk et al., 2000; Wernegreen et al., 2001; Jousselin et al., 2009; Peccoud et al., 2009a, b; Liu et al., 2013).
Previous studies usually support parallel phylogenies
and cospeciation between aphids and Buchnera. However, previous studies were performed only for several
aphid groups, including Uroleucon spp., Brachycaudus
spp., Mollitrichosiphum spp. and Acyrthosiphon pisum
(Clark et al., 2000; Funk et al., 2000; Jousselin et al.,
2009; Peccoud et al., 2009a, b; Liu et al., 2013).
Pemphigini belongs to the aphid subfamily Eriosomatinae, together with Eriosomatini and Fordini (Blackman & Eastop, 1994; Remaudière & Remaudière, 1997;
Nieto Nafria et al., 1998). The life cycle of Pemphigini is
mostly of the holocyclic-heteroecious type, that is, they
typically infest Populus as woody primary hosts on which
sexual reproduction occurs, as well as herbaceous plants
such as Graminaceae as secondary hosts on which asexual parthenogenesis occurs (Ghosh, 1984; Zhang et al.,
1999). Most Pemphigini species are gall makers that induce pseudo-galls or galls only on their woody primary
hosts (Ghosh, 1984; Zhang et al., 1999; Zhang & Qiao,
2007a). The gall traits are highly species specific and show
great variation in shape, size, structure and galling-site.
Galls form relatively isolated habitats, provide improved
nutrition and better protection against natural enemies to
the inducer and its offspring (Cornell, 1983; Price et al.,
1986; Price et al., 1987; Inbar et al., 2004; Koyama et al.,
2004; Zhang & Qiao, 2007a, b; Miller et al., 2009). Considering that previous studies on aphid–Buchnera relationships mainly sampled non-galling aphid groups, Pemphigini species provide an opportunity to understand whether
relatively isolated habitats (i.e., galls) have effect on the
C 2014
parallel relationships between Buchnera and closely related aphid species with the same host plant group (i.e.,
Populus spp.) and overlapping geographical distributions.
In this study, we chose gall-forming aphid species
from Pemphigus and its allied genera (Pemphigini) that
have different galling locations on poplars and investigated their phylogenetic relationships with Buchnera. The
molecular phylogenies were inferred based on three aphid
genes (COI, COII and EF-1α) and two Buchnera genes
(gnd, 16S rRNA gene), and the congruence between these
phylogenies was then tested. The evolutionary relationships among Pemphigus and its allied genera as well as
the gall evolution are also discussed.
Materials and methods
Taxon sampling
Forty-one samples representing 15 gall-forming species
from Pemphigus and allied genera, which were collected
from galls located on leaf, joint of leaf blade and petiole, as well as branches of poplars, were used in this
study. We chose two aphid species, namely Phloeomyzus
passerinii (Phloeomyzinae) and Chaitophorus populeti
(Chaitophorinae), which also feed on poplar, as outgroups
for the aphid phylogeny. Escherichia coli, Salmonella
enterica and Klebsiella pneumoniae, which are closely
related to Buchnera aphidicola (Munson et al., 1991b),
were selected as outgroups for the bacteria phylogeny. The
aphid samples used in this study are listed in Table S1.
All the voucher specimens (individuals from which DNA
were extracted, as well as their gall mates) preserved in
95 % or 100 % ethanol were deposited in the National Zoological Museum of China, Institute of Zoology, Chinese
Academy of Sciences, Beijing, China.
Data collection
Total DNA, including Buchnera genome, was extracted
from single aphids using the DNeasy Tissue Kit (Qiagen,
Germantown, MD, USA). Five gene fragments were amplified, including the Buchnera genes 16S rRNA gene
and gluconate-6-phosphate dehydrogenase (gnd) gene,
and the aphid mitochondrial cytochrome c oxidase subunits I and II (COI/COII) genes, and the nuclear elongation factor 1α (EF-1α) gene. All polymerase chain
reaction (PCR) primers used in this study are listed in
Table 1. PCRs contained 3 μL total DNA, 3 μL 10×
EasyTaq DNA Polymerase Buffer (+Mg2+ ) (TransGen
Biotech, Beijing, China), 2.0 U EasyTaq DNA polymerase
(TransGen Biotech), 6.0 mmol/L each deoxynucelotide
Institute of Zoology, Chinese Academy of Sciences, 21, 301–312
Phylogenetic congruence between gall aphids and Buchnera
303
Table 1 Primers used for aphid and Buchnera gene amplification and sequencing.
Primers (5 –3 )
Gene
16S rRNA gene
gnd
COI
COII
EF1α
8–30: AGAGTTTGATCATGGCTCAGATTG
1507–1484: TACCTTGTTACGACTTCACCCCAG
BamHI: CGCGGATCCGGWCCWWSWATWATGCCWGGWGG
ApaI: CGCGGGCCCGTATGWGCWCCAAAATAATCWCKTTGWGCTTG
LepF: ATTCAACCAATCATAAAGATATTGG
LepR: TAAACTTCTGGATGTCCAAAAAATCA
2993+: CATTCATATTCAGAATTACC
A3772: GAGACCATTACTTGCTTTCAGTCATCT
EF3: GAACGTGAACGTGGTATCAC
EF2: ATGTGAGCAGTGTGGCAATCCAA
triphosphate (dNTP: TransGen Biotech), 6 pmole each
primer, and were brought to a final volume of 30 μL with
double-distilled water. PCR conditions were as follows:
an initial denaturation at 95 °C for 4–5 min, followed by
35 cycles of 95 °C for 30–60 s; annealing temperatures
(depending on the primer sets) for 1 min; extension at
72 °C for 1–2 min; final extension at 72 °C for 7–10 min.
The annealing temperatures of each specific primer set
were used as follows: 52 °C for COI, 42 °C for COII, 51 °C
for EF-1α, 65 °C for 16S rRNA gene, and 55 °C for gnd.
PCRs were visualized using 1 % agarose gel electrophoresis and purified using a DNA Fragment Purification kit
(Labest, Beijing, China). Some products were cloned into
plasmid vectors to obtain sufficient template for DNA sequencing. PCR products and clones were sequenced on
an ABI 3730 automated sequencer (Applied Biosystems,
Foster City, CA, USA). All sequences acquired in this
study have been deposited in GenBank under the accession numbers given in Table S1.
Raw sequences were assembled and corrected by SeqmanII (version 5.01, 2001; DNAstar Inc., Madison, WI,
USA). All DNA sequences for each fragment were aligned
in MEGA 5.05 (Tamura et al., 2011) using default parameters and then adjusted by eye to correct for spurious insertions/deletions. For EF-1α, only coding regions
were used in phylogenetic analysis. The introns were
removed by using GT-AG rule and by comparing with
the complementary DNA (cDNA) sequence of Epipemphigus niisimae (GenBank accession no. DQ499607).
Some ambiguous sites from COII, EF-1α, gnd, 16S
rRNA gene, which contained many gaps, were removed.
The sequences of Buchnera outgroups, Escherichia coli,
Salmonella enterica and Klebsiella pneumoniae, were obtained from GenBank (16S rRNA gene, accession no.
J01859, DQ153191, X87276; gnd, accession no. U00096,
U14495, CP000964).
C 2014
References
van Ham et al. (1997)
Clark et al. (1999)
Foottit et al. (2008)
Stern (1994)
Normark (1996)
von Dohlen et al. (2002)
Palumbi (1996)
Phylogenetic analysis
Before combining gene fragments, we used 100 replicates of the partition homogeneity test (PHT) (Farris et al.,
1994) as contained in PAUP* 4.0 (Swofford, 2002), to estimate congruence between datasets. The results of PHT
showed that the sequence data sets for COI+COII (P =
0.6), COI+COII+EF-1α (P = 0.05) and gnd+16S rRNA
gene (P = 0.3) were congruent and could therefore be
combined in the following analyses.
To assess the relative stability of trees, we used two tree
construction methods: maximum likelihoods (ML) and
Bayesian. These analyses were conducted for aphid (COI,
COII, EF-1α and the combined datasets of COI+COII,
COI+COII+EF-1α) and Buchnera (gnd, 16S rRNA gene
and gnd+16S rRNA gene) datasets independently. The
most appropriate models of evolution were selected independently for each dataset using the AIC (Posada &
Buckley, 2004) in jModeltest (Posada, 2008).
ML analyses were implemented in PAUP*4.0, and compared with results of RaxML (Stamatakis et al., 2005)
and PhyML (Guindon & Gascuel, 2003). ML conducted
in PAUP*4.0 under heuristic searches used tree bisection
reconnection (TBR) branch-swapping and associated parameters estimated by jModelTest. ML bootstrap values
were computed by repeating the same ML heuristic search
on 100 pseudo-replicates. PhyML and RAxML were run
by applying the optimal substitution model obtained from
jModelTest and estimating all model parameters. Branch
support was assessed by bootstrap analysis with 1 000
replicates.
Bayesian analyses were implemented in MrBayes 3.0
(Larget & Simon, 1999) for the single and combined
datasets. In the concatenated analysis the data were partitioned by gene, where each partition had its corresponding model. Substitution model parameters were unlinked
among partitions, and rate priors were set to variable to
Institute of Zoology, Chinese Academy of Sciences, 21, 301–312
304
L. Liu et al.
allow differing substitution rates among partitions. For
each dataset, Bayesian analyses consisted of two independent runs, each with four chains, run for one million generations sampling every 100 generations. The
first 25 % of trees generated were then discarded. After the summarizing consensus tree was assigned, the
posterior probabilities were accordingly obtained. Finally,
Shimodaira–Hasegawa (SH) tests were used to compare
alternative topologies obtained during the various analyses (Shimodaira & Hasegawa, 1999), as implemented in
PAUP.
Test of phylogenetic congruence
Several methods for testing codivergence hypotheses
are available, most of which are reviewed in Paterson and
Banks (2001), Stevens (2004) and De Vienne et al. (2013).
Two representative methods were used to analyze the hostsymbiont interactions in the present study: TreeMap 1.0
(Page, 1994) and Jane 4.01(Conow et al., 2010) programs.
TreeMap 1.0 (Page, 1994) is a tree-based program that
reconciles two trees using four types of events (i.e., cospeciation, host-switching, duplication and sorting events)
to test whether more cospeciation events are present
than would be expected by chance. According to the
requirement of TreeMap that each parasite should have
a corresponding host but not every host has to have a
corresponding parasite, we deleted outgroups from the
Buchnera and aphid trees. We input the best pruned
ML trees of aphid (COI+COII+EF-1α) and Buchnera
(gnd+16S rRNA gene) combined analyses. Both exact search and heuristic search algorithms were implemented to find optimal reconstructions. Randomization
tests with the proportional-to-distinguishable search were
conducted with 1 000 random Buchnera trees to test
whether the two phylogenies contain more cospeciation
events than expected by chance.
Jane runs faster than TreeMap and is more precise in
estimating the cophylogeny events (Keller-Schmidt et al.,
2011). As these two programs are using different heuristics models, we complemented the analysis with Jane 4.01
to compare the solution results. According to Charleston’s
cost scheme (Charleston, 1998), the event cost used here
were zero for a codivergence event, one for duplication
and host switching, and two for sorting events. We performed analyses with 500 generations and population size
of 100. Significant matching of host and bacterial phylogenies was tested by computing the costs of 100 replicates
with random tip mapping and random parasite methods
and comparing the resulting costs to the cost of the original associations.
C 2014
Results
Phylogenetic relationships among Pemphigus and allied
genera
The detail attributes of nucleotide sequences are summarized in Table 2. In the analyses of the three single
genes, COI, COII and EF-1α, all the obtained topologies grouped aphid samples into clades corresponding to
species of the current classification. For each single gene,
ML and Bayesian analyses produced similar topologies
that were not significantly different using the likelihoodbased SH test. However, in both analyses, branch support was relatively weaker for the relationships higher
than generic level. Consequently, the analyses of the individual genes are not presented here. The monophyly
of Epipemphigus as well as Thecabius plus Epipemphigus was supported in all analyses (ML/BI>95). However,
the monophyly of Pemphigus was not recovered in all the
analyses. Pemphigus matsumurai and P. sinobursarius occupied the basal position. The rest of Pemphigus species
clustered together and then clustered with Thecabius and
Epipemphigus. In the COI, COII trees, P. bursarius was
closely related to P. tibetensis, and then clustered with
P. borealis. However, the lack of resolution for the relationship of Pemphigus species in EF-1α trees was especially noticeable. The only difference among COI, COII
and EF-1α trees was the position of Thecabius, which
grouped with Epipemphigus in COI and COII analyses,
but formed a weaker clade with some Pemphigus species
in the EF-1α tree (ML/BI: 67/0.55).
ML and Bayesian analyses for the two combined
datasets (COI+COII, COI+COII +EF-1α) showed almost identical topologies for each dataset. Also, the
topologies of each combined dataset analyses were highly
congruent, and enhanced the phylogenetic resolution
when compared to those of COI, COII and EF-1α. As
shown by the tree of the COI+COII combined analysis
(Fig. S1), Epipemphigus and Thecabius clustered together
with relatively high statistical support values. The genus
Pemphigus was always polyphyletic. P. matsumurai and
P. sinobursarius grouped together and occupied a basal
position. The rest of Pemphigus species formed a clade
and then grouped with the genera Epipemphigus + Thecabius. The only difference between the two combined
data analyses was that P. bursarius clustered with P. tibetensis and then grouped with P. borealis in COI+COII
analyses (Fig. S1), but positioned as sister to P. tibetensis
+ P. borealis in COI+COII+EF-1α analyses (Fig. S2).
Finally, the SH test determined that there was no significant difference between the topology of the COI+COII
and COI+COII+EF-1α trees (P = 0.215) based on the
Institute of Zoology, Chinese Academy of Sciences, 21, 301–312
Phylogenetic congruence between gall aphids and Buchnera
305
Table 2 Characters and evolutionary models of DNA sequences and the datasets used in phylogenetic analyses.
Alignment
aphid
COI
COII
EF-1α
COI+COII
COI+COII+EF-1α
Buchnera gnd
16S rRNA
gnd+16S rRNA
No. of
samples
Aligned
sequence
length (bp)
Variable
site
Parsimony
informative
site
p-distance
Nucleotide
composition
(T:C:A:G)
AIC best
model
36
39
33
30
30
33
32
29
657
704
762
1361
2123
828
1339
2167
135 (20.6 %)
167 (23.7 %)
54 (7.1 %)
270 (19.8 %)
323 (15.2 %)
250 (30.2 %)
67 (5.0 %)
311 (14.4 %)
115 (17.5 %)
120 (17.1 %)
48 (6.3 %)
221 (16.2 %)
269 (12.7 %)
221 (26.7 %)
56 (4.2 %)
277 (12.8 %)
0.064
0.063
0.022
0.063
0.048
0.102
0.016
0.049
41.1:14.6:34.4:10.0
39.9:12.3:40.7:7.2
25.7:21.8:28.0:24.4
40.5:13.4:37.6:8.5
35.2:16.4:34.2:14.2
34.7:11.2:38.2:15.9
21.6:21.3:28.4:28.7
26.6:17.5:32.1:23.8
TIM2+I+G
TIM2+G
TIM2+G
TIM2+I+G
GTR+I+G
TIM1+G
GTR+I+G
GTR+I+G
analysis of COI+COII dataset, as well as when
COI+COII +EF-1α dataset was used (P = 0.118).
Phylogenetic relationships among Buchnera
For the phylogenetic analyses of the two individual
datasets (gnd and 16S rRNA gene), the branch support
values were insufficient to resolve relationships between
genera, but major species were highly supported, similar
to the results obtained in aphid single gene analyses. We
used the ‘Buchnera-aphid species name’ to represent the
Buchnera of corresponding aphid species in the present
study (Liu et al., 2013). ML and Bayesian analyses for 16S
rRNA gene and gnd fragments showed similar topologies,
respectively. The monophyly of Buchnera-Epipemphigus
and Buchnera-Thecabius was supported robustly in both
16S rRNA gene (Fig. S3) and gnd (Fig. S4) analyses.
A conspicuous finding in the 16S rRNA gene and gnd
trees is that the members of Buchnera–Pemphigus could
not form a monophyletic clade. Two major clades were
identified based on 16S rRNA gene analyses: Buchnera–
Epipemphigus and Buchnera–Thecabius clustered together, while the second clade consisted of Buchnera–P.
borealis, Buchnera–P. tibetensis, Buchnera–P. bursarius,
Buchnera–P. sp. 1 and Buchnera–P. sp. 2. The samples of
Buchnera–P. matsumurai and Buchnera–P. sinobursarius
grouped together and adopted a basal position. However,
in the gnd trees, Buchnera–P. matsumurai + Buchnera–
P. sinobursarius grouped with Buchnera–Epipemphigus
and Buchnera–Thecabius.
ML and Bayesian analyses for gnd and 16S rRNA gene
combined dataset (Fig. 1) showed identical topologies,
and similar to those of 16S rRNA gene. The only topological difference between these trees was that the combined dataset reconstructed Buchnera–Thecabius to be
sister to the remaining Buchnera–Pemphigus clade (including Buchnera–P. borealis, Buchnera–P. tibetensis,
C 2014
Buchnera–P. bursarius, Buchnera–P. sp. 1 and Buchnera–
P. sp. 2), and then grouped with Buchnera–Epipemphigus.
These topological differences were not significant by SH
tests (ML vs. Bayesian topology, P = 0.166).
Phylogenetic congruence analyses
TreeMap found 642 optimal reconstructions with
18 cospeciations, 1–8 duplications, 0–7 host switches and
15–33 sorting events. The probability of obtaining the observed number of cospeciation events cannot be explained
as a result of random establishments of host–parasite association (P < 0.01). Results obtained in Jane (Fig. 2)
corroborated this finding, which also showed significant
levels of cospeciation in the aphid–Buchnera association
(P < 0.01, in both permutation tests). Fourteen cospeciations, one duplications, 13 host switches and two loss
events were identified.
Discussion
Phylogenetic congruence between Buchnera and their
aphid hosts
The phylogenies of Buchnera and galling aphid species
from Pemphigus and its allied genera were generally congruent. This confirms and expands previous evidence of
parallel evolution between aphids and Buchnera (Clark
et al., 2000; Funk et al., 2000; Wernegreen et al., 2001;
Jousselin et al., 2009; Peccoud et al., 2009a, b; Liu
et al., 2013). The Buchnera phylogeny reflected major
features of the aphid phylogeny, including the monophyly
of Epipemphigus, and P. borealis + P. tibetensis were
the sister group with P. bursarius. These relationships
are congruent with those presented by Zhang and Qiao
(2007a), who used molecular data (COI and EF-1α) and
Institute of Zoology, Chinese Academy of Sciences, 21, 301–312
Fig. 1 Comparison of phylogenies of aphids (Pemphigus and allied genera) and Buchnera. (A) Aphid phylogeny based on maximum likelihood (ML) analysis of COI/COII/EF1α combined data set. (B) ML phylogenetic tree derived from gnd/16S rRNA gene combined dataset of Buchnera. Values above branches are bootstrap values of maximum
likelihood analysis. The bootstrap values higher than 50 are shown. Solid circles indicate cospeciation events. See text for the gall types and gall locations of each of the
clades A–C.
306
L. Liu et al.
C 2014
Institute of Zoology, Chinese Academy of Sciences, 21, 301–312
Fig. 2 Cophylogeny of aphid and Buchnera from Jane 4.01 (Conow et al., 2010). The reconciled trees based on the COI/COII/EF-1α combined dataset of aphid and gnd/16S
rRNA gene of Buchnera are shown here. Blue and black lines indicate the phylogenies of the Buchnera and aphids, respectively. Hollow red circles indicate cospeciation
events; yellow or red solid circles indicate duplications; arrows indicate host switch events; dashed line indicates sorting events. Support values were shown near each event.
Phylogenetic congruence between gall aphids and Buchnera
C 2014
Institute of Zoology, Chinese Academy of Sciences, 21, 301–312
307
308
L. Liu et al.
more species to infer the phylogenetic relationships within
Pemphigini. However, the genus Pemphigus appeared as
polyphyletic in all analyses based on Buchnera and aphid
sequences. P. matsumurai + P. sinobursarius were placed
at a distant position with the other Pemphigus species.
The slight incongruence between analyses based on
Buchnera and aphid combined datasets were concentrated
at the genera Epipemphigus and Thecabius. Although the
sister relationship of Epipemphigus and Thecabius indicated in the aphid-based topologies was not recovered in
the Buchnera tree based on combined datasets, it was really supported by the analyses based on 16S rRNA gene.
However, relationships in the Buchnera tree based on combined data are consistent with those obtained in Zhang and
Qiao (2007a). In addition, both TreeMap and Jane analyses detected a significant pattern of cophylogeny between
the aphid lineages and their Buchnera symbionts. These
results support the view that topological congruence between aphid and Buchnera trees are not due to chance
alone. The strong cospeciation signal detected between
Buchnera and aphid species from Pemphigus and allied
genera could be indicative of a specialized interaction.
Buchnera could follow the radiation of aphids and diversified in parallel with their hosts. Although Jane analysis
(Fig. 2) evidenced 13 host switches, 11 of them occurred
at the intraspecies level. As the obtained aphid species reproduced asexually, and they are living in the gall which
rules out the influence of parasitic wasps, we infer that the
horizontal transfer cannot happen at the intraspecies level.
Two other host switches were the Buchnera with ancestor
nodes of P. matsumurai + P. sinobursarius, Epipemphigus + Thecabius, Epipemphigus + Thecabius and that of
the rest of the Pemphiginus species. However, the support
values of these two switching events are quite low (P <
50 %). In addition, if the host switches occurred at the
ancestor period, the aphid–Buchnera phylogenies should
show significant incongruence. Therefore, as Clark et al.
(2000) and Jousselin et al. (2009) mentioned, we suggest
that the slight conflict between host and symbiont trees in
our study may be due to potential influence of methodological artifacts, such as the inadequacy of the models
of evolution or limited taxon sampling, as well as lack of
adequate signal for certain nodes.
The effect of isolated habitats on aphid–Buchnera
relationship
Ecological factors are important to the associated organisms (Guay et al., 2009; Anbutsu & Fukatsu, 2011).
Ecological factors such as feeding sites and living habitats of aphid hosts may have effect on the aphid–Buchnera
C 2014
relationship. For instance, if the aphid hosts have frequent
ecological and behavioral contact and overall biological
similarity, the potential for horizontal transmission could
be maximized (Funk et al., 2000). Moreover, different
parts of the plant have different nutrition-distribution patterns (Pich et al., 1994; Ma et al., 2002). Some previous studies suggested that the galls located more closely
to the plant vascular system may absorb more nutrition
(Nyman et al., 1998, 2000; Zhang & Qiao, 2007a, b).
Some researchers also found that photosynthesis rate of
galls were higher than those of non-gall tissues of the
same organ (Fay et al., 1993; Huang et al., 2011), which
indicates that gall tissue is more nutritious than nongall tissue (Koyama et al., 2004). Therefore, non-galling
aphids and galling aphids with relatively isolated habitats may have experienced different selection pressures
and have different phylogenetic relationships with their
nutritional partner Buchnera. However, the present study
indicates obvious phylogenetic congruence between gallforming aphids and Buchnera. This rules out the regular
occurrence of horizontal transfer of Buchnera between
closely related aphid species with the same host plants
and overlapping geographical distributions. In addition,
it appears that different ecological niches and relatively
isolated habitats may have no obvious effect on the evolutionary relationships of aphids and Buchnera.
The phylogenetic conservatism of gall characters
Three major clades (Fig. S2) were identified, which
correspond to gall types and gall locations. The clade C,
including P. matsumurai and P. sinobursarius, was placed
at the basal position. These two species induce true galls
on the joint of leaf blade and petiole with tissue lignification and smaller cubage inside (Zhang & Zhong, 1979;
Zhang & Qiao, 2007a). Clade B included five species of
Pemphigus. Most of them can induce true-galls with thick
walls on the twig (Zhang & Zhong, 1979; Zhang & Qiao,
2007a). Clade A includes Thecabius and Epipemphigus,
which often form pseudo-galls on leaves of Populus which
shapes as a rolling leaf or appears as slight tissue lignification and has a primary exit (Zhang & Zhong, 1979;
Zhang et al., 1995; Zhang & Qiao, 2007a).
The present phylogeny showed the conservatism of gall
characters on aphid phylogeny, which supported the hypothesis that gall characters are more affected by aphids
rather than their host plants (Stern, 1995; Inbar et al.,
2004; Sano & Akimoto, 2011). The association between
gall morphology and gall inducers’ phylogeny is similar to
that described in thrips (Crespi & Worobey, 1998), wasps
(Stone & Cook, 1998) and sawflies (Nyman et al., 2000).
Institute of Zoology, Chinese Academy of Sciences, 21, 301–312
Phylogenetic congruence between gall aphids and Buchnera
Some previous studies on the potential mechanisms of
gall formation demonstrated that insect genotype, rather
than plant genotype, determine the variation in gall formation (Crego et al., 1990; Dodson, 1991; Höglund et al.,
2012). In addition, the selection of galling-site, which
is determined by the fundatrix of aphid species, was confirmed by previous researches (Inbar & Wool, 1995; Inbar,
1998; Wool, 2004). These evidences indicate that insect
gall form is determined primarily by the insects, and gall
characters represent extended insect phenotypes (Stern,
1995; Stone & Cook, 1998; Stone & Schönrogge, 2003;
Chen & Qiao, 2012). However, to clarify the evolutionary
trend of gall characters in Pemphigini on Populus, more
taxa need to be investigated in the future.
Acknowledgments
We are grateful to David Voegtlin, Dong Zhang, Jian-Feng
Wang, Guo-Dong Ren, Kun Guo, Li-Yun Jiang, XiaoMei Su and Tong Lei for collecting specimens; to Fen-Di
Yang for making aphid slides. Dr. Masakazu Sano and
two anonymous reviewers provided valuable suggestions
on previous versions of the manuscript. The work was supported by National Natural Sciences Foundation of China
(31272348), National Science Funds for Distinguished
Young Scientists (No. 31025024), National Science Fund
for Fostering Talents in Basic Research (No. J1210002),
a grant from the Ministry of Science and Technology of
the People’s Republic of China (No. 2011FY120200) and
grants from the Key Laboratory of the Zoological Systematics and Evolution of the Chinese Academy of Sciences
(No. Y229YX5105, O529YX5105).
Disclosure
Each author of this study declares that there is no conflict
of interests in this work.
References
Aanen, D.K., Eggleton, P., Rouland-Lefèvre, C., GuldbergFrøslevl, T., Rosendahll, S. and Boomsma, J.J. (2002) The
evolution of fungus-growing termites and their mutualistic
fungal symbionts. Proceedings of the National Academy of
Sciences of the United States of America, 99, 14887–14892.
Anbutsu, H. and Fukatsu, T. (2011) Spiroplasma as a model
insect endosymbiont. Environmental Microbiology Reports,
3, 144–153.
Baumann, L. and Baumann, P. (2005) Cospeciation between the
primary endosymbionts of mealybugs and their hosts. Current
Microbiology, 50, 84–87.
C 2014
309
Baumann, L., Baumann, P., Moran, N.A., Sandstrom, J. and
Thao, M.L. (1999) Genetic characterization of plasmids containing genes encoding enzymes of leucine biosynthesis in
endosymbionts (Buchnera) of aphids. Journal of Molecular
Evolution, 48, 77–85.
Baumann, P., Moran, N. and Baumann, L. (2013) Bacteriocyteassociated endosymbionts of insects. The Prokaryotes (ed. M.
Dworkin), pp. 465–496. Springer-Verlag, New York.
Blackman, R.L. and Eastop, V.F. (1994) Aphids on the World’s
Trees: An Identification and Information Guide. CAB International, Wallingford. 1024 pp.
Buchner, P. (1965) Endosymbiosis of Animals with Plant Microorganisms. Interscience Publishers, Inc., New York. 909 pp.
Charleston, M.A. (1998) Jungles: A new solution to the
host/parasite phylogeny reconciliation problem. Mathematical Biosciences, 149, 191–223.
Crego, C.L., Weis, A.E., Polans, O. and Bretz, C.K. (1990) Sympatric sibling species from three phenotypically distinct Asteromyia (Diptera: Cecidomyiidae) galls on the same host plant
species. Environmental Entomology, 83, 149–154.
Chen, X., Li, S. and Aksoy, S. (1999) Concordant evolution of a
symbiont with its host insect species: Molecular phylogeny of
genus Glossina and its bacteriome-associated endosymbiont,
Wigglesworthia glossinidia. Journal of Molecular Evolution,
48, 49–58.
Chen, J. and Qiao, G.X. (2012) Galling aphids (Hemiptera:
Aphidoidea) in China: Diversity and host specificity. Psyche,
2012: 621934.
Clark, M.A., Moran, N.A. and Baumann, P. (1999) Sequence
evolution in bacterial endosymbionts having extreme base
compositions. Molecular Biology and Evolution, 16, 1486–
1598.
Clark, M.A., Moran, N.A., Baumann, P. and Wernegreen, J.J.
(2000) Cospeciation between bacterial endosymbionts (Buchnera) and a recent radiation of aphids (Uroleucon) and pitfalls
of testing for phylogenetic congruence. Evolution, 54, 517–
525.
Cornell, H.V. (1983) The secondary chemistry and complex morphology of galls formed by the Cynipinae (Hymenoptera):
Why and how? American Midland Naturalist, 110, 225–
234.
Conow, C., Fielder, D., Ovadia, Y. and Libeskind-Hadas, R.
(2010) Jane: A new tool for the cophylogeny reconstruction
problem. Algorithms for Molecular Biology, 5, 16–25.
Crespi, B. and Worobey, M. (1998) Comparative analysis of
gall morphology in Australian gall thrips: The evolution of
extended phenotypes. Evolution, 52, 1686–1696.
De Vienne, D.M., Refrégier, G., López-Villavicencio, M., Tellier, A., Hood, M.E. and Giraud, T. (2013) Cospeciation vs
host-shift speciation: Methods for testing, evidence from natural associations and relation to coevolution. New Phytologist,
198, 347–385.
Institute of Zoology, Chinese Academy of Sciences, 21, 301–312
310
L. Liu et al.
Dodson, G.N. (1991) Control of gall morphology: Tephritid
gallformers (Aciurina spp.) on rabbitbrush (Chrysothamnus).
Ecological Entomology, 16, 177–182.
Douglas, A.E. (1989) Mycetocyte symbiosis in insects. Biological Reviews, 64, 409–434.
Farris, J.S., Kallersjo, M., Kluge, A.G. and Bult, C. (1994) Testing significance of congruence. Cladistics, 10, 315–319.
Fay, P.A., Hartnett, D.C. and Knapp, A.K. (1993) Increased
photosynthesis and water potentials in Silphium intrgrifolium
galled by cynipid wasps. Oecologia, 93, 114–120.
Foottit, R.G., Maw, H.E.L., von Dohlen, C.D. and Herbert,
P.D.N. (2008) Species identification of aphids (Insecta:
Hemiptera: Aphididae) through DNA barcodes. Molecular
Ecology Resources, 8, 1189–1201.
Funk, D.J., Helbling, L., Wernegreen, J.J. and Moran, N.A.
(2000) Intraspecific phylogenetic congruence among multiple symbiont genomes. Proceedings of the Royal Society
B-Biological Science, 267, 2517–2521.
Ghosh, A.K. (1984) Fauna of India, Homoptera, Aphidoidea,
Subfamily Pemphiginae. The Technical and General Press,
Calcutta.
Guay, J.F., Boudreault, S., Michaud, D. and Cloutier, C. (2009)
Impact of environmental stress on aphid clonal resistance to
parasitoids: Role of Hamiltonella defensa bacterial symbiosis
in association with a new facultative symbiont of the pea
aphid. Journal of Insect Physiology, 55, 919–926.
Guindon, S. and Gascuel, O. (2003) A simple, fast, and accurate
algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology, 52, 696–704.
Höglund, S., Rönnberg-Wästljung, A.C., Lagercrantz, U. and
Larsson, S. (2012) A rare major plant QTL determines nonresponsiveness to gall-forming insect in willow. Tree Genetic
and Genomes, 8, 1051–1060.
Huang, M.Y., Lin, K.H., Yang, M.M., Chou, H.M., Yang, C.M.
and Chang, Y.T. (2011) Chlorophyll fluorescence, spectral
properties, and pigment composition of galls on leaves of
Machilus thunbergii. International Journal of Plant Sciences,
172, 323–329.
Inbar, M. (1998) Competition, territoriality and maternal defense in a gall-forming aphid. Ethology Ecology and Evolution, 10, 159–170.
Inbar, M. and Wool, D. (1995) Phloem-feeding specialists sharing a host tree: Resource partitioning minimizes interference
competition among galling aphid species. Oikos, 73, 109–
119.
Inbar, M., Wink, M. and Wool, D. (2004) The evolution of
host plant manipulation by insects: Molecular and ecological
evidence from gall-forming aphids on Pistacia. Molecular
Phylogenetics and Evolution, 32, 504–511.
Jousselin, E., Desdevised, Y. and Coeur d’acier, A. (2009)
Fine-scale cospeciation between Brachycaudus and Buchnera
aphidicola: Bacterial genome helps define species and evo-
C 2014
lutionary relationships in aphids. Proceedings of the Royal
Society, Series B: Biological Science, 276, 187–196.
Keller-Schmidt, S., Wieseke, N., Klemm, K. and Middendorf, M. (2011) Evaluation of host parasite reconciliation
methods using a new approach for cophylogeny generation.
Working paper from Bioinformatics Leipzig. Available at:
http://www.bioinf.uni-leipzig.de/working/11-013.
Koyama Y., Yao, I. and Akimoto, S. (2004) Aphid galls accumulate high concentrations of amino acids: A support for the
nutrition hypothesis for gall formation. Entomologia Experimentalis et Applicata, 113, 35–44.
Larget, B. and Simon, D. (1999) Markov chain Monte Carlo
algorithms for the Bayesian analysis of phylogenetic trees.
Molecular Biology and Evolution, 16, 750–759.
Liu, L., Huang, X.L., Zhang, R.L., Jiang, L.Y. and Qiao, G.X.
(2013) Phylogenetic congruence between Mollitrichosiphum
(Aphididae: Greenideinae) and Buchnera indicates insect–
bacteria parallel evolution. Systematic Entomology, 38,
81–92.
Ma, S.B., Yang, G.Y. and Zhao, N.X. (2002) Nutrition distribution pattern in different organs of Sinopodophyllum hexandrum (Royle) Ying and its ecological significance. Chinese
Journal of Ecology, 21, 65–67.
Miller, D.G., Ivey, C.T. and Shedd, J.D. (2009) Support for the
microenvironment hypothesis for adaptive value of gall induction in the California gall wasp, Andricus quercuscalifornicus.
Entomologia Experimentalis et Applicata, 132, 126–133.
Moran, N.A. and Telang, A. (1998) Bacteriocyte-associated
symbionts of insects: A variety of insect groups harbor ancient
prokaryotic endosymbionts. Bioscience, 48, 295–304.
Moran, N.A., McCutcheon, J.P. and Nakabachi, A. (2008) Genomics and evolution of heritable bacterial symbionts. Annual
Review of Genetics, 42, 165–190.
Moran, N.A., Munson, M.A., Baumann, P. and Ishikawa, H.
(1993) A molecular clock in endosymbiotic bacteria is calibrated using the insect hosts. Proceedings of the Royal Society
B-Biological Science, 253, 167–171.
Moran, N.A., Plague, G.R., Sandström, J.P. and Wilcox, J.L.
(2003) A genomic perspective on nutrients provisioning by
bacterial symbionts of insects. Proceedings of the National
Academy of Sciences of the United States of America, 100,
9388–9393.
Munson, M.A., Baumann, P., Clark, M.A., Baumann, L., Moran,
N.A., Voegtlin, D.J. and Campbell, B.C. (1991a) Evidence for
the establishment of aphid–Eubacterium endosymbiosis in an
ancestor of four aphid families. Journal of Bacteriology, 173,
6321–6324.
Munson, M.A., Baumann, P. and Kinsey, M.G. (1991b) Buchnera gen. nov. and Buchnera aphidicola sp. nov., a taxon consisting of the mycetocyte-associated, primary endosymbionts
of aphids. International Journal of Systematic and Evolutionary Microbiology, 41, 566–568.
Institute of Zoology, Chinese Academy of Sciences, 21, 301–312
Phylogenetic congruence between gall aphids and Buchnera
Nieto Nafria, J.M., Mier Durante, M.P. and Remaudière, G.
(1998) Les noms des taxa du groupe-famille chez les
Aphididae. Revue Francxaise d’Entomologie (N.S.), 19, 77–
92.
Noda, S., Kitade, O., Inoue, T., Kawai, M., Kanuka, M.,
Hiroshima, K., Hongoh, Y., Constantino, R., Uys, V., Zhong,
J., Kudo, T. and Ohkuma, M. (2007) Cospeciation in the
triplex symbiosis of termite gut protists (Pseudotrichonympha
spp.), their hosts, and their bacterial endosymbionts. Molecular Ecology, 16, 1257–1266.
Normark, B.B. (1996) Phylogeny and evolution of parthenogenetic weevils of the Aramigus tessellatus species complex
(Coleoptera: Curculionidae: Naupactini): Evidence from mitochondrial DNA sequences. Evolution, 50, 734–745.
Nyman, T., Roininen, H. and Vuorinen, J.A. (1998) Evolution of
different gall types in willow-feeding sawflies (Hymenoptera:
Tenthredinidae). Evolution, 52, 465–474.
Nyman, T., Widmer, A. and Roininen, H. (2000) Evolution
of gall morphology and host plant relationships in willowfeeding sawflies (Hymenoptera: Tenthredinidae). Evolution,
54, 526–533.
Page, R.D. (1994) Parallel phylogenies: Reconstructing the history of host–parasite assemblages. Cladistics, 10, 155–173.
Palumbi, S.R. (1996) Nucleic acids II: The polymerase chain
reaction. Molecular Systematics (ed. D.M. Hillis), pp. 205–
247. Sinauer Press, Sunderland, UK.
Paterson, A.M. and Banks, J. (2001) Analytical approaches
to measuring cospeciation of host and parasites: Through
a glass, darkly. International Journal for Parasitology, 31,
1012–1022.
Peccoud, J., Ollivier, A., Plantegenest, M. and Simon, J.-C.
(2009a) A continuum of genetic divergence from sympatric
host races to species in the pea aphid complex. Proceedings
of the National Academy of Sciences of the United States of
America, 106, 7495–7500.
Peccoud, J., Simon, J.-C., McLaughlin, H.J. and Moran, N.A.
(2009b) Post-Pleistocene radiation of the pea aphid complex
revealed by rapidly evolving endosymbionts. Proceedings of
the National Academy of Sciences of the United States of
America, 106, 16315–16320.
Pich, A., Scholz, G. and Stephan, U.W. (1994) Iron-dependent
changes of heavy metals, nicotianamine, and citrate in different plant organs and in the xylem exudate of two tomato genotypes. Nicotianamine as possible copper translocator. Plant
and Soil, 165(2), 189–196.
Posada, D. (2008) jModelTest: Phylogenetic model averaging.
Molecular Biology and Evolution, 25, 1253–1256.
Posada, D. and Buckley, T.R. (2004) Model selection and model
averaging in phylogenetics: Advantages of Akaike information criterion and Bayesian approaches over likelihood ratio
tests. Systematic Biology, 53, 793–808.
C 2014
311
Price, P.W., Fernandes, G.W. and Waring, G.L. (1987) Adaptive
nature of insect galls. Environmental Entomology, 16, 15–24.
Price, P.W., Waring, G.L. and Fernandes, G.W. (1986) Hypotheses on the adaptive nature of galls. Proceedings of the Entomological Society of Washington, 88, 361–363.
Rosenblueth, M., Sayavedra, L., Sámano-Sánchez, H., Roth, A.
and Martı́nez-Romero, E. (2012) Evolutionary relationships
of flavobacterial and enterobacterial endosymbionts with their
scale insect hosts (Hemiptera: Coccoidea). Journal of Evolutionary Biology, 25, 2357–2368.
Remaudière, G. and Remaudière, M. (1997) Catalogue des Aphididae du Monde: Homoptera Aphidoidea. Institut National de
la Recherche Agronomique, Paris.
Sano, M. and Akimoto, S. (2011) Morphological phylogeny
of gall-forming aphids of the tribe Eriosomatini (Aphididae:
Eriosomatinae). Systematic Entomology, 36, 607–627.
Shimodaira, H. and Hasegawa, M. (1999) Multiple comparisons
of log-likelihoods with applications to phylogenetic inference.
Molecular Biological and Evolution, 16, 1114–1116.
Spaulding, A.W. and von Dohlen, C.D. (2001) Psyllid endosymbionts exhibit patterns of co-speciation with hosts and destabilizing substitutions in ribosomal RNA. Insect Molecular
Biology, 10, 57–67.
Stamatakis, A., Ludwig, T. and Meier, H. (2005) RAxML-III:
A fast program for maximum likelihood-based inference of
large phylogenetic trees. Bioinformatics, 21, 456–463.
Stern, D.L. (1994) A phylogenetic analysis of soldier evolution
in the aphid family Hormaphididae. Proceedings of the Royal
Society B-Biological Science, 256, 203–209.
Stern, D.L. (1995) Phylogenetic evidence that aphids, rather than
plants, determine gall morphology. Proceedings of the Royal
Society B-Biological Science, 260, 85–89.
Stevens, J. (2004) Computational aspects of host–parasite phylogenies. Briefings in Bioinformatics, 54, 339–349.
Stone, G.N. and Cook, J.M. (1998) The structure of cynipid
oak galls: Patterns in the evolution of an extended phenotype.
Proceedings of the Royal Society B-Biological Science, 265,
979–988.
Stone, G.N. and Schönrogge, K. (2003) The adaptive significance of insect gall morphology. Trends in Ecology and Evolution, 18, 512–522.
Swofford, D. (2002) PAUP*: Phylogenetic analysis using parsimony (*and other methods), version 4.0b.10. Sinauer Associates, Sunderland, Massachusetts.
Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M. and
Kumar, S. (2011) MEGA5: Molecular evolutionary genetics
analysis using maximum likelihood, evolutionary distance,
and maximum parsimony methods. Molecular Biology and
Evolution, 28, 2731–2739.
Thao, M.L., Moran, N.A., Abbot, P., Brennan, E.B., Burckhardt,
D.H. and Baumann, P. (2000) Cospeciation of psyllids and
Institute of Zoology, Chinese Academy of Sciences, 21, 301–312
312
L. Liu et al.
their primary prokaryotic endosymbionts. Applied and Environmental Microbiology, 66, 2898–2905.
van Ham, R.J., Moya, A. and Latorre, A. (1997) Putative
evolutionary origin of plasmids carrying the genes involved in leucine biosynthesis in Buchnera aphidicola (endosymbiont of aphids). Journal of Bacteriology, 179, 4768–
4777.
von Dohlen, C.D., Kurosu, U. and Aoki, S. (2002) Phylogenetics
and evolution of the eastern Asian–eastern North American
disjunct aphid tribe, Hormaphidini (Hemiptera: Aphididae).
Molecular Phylogenetics and Evolution, 23, 257–267.
Wernegreen, J.J. and Riley, M.A. (1999) Comparison of the evolutionary dynamics of symbiotic and housekeeping loci: A
case for the genetic coherence of rhizobial lineages. Molecular Phylogenetics and Evolution, 16, 98–113.
Wernegreen, J.J., Richardson, A.O. and Moran, N.A. (2001) Parallel acceleration of evolutionary rates in symbiont genes underlying host nutrition. Molecular Phylogenetics and Evolution, 19, 479–485.
Wool, D. (2004) Galling aphids: Specialization, biological complexity, and variation. Annual Review of Entomology, 49, 175–
192.
Zhang, G.X., Qiao, G.X., Zhong, T.S. and Zhang, W.Y. (1999)
Fauna Sinica Insecta, Vol. 14. Homoptera: Mindaridae and
Pemphigidae. Science Press, Beijing.
Zhang, H.C. and Qiao, G.X. (2007a) Systematic status of the
genus Formosaphis Takahashi and the evolution of galls
based on the molecular phylogeny of Pemphigini (Hemiptera:
Aphididae: Eriosomatinae). Systematic Entomology, 32, 690–
699.
Zhang, H.C. and Qiao, G.X. (2007b) Molecular phylogeny of
Fordini (Hemiptera: Aphididae: Pemphiginae) inferred from
nuclear gene EF-1α and mitochondrial gene COI. Bulletin of
Entomological Research, 97, 379–386.
Zhang, G.X. and Zhong, T.S. (1979) Five new species of Pemphigus Hartig and a new species of Sanpupemphigus gen. nov.
from China (Aphidoidea: Pemphigidae). Acta Entomologica
Sinica, 22, 324–332.
Zhang, G.X., Zhong, T.S. and Qiao, G.X. (1995) A study on
Chinese Thecabius Koch 1857, with description of new sub-
C 2014
genus, new species and new subspecies. Entomologia Sinica,
2, 206–224.
Accepted January 26, 2014
Supporting Information
Additional Supporting Information may be found in the
online version of this article at the publisher’s web-site:
Table S1 Collection information for aphid samples used
in this study and sequence GenBank accession numbers.
Fig. S1 ML tree obtained from the analysis of the mitochondrial combined dataset (COI/COII). Bootstrap values
from maximum likelihood analysis (50 % and greater) are
shown above the branches, and the posterior probabilities
of Bayesian analysis (BI) (50 % and greater) are shown
below.
Fig. S2 Aphid phylogenetic tree based on maximum likelihood analysis of the combined dataset
(COI/COII/EF-1α). Bootstrap values from maximum
likelihood analysis (50 % and greater) are shown above the
branches, and the posterior probabilities of Bayesian analysis (BI) (50 % and greater) are shown below. See text for
the gall types and gall locations of each of the clade A–C.
Fig. S3 Bayesian phylogenetic tree of Buchnera reconstructed from 16S rRNA gene sequences. Buchnera samples are indicated as names of their aphid hosts. Values
above and below branches are bootstrap values of maximum likelihood analysis and posterior probabilities of
Bayesian inference. Only nodes supported by 50 % or
greater are shown. A dash (-) marks the bootstrap values
of those nodes that were lower than 50 %.
Fig. S4 Bayesian phylogenetic tree of Buchnera reconstructed from gnd sequences. Buchnera samples are indicated as names of their aphid hosts. Values above and below branches are bootstrap values of maximum likelihood
analysis and posterior probablities of Bayesian inference.
Only nodes supported by 50 % or greater are shown.
Institute of Zoology, Chinese Academy of Sciences, 21, 301–312