Am J Physiol Regul Integr Comp Physiol 304: R991–R1000, 2013.
First published April 10, 2013; doi:10.1152/ajpregu.00411.2012.
Ontogeny of ornithine-urea cycle gene expression in zebrafish (Danio rerio)
Christophe M. R. LeMoine and Patrick J. Walsh
Department of Biology, University of Ottawa, Ottawa, Ontario, Canada
Submitted 6 September 2012; accepted in final form 3 April 2013
ureogenesis; nitrogen metabolism; development; ammonia challenge
IN ANIMALS, AMMONIA IS THE PRIMARY metabolic waste formed from
the breakdown of proteins. Ammonia is highly toxic and therefore
must be excreted or detoxified to prevent harmful accumulation
within the body. Most tetrapods have adopted the strategy to
convert the bulk of their ammonia into less noxious compounds,
urea and uric acid. In contrast, the majority of adult teleost fish
directly excrete most of their nitrogenous waste in the form of
ammonia to the surrounding water. This strategy is believed to be
advantageous, because in permissive environments, ammonia can
diffuse down its gradient from the blood to the water via the gills
at little or no cost, whereas the production of urea is energetically
expensive. Indeed, in fish the ornithine-urea cycle (O-UC) yields
1 mol of urea for 5 mol of ATP consumed, and it requires several
enzyme-catalyzed steps via carbamoyl phosphate synthase III
(CPSIII), ornithine transcarboxylase (OTC), arginosuccinate synthetase (ASS), arginosuccinate lyase (ASL), arginase, and the
accessory enzyme glutamine synthetase, which catalyzes the formation of glutamine from ammonia for the entry into the O-UC
through CPSIII (57). Although additional pathways (e.g., uricol-
Address for reprint requests and other correspondence: C. LeMoine, Dept. of
Biology, Univ. of Ottawa, 30 Marie Curie private, Ottawa, ON K1N 6N5,
Canada (e-mail: [email protected]).
http://www.ajpregu.org
ysis, arginine catabolism) may contribute to urea production in
ammonotelic teleosts, these pathways are not believed to be functionally related to ammonia detoxification in these species (1).
Although the majority of adult teleosts are primarily ammonotelic, a few exceptional species can excrete substantial
amounts of urea in challenging or stressful environmental
conditions (30, 38, 46, 56, 60). In addition, a variety of fish that
are primarily ammonotelic as adults are also capable of producing significant amounts of urea early in their development
(4, 7, 13, 51, 62). This ureogenic capacity may be of crucial
importance to prevent ammonia toxicity considering the nutritional, developmental, and biophysical constraints imposed
upon developing teleost fish. Indeed, developing embryos and
larvae rely heavily on amino acid catabolism for energy production, resulting in the formation of ammonia (12, 15, 16, 23,
42, 43, 44, 48). This ammonia, however, cannot be efficiently
excreted to the external medium because, prior to hatching, fish
typically lack functional gills and are enclosed in a semipermeable chorion (41, 48). Therefore, the biophysical characteristics that allow adult fish to readily excrete ammonia in their
environment are absent or minimized early in development, as
suggested by the accumulation of nitrogenous wastes in embryos and yolks of several teleost species (4, 7, 18, 62). Thus
the detoxification of ammonia via urea production may be of
crucial importance to prevent ammonia toxicity during embryogenesis. In addition, in the few fish species examined,
ureogenesis capability during early life stages has been attributed to the presence of the gene transcripts and functional
activities of several enzymes of the O-UC (7, 13, 25, 27, 50,
62). Furthermore, recent work in trout showed that most O-UC
enzyme activities were primarily located in the embryonic
body, not the yolk sac or liver, but due to technical limitation
of the assays, the precise localization of the enzymes could not
be further refined (50). Similarly, in the African catfish, the
enzymes localized to the muscle tissues, not the liver (51).
In regulatory terms, the ontogenic switch from larval fish
able to produce significant levels of urea to adults with much
lower capacity is intriguing. Indeed, it suggests that all the
genetic material necessary for making up the various components of the O-UC are present in fish, primarily functional
during early life stages, and silenced thereafter (7, 62). Typically, the regulation of physiological processes can be achieved
at several levels. Traditionally, transcriptional regulation via
changes in the abundance or activity of specific transcription
factors has been found to play a major role in physiological
adaptations. More recently, an additional layer of regulation
termed epigenetics has emerged to be an important mechanism
in both ontogenic and tissue-specific mRNA expression patterns in a variety of models (8, 31, 40, 49). In particular, the
methylation status of cytosine/guanine dinucleotide-rich domains (CpG islands) of regulatory regions of specific genes has
a profound effect on the activation or silencing of these genes
under certain conditions. Interestingly, in CPSI in mammals
0363-6119/13 Copyright © 2013 the American Physiological Society
R991
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 17, 2017
LeMoine CM, Walsh PJ. Ontogeny of ornithine-urea cycle gene
expression in zebrafish (Danio rerio). Am J Physiol Regul Integr
Comp Physiol 304: R991–R1000, 2013. First published April 10,
2013; doi:10.1152/ajpregu.00411.2012.—Although the majority of
adult teleosts excrete most of their nitrogenous wastes as ammonia,
several fish species are capable of producing urea early in development. In zebrafish, it is unclear whether this results from a functional
ornithine-urea cycle (O-UC) and, if so, how it might be regulated.
This study examined the spatiotemporal patterns of gene expression of
four major O-UC enzymes: carbamoyl phosphate synthase III (CPSIII), ornithine transcarboxylase, arginosuccinate synthetase, and
arginosuccinate lyase, using real-time PCR and whole mount in situ
hybridization. In addition, we hypothesized that CPSIII gene expression was epigenetically regulated through methylation of its promoter,
a widespread mode of differential gene regulation between tissues and
life stages in vertebrates. Furthermore, to assess CPSIII functionality,
we used morpholinos to silence CPSIII in zebrafish embryos and
assessed their nitrogenous waste handling during development, and in
response to ammonia injections. Our results suggest that mRNAs of
O-UC enzymes are expressed early in zebrafish development and
colocalize to the embryonic endoderm. In addition, the methylation
status of CPSIII promoter is not consistent with the patterns of
expression observed in developing larvae or adult tissues, suggesting
other means of transcriptional regulation of this enzyme. Finally,
CPSIII morphants exhibited a transient reduction in CPSIII enzyme
activity 24 h postfertilization, which was paralleled by reduced urea
production during development and in response to an ammonia
challenge. Overall, we conclude that the O-UC is functional in
zebrafish embryos, providing further evidence that the capacity to
produce urea via the O-UC is widespread in developing teleosts.
R992
O-UC GENE EXPRESSION IN ZEBRAFISH
METHODS
Animals. Adult wild-type zebrafish (Danio rerio) were kept in
10-liter plastic tanks in aerated and dechlorinated Ottawa tap water at
28°C. The fish were maintained in a 10:14-h light-dark cycle and fed
once daily on Adult Zebrafish Complete Diet (Zeigler, Gardners, PA).
Embryos were obtained following standard breeding procedures (59)
and raised in E3 embryo medium (in mM: 5 NaCl, 0.17 KCl, 0.33
CaCl, 0.33 MgSO4, and 0.00001% methylene blue) in Petri dishes at
28°C until needed. All procedures were approved under Protocol
BL-255 by the Animal Care Committee of the University of Ottawa
and were in accordance with guidelines of the Canadian Council on
Animal Care.
Real-time PCR analysis. Embryos were harvested at 5, 24, 32, 48,
and 72 h postfertilization (hpf), immediately flash-frozen in liquid
nitrogen, and stored at ⫺80°C until further analysis. For each time
point, 30 –50 embryos were homogenized in TRIzol, total RNA was
extracted, treated with DNase I and reverse transcribed with Superscript II reverse transcriptase following the manufacturer’s instructions (Invitrogen, Burlington, ON). Gene expression analysis was
carried out with real-time PCR technology on an Mx3000P real-time
cycler (Stratagene, La Jolla, CA). The cycling conditions were 3 min
of 95°C denaturation and 40 cycles of 15-sec denaturation (95°C), 30
sec annealing (58°C) and 30 sec extension (72°C). Each sample was
assayed in duplicate in a 12.5-␮l mix containing 6.5 ␮l Brilliant
SYBR mix, 2 ␮l cDNA, and 0.2 ␮M of each primer (Table 1). No
template controls were run in parallel to ensure the absence of
contamination. Relative levels of gene expression were obtained
following ⌬⌬Ct using elongation factor 1␣ (EF1␣) as a reference
gene. The specificity of the primers used was ensured through postreal-time PCR dissociation curve analysis.
Whole mount in situ hybridization. Digoxygenin (DIG)-labeled
RNA probes were generated as previously described (54). Briefly,
gene-specific antisense sequences were amplified using gene-specific
primers (Table 1) and cloned in pDrive vectors (Qiagen, Mississauga,
ON). Plasmids were then linearized with either BamHI or SacI, and
transcribed using the DIG RNA labeling kit (Sp6/T7) following the
manufacturer’s instructions (Roche, Laval, QC). DIG-labeled RNA
was ethanol purified, quantified through native gel electrophoresis,
and stored at ⫺80°C until needed. Wild-type embryos were raised
until 30 –32 hpf in embryo medium containing 0.003% 1-phenyl-2thiourea (Sigma-Aldrich, Oakville, ON) to minimize pigment formation. After collection, embryos were fixed, manually dechorionated,
dehydrated, and stored at ⫺20°C in 100% methanol until further
manipulation. The whole mount in situ hybridization was performed
as described by Thisse and Thisse (54), after which the embryos were
postfixed in a 4% paraformaldehyde solution overnight and transferred to glycerol prior to image acquisition. Embryos were manually
deyolked and images were captured on an SMZ1500 stereomicroscope (Nikon, Melville, NY).
Morpholino gene knockdown. A splice-blocking morpholino was
designed to target the second intron-exon boundary of the zebrafish
CPSIII gene (ZDB-GENE-081105-17) (Gene Tools, Philomath, OR).
This morpholino prevents the excision of the second intron of CPSIII
from the pre-mRNA transcript and introduces nine stop codons in
Table 1. Primers used in this study
Gene target
Real time PCR
EF1␣a
CPSIIIb
OTCc
ASS1d
ASLe
In situ hybridization
CPSIIIb
OTCc
ASS1d
ASLe
Bisulfite PCR
CPSIIIf
Morpholino PCR
CPSIIIb
Forward Primer (5=-3=)
Reverse Primer (5=-3=)
gtgctgtgctgattgttgct
agcagcgtctgggtcagtat
gtgggaaaagcaactttgga
aaccctgagcattctcctga
ctggctttgcaactcatcaa
tgtatgcgctgacttccttg
cgatctgtttgacccaaggt
tgggagatgctctcctctgt
tgctttcctccgatctcatt
catccctgcttattgccact
gcgtgtcaggagctctttct
gcgtggacatcctctgactt
acgcgtctgatccaattcat
cgctttagttttccgtttgc
ggcgcactgaataaaatgaa
caggtgctccagagacgagt
caaagcgaacctggtcattt
gcaataccatcccgtaacca
ttggttttgaagtttttatttatttatt
aatttacatattctccctacattcac
aaatcactgaggctgggatg
tgaatccgatcagactccac
Accession numbers: aAY422992 (29); bENSDART00000004742; cENSDART00000089526; dENSDART00000039903; eENSDART00000040190;
f
ENSDARG00000020028. EF1␣, elongation factor 1␣; CPSIII, carbamoyl phosphate synthase III; OTC, ornithine transcarboxylase; ASS, arginosuccinate
synthetase; ASL, arginosuccinate lyase.
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00411.2012 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 17, 2017
(homologous to CPSIII in fish), the promoter has been well
characterized (9 –11, 19, 28), and the methylation status of
cytosine residues in the rat promoter correlates well with its
tissue and developmental mRNA expression patterns (45).
With the above background in mind, we undertook the
current study to further explore the ontogeny of ureogenesis in
a teleost species. Because the zebrafish has been found to be
ureogenic during its early life stages (4), we wanted to further
exploit the numerous advantages of the zebrafish as an animal
model in genetics, developmental biology, and physiology.
The first aim of the present study was to assess the presence
and developmental patterns of expression transcripts of the
O-UC enzymes in developing zebrafish embryos. In addition,
using in situ hybridization techniques we wanted to further
refine the spatial mRNA expression patterns of selected O-UC
enzymes in the developing embryo. Second, we hypothesized
that the differences in expression patterns of CPSIII, the
enzyme limiting nitrogen entry in the O-UC that were observed
during development in zebrafish larvae and in specific tissues
of adult fish, are epigenetically regulated by the methylation
status of its proximate promoter. Finally, although the transcript and enzyme activity of several O-UC enzymes has
previously been detected in several species (e.g., 7, 62), the
functionality of the O-UC in developing fish has rarely been
directly tested (13). Therefore, we used morpholino-based gene
silencing to knock down CPSIII expression in developing
zebrafish to assess whether urea production during early development is primarily via the O-UC and thus determine
whether this pathway is physiologically relevant in developing
fish embryos.
O-UC GENE EXPRESSION IN ZEBRAFISH
kinase, 5 mM [14C]sodium bicarbonate (3 ⫻ 106 cpm), 0.04 M
HEPES pH 7.6, 0.04 M KCl, 0.5 mM DTT, 0.05 mM EDTA, 20 mM
glutamine, and when applicable, 1.7 mM AGA, 1.7 mM UTP. After
1 h of incubation at 26°C, the reaction was stopped with 40 ␮l of
freshly prepared 1 M NH4OH in 0.5 M NaOH containing 0.5 mM
carbamoyl phosphate and incubated for 5 min at room temperature.
The reaction was then boiled for 15 min in a fume hood immediately
after addition of 100 ␮l of 2 M NH4Cl pH 8.7. The solution was
allowed to cool, after which it was passed through a DOWEX anion
exchange column (OH⫺, 50 –100 mesh; Sigma), washed into the resin
with 500 ␮l of 0.5 mM urea. The [14C]urea formed was eluted from
the column with 5 ml of 0.5 mM urea into a scintillation vial. The
eluate was thoroughly mixed with 10 ml of Ultima Gold XR scintillation fluid (Perkin Elmer, Waltham, MA), and the radioactivity in
each sample was measured on a Tricarb LSC 2910 TR liquid scintillation spectrometer (Perkin Elmer). All reactions were carried out in
duplicate, and each assay series included t ⫽ 0 controls in which the
reaction was immediately stopped to evaluate background values.
Protein contents of the homogenates were evaluated using the bicinchoninic acid assay following the manufacturer’s instructions (Sigma).
Because the homogenates were not subjected to gel filtration described before (7), the enzymatic rates obtained are not maximal, but
could be more reflective of their in vivo activity.
Bisulfite sequencing. To examine methylation status, bisulfite sequencing was employed. This method consists in treating genomic
DNA with sodium bisulfite under acidic condition (17). This treatment
converts only cytosine residues to uracil if they are unmethylated,
leaving all methylated cytosines unchanged (17). Thus following PCR
amplification and sequencing, one can identify the methylation state
of each cytosine residue in a given genomic DNA region (for review,
see Ref. 22). Genomic DNA was extracted using the standard phenol/
chloroform technique and subjected to bisulfite conversion using the
Imprint DNA modification kit following the manufacturer’s instructions (Sigma). The bisulfite-treated DNA was then PCR amplified
with specific primers (Table 1; Fig. 1) flanking a major CpG island
situated ⫺920 to ⫺630 bp upstream of the translation start site of
CPSIII (Fig. 1). The PCR products were then purified and cloned
using commercially available kits (Qiagen). The clones for each
amplified product (n ⫽ 6 –10) were then sequenced in both directions
at the Genome Quebec Sequencing center (Montreal, QC). Results
were analyzed with BiQ Analyzer v2.0 (2).
Statistical analyses. All data were analyzed in SigmaStat v 3.5
(Systat Software, San Jose, CA). Gene expression for larval zebrafish
Fig. 1. Location of CpG nucleotides in zebrafish carbamoyl phosphate synthase
III (CPSIII) promoter. This sequence encompasses the region ⫺920 bp to
⫺630 bp upstream of the CPSIII translation start site. The 12 putative
methylation sites are boxed; the underlined sequences indicate the locations of
the primer used for bisulfite sequencing (see Table 1.).
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00411.2012 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 17, 2017
frame. With the use of a microinjector (IM 300, Narishige, Long
Island, NY) and a pulled 1.0-mm borosilicate glass micropipette
(Stutton Instrument, Novato, CA), 1-cell embryos were injected with
1 nl of either the splice-blocking morpholino for CPSIII [TTCAGAGGATGCCTTCTCACCCAAC] or a control morpholino [CCTCTTACCTCAGTTACAATTTATA] at a concentration of 0.5 mM in
Danieau buffer [in mM: 58 NaCl, 0.7 KCl, 0.4 MgSO4, 0.6 Ca(NO3)2,
5.0 HEPES pH 7.6] with 0.05% Phenol Red. This concentration was
found to be the optimal amount of morpholino required to silence
CPSIII in CPSIII morphants at 24 hpf as checked by standard PCR
with primers flanking the exon-intron boundary (Table 1), while also
reducing the risks of nonspecific effects on the developmental rates,
morphology, and nitrogenous waste excretion patterns of both control
and CPSIII morphants. Both control and CPSIII morpholinos were
labeled with a fluorescent dye, carboxyfluorescein, allowing to screen
in vivo the successful uptake of the morpholino by the injected
embryos. Only the embryos exhibiting widespread fluorescence by
6 –24 hpf were kept for further analysis.
Urea and ammonia determination. At different stages of development (n ⫽ 4 –7), ⬃50 embryos (corresponding to n ⫽ 1) were
incubated in a well of a 6-well cell culture plates (BD Biosciences,
Mississauga, ON) for evaluation of their nitrogenous waste excretion
flux rates. The fluxes were conducted for 6 and 18 h in, respectively,
3 and 6 ml of filtered dechlorinated tap water at 28°C. These flux
periods were selected for practical reasons (light vs. dark) and to allow
for reliable measurements of nitrogenous wastes in the water. For each
series, a well containing water only was included to serve as a blank.
The water samples were immediately frozen at ⫺20°C for later
determination of ammonia and urea concentration following standard
procedures (37, 56). The excretion rates were calculated accounting
for the duration of the flux, initial and final ammonia or urea concentration in the water, the volume of water in the well, and the number
of embryos fluxed. For whole body urea and ammonia concentration
in 24 hpf and 48 hpf morphants, the embryos were collected, flashfrozen in liquid nitrogen, and stored at ⫺80°C until further manipulation. Each sample (⬃50 embryos) was homogenized in 100 ␮l of
8% perchloric acid, and centrifuged at 13,000 g for 15 min. The
supernatant was then neutralized with saturated K2CO3, and assayed
for urea as described above and for ammonia using a commercially
available assay (AA0100, Sigma). Urea concentrations (flux and body
content) were multiplied by 2 to account for the two nitrogen atoms
present in urea, and the detection limit of the assay is estimated to be
0.5 ␮mol/l (35).
In addition, we subjected 24 hpf morphants to an ammonia challenge as described before (6). We chose this route of administration to
test the capacity of the embryo to detoxify ammonia due to a rapid
surge within the embryo/yolk sac. In addition, this technique allowed
us to precisely control the level of exposure of each embryo, and
circumvent any potential problems due to the chorion and its permeability to ammonia observed before in young zebrafish (5). Briefly,
24-hpf embryos were enzymatically dechorionated in pronase (1 mg/l;
Roche), and lightly anesthetized in tricaine methanesulfonate (0.01
mg/l; Sigma Aldrich). The embryos were then microinjected in their
yolk sac with 3 nl of a solution of 1 mM NH4Cl in Danieau buffer.
The embryos (50 per well, n ⫽ 4 – 6 replicates) were then fluxed in
6-well plates for 2 h, and water and body samples were taken for
determination of their nitrogen waste excretion and whole body
content as described above.
Enzyme assays. The activities of CPSII (a cytoplasmic isoform of
CPS involved in pyrimidine synthesis and not the O-UC) and CPSIII
of morphants were assayed radiometrically as described before (27).
Embryos were homogenized on ice in 3 volumes of homogenization
buffer (0.05 M HEPES pH 7.5, 0.05 M KCl, 1 mM DTT, and 0.5 mM
EDTA), briefly sonicated, and centrifugated at 14,500 g for 10 min at
4°C, and immediately, 100 ␮l of this supernatant was added to 200 ␮l
of reaction buffer such that final concentrations were as follows: 20
mM ATP, 25 mM MgCl2, 25 mM phosphoenolpyruvate, 2 U pyruvate
R993
R994
O-UC GENE EXPRESSION IN ZEBRAFISH
Relative mRNA
expression
A
B
CPSIII
3
b
b
3
2
a
a
a
a
1
a
2
a
a
a
1
0
C
0
D
ASS1
ASL
Relative mRNA
expression
b
2
a
2
a
a
a
a
1
0
0
24
Relative mRNA
expression
b
ab
a
1
E
b
32
48
72
Hours post fertilization
96
24
32
48
72
Hours post fertilization
96
Adult tissues
10
1
0.1
0
CPSIII
OTC
was analyzed with one-way ANOVA on ranks (Fig. 2, A–D) and with
t-tests (Fig. 2E) for adult tissues. Ammonia and urea excretion fluxes
(Fig. 5, A and B) were rank-transformed and analyzed using a
two-way ANOVA. Ammonia and urea content of morphants (Fig. 5,
C and D) and CPS enzyme activities (Fig. 4) were analyzed using a
two-way ANOVA. Data pertaining to the ammonia-injected morphants (Fig. 6) were subjected to t-test analyses. All multiple comparisons were followed by post hoc Student-Newman-Keuls analysis.
RESULTS
The expression of CPSIII, OTC, ASL, and ASS1 mRNAs
was detected as early as 5 hpf (data not shown). During the first
96 hpf, the transcripts for all genes had a tendency to increase
(Fig. 2, A–D). CPSIII mRNA increased twofold between 24 and
32 hpf to return to basal levels afterward. The other enzyme
transcripts slowly increased over the course of development only
to become significantly elevated by 72 hpf (ASL) and 96 hpf
(OTC and ASS1). As a qualitative comparison, we also evaluated
the gene expression of these enzymes in the liver and muscle of
adult fish (Fig. 2E). In adult liver, most enzymes were expressed
at very low levels except for ASL. In comparison, the transcripts
of urea enzymes were expressed at levels comparable to those of
24 hpf larvae in the adult muscle, with a markedly high expression
of ASL in adult muscle.
ASS1
ASL
The methylation status of cytosine residues in the proximal
promoter of CPSIII appeared to be variable both across developmental stages and adult tissues (Table 2.). Through the course of
development, there was a tendency for a reduction in the proportion of methylated residues as the larvae grew older, but there did
not appear to be any consistent patterns at individual residues.
Similarly, when comparing adult tissues, the CPSIII promoter in
liver was overall hypomethylated compared with muscle. However, when examining each residue individually, the differences in
methylation status were more variable. For example site 1 is
hypomethylated, whereas site 2 is hypermethylated (Table 2) in
muscle compared with adult liver tissue.
When we examined the localization of transcripts of O-UC
enzymes through whole mount in situ hybridization in zebrafish
larvae at 32 hpf, transcripts of all four enzymes examined were
detectable (Fig. 3). The O-UC enzyme transcripts appeared to
primarily localize in the embryonic endoderm adjacent to the
anterior part of the yolk sac (i.e., the yolk ball), although in
contrast, no marking was observable on the posterior trunk region
surrounding the yolk extension (Fig. 3). Transcripts for the enzymes can also be detected, albeit more diffusely, in the anterior
part of brain for ASL and ASS1, and in the region ventral to the
hindbrain for CPSIII and OTC (Fig. 3).
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00411.2012 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 17, 2017
Fig. 2. Ornithine-urea cycle (O-UC) mRNA
expression in developing larvae and adult tissues of zebrafish. Real-time PCR analysis was
used to evaluate the mRNA levels of CPSIII
(A), ornithine transcarboxylase (OTC) (B), arginosuccinate synthetase (ASS1) (C), and arginosuccinate lyase (ASL) (D) in developing zebrafish using EF1␣ as a reference gene. E: relative
levels of these transcripts were also measured in
liver (white bars) and muscle (black bars) tissues of adult zebrafish. In both developing embryos and adults, for each gene, the levels of
expression are normalized to the expression in
24-h postfertilization embryos. Different letters
denote statistical significance between time
points (n ⫽ 5).
OTC
4
R995
O-UC GENE EXPRESSION IN ZEBRAFISH
Table 2. Methylation status of the CPSIII proximal promoter
in developing embryos and adult tissues
24 hpf
Embryo
36 hpf
Embryo
48 hpf
Embryo
Adult Liver
Adult Muscle
1
2
3
4
5
6
7
8
9
10
11
12
Total
100
100
75
50
100
75
100
100
100
75
100
0
81
100
100
100
100
100
100
100
33
33
50
67
0
74
83
83
17
83
83
83
83
83
67
17
0
17
58
83
83
100
100
70
70
70
80
47
47
43
8
67
75
100
100
89
89
89
89
96
96
96
21
0
78
The proportion of methylated cytosine residues is calculated as a percentage
at each individual site (n ⫽ 2 for each embryonic stage, n ⫽ 3 for adult
tissues). See Fig. 1 for location of the CpG sites in the DNA sequence. hpf,
hours postfertilization.
Next, knowing that the transcript levels for these four
enzymes of the O-UC were present in developing zebrafish, we
decided to test the functionality of the cycle in these fish with
a CPSIII morpholino knockdown. To test the effectiveness of
this knockdown, we assayed the activity of CPSIII, and its
cytosolic homologue CPSII, in control and CPSIII morphants
(Fig. 4). There was a significant decrease in CPSII activity at
48 hpf independent of the type of morpholino injected. Overall,
CPSII enzyme activity was unaffected by the morpholino
treatment (Fig. 4A). In contrast, CPSIII morphants showed a
50% reduction in CPSIII enzyme activity compared with control morphants at 24 hpf. However, by 48 hpf, CPSIII morphants mostly recovered to exhibit CPSIII enzyme activities
comparable to those of their control morphant counterparts. In
addition, regardless of the morpholino injected, morphants’
CPSIII activity approximately doubled from 24 to 48 hpf.
We monitored the nitrogenous waste excretion in the morphants over the course of 72 h (Fig. 5). Regardless of the
morpholino treatment, ammonia excretion significantly increased
over the course of development (Fig. 5A). Ammonia excretion
rates were overall comparable between the CPSIII and control
morphants (Fig. 5A). However, between 30 and 48 hpf, ammonia
excretion was elevated in control morphants, and significantly
lower after 58 hpf (Fig. 5A). In contrast, overall urea excretion
was more variable during development (Fig. 5B), and significantly
elevated during the nocturnal fluxes (30 – 48 hpf and 55–72 hpf;
Fig. 5B). Compared with the control morphants, the CPSIII
morphants did not excrete any significant levels of urea between
24 and 30 hpf (Fig. 5B). It should be noted that although low
levels of urea were excreted in some treated fish, we could not
detect any urea in most water samples. After 30 hpf, the CPSIII
morphants excreted urea at levels comparable to those of control
morphants (Fig. 5B). As a result, between 23 and 30 hpf, urea
production as a percentage of total nitrogenous waste was fourfold
lower in the CPSIII morphants than in the control morphants, but
relatively similar at later developmental stages. We also measured
the urea and ammonia body content at 24 and 48 hpf (Fig. 5, C
and D). Ammonia body content showed no significant differences
between CPSIII and control morphants at both time points examined (Fig. 5C). In contrast, by 24 hpf, the urea body content was
DISCUSSION
In the current study, we demonstrate that mRNA for four of
the six urea cycle enzymes is expressed early in the development of zebrafish. We also established that differences associated with the gene expression of CPSIII across developmental
stages and between adult tissues could not be attributed to
drastic changes in the methylation status of its promoter,
suggesting other means of transcriptional regulation of this
gene. Furthermore, the use of a morpholino-based silencing of
CPSIII allowed us for the first time to directly assess the
A
B
CPS III
C
OTC
D
ASS1
ASL
Fig. 3. Spatial expression of O-UC enzymes in 32-h postfertilization zebrafish
embryos. In situ hybridization of whole mounts was performed to localize the
mRNA expression of CPSIII (A), OTC (B), ASS1 (C), and ASL (D). Arrows
indicate the pronounced marking for each gene on the embryonic endoderm.
The scale represents 100 ␮m.
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00411.2012 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 17, 2017
CpG site
⬃10 times lower in CPSIII morphants compared with their
control counterparts, but this difference disappeared by 48 hpf
(Fig. 5D).
At 24 hpf, morphants were injected in the yolk sac with
exogenous ammonia and their nitrogenous waste excretion was
monitored. Both control and CPSIII morphants excreted high
levels of ammonia for 2 h postinjection (Fig. 6A). In contrast,
although the control morphants also excreted high levels of
urea in response to ammonia loading, CPSIII morphants excreted only approximately half the amount of the urea excreted
by their control morphants (Fig. 6A). When we examined their
body contents, CPSIII morphants had higher concentrations of
ammonia, whereas their urea content was marginally lower
than the control morphants (Fig. 6B). Overall, the nitrogenous
budget (excreted nitrogenous waste ⫹ nitrogenous body content) of both morphant types was comparable over the flux
period (0.76 ⫾ 0.07 nmol N/embryo for controls vs. 0.75 ⫾
0.07 nmol N/embryo in CPSIII morphants) with the CPSIII
morphants excreting and accumulating less urea and more
ammonia than control morphants.
R996
O-UC GENE EXPRESSION IN ZEBRAFISH
B
a
16
CPSIII activity (pmole/min/mg protein)
Fig. 4. CPSII and CPSIII enzyme activities in developing control (white bars) and CPSIII morphants (black
bars). The relative enzyme activity of CPSII (A) and
CPSIII (B) was evaluated in zebrafish embryos 24 and
48 h postfertilization. Different letters indicate statistically significant difference between developmental
times or between treatments (n ⫽ 4 – 6).
CPSII activity (pmole/min/mg protein)
A
12
b
8
4
0
b
e
3
2
c
d
1
0
A
24
48
Hours post fertilization
wk of development (27). Our results suggest that not only CPSIII
but three other enzymes of the O-UC cycles are transcriptionally
active as early as 24 hpf (Fig. 2). In addition, we detected
transcripts for these enzymes as early as 5 hpf, which is barely
after the start of zygotic transcription, suggesting that the
transcripts detected at this point may be of maternal origin
(24). Another interesting point is that there is a surge in CPSIII
mRNA at ⬃32 hpf (Fig. 2A). Given that zebrafish larvae
typically hatch around 48 –72 hpf, it is reasonable to think that
this CPSIII mRNA increase primes the fish for the upcoming
hatching event. Indeed, during hatching, the weakened chorion
Ammonia
d
Rate of nitrogen excretion
(nmol N/h/embryo)
0.4
f
c
e
b
e
0.2
e
e
f
0.06
a
e
a
0.04
f
a
e
e
e
0.1
0.02
e
f
0
24-30
30-48
48-55
55-72
Hours post fertilization
C
b
0.08
e
0
Nitrogen concentration
(nmol N/h/embryo)
Urea
b
0.3
e e
Fig. 5. Nitrogen fluxes and body contents in developing control and CPSIII morphants. Control morphants
(white bars) and CPSIII morphants (black bars) were
evaluated for ammonia (A) and urea (B) excretion, and
whole body content for ammonia (C) and urea (D) at
different stages of their development. Different letters
indicate statistically significant difference between developmental times or between treatments (n ⫽ 4 –7).
B
24-30
30-48
48-55
Hours post fertilization
D
Ammonia
0.8
Urea
a
a
a
0.16
a
0.6
a
0.4
a
a
0.12
0.08
0.2
0.04
b
0
55-72
0
24
48
Hours post fertilization
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00411.2012 • www.ajpregu.org
24
48
Hours post fertilization
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 17, 2017
24
48
Hours post fertilization
functionality of the O-UC in zebrafish larvae, suggesting that at
least very early in development the O-UC is functional, and has
an impressive capacity to detoxify ammonia as tested via
injections of supraphysiological levels of ammonia.
Gene expression of O-UC enzymes. In a variety of teleosts,
several enzymes of the O-UC are detectable at relatively early
life stages (7, 25, 27, 50, 62). To our knowledge, the only other
study to examine mRNA expression patterns of the O-UC in a
developing teleost focused on CPSIII mRNA in rainbow trout
(27). In rainbow trout, CPSIII transcripts are present shortly
after fertilization, and mRNA expression maximizes within 2
e
a
O-UC GENE EXPRESSION IN ZEBRAFISH
Rate of nitrogen excretion
(nmol N/h/embryo)
A
a
0.08
a
a
0.06
b
0.04
0.02
0
Ammonia
0.5
0.4
b
a
0.3
a
0.2
b
0.1
0
Ammonia
Urea
Fig. 6. Nitrogen fluxes and body contents in ammonia-injected control and
CPSIII morphants. Control morphants (white bars) and CPSIII morphants
(black bars) were yolk injected with ammonia, and their ammonia and urea
excretion rates were evaluated for 2 h (A), and their ammonia and urea body
contents (B). Different letters indicate statistically significant difference between treatments (n ⫽ 4 – 6).
is first opened and then shed by the movements of the larvae.
Metabolically speaking, this prehatch surge in activity of the
embryo must be demanding, and thus must be exacerbating
production of metabolic wastes (i.e., ammonia) that need to be
detoxified (15, 16, 33). Interestingly, zebrafish larvae accumulate significant amounts of urea (a fourfold increase!) during
hatching, whereas their excretion of both ammonia and urea
remain stable (4). These observations would tend to suggest
that the increase in CPSIII mRNA prior to hatching is of
physiological importance because it will help the embryo
detoxify the ammonia produced during hatching. Although the
transcripts of other enzymes did not increase until later (Fig. 2,
A–D), this situation is not atypical. For example, in fetal mice,
CPSI, the CPSIII mammalian homologue, is one of the first
O-UC genes to be expressed during development, whereas
other enzymes such as OTC follow a few days later (32). It is
possible that the other enzymes are in sufficient quantities
before hatching, and considering the importance of CPSIII as a
regulatory enzyme (controlling entry into the O-UC), it might
be most important to tightly regulate that enzyme to control
overall urea production rate through the cycle.
Previous work has examined the localization of some of the
O-UC enzymes in newly hatched rainbow trout (50), and
determined that CPSIII enzyme activity was primarily detected
in the embryonic body of developing trout, whereas OTC was
found to be also expressed in hepatic tissues. However, because of the technical limitation of the assays, these spatial
patterns could not be further refined or include other O-UC
enzymes (i.e., ASL, ASS). Thus we took advantage of established techniques in zebrafish to localize the transcripts of
major O-UC enzymes (Fig. 3). Overall, most of the expression
of the transcripts was restricted to the anterior endoderm
adjacent to the yolk sac (Fig. 3). This finding is not surprising
when we consider the compartmentalization of nitrogen waste
in teleost embryos. Indeed, in zebrafish, as in other fish species,
urea, and to a lesser extent ammonia, accumulate at much
higher levels in the yolk sac than in the embryonic body (6,
15–17, 36, 42, 50). This compartmentalization would suggest
that a transport mechanism exists that allows these nitrogenous
wastes to be concentrated in the yolk sac, and for urea, that the
site of formation is either in the yolk sac of the embryo or in
adjacent areas. Our results and previous work suggest that not
only are ammonia and urea transporters present in the region
surrounding the yolk sac in zebrafish (4), but that O-UC
enzymes predominantly colocalize to embryonic tissues surrounding the yolk sac (Fig. 3). Thus both synthesis and transport of urea could potentially occur very effectively in that
vascularized region allowing rapid detoxification of ammonia
and segregation of nitrogenous wastes within the yolk. In terms
of gene expression in adults, the higher expression of mRNA
O-UC enzymes in muscular than in hepatic tissues is in
agreement with previous work in several other ammonotelic
teleosts at both the mRNA and enzyme levels (26, 27).
Considering these very specific patterns of expression both
in developing fish and adult tissues, we hypothesized that they
could be dictated by epigenetic mechanisms of regulation as
opposed to transcriptional regulation. Indeed, epigenetic regulation has recently emerged as a powerful means to establish
both temporal and tissue-specific gene expression patterns (8,
31, 40, 49, 63). Specifically, we focused on the methylation
status of cytosine residues located in a region rich in cytosineguanosine dinucleotides within the proximal promoter of CPSIII.
Overall, the patterns we observed both across developmental
stages and between adult tissues are not consistent with our
initial hypothesis (Table 2). The methylation state in embryos
seemed to decrease over time, whereas the gene expression
peaked at 32 hpf (Fig. 2A). Similarily, in adult fish, although
CPSIII mRNA is expressed at levels that are orders of magnitude higher in muscle than in liver (Fig. 2E), the methylation
status at both individual sites and of the region as a whole show
little difference between the two tissues; if anything, the
promoter is slightly hypomethylated in liver compared with
muscle (Table 2.). This situation is very different from that of
mammalian systems, in which there is clearly an epigenetic
impact on gene expression of CPSI (45). Furthermore, the
characterization of the mammalian CPSI promoter uncovered a
complex mode of transcriptional regulation, with multiple
regulatory units controlling its gene expression (9 –11, 19, 20,
28, 47, 55). We performed a preliminary in silico analysis of
the zebrafish CPSIII promoter, and failed to identify most of
the regulatory markers present in mammalian CPSI promoter
(e.g., glucocorticoid and hepatocyte nuclear factor response
elements). However, our results suggest the possibility that
transcriptional, and not epigenetic, regulation may be coordinating the spatiotemporal expression of CPSIII in zebrafish,
although this speculation warrants further investigation beyond
the scope of the present study. We should keep in mind,
though, that in mammals, the functionality of the urea cycle is
of crucial importance in all life stages, because defects in this
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00411.2012 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 17, 2017
Nitrogen body content
(nmol N/embryo)
B
Urea
R997
R998
O-UC GENE EXPRESSION IN ZEBRAFISH
sults also suggest that this rapid detoxification of ammonia occurs
primarily through the O-UC, because a 50% decrease in CPSIII
activity results in a similar reduction in urea production in the
ammonia-injected CPSIII morphants (Fig. 4B).
However, when considering these rapid changes in urea
production, the activities for CPS enzyme activities obtained in
zebrafish larvae seem relatively modest to accomplish this feat.
But when approximated per gram of tissue, we estimate them
to be about 0.05– 0.2 nmol·min⫺1·g⫺1 for CPSII and 0.01– 0.04
nmol·min⫺1·g⫺1 for CPSIII, which is lower than, but in the
range of previous reports for teleost embryos (e.g., Ref. 7).
However, even at these relatively low levels of activity, the
flux through CPSIII in optimal conditions (though unlikely to
happen in vivo), would be more than sufficient to produce the
large amounts of urea observed when presented with an excessive ammonia load (Fig. 5). Thus, zebrafish embryos, as other
teleost species, have the capacity to produce significant levels
of urea even early in their development, but do not completely
activate that metabolic pathway until presented with an ammonia challenge. Although seemingly excessive compared
with their normal nitrogenous budget, this capacity could be
crucial at specific point in development (i.e., hatching) where
conditions may require rapid detoxification of ammonia.
Perspectives and Significance
Overall, we demonstrated that several enzymes of the O-UC
are expressed at early developmental stages of the zebrafish
larvae. In addition, the localization of the enzyme transcripts
suggest that they are optimally located to compartmentalize urea
within the yolk of the embryo. Furthermore, using reverse genetics and manipulation of ammonia load in embryo, we firmly
establish the functionality of the O-UC and its potential importance over other ureogenic pathways for ammonia detoxification
at these stages of development. Considering the localization of the
O-UC enzymes and their capacity to rapidly detoxify relatively
large amounts of urea, it appears that the retention of ureogenic
capacity in several developing teleost embryos could act as a
protective mechanism against endogenous or exogenous surges in
ammonia. This report in zebrafish, a warm acclimated freshwater
species, corroborate previous results obtained in phylogenetically
distant species from diverse freshwater and seawater environments (e.g., cod, rainbow trout, halibut, African catfish; 7, 51, 52,
62). Thus our results provide additional support to the emerging
view that O-UC detoxifying capacity is active and maintained in
a variety of teleost species during early development, but this
capacity is repressed at later life stages (21).
ACKNOWLEDGMENTS
The authors thank Marc Ekker and Steve Perry for helpful discussions; and
Vishal Saxhena and Melanie Debiais for technical assistance with fish husbandry, in situ hybridization, and microinjection work.
GRANTS
Support for this study was provided by a Canada Foundation for Innovation
grant and a Natural Science and Engineering Research Council Discovery grant to
P. J. Walsh, who is also supported by the Canada Research Chair Program.
DISCLOSURES
No conflicts of interest, financial or otherwise, are declared by the author(s).
AUTHOR CONTRIBUTIONS
Author contributions: C.M.L. and P.J.W. conception and design of research;
C.M.L. performed experiments; C.M.L. analyzed data; C.M.L. interpreted
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00411.2012 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 17, 2017
cycle are highly detrimental and can be lethal on the basis of
their severity (3). In contrast, in ammonotelic teleost the urea
cycle is apparently mostly active only at early life stages, and
defects in the cycle (i.e., transient knockdown of CPSIII) are
not lethal in zebrafish embryos (C. M. R. LeMoine and P. J.
Walsh personal observation). Thus it is reasonable to believe
that the two evolutionary and physiologically distant taxa
present very different means of regulating components of the
urea cycle. In that respect, a comparative study of the mechanism of regulation of the O-UC in closely related ammonotelic
and ureotelic teleosts (e.g., Opsanus beta and Porhychis notatus) compared with the mammalian model could provide invaluable information on the evolution and regulation of ureotelism in vertebrates.
CPSIII silencing. We employed reverse genetic techniques to
assess the functionality of CPSIII and by extension the O-UC in
developing zebrafish (Figs. 4 – 6). Overall, our results suggest that
in zebrafish, CPSIII and the O-UC are active at early life stages.
CPSIII was efficiently silenced for the first 24 hpf in the larvae as
indicated by enzyme assays (Fig. 4B). Indeed, the activity of the
enzyme was reduced by ⬃50% in CPSIII morphants, but quickly
recovered to control levels thereafter (Fig. 4B). The patterns
observed at the enzyme level were mirrored by the urea fluxes and
body contents of the morphants, because by 24 hpf nearly no urea
was excreted or accumulated by the CPSIII morphants, but a full
recovery was evident by 48 hpf (Fig. 5, B and D). As development
progresses, ammonia excretion tends to increase regardless of the
morpholino treatment as described elsewhere (Fig. 5A) (3, 5),
however, there does not seem to be a compensatory increase in
ammonia fluxes from the CPSIII morphants compared with their
control counterparts. The rapid recovery observed in CPSIII
morphants may be due to several factors. First, this compensation
may reflect the normal increase in gene expression that occurs in
wild-type embryos (Fig. 2A), and a large increase in CPSIII
mRNA could buffer the morpholino effect in part or completely.
Another possible cause for this rescue of CPSIII could be a
specific attempt by the embryo to compensate for the morpholino
silencing, again resulting in the reduction of the morpholino effect
(13, 34). These two possibilities could superimpose on the fact
that as the embryo grows, the morpholinos are diluted over time,
and for a site-specific expression of the target sequence (as
evidenced by Fig. 3), the initial effective morpholino concentration becomes diluted and the silencing is overwhelmed by the
relative increase in the mRNA target’s expression.
To extend our findings, we ammonia-challenged 24 hpf morphants with direct injection and assessed their nitrogenous waste
fluxes and body contents (Fig. 6). Both control and CPSIII
morphants showed an elevated excretion of ammonia within 2 h
of injection compared with 24 –30 hpf in uninjected embryos
(Figs. 5A and 6A). In addition, control morphants also showed a
rate of urea excretion similar in magnitude to their ammonia flux
(Fig. 6A). In contrast, CPSIII morphants excreted only half the
amount of urea the control morphants did (Fig. 6A), further
establishing that the O-UC is impaired in CPSIII morphants.
Moreover, the accumulation of nitrogenous wastes in the embryos
corroborates these results, because CPSIII accumulated more
ammonia and less urea than control morphants (Fig. 6A). The
effects of the exogenous ammonia injection on the control morphants are similar to previous reports of embryos exposed to high
environmental ammonia (50, 61), as embryos increased their urea
excretion to prevent harmful ammonia accumulation. These re-
O-UC GENE EXPRESSION IN ZEBRAFISH
results of experiments; C.M.L. prepared figures; C.M.L. drafted manuscript;
C.M.L. and P.J.W. edited and revised manuscript; C.M.L. and P.J.W. approved
final version of manuscript.
REFERENCES
22. Hayatsu H. The bisulfite genomic sequencing used in the analysis of
epigenetic states, a technique in the emerging environmental genotoxicology research. Mutat Res 659: 77–82, 2008.
23. Kamler E. Early Life History of Fish: An Energetics Approach, edited by
Pitcher TJ. London: Chapman and Hall, 1992.
24. Kane D, Kimmel C. The zebrafish midblastula transition. Development
119: 447–456, 1993.
25. Kharbuli ZY, Datta S, Biswas K, Sarma D, Saha N. Expression of
ornithine-urea cycle enzymes in early life stages of air-breathing walking
catfish Clarias batrachus and induction of ureogenesis under hyper-ammonia
stress. Comp Biochem Physiol B Biochem Mol Biol 143: 44 –53, 2006.
26. Kong H, Edberg DD, Korte JJ, Salo WL, Wright PA, Anderson PM.
Nitrogen excretion and expression of carbamoyl-phosphate synthetase III
activity and mRNA in extrahepatic tissues of largemouth bass (Micropterus salmoides). Arch Biochem Biophys 350: 157–168, 1998.
27. Korte JJ, Salo WL, Cabrera VM, Wright PA, Felskie AK, Anderson
PM. Expression of carbamoyl-phosphate synthetase III mRNA during the
early stages of development and in muscle of adult rainbow trout (Oncorhynchus mykiss). J Biol Chem 272: 6270 –6277, 1997.
28. Lagacé M, Howell BW, Burak R, Lusty CJ, Shore GC. Rat carbamylphosphate synthetase I gene. Promoter sequence and tissue-specific transcriptional regulation in vitro. J Biol Chem 262: 10415–10418, 1987.
29. LeMoine CM, Craig PM, Dhekney K, Kim JJ, McClelland GB.
Temporal and spatial patterns of gene expression in skeletal muscles in
response to swim training in adult zebrafish (Danio rerio). J Comp Physiol
B Biochem Mol Biol 180: 151–160, 2010.
30. Mommsen TP, Walsh PJ. Evolution of urea synthesis in vertebrates: the
piscine connection. Science 243: 72–75, 1989.
31. Moore LD, Le T, Fan G. DNA methylation and its basic function.
Neuropsychopharmacology 38: 23–38, 2013.
32. Morris SM Jr, Kepka DM, Sweeney WE Jr, Avner ED. Abundance of
mRNAs encoding urea cycle enzymes in fetal and neonatal mouse liver.
Arch Biochem Biophys 269: 175–180, 1989.
33. Ninness MN, Stevens ED, Wright PA. Energy expenditure during
hatching in rainbow trout (Oncorhynchus mykiss) embryos. Can J Fish
Aquat Sci 63: 1405–1413, 2006.
34. Nornes S, Newman M, Verdile G, Wells S, Stoick-Cooper CL, Tucker
B, Frederich-Sleptsova I, Martins R, Lardelli M. Interference with
splicing of Presenilin transcripts has potent dominant negative effects on
Presenilin activity. Hum Mol Genet 17: 402–412, 2008.
35. Pilley CM, Wright PA. The mechanisms of urea transport by early life
stages of rainbow trout (Oncorhynchus mykiss). J Exp Biol 203: 3199 –
3207, 2000.
36. Rahaman-Noronha E, O’Donnell MJ, Pilley CM, Wright PA. Excretion and distribution of ammonia and the influence of boundary layer
acidification in embryonic rainbow trout (Oncorhynchus mykiss). J Exp
Biol 199: 2713–2723, 1996.
37. Rahmatullah M, Boyde TR. Improvements in the determination of urea
using diacetyl monoxime; methods with and without deproteinisation. Clin
Chim Acta 107: 3–9, 1980.
38. Randall DJ, Wood CM, Perry SF, Bergman H, Maloiy GM, Mommsen TP, Wright PA. Ureotelism in a completely aquatic teleost fish: a
strategy for survival in an extremely alkaline environment. Nature 337:
165–166, 1989.
39. Rice SD, Stokes RM. Metabolism of nitrogenous wastes in the eggs and
alevins of rainbow trout, Salmo gairdneri Richardson. In: The Early Life
History of Fish, edited by Blaxter JH. New York: Springer-Verlag, 1974,
p. 325–337.
40. Rishi V, Bhattacharya P, Chatterjee R, Rozenberg J, Zhao J, Glass K,
Fitzgerald P, Vinson C. CpG methylation of half-CRE sequences creates
C/EBPalpha binding sites that activate some tissue-specific genes. Proc
Natl Acad Sci USA 107: 20311–20316, 2010.
41. Rombough PJ. Respiratory gas exchange, aerobic metabolism and effects
of hypoxia during early life. In: Fish Physiology, vol. XIA, edited by Hoar
WS and Randall DJ. New York: Academic Press, 1988, p. 59 –161.
42. Rønnestad I, Fyhn HJ, Gravningen K. The importance of free amino
acids to the energy metabolism of eggs and larvae of turbot (Scophthalmus
maximus). Mar Biol 114: 517–525, 1992.
43. Rønnestad I, Thorsen A, Finn RN. Fish larval nutrition: a review of recent
advances in the roles of amino acids. Aquaculture 177: 201–216, 1999.
44. Rønnestad I, Finn RN, Groot E, Fyhn HJ. Utilization of free amino
acids related to energy metabolism of developing eggs and larvae of lemon
sole Microstomus kilt reared in the laboratory. Mar Ecol Prog Ser 88:
195–205, 1992.
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00411.2012 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 17, 2017
1. Anderson P. Urea, and glutamine synthesis: environmental influences on
nitrogen excretion. In: Fish Physiology Vol. XX Nitrogen Excretion, edited
by Wright PA and Anderson PM. San Diego, CA: Academic, 2001, p.
239 –277.
2. Bock C, Reither S, Mikeska T, Paulsen M, Walter J, Lengauer T. BiQ
analyzer: visualization and quality control for DNA methylation data from
bisulfite sequencing. Bioinformatics 21: 4067–4068, 2005.
3. Braissant O. Current concepts in the pathogenesis of urea cycle disorders.
Mol Genet Metab 100, Suppl 1: S3–S12, 2010.
4. Braun MH, Steele SL, Ekker M, Perry SF. Nitrogen excretion in
developing zebrafish (Danio rerio): a role for Rh proteins and urea
transporters. Am J Physiol Renal Physiol 296: F994 –F1005, 2009.
5. Braun MH, Steele SL, Perry SF. The responses of zebrafish (Danio
rerio) to high external ammonia and urea transporter inhibition: nitrogen
excretion and expression of rhesus glycoproteins and urea transporter
proteins. J Exp Biol 212: 3846 –3856, 2009.
6. Bucking C, LeMoine CM, Walsh PJ. Waste nitrogen metabolism and
excretion in zebrafish embryos: effects of light, ammonia and nicotinamide. J Exp Zool. In press.
7. Chadwick TD, Wright PA. Nitrogen excretion and expression of urea
cycle enzymes in the Atlantic cod (Gadus morhua L.): a comparison of
early life stages with adults. J Exp Biol 202: 2653–2662, 1999.
8. Chang CP, Bruneau BG. Epigenetics and cardiovascular development.
Annu Rev Physiol 74: 41–68, 2012.
9. Chen YR, Sekine K, Nakamura K, Yanai H, Tanaka M, Miyajima A.
Y-box binding protein-1 down-regulates expression of carbamoyl phosphate synthetase-I by suppressing CCAAT enhancer-binding proteinalpha function in mice. Gastroenterology 137: 330 –340, 2009.
10. Christoffels VM, Habets PE, Das AT, Clout DE, van Roon MA,
Moorman AF, Lamers WH. A single regulatory module of the carbamoylphosphate synthetase I gene executes its hepatic program of expression.
J Biol Chem 275: 40020 –40027, 2000.
11. Christoffels VM, van den Hoff MJ, Moorman AF, Lamers WH. The
far-upstream enhancer of the carbamoyl-phosphate synthetase I gene is
responsible for the tissue specificity and hormone inducibility of its
expression. J Biol Chem 270: 24932–24940, 1995.
12. Dabrowski KR. Ontogenetical aspects of nutritional requirements in fish.
Comp Biochem Physiol A Comp Physiol 85: 639 –655, 1986.
13. Dépeche J, Gilles R, Daufresne S, Chiapello H. Urea content and urea
production via the ornithine-urea cycle pathway during the ontogenic
development of two teleost fishes. Comp Biochem Physiol A Physiol 63A:
51–56, 1979.
14. Eisen JS, Smith JC. Controlling morpholino experiments: don’t stop
making antisense. Development 135: 1735–1743, 2008.
15. Finn RN, R兾onnestad I, Fyhn HJ. Respiration, nitrogen and energy
metabolism of developing yolk-sac larvae of Atlantic halibut (Hippoglossus hippoglossus L.). Comp Biochem A Physiol A Physiol 111: 647–671,
1995.
16. Finn RN, Widdows J, Fyhn HJ. Calorespirometry of developing embryos and yolk-sac larvae of turbot (Scophthalmus maximus L.). Mar Biol
122: 157–163, 1995.
17. Frommer M, McDonald LE, Millar DS, Collis CM, Watt F, Grigg
GW, Molloy PL, Paul CL. A genomic sequencing protocol that yields a
positive display of 5-methylcytosine residues in individual DNA strands.
Proc Natl Acad Sci USA 80: 1579 –1583, 1992.
18. Fyhn HJ. Energy production in marine fish larvae with emphasis on free
amino acids as a potential fuel. In: Animal Nutrition and Transport
Processes: Nutrition in Wild and Domestic Animals (Comparative Physiology), edited by Mellinger J. Basel: Karger, 1990, p. 176 –192.
19. Goping IS, Lagacé M, Shore GC. Factors interacting with the rat
carbamyl phosphate synthetase promoter in expressing and nonexpressing
tissues. Gene 118: 283–287, 1992.
20. Goping IS, Shore GC. Interactions between repressor and anti-repressor
elements in the carbamyl phosphate synthetase I promoter. J Biol Chem
269: 3891–3896, 1994.
21. Griffith RW. Guppies, toadfish, lungfish, coelacanths and frogs: a scenario for the evolution of urea retention in fishes. Env Biol Fishes 32:
199 –218, 1991.
R999
R1000
O-UC GENE EXPRESSION IN ZEBRAFISH
54. Thisse C, Thisse B. High-resolution in situ hybridization to whole-mount
zebrafish embryos. Nat Protoc 3: 59 –69, 2008.
55. van den Hoff MJ, van de Zande LP, Dingemanse MA, Das AT,
Labruyère W, Moorman AF, Charles R, Lamers WH. Isolation and
characterization of the rat gene for carbamoylphosphate synthetase I. Eur
J Biochem 228: 351–361, 1995.
56. Verdouw H, Van Echted CJ, Dekkers EM. Ammonia determination
based on indophenol formation with sodium salicylate. Water Res 12:
399 –402, 1978.
57. Walsh PJ, Danulat E, Mommsen TP. Variation in urea excretion in the
gulf toadfish, Opsanus beta. Mar Biol 106: 323–328, 1990.
58. Walsh PJ, Mommsen TP. Evolutionary considerations of nitrogen metabolism and excretion. In: Fish Physiology Vol. XX Nitrogen Excretion,
edited by Wright PA and Anderson PM. San Diego, CA: Academic, 2001,
p. 1–30.
59. Westerfield M. The Zebrafish Book. Eugene: University of Oregon Press,
1995.
60. Wood CM, Perry SF, Wright PA, Bergman HL, Randall DJ. Ammonia
and urea dynamics in the Lake Magadi tilapia, a ureotelic teleost fish
adapted to an extremely alkaline environment. Respir Physiol 77: 1–20,
1989.
61. Wright PA, Land MD. Urea production and transport in teleost fish.
Comp Biochem A Physiol A Physiol 119: 47–54, 1998.
62. Wright PA, Felskie A, Anderson PM. Induction of ornithine-urea cycle
enzymes and nitrogen metabolism and excretion in rainbow trout (Oncorhynchus mykiss) during early life stages. J Exp Biol 198: 127–135,
1995.
63. Yamakoshi K, Shimoda N. De novo DNA methylation at the CpG island
of the zebrafish no tail gene. Genesis 37: 195–202, 2003.
AJP-Regul Integr Comp Physiol • doi:10.1152/ajpregu.00411.2012 • www.ajpregu.org
Downloaded from http://ajpregu.physiology.org/ by 10.220.33.1 on June 17, 2017
45. Ryall JC, Quantz MA, Shore GC. Rat liver and intestinal mucosa differ
in the developmental pattern and hormonal regulation of carbamoylphosphate synthetase I and ornithine carbamoyl transferase gene expression. Eur J Biochem 156: 453–458, 1986.
46. Saha N, Ratha BK. Active ureogenesis in a freshwater air-breathing
teleost, Heteropneustes fossilis. J Exp Zool 241: 137–141, 1987.
47. Schoneveld OJ, Hoogenkamp M, Stallen JM, Gaemers IC, Lamers
WH. cyclicAMP and glucocorticoid responsiveness of the rat carbamoylphosphate synthetase gene requires the interplay of upstream regulatory
units. Biochimie 89: 574 –580, 2007.
48. Smith S. Studies in the development of the rainbow trout (Salmo irideus).
J Exp Biol 23: 357–378, 1947.
49. Stancheva I, El-Maarri O, Walter J, Niveleau A, Meehan RR. DNA
methylation at promoter regions regulates the timing of gene activation in
Xenopus laevis embryos. Dev Biol 243: 155–165, 2002.
50. Steele SL, Chadwick TD, Wright PA. Ammonia detoxification and
localization of urea cycle enzyme activity in embryos of the rainbow trout
(Oncorhynchus mykiss) in relation to early tolerance to high environmental
ammonia levels. J Exp Biol 204: 2145–2154, 2001.
51. Terjesen BF, Chadwick TD, Verreth JAJ, Rønnestad I, Wright PA.
Pathways for urea production during early life of an air-breathing teleost,
the African catfish Clarias gariepinus Burchell. J Exp Biol 204: 2155–
2165, 2001.
52. Terjesen BF, Rønnestad I, Norberg B, Anderson PM. Detection and
basic properties of carbamoyl phosphate synthetase III during teleost
ontogeny: a case study in the Atlantic halibut. Comp Biochem Physiol B
Biochem Mol Biol 126: 521–535. 2000.
53. Terjesen BF, Verreth J, Fyhn HJ. Urea and ammonia excretion by
embryos and larvae of the African catfish Clarias gariepinus (Burchell
1822). Fish Physiol Biochem 16: 311–321, 1997.