FEMS Microbiology Reviews 28 (2004) 469–487
www.fems-microbiology.org
Cellular differentiation and the NtcA transcription factor
in filamentous cyanobacteria
Antonia Herrero *, Alicia M. Muro-Pastor, Ana Valladares, Enrique Flores
Instituto de Bioquımica Vegetal y Fotosıntesis, Consejo Superior de Investigaciones Cientıficas, Centro de Investigaciones Cientıficas Isla de la Cartuja,
Universidad de Sevilla, Avda. Americo Vespucio s/n, E-41092 Seville, Spain
Received 31 July 2003; received in revised form 31 December 2003; accepted 4 April 2004
First published online 8 May 2004
Abstract
Some filamentous cyanobacteria can undergo a variety of cellular differentiation processes that permit their better adaptation to
certain environmental conditions. These processes include the differentiation of hormogonia, short filaments aimed at the dispersal
of the organism in the environment, of akinetes, cells resistant to various stress conditions, and of heterocysts, cells specialized in the
fixation of atmospheric nitrogen in oxic environments. NtcA is a transcriptional regulator that operates global nitrogen control in
cyanobacteria by activating (and in some cases repressing) many genes involved in nitrogen assimilation. NtcA is required for the
triggering of heterocyst differentiation and for subsequent steps of its development and function. This requirement is based on
the role of NtcA as an activator of the expression of hetR and other multiple genes at specific steps of the differentiation process. The
products of these genes effect development as well as the distinct metabolism of the mature heterocyst. The different features found
in the NtcA-dependent promoters, together with the cellular level of active NtcA protein, should have a role in the determination of
the hierarchy of gene activation during the process of heterocyst differentiation.
Ó 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
Keywords: Cellular differentiation; Cyanobacteria; Heterocyst differentiation; Nitrogen regulation; NtcA
Contents
1.
2.
3.
4.
5.
6.
7.
*
Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Nitrogen control and the NtcA transcription factor . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2.1. Nitrogen control in enterobacteria and some other bacteria . . . . . . . . . . . . . . . . .
2.2. Nitrogen control in cyanobacteria. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Cellular differentiation in filamentous cyanobacteria . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.1. Differentiation of hormogonia . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.2. Differentiation of akinetes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
3.3. Differentiation of heterocysts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Role of NtcA at the initiation of heterocyst differentiation. . . . . . . . . . . . . . . . . . . . . . . . .
Role of NtcA during the progression of heterocyst differentiation and in the mature
heterocyst . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
A compilation of NtcA-regulated promoters involved in heterocyst development or function
Concluding remarks and prospects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Corresponding author. Tel.: +34-95-448-9522; fax: +34-95-446-0065.
E-mail address: [email protected] (A. Herrero).
0168-6445/$22.00 Ó 2004 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.
doi:10.1016/j.femsre.2004.04.003
470
470
470
471
472
472
473
474
475
478
479
482
470
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
483
References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
483
1. Introduction
Cyanobacteria are ancient organisms that by having
developed oxygenic photosynthesis, leading to the accumulation of oxygen in the atmosphere, have played a
crucial role in the evolution of our planet. Together with
chloroplasts, cyanobacteria constitute a coherent phylogenetic group of high rank in the Bacteria domain of
life [1]. Currently, cyanobacteria have a wide ecological
distribution and contribute an important fraction of the
primary productivity of the oceans, in which the input of
fixed nitrogen due to cyanobacterial diazotrophy is
highly relevant [2].
Cyanobacteria display a relatively wide range of
morphological diversity, that ranges from unicellular,
rod- or coccus-shaped, in some cases grouped into defined aggregates, to filamentous forms exhibiting different degrees of filament complexity [3]. Despite this
morphological diversity, cyanobacteria are rather homogeneous in their metabolic way of living, which is
primarily based on photoautotrophy with CO2 fixation
through the reductive pentose phosphate pathway.
With regard to the assimilation of nitrogen, cyanobacteria preferentially use inorganic nitrogen for
growth. Nitrate and ammonium are excellent sources of
nitrogen for cyanobacteria in general, and many representatives, both unicellular and filamentous, are also
able to perform the fixation of atmospheric nitrogen.
Some simple organic molecules such as urea can also be
efficiently used by a number of cyanobacteria, some of
which are also able to grow at the expenses of some
amino acids, such as arginine or glutamine, or nitrogencontaining bases (for a review, see [4]). In recent years, a
good deal of knowledge has accumulated on the
molecular details of the pathways for the assimilation of
nitrogen by cyanobacteria, including information on a
number of transport systems for the uptake of nitrogen
nutrients, and numerous genetic systems encoding elements of those pathways have been identified and
characterized (see [5]). Whatever the environmental nitrogen source, its intracellular processing renders ammonium, which is assimilated mainly through the
glutamine synthetase/glutamate synthase pathway, thus
providing the basis for a coordinated regulation of nitrogen assimilation.
Global regulation of nitrogen assimilation exerted
through ammonium-promoted repression of genes involved in the assimilation of alternative nitrogen sources
is a common theme in bacteria, and is also operative in
cyanobacteria. Nevertheless, the molecular mechanism
by which nitrogen control is exerted in the cyanobacteria is distinctive, with the transcriptional regulator NtcA
playing a central role in it.
2. Nitrogen control and the NtcA transcription factor
Many microorganisms that are capable of assimilating a variety of nitrogen sources exhibit a preference for
ammonium (or, in some cases, glutamine) over other
compounds which are therefore considered as alternative nitrogen sources. This preference of assimilation is
sustained by a regulatory phenomenon termed nitrogen
control (N control) that ensures that permeases and
enzymes of the assimilatory pathways for alternative
nitrogen sources are not expressed when the cells are
exposed to a non-limiting concentration of ammonium.
N control also affects the genes amt (or amtB), encoding
the ammonium permease, and glnA, encoding glutamine
synthetase, whose high-level expression is essential for
an efficient assimilation of ammonium when it is present
at a low concentration in the extracellular medium. At
least five different molecular mechanisms operating N
control have been identified in bacteria, those of the
enterobacteria (also present with some variations in
some other proteobacteria), Bacillus subtilis, Corynebacterium glutamicum, Methanococcus maripaludis, and
the cyanobacteria.
2.1. Nitrogen control in enterobacteria and some other
bacteria
The best characterized bacterial N-control system is
the one found in the enterics, whose core elements are the
NtrB–NtrC two-component regulatory system (in which
NtrB is the sensor and NtrC the response regulator), the
PII -type signal transduction protein GlnB, and the glnD
gene product uridylyltransferase, an enzyme that modifies or demodifies GlnB in response to, respectively, low
and high cellular levels of glutamine (for recent reviews,
see [6,7]). Activity of GlnB is not only affected by its uridylylation state but also by binding of 2-oxoglutarate
(and ATP). Under nitrogen limitation, when GlnB is uridylylated and carries bound 2-oxoglutarate, NtrB
phosphorylates NtrC producing NtrC-P that activates
transcription of glnA and other genes. In contrast, under
nitrogen excess, non-modified GlnB accumulates and
interacts with NtrB stimulating its NtrC-P phosphatase
activity, leading to accumulation of non-phosphorylated
NtrC and thus to decreased expression of the NtrC-
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
dependent genes. GlnB also affects the modification of
glutamine synthetase by adenylylation, which negatively
influences glutamine synthetase activity and increases its
sensitivity to feed-back inhibitors. The glutamine synthetase adenylyltransferase (glnE gene product) is, as is
also the case with the PII uridylyltransferase, sensitive to
glutamine [6,7]. It is now known that a second PII -type
protein, GlnK, is widely distributed in bacteria [7]. In its
non-uridylylated state, GlnK appears to be an inhibitor
of the ammonium permease [8]. Another relevant role of a
GlnK protein has been described concerning the NifL–
NifA regulatory system of nif gene expression in Azotobacter vinelandii [9], in which the inhibitory activity of
NifL on NifA is stimulated by non-uridylylated PII
(GlnK).
In the low-G + C content bacterium B. subtilis,
N-regulated gene expression is controlled by the MerRfamily proteins TnrA and GlnR [10]. Under N excess,
GlnR represses glnA and other genes, and under N
limitation TnrA activates the expression of genes like
amtB-glnK and represses others like glnA. Glutamine
synthetase is not subjected to post-translational modification in B. subtilis, but it is the target of feedback
regulation mainly by glutamine. It has recently been
shown that the feedback-inhibited form of glutamine
synthetase directly interacts with TnrA blocking the
DNA binding activity of this transcriptional regulator
[11]. In the high-G + C content bacterium C. glutamicum
N control is mediated by AmtR, a DNA-binding protein
of the TetR/ArcR family that acts as a repressor of amt
and other N-controlled genes [12]. One of the operons
repressed by AmtR is amtB-glnK-glnD, and GlnK and
GlnD are necessary for expression of N-controlled
genes. It has been suggested that GlnK-UMP interacts
with AmtR to release repression, and that in this bacterium N control responds to metabolic signal(s) other
than glutamine [13]. Recently, in the methanogenic archaeon M. maripaludis, the NrpR protein has been
identified. NrpR represses glnA and nif genes by binding
to their promoters in cells exposed to ammonium, and
represents a novel type of transcriptional regulator [14].
Perception of the C and N metabolic status of the cell
is unknown in the case of C. glutamicum or M. maripaludis, but it appears to involve glutamine (sensed by
glutamine synthetase) in B. subtilis, and glutamine
(sensed by uridylyltransferase) and 2-oxoglutarate
(sensed by GlnB or GlnK) in the enterobacteria.
2.2. Nitrogen control in cyanobacteria
In cyanobacteria, a distinct N control mechanism has
been identified. Ammonium is a preferred nitrogen
source in these organisms, and its presence in the growth
medium determines repression of genes encoding elements of the assimilation pathways for the alternative
nitrogen sources N2 , nitrate or urea (for a review, see
471
[4]). In the absence of ammonium, NtcA, a transcriptional regulator of the CAP family, promotes expression
of alternative nitrogen-source assimilation genes, such
as those in the nir (nitrate assimilation) and urt (urea
transport) operons, and of ammonium assimilation
genes like amt and glnA, but can also act as a repressor
of some genes [5]. The NtcA binding site in DNA has
the sequence signature GTAN8 TAC [5,15] of which the
GTN10 AC subset can be considered essential for
binding [16]. In the NtcA-activated promoters, the
NtcA-binding site is frequently centered at about )41.5
nucleotides with respect to the transcription start site
(tsp), and these promoters also carry a )10 box in the
form TAN3 T. This promoter structure is similar to that
of the Class II promoters activated by CAP [15], but
NtcA-activated promoters in which an NtcA-binding
site is found further upstream from the )41.5 position
have moreover been identified (see below). Also, NtcA
could bind at more than one site in the regulated promoter to effect regulation of gene expression. This is the
case, for instance, of the nir operon promoter in
Synechococcus sp. strain PCC 7942, in which an NtcAbinding site centered at )109.5 is found in addition to
the one centered at )40.5 [15]. NtcA-repressor sites are
located in positions overlapping the )35 or )10
promoter boxes or the transcription start site [5].
Details of NtcA action have been worked out mainly
in the unicellular, non-nitrogen fixing cyanobacterium
Synechococcus elongatus strain PCC 7942. The ntcA gene
is autoregulatory showing a low level of expression in
ammonium-grown cells and an increased expression,
which is dependent on NtcA itself, in the absence of
ammonium [15]. Additionally, over-expression of NtcA
in S. elongatus does not override the need for ammonium
deprivation to allow expression of N-regulated genes
[17]. The transcriptional activity of NtcA appears therefore to be subjected to regulation so that NtcA becomes
active when the cells perceive limitation of ammonium.
NtcA binding in vitro to the S. elongatus glnA promoter
[18], as well as in vitro activation of transcription at
the glnA and ntcA promoters [19], is stimulated by 2oxoglutarate. This metabolite has also been shown to
stimulate expression of NtcA-dependent nitrogen assimilation genes in S. elongatus transformed with a gene
encoding a 2-oxoglutarate permease [20]. Additionally,
expression of the NtcA-dependent gene amt1 has been
shown to be influenced not only by the nitrogen but also
by the carbon supply of the cells [21]. All these observations point to 2-oxoglutarate as a key element in the C to
N balance signaling pathway of S. elongatus. Consistently with its putative signaling role, determinations of
2-oxoglutarate levels in different cyanobacteria incubated
under different conditions of nitrogen supply have
indicated accumulation of 2-oxoglutarate under
N-limiting conditions [22–25]. Because cyanobacteria
lack 2-oxoglutarate dehydrogenase [26], the main
472
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
metabolic role of 2-oxoglutarate in these organisms is
incorporation of nitrogen through the glutamine
synthetase-glutamate synthase cycle [27], which positions
2-oxoglutarate at the link of C and N metabolisms.
A PII -type protein, GlnB, which acts as a 2-oxoglutarate sensor, is present in cyanobacteria, although in
these organisms GlnB is subjected to modification by
phosphorylation rather than by uridylylation (for a review, see [28]). In S. elongatus, GlnB mediates the ammonium-promoted inhibition of nitrate uptake [29,30]
and is required for high-level expression of NtcAdependent genes under N deprivation [31,32]. Although
the mechanism behind this relationship between NtcA
and GlnB is not yet known, regulation by these two
2-oxoglutarate-responsive proteins may have synergistic
effects. In Nostoc punctiforme strain ATCC 29133, inability to segregate a knockout mutant of the glnB gene
has led to the suggestion that it may have an essential
function in heterocyst-forming cyanobacteria [33]. On
the other hand, no role for glutamine as a putative
effector in N control has been found in cyanobacteria.
Glutamine synthetase is not subjected to adenylylation
in these organisms, but it can be the target of feedback
inhibition by some amino acids (Asp, Ala, Ser, Gly) and
nucleotides (AMP, ADP) (reviewed in [4]). Additionally,
in Synechocystis sp. strain PCC 6803, glutamine synthetase activity has been shown to be negatively regulated by binding of two inhibitory factors, the gifA and
gifB gene products, whose cellular levels are determined
by NtcA-dependent repression, which takes place in the
absence of ammonium [34,35]. Thus, in contrast to the
situation in the enterics and Gram-positive bacteria
in which glutamine plays a key role in N control, 2oxoglutarate, influencing the activity of NtcA and GlnB,
is emerging as the key metabolite in the regulation of
nitrogen assimilation in cyanobacteria.
3. Cellular differentiation in filamentous cyanobacteria
Many filamentous cyanobacteria can undergo one or
several of a variety of cellular differentiation processes
that most commonly take place as adaptive responses to
environmental changes. In general, these differentiation
processes allow the cyanobacterium to make use of some
nutritional options or to better stand unfavourable
conditions, but are dispensable for the survival of the
organism under other circumstances. In some cases,
multiple relationships, both nutritional and regulatory,
are established between the different types of cells of
the filament, so that in some respects the filamentous
cyanobacteria can be regarded as simple multicellular
organisms.
The remainder of this review will be devoted to cellular differentiation processes widely studied in representatives of the order Nostocales, but a peculiar type of
differentiated cells has recently been identified in nonheterocystous marine cyanobacteria of the genus
Thrichodesmium. Members of this genus make a significant contribution to global N2 fixation in the oceans
and are able to fix N2 in the light under oxic conditions.
In these cyanobacteria, nitrogenase is located in specialized cells called diazocytes that form short stretches
in the trichome [36,37]. The differentiation of diazocytes
will undoubtedly be the subject of detailed study in the
near future.
3.1. Differentiation of hormogonia
Hormogonia are short, motile filaments of small cells,
generally distinguishable both in morphology and shape
from the mature trichome (Fig. 1), that function in the
dispersal of the cyanobacterium in the environment. The
differentiation of hormogonia takes place through a
number of rapid cell division events that are not coupled
to net DNA synthesis or to an increase in cell biomass,
but produces partitioning of the many copies of the
chromosome that are usually present in vegetative cyanobacterial cells [38,39]. The ftsZ gene (which in
Escherichia coli has been shown to encode a selfassembling, filament-forming protein essential for cell
division) has been cloned from the hormogoniumforming cyanobacterium Fremyella diplosiphon (Calothix
sp. strain PCC 7601) and characterized [40]. ftsZ has
been shown to increase its expression preceding the peak
of cell division, after a shift to conditions that induce
hormogonium formation. This observation suggests
that, as seems to be also the case in E. coli, the amount of
FtsZ protein could be rate-limiting for cell division in
F. diplosiphon [40], at least during the burst of cell division that produces the hormogonium. Hormogonia
represent a transient state of the cyanobacterium that,
subsequently, losses motility and resumes the synthesis
of macromolecules leading to the production of mature,
vegetative trichomes.
In some strains of the genera Nostoc, Tolypothrix and
Calothrix, the differentiation of hormogonia may take
place as a transient stage of the cell cycle (see [41]), and
in the case of symbiotic associations with other organisms, hormogonia represent the infective form of the
cyanobacterium that initiates the contact with the
partner, hormogonium development being influenced
both positively and negatively by host-released factors
during the progression of the symbiosis [42,43]. Nevertheless, in many cyanobacteria the differentiation of
hormogonia seems to be a dispensable event taking
place in response to changes in diverse external factors,
including light and nutrients, that in fact can affect the
differentiation process either positively or negatively (see
[41]). It can be envisioned that rather than in response to
a specific environmental cue, the differentiation of hormogonia may respond to changes that could impact the
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
473
Fig. 1. Cyanobacterial filaments showing vegetative and differentiated cells. Left, Nostoc sp. strain PCC 9203 showing hormogonia (HO); upper right,
Anabaena cylindrica (ATCC 29414) showing akinetes (A) and heterocysts (H); lower right, strain 9v, a natural isolate from Mkindo (Tanzania)
showing intercalary and terminal heterocysts (H). The photographs show filaments from cultures grown in BG110 medium (combined nitrogen-free
medium [3]).
coordination between cell growth and division. In particular, the relation of hormogonium differentiation to
nitrogen availability is apt to be nonspecific, and in fact
hormogonium differentiation can be induced both in the
presence and absence of combined nitrogen (see e.g. [44]
for hormogonia development in nitrate-containing medium). However, a mutant of the global nitrogen regulator NtcA derived from N. punctiforme has been
reported to differentiate hormogonia at lower frequency
than the wild-type strain when tested in co-culture with
its symbiotic partner Anthoceros punctatus, and is unable to infect it [45]. In contrast, N. punctiforme strains
with mutations in hetR or hetF genes (involved in heterocyst development, see below) infect A. punctatus at
frequencies similar to that of the wild type [45].
3.2. Differentiation of akinetes
Akinetes are cells distinguishable from vegetative
cells of the filament by their larger size, thicker cell wall
and conspicuous granulation (Fig. 1) consisting of cyanophycin and glycogen. Akinetes are considered as
propagating, or perennating, bodies exhibiting resistance to adverse conditions, mainly cold and dessication. However, similarly to Azotobacter cysts, akinetes
are sensitive to high temperatures, in this respect differing from bacterial endospores [46]. Under favourable
conditions, akinetes germinate producing short filaments that emerge through ruptures of the akinete cell
wall (see e.g. [47]). The amount of DNA is generally
reported to be similar in akinetes and vegetative cells,
and while some metabolic activities such as CO2 fixation
are very low in akinetes, the rate of respiration is often
high (see [48]). Also, akinetes have been shown to make
at least a few proteins, so that they seem to maintain
some, although low, metabolic activity [49].
Similar to the situation with the development of
hormogonia, no single environmental trigger has been
demonstrated to promote akinete development. Under
laboratory conditions, akinetes are profusedly formed at
the end of the exponential growth phase, their appearance being delayed by factors that prolong active growth
of cultures, so that the most widely recognized factors
influencing akinete differentiation, such as light or
phosphate limitation, could act by causing energy limitation [46]. Akinete germination can be induced by dilution of stationary-phase cultures into fresh medium,
and in general by changes favouring active growth of
cultures, and it should be aided by their usually high
nitrogen (cyanophycin) and carbon (glycogen) reserves
content. Initiation of akinete germination does not require DNA synthesis, but may be sustained by cell division events distributing between the newly formed
vegetative cells the various copies of the chromosome
present in the akinete. In this context, it is worth mentioning the report [50] that mutation of genes ftn, which
would encode products containing a DnaJ motif, causes
the formation of akinete-like cells in Anabaena sp. strain
PCC 7120 (also known as Nostoc sp. strain PCC 7120), a
strain not previously recognized as capable of akinete
474
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
differentiation. This observation suggests that these
genes could be involved in akinete differentiation
through an effect on cell division.
In some cyanobacteria, in the absence of combined
nitrogen akinetes are frequently formed adjacent to a
heterocyst, which specifically differentiates in response
to combined nitrogen deprivation (see below), and the
addition of some nitrogen nutrients like nitrate or urea
inhibits akinete formation (e.g. [51]). Nevertheless, in
other strains akinetes first appear distant from heterocysts in the absence of combined nitrogen, and can
differentiate in the presence of combined nitrogen and
thus in the absence of heterocysts [52]. Information
currently available suggests to us that limitation of nitrogen may be a factor that induces akinete development indirectly by provoking a decrease of the growth
rate.
The differentiation of akinetes has evident connections to the differentiation of heterocysts. In some
strains the pattern of heterocyst distribution determines
that of akinete distribution in the absence of combined
nitrogen [46]. Additionally, some common specific
structural components have been identified in the wall of
both cell types that are synthesized during the differentiation processes (see [53]), and mutation in Anabaena
variabilis (strain ATCC 29413) of the gene hepA (which
in Anabaena sp. strain PCC 7120 has been characterized
as involved in formation of the heterocyst polysaccharide layer) also impairs akinete development [53]. In
Nostoc ellipsosporum, inactivation of the gene hetR
(whose mutation prevents heterocyst differentiation, see
below) has been reported to impair also akinete differentiation, and the hetR gene is expressed also in the
akinetes [54]. It has been suggested that the differentiation of heterocysts may have evolved based on that of
akinetes, which would have existed formerly [53], with
some genetic elements (e.g. hetR and hepA) acting in a
supposedly common stem of the differentiation of both
types of cells, while other elements (e.g. hetP) would act
later and be specific for the differentiation of heterocysts
[54]. On the other hand, in N. punctiforme, inactivation
of hetR has been reported to prevent heterocyst development but permit the formation of akinete-like cells
[45]. Strain differences might respond for these apparently contrasting results. Alternatively, akinete-like cells
could develop in the N. ellipsosporum hetR mutant as
cells more resistant to certain stress conditions, but more
similar in morphology to vegetative cells than to akinetes of the wild type and, thus, could have gone unnoticed (see [45]). If this were the case, hetR would have
a role in akinete differentiation but, in contrast to heterocyst differentiation (see below), would not be required to trigger the process.
Research on akinete differentiation may experience a
revival thanks to the recent identification of AvaK, a
protein that may serve as a marker for the process [55].
3.3. Differentiation of heterocysts
Heterocysts are cells highly specialized in the fixation
of atmospheric nitrogen under oxic conditions that some
filamentous cyanobacteria differentiate when combined
nitrogen becomes limiting (Fig. 1). Heterocysts are terminally differentiated cells that neither divide, consistent
with the lack of the FtsZ protein in these cells [56], nor,
after a certain point in the developmental process, revert
to the vegetative cell state. Heterocyst death causes, in
the case of intercalary heterocysts, breakage of the filament at the point occupied by the moribund heterocyst.
Heterocysts exhibit conspicuous differences, both in
structure and function, with the vegetative cells from
which they originate. These differences are aimed at the
expression of the nitrogen fixation machinery, at increasing the efficiency of the nitrogen fixation reaction,
and at protection of the nitrogen fixation machinery
against oxygen. The differential traits of the heterocyst
include the presence of supplemental glycolipid and
polysaccharide layers in the cell envelope, aimed at
hampering the influx of gases; lack of activity of the
photosystem II, avoiding photosynthetic oxygen production; increased respiration, eliminating free oxygen
and also contributing to the provision of energy for the
nitrogen fixation reaction; and lack of photosynthetic
CO2 fixation, thus avoiding distracting energy and reducing power to processes other than nitrogen fixation
(for a detailed review see [53]). During the process of
heterocyst differentiation, several steps have traditionally been distinguished based mainly on physiological
and ultrastructural evidence (see e.g. [57]).
When considering the differentiation of ‘‘first generation’’ heterocysts, i.e. differentiation triggered by exhaustion of sources of combined nitrogen, the first event
is perception of nitrogen stress. This leads to an increase
in general proteolysis and, in particular, to degradation
of the phycobiliproteins, photosynthetic accessory pigments that may account for up to 50% of the cellular
protein, thus producing the first microscopic sign of
differentiation as a deficiency in fluorescence of the cells
that start the route of development. Progression of differentiation produces the so-called proheterocysts, an
intermediate stage that differs in shape and granulity
from vegetative cells [53]. Proheterocysts undergo a series of traceable morphological changes (see [57,58]) that
leads to the formation of the heterocyst-specific envelope and reorganization of intracellular membranes,
more or less concomitant with characteristic changes in
cell metabolism such as an increase in respiration and,
finally, expression of nitrogenase activity, that in some
cyanobacteria is preceded by several genomic reorganizations effected through site-specific recombinational
events [53]. Based on the fact that certain mutants unable to form a proper heterocyst envelope are also unable to complete protoplast maturation, it has been
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
suggested that the establishment of the barrier to oxygen
might constitute a developmental checkpoint that could
trigger the process of maturation [59,60].
In the diazotrophic filament of cyanobacteria, vegetative cells and heterocysts are mutually interdependent
relying on metabolite exchanges that take place between
the two types of cells. The heterocysts provide fixed nitrogen throughout the filament. Ammonium resulting
from the reduction of N2 is incorporated inside the
heterocyst into glutamate through the action of glutamine synthetase, whose activity is high in these cells, to
render glutamine. It has been suggested that glutamine
is the N-containing metabolite that is exported out of
the heterocysts and made available to the vegetative cells
[61,62], but the possibility that some other amino acids
are also transferred should be considered. Although the
mechanism of transference of fixed nitrogen in the diazotrophic filament is unknown, the involvement of uptake amino acid permeases in diazotrophic growth of
Anabaena sp. strain PCC 7120 has suggested the hypothesis that amino acids can be exported from the
heterocysts to the periplasmic space, which is continuous along the filament, from where they could be taken
up by the vegetative cells through amino acid permeases
[63]. On the other hand, although this point has been the
subject of some controversy (see [53]), it appears that
heterocysts are deficient in glutamate synthase [62,64],
implying that glutamate has to be transferred to the
heterocysts from the vegetative cells and/or synthesized
in the heterocysts by a pathway alternative to that of
glutamate synthase.
Since heterocysts have lost the capacity of photosynthetic CO2 fixation, the activity of nitrogen fixation
in these cells depends upon the supply by the adjacent
vegetative cells of reduced carbon compounds to be used
as sources of reductant and of the substrate necessary
for the incorporation of the ammonium derived from N2
reduction. Sucrose is considered a likely candidate for
reduced carbon vehicle [53,65].
The distinctive morphological and physiological
traits of the heterocysts are the consequence of a differential program of gene expression relative to that
operating in the vegetative cells. Thus, a number of
genes, such as those encoding the enzyme nitrogenase,
are expressed only in the mature heterocyst or, such as
the devBCA genes (see below), preferentially during the
intermediate stages of heterocyst development, whereas
other sets of genes, e.g. those encoding ribulose-1,5bisphosphate carboxylase/oxygenase (Rubisco), are actively expressed in the vegetative cells but not in the
heterocyst. Some genes can still be expressed in both
types of cells, as is the case of glnA, encoding glutamine
synthetase. As we will describe later in more detail, in
Anabaena sp. strain PCC 7120 this and other genes can
be transcribed from the same promoter in heterocysts
and, at least under some conditions, in vegetative cells.
475
In the remainder of this review we will analyze present knowledge about the events of activation of gene
expression that trigger the initiation of heterocyst differentiation, as well as those that take place during the
intermediate stages of heterocyst differentiation and in
the mature heterocyst, focusing on the function of the
global nitrogen regulator NtcA that appears to play a
crucial role at regulation of gene expression throughout
the whole developmental process. Table 1 summarizes
some genes that have been identified as involved in
heterocyst differentiation or function. Some of these
genes will be considered below, but for a more comprehensive description of them, as well as for discussion
of possible mechanisms responsible for the establishment of the pattern of distribution of heterocysts along
the filament, the reader is referred to some other recent
reviews [39,42,95,121].
4. Role of NtcA at the initiation of heterocyst
differentiation
Heterocyst differentiation takes place upon exhaustion of combined nitrogen and, as mentioned above,
involves a number of changes, both at the structural and
metabolic levels, that turn cells into efficient nitrogen
fixation factories. Although different heterocyst distribution patterns can be found in different filamentous
cyanobacteria, the subject of heterocyst differentiation
and distribution has been studied at the molecular level
almost exclusively in the Nostocaceae, in which heterocysts appear at semiregular intervals along the filament
with a frequency of one heterocyst every ca. 10–15
vegetative cells.
A number of genes has been identified as involved in
heterocyst differentiation and/or function. These genes
can be ascribed to different stages of the process of
heterocyst differentiation on the basis of the phenotypes
observed upon their mutation or overexpression. Genes
whose products are involved in early steps of differentiation are referred to as early genes, whereas those
whose products are involved in maturation until the
formation of a functional heterocyst are referred to as
late genes. In the case of some genes whose products
exert a positive action at the initiation of the process,
mutation leads to absence of any sign of differentiation,
whereas mutation of some other early genes still permits
the observation of some initial symptoms of differentiation, such as a pattern of spaced nonfluorescent cells.
In the case of genes whose products exert a negative
action, mutation can lead to a high frequency, and
eventually the formation of clusters, of heterocysts
(multiple contiguous heterocysts phenotype, Mch). The
same phenotype can be produced by overexpression of
some positive-acting genes. If the gene product acts at
later stages, the phenotype of the corresponding
476
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
Table 1
Some genes involved in heterocyst development or function
Gene
Product homology or (putative) function
Reference(s)
Early events
ntcA
patA
patS
hanA
hetR
hetC
hetP
hetL
hetF a
Nitrogen regulation; autoregulatory gene
Pattern formation
Intercellular inhibition of heterocyst formation
Similar to E. coli protein HU
Autoregulatory gene; autoproteolytic and DNA-binding activities
ABC-type exporter
Unknown function
Non essential positive-acting element
Required for localization of HetR in differentiating heterocysts
[66,67]
[68]
[69,70]
[71]
[72–75]
[76]
[77]
[78]
[79]
Putative DNA binding protein
Pattern maintenance
Structural genes for glycolipid biosynthesis
[80]
[81–83]
[81,82,84]
Transport and deposition of heterocyst envelope glycolipids
Two-component regulatory system; heterocyst polysaccharide biosynthesis
Heterocyst envelope polysaccharide biosynthesis
DNA-binding proteins required for expression of hepC and hepA
Autolysin required for heterocyst maturation
Putative penicillin-binding protein
Undecaprenyl-phosphate galactosephosphotransferase
Protein kinase
Protein phosphatase and kinase, respectively
Excisases involved in DNA rearrangements
Excision of the fdxN DNA-intervening element
Putative helix-turn-helix and ferredoxin domains
[59,85]
[86–88]
[87,89]
[90]
[60]
[91]
[92]
[93]
[94]
Reviewed in [95]
[96]
[97,98]
Glucose-6-phosphate dehydrogenase and allosteric effector
Terminal respiratory oxidases
Ferredoxin-NADPþ reductase
Ferredoxin
Bacterial-type ferredoxin
Nitrogenase structural and maturation genes
Uptake hydrogenase
Cyanoglobin
Glutamine syntethase
Arginine biosynthesis
Cyanophycin synthetase and cyanophycinase
Isocitrate dehydrogenase
[99,100]
[101,102]
[103,104]
[105,106]
[107,108]
[109,110]
[111–113]
[114,115]
[66,116]
[117]
[118,119]
[64,120]
Maturation
devH
hetN
hglB(hetM), hglC, hglD,
hglEa
hglK, devBCA
hepK, devRa
hepC, hepA
abp2 abp3
hcwA
pbpB
rfbP
pknD
prpA, pknE
xisA, xisC, xisF
xisH, xisI
patB
Function
zwf a , opcAa
cox2, cox3 operons
petH b
fdxH
fdxN
nif genes
hupLS
glbN c
glnA
argLd
cphAe , cphB
idh
All genes first identified in Anabaena sp. strain PCC 7120 except those identified in N. punctiforme (ATCC 29133) (a ), Anabaena sp. strain PCC
7119 (b ), Nostoc commune (c ), N. ellipsosporum (d ) or A. variabilis (ATCC 29413) (e ).
knockout mutant is less severe, so that heterocysts are
observed but they are morphologically aberrant or
simply not functional. It should be noted, however, that
the time at which a certain gene is induced can be considerably earlier than that at which its product exerts a
discernible effect during the course of the differentiation
process.
In those strains in which the subject has been studied,
Anabaena sp. strain PCC 7120 [66,67], A. variabilis [122],
and N. punctiforme [45], NtcA has been shown to be
required for the differentiation of heterocysts. The requirement for NtcA indicates a regulatory link between
nitrogen nutrition and heterocyst development, so that
the latter is integrated into a suite of cellular responses
to nitrogen stepdown. In this context, it is of interest
that in a derivative of Anabaena sp. strain PCC 7120
that expresses a 2-oxoglutarate permease, 2-oxoglutarate has been reported to increase heterocyst frequency
both in nitrate- and no combined nitrogen-containing
media [123]. Mutant strains carrying an inactivated ntcA
gene show no sign of differentiation upon combined
nitrogen deprivation, indicating that the NtcA protein is
required at the initiation of the process. Induction of
two other positive-acting genes whose products act early
in heterocyst development, namely hetR and hetC, has
been shown to depend on NtcA. The positive regulatory
(and autoregulated) gene hetR encodes a protein that
exhibits DNA-binding [75] and autoproteolytic [74] ac-
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
tivities in vitro and its mutants do not show any sign of
heterocyst differentiation [72]. Induction of hetR, which
takes place shortly after combined nitrogen deprivation
[72,73], is impaired in ntcA mutant strains of Anabaena
sp. strain PCC 7120 [66,124] and N. punctiforme [79], but
the basis for such dependence on NtcA is not yet known.
Expression of hetR in Anabaena sp. strain PCC 7120
takes place from several promoters [124,125], two of
which (those generating tsps located at nucleotides )271
and )728 from the gene) are N-regulated and not used
in an ntcA mutant strain but do not show the typical
structure of an NtcA-activated promoter or even NtcAbinding sites [124]. Thus, in this case the requirement for
NtcA might be indirect.
The Anabaena sp. strain PCC 7120 hetC gene would
encode a product similar to proteins of the HlyB family
of bacterial ABC exporters, although its putative substrate is unknown [76]. In hetC mutants heterocyst development is arrested at a very early stage, although a
delayed pattern of weakly autofluorescent cells in which
expression of a hetR::gfp fusion takes place is observable
after prolonged nitrogen deprivation [126]. Expression
of hetC takes place from a single NtcA-dependent promoter that is activated promptly upon combined nitrogen deprivation [127].
Expression of the ntcA gene itself is induced severalfold during the early steps of heterocyst differentiation
in a HetR-dependent and autoregulated manner based
on activation of two regulated promoters: one generating tsp )49 that is preferably used in the absence of
combined nitrogen and early during heterocyst differentiation, and that is active in mature heterocysts, and
another one generating tsp )180 that appears to be
transiently used during heterocyst development, but not
in mature heterocysts [124,128]. Thus, a mutual dependence is observed in the expression of both regulatory
genes ntcA and hetR. Activation of the expression of
hetR at the initiation of heterocyst differentiation
precedes that of ntcA [124]. This implies that NtcAmediated activation of hetR expression does not require
activation of the expression of the ntcA gene, and makes
it conceivable that the HetR-dependent activation of
ntcA expression requires previous activation of the expression of hetR. (It should be noted that the requirement of HetR for NtcA function is specific to heterocyst
development, since mutation of hetR does not impair
growth with nitrate.) Conversely, the NtcA-dependent
initiation of hetC transcription is independent of HetR
[124]. Because activation of ntcA expression is dependent on HetR, these observations suggest that initiation
of hetC transcription does not require HetR-dependent
increased expression of the ntcA gene. Additionally, the
observation that the NtcA-mediated activation of hetR
expression is not impaired in a hetC mutant [126,127]
indicates that HetC is not required for activation of hetR
expression.
477
NtcA
NtcA
hetC
hetR
ntcA
HetR
Fig. 2. Some events of activation of gene expression at the initiation of
heterocyst differentiation. Black arrows represent gene expression from
transcription to the corresponding mature protein. Red solid arrows
indicate NtcA promoted transcription activation. Dashed arrows indicate a positive action exerted by NtcA (red) or HetR (blue) on gene
expression. See the text for further explanations. Different letter sizes in
the case of NtcA try to indicate different (not to scale) cellular levels of
the protein.
A possible model for a sequence of events of activation of gene expression at the initiation of heterocyst
differentiation implies independent activation of the
hetR and hetC genes both operated by the initial low
levels of NtcA protein already present in the filament
exposed to combined nitrogen. Activation of hetR by
NtcA would be indirect and enhanced by autoregulation, whereas that of hetC would be direct. Subsequently, the resulting increased cellular levels of the
HetR protein would lead to activation of ntcA expression also enhanced by autoregulation (Fig. 2).
Some genes have also been described that negatively
affect heterocyst development. The patS gene encodes a
short peptide thought to constitute a diffusible negative
signal of differentiation [69]. Overexpression of patS
suppresses heterocyst development, whereas mutation of
this gene leads to the formation of heterocysts in nitratecontaining medium and Mch in combined nitrogen-free
medium [69]. Expression of patS increases during several
hours after nitrogen stepdown in a patterned way in the
cells that will become heterocysts, and then decreases
down to the initial levels [69,70]. Although the way of
regulation of patS is currently unknown, the recent report [75] of binding of HetR to its promoter region must
be taken into account. PatS seems to be involved in ‘‘de
novo’’ heterocyst pattern formation upon combined
nitrogen deprivation, by inhibition of the differentiaton
of neighbouring cells [69,70].
As is the case for the expression of patS, activation of
the expression of both hetR and hetC can be observed to
be favoured in those cells of the filament that will develop into heterocysts [73,126] (but see below for the
case of activation of the hetC promoter). Whether activation of expression of the ntcA gene also takes place in
a patterned way remains to be studied.
Other genes that participate in the early events of
heterocyst development and the establishment of the
pattern of heterocyst distribution along the cyanobacterial filament have been described. In N. punctiforme, a
gene named hetF whose product appears to cooperate
478
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
with HetR at positive regulation has been identified [79].
Similarly to the situation with hetR, hetF mutants are
unable to develop heterocysts, whereas extra copies of
hetF induce formation of clusters of heterocysts. Activation of hetR expression in hetF mutants is delayed and
not restricted to developing heterocysts, taking place
even under nitrogen-replete conditions [79]. The hetF
gene is constitutively expressed and its relationship to
NtcA, if any, is unknown. Another gene, named hetL,
whose overexpression produces Mch even in nitratecontaining medium, has been recently identified in Anabaena sp. strain PCC 7120 [78]. Although a hetL-null
mutant shows normal heterocyst development and diazotrophic growth, which might indicate a nonessential
role of HetL in the process, hetL overexpression can
bypass the suppression of heterocyst differentiation
provoked by extra copies of patS, but cannot bypass the
requirement for HetC or HetR [78]. Interestingly, hetL
overexpression in an ntcA mutant allows signs of initiation of heterocyst development, but differentiation could
not proceed and the filaments became highly fragmented
[78], consistent with a requirement for NtcA beyond the
initial steps of differentiation (see below). Thus, hetL
overexpression may have a positive effect on HetR activity or abundance [78], perhaps bypassing the requirement for NtcA of hetR activation. However, it is also
possible that HetL is not involved in the regulation of
heterocyst differentiation in the wild-type strain [78].
Finally, the hetN gene has been identified whose product
would show homology to oxidoreductases involved in
fatty acid or polyketide biosynthesis [81]. Overexpression
of the hetN gene prevents the patterned activation of
hetR under nitrogen deprivation and hence suppresses
differentiation [83,129]. However, the observation that in
wild-type filaments induction of hetN occurs late in the
course of development, and that when expression of this
gene is turned off a wild-type initial pattern of heterocysts
appears that is later substituted by a Mch phenotype,
would imply that HetN plays a role in maintenance of
the pattern once it has been established [83].
The effects of manipulation of the expression of the
N-control regulator NtcA and of the genes hetR, hetF
and patS on heterocyst frequency and spacing pattern
can be compared. While strains carrying multiple copies
of ntcA (N. punctiforme, [45]) or expressing the ntcA gene
from a strong, constitutive promoter (Anabaena sp. strain
PCC 7120; E. Olmedo-Verd, A. Herrero, E. Flores and
A. M. Muro-Pastor, unpublished) develop heterocysts
only in the absence of combined nitrogen, and do so with
wild-type spacing pattern and frequency, overexpression
of hetR or hetF or mutation of patS leads to the formation of Mch in combined nitrogen-free medium. Moreover, overexpression of hetR or inactivation of patS, but
not overexpression of hetF, leads to differentiation of
heterocysts in the presence of nitrate [69,72,79,125]. It is
tempting to speculate that the action of NtcA could be
primarily involved with the triggering and progression of
differentiation of a given cell to a functional heterocyst
(see below), while the action of the product of hetR (and
perhaps also of hetC, hetF and hetL) could be more
directly connected to that of the negative factor PatS in
determining the spacial distribution of heterocysts and
prevention of PatS action inside the differentiating cell.
When the cells sense nitrogen deficiency, the balance
between the action of positive factors (NtcA, HetR,
HetF, HetC, and possibly HetL) and the suppression
mediated by PatS (and later by HetN) may lead to the
decision of whether or not to differentiate and which
particular cell will become a heterocyst.
5. Role of NtcA during the progression of heterocyst
differentiation and in the mature heterocyst
Induction of a number of genes whose expression is
required for the progression of heterocyst development is
dependent on an intact hetR gene [130]. The nature
of this dependence is currently unknown. Activation of
genes whose products are involved in the progression of
heterocyst development, and whose relation to NtcA has
been studied, has been found to exhibit a requirement for
an intact ntcA gene. Because NtcA is required for hetR
induction and heterocyst development, impairment of
expression of HetR-dependent genes in an ntcA mutant
could simply be a consequence of the lack of hetR activation and/or heterocyst differentiation in such a mutant.
However, although overexpression of hetR results in
heterocyst development even in the presence of nitrate,
only in a medium without combined nitrogen are these
cells active in nitrogen fixation [125]. This observation
implies operation of N regulation beyond induction of
hetR, consistent with a direct activation by NtcA of some
genes involved in heterocyst function. In fact, recent results from our laboratory have shown that addition of
ammonium to a heterocyst-containing culture of Anabaena sp. strain PCC 7120 inhibits accumulation of
nifHDK transcripts (E. Olmedo-Verd, A. Herrero,
E. Flores and A. M. Muro-Pastor, unpublished). As
described below, it has been shown that the NtcA protein
is directly involved in transcriptional activation of some
genes that are expressed at intermediate stages of heterocyst development or in the mature heterocyst.
Anabaena sp. strain PCC 7120 genes studied to date
that act at intermediate stages of heterocyst development and whose expression is activated in a HetR- and
NtcA-dependent manner include: the devBCA operon
that encodes an ABC transporter involved in the maturation of the heterocyst envelope [59,130,131], the devH
gene encoding a putative DNA-binding protein required
for N2 fixation in the heterocysts [80], and the cox2 and
cox3 operons encoding terminal respiratory oxidases
also required for nitrogenase activity in the heterocysts
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
[102]. The devBCA operon is expressed from a Nregulated, NtcA-dependent promoter early upon combined nitrogen deprivation [131]. The prompt activation
of this promoter would suggest that it does not require
HetR-mediated increased amounts of the NtcA protein.
However, the increase of devBCA transcript levels that is
detected at intermediate stages of heterocyst development requires HetR in addition to NtcA [131]. The cox2
and cox3 gene clusters are induced at intermediate and
late stages, respectively, of heterocyst development
and are expressed in mature heterocysts from NtcA- and
HetR-dependent promoters [102]. In contrast, direct
involvement of NtcA in transcription of devH has not
been established yet.
Excision of two intervening DNA elements (the nifD
and the fdxN elements, which in Anabaena sp. strain
PCC 7120 are of 11 kb and 55 kb, respectively) that in
some strains takes place in the course of heterocyst development [132,133] does not take place in hetR (E.
Olmedo-Verd, A. Herrero, E. Flores and A. M. MuroPastor, unpublished) or ntcA mutants [67]. In Anabaena
sp. strain PCC 7120, binding of NtcA to three sites in
the region upstream of xisA, which encodes the sitespecific recombinase responsible for excision of the nifD
element, has been described [134]. The role of these
binding sites in regulation of expression of xisA is unknown. It has been hypothesized that binding of NtcA
to them could exert a repressor role in vegetative cells
[134]. However, excision of the nifD element can be
forced, even under nitrogen replete conditions, by increasing the levels of NtcA in a hetR mutant background (E. Olmedo-Verd, A. Herrero, E. Flores and A.
M. Muro-Pastor, unpublished), adding to the idea that
NtcA might have a positive role on expression of xisA.
Anabaena sp. strain PCC 7120 genes whose induction
require NtcA and whose products act in the mature
heterocyst include petH (encoding ferredoxin:NADPþ
reductase), glnA (encoding glutamine synthetase) and
those in the cphBA1 (encoding proteins of cyanophycin
metabolism) and nifHDK operons. Ferredoxin:NADPþ
reductase, which can contribute to the provision of the
reduced ferredoxin required for the nitrogenase reaction,
and glutamine synthetase, responsible for the incorporation of the fixed nitrogen into carbon skeletons, are
critical for the assimilation of nitrogen in heterocysts.
The petH gene is transcribed from two promoters, one
constitutive with respect to the nitrogen source and another used in the absence of combined nitrogen and dependent on NtcA. The latter is the main promoter used
in heterocysts, but it is also used in a hetR mutant and in
the wild type after a nitrogen stepdown before mature
heterocysts have developed [104]. The glnA gene is expressed from at least three promoters, one constitutive
and two negatively regulated by ammonium and NtcAdependent [66]. Of these, the one producing RNAI (P1 ) is
the main promoter used in heterocysts and is activated
479
upon combined nitrogen deprivation irrespective of the
presence or absence of a functional hetR gene [104].
The nifHDK operon is expressed in Anabaena sp.
strain PCC 7120 under oxic conditions exclusively in the
heterocysts [135] from a single N-regulated promoter
that is not operative in the ntcA [66] or hetR (A. Valladares, A. M. Muro-Pastor, A. Herrero and E. Flores,
unpublished) mutants. An additional basis of the requirement for HetR and completion of heterocyst development for expression of the nif genes could originate
in a negative effect of oxygen, consistent with the observed requirement of intact cox2 or cox3 genes for expression of nitrogenase activity [102]. In this context,
PatB, a DNA-binding protein with a putative ferredoxinlike domain expressed late during development and required for nitrogenase activity expression, may represent
a sensor of redox state in the heterocyst [98]. Finally, in
heterocysts, promoters PcphB1 -1 that directs cotranscription of cphB1 (encoding cyanophycinase) and cphA1
(encoding cyanophycin synthetase) and PcphA1 -2 for
monocistronic expression of cphA1 are N-regulated and
used in an NtcA-dependent manner, although their requirement for HetR has not been investigated [119].
In addition to its role as a transcriptional activator,
NtcA appears to act as a repressor of some promoters
during the course of heterocyst development (see [5]).
Rubisco, encoded in the rbcLXS operon, is not expressed
in heterocysts, and in Anabaena sp. strain PCC 7120
NtcA has been shown to bind to two sites in its promoter
[136]. At least one of these sites could be a repressor site,
since it maps to the region from )12 to +12 with respect
to the tsp [136]. The hanA gene encodes the histone-like
HU protein that is absent from heterocysts and whose
mutation results in a highly pleiotropic phenotype that
includes lack of heterocyst development [71,137]. The
sequence TGTAN8 AACA, that could represent an NtcA
binding site, is located 60 nucleotides downstream from a
tsp of hanA that has been detected with RNA from
ammonium-grown cells [71,137]. Whether this putative
NtcA-binding site has a role at suppression of hanA expression remains to be investigated.
The ntcA gene is expressed in fully developed, mature
heterocysts [124,128,136,138], and activity of isocitrate
dehydrogenase, that produces 2-oxoglutarate, is high in
these differentiated cells [64,120]. Since 2-oxoglutarate is
a putative positive effector of NtcA, these observations
suggest that high levels of active NtcA protein are present in the heterocysts, consistent with an important role
of NtcA in gene expression in these differentiated cells.
6. A compilation of NtcA-regulated promoters involved in
heterocyst development or function
As described above, NtcA is required for activation
of expression of genes that are required for the initiation
480
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
Fig. 3. Hypothetical model for some steps of sequential activation of gene expression during heterocyst differentiation. Open arrow represents
metabolic activation of the NtcA protein. Meaning of other types of arrows are as specified in the legend to Fig. 2. See the text for further explanations. Other putative effects of HetR on transcript accumulation are not depicted. Temporal progression of morphological differentiation
(shown on bottom) is only approximate.
of heterocyst differentiation or for other steps of its
development and function. Indeed, with the exception of
hetR, every gene required for heterocyst development
that has been tested (see below) appears to be directly
activated by NtcA.
Activation of expression of some of those genes
does not depend on HetR. Because activation of expression of the ntcA gene during heterocyst development is dependent on a functional hetR gene, we
suggest that NtcA-dependent transcription of genes
that are independent of hetR does not require the
increased levels of the NtcA protein that would result
from HetR-dependent increased expression of the ntcA
gene. Rather, activation of those promoters would be
effected at the expense of the initial lower levels of
NtcA protein, once metabolically activated upon
sensing of combined nitrogen deprivation. This would
be the case for the NtcA-dependent promoters of petH
and glnA used in the heterocysts but which are activated early after combined nitrogen deprivation not
only in the cells that start to differentiate but also in
the non-differentiating cells. The same rationale could
apply to the promoter of the hetC gene, to the promoter producing tsp )728 of hetR, and possibly to the
early use of the promoter of the devBCA operon.
(Although it has been described [126] that after prolonged incubation without combined nitrogen a
hetC::gfp transcriptional fusion is expressed most
strongly in proheterocysts and heterocysts, this would
not preclude that the hetC promoter could initially be
activated in all cells of the filament. Later, a patterned
expression could be established along the filament, e.g.
responding to differences in the C/N balance status
between different cells, which would determine different levels of active NtcA protein, or to the action of
other regulatory proteins.)
On the other hand, activation of some NtcAdependent genes (or promoters) during intermediate
stages of heterocyst development or in the mature
heterocyst requires, besides NtcA, a functional hetR
gene. These include the ntcA gene itself, the promoter
producing tsp )271 of hetR, and the cox2, cox3 and
nifHDK operons (see above). For the NtcA-dependent
promoters activated late during development, the prediction can be made that a reason for the lack of their
early expression could rely upon their requirement for
increased amounts of NtcA protein to be activated.
In summary, a hypothetical model for sequential activation of transcription of NtcA-dependent genes during heterocyst development is as presented in Fig. 3.
Upon combined nitrogen stepdown, the initial relatively
low levels of NtcA protein already present in the combined nitrogen-exposed filament would become activated in response to the change produced in the C to N
balance of the cells (e.g., reflected in the increased levels
of 2-oxoglutarate). Activated NtcA would then promote
transcription from N-regulated, HetR-independent
promoters of early activated genes (such as petH, glnA,
and possibly also hetC and devBCA), initially in all cells
of the filament, and would also promote induction of the
hetR gene, known to be localized in cells that will become heterocysts. The resulting increased amounts of
the HetR protein would then (acting at an as yet unidentified level) increase the expression of genes that are
activated early but are influenced by HetR, such as
devBCA and ntcA itself. (At this point, increases in the
levels of HetR and NtcA would be potentiated by their
autoregulatory character.) The resulting increased levels
of the NtcA protein would then be able to promote the
use of N-regulated promoters of genes (such as cox2,
cox3, nifHDK, and possibly cphBA1 and cphA1) that are
activated late during heterocyst development or in the
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
Gene (promoter)
481
Promoter sequence
tsp location
hetC
devBCA
glnA (P1)
ATCTGTAACATGAGATACACAATAGCATTTATATTTGCTT.TAGTATCTCTCt
ATTTGTACAGTCTGTTACCTTTACCTGAAACAGATGAATG.TAGAATTTATa
TTCTGTAACAAAGACTACAAAACTGTCTAATGTTTAGAATCTACGATATTTCa
-571
-704
-92
petH (P2)
nifH
cphA1 (P2)
AATTGACTCATTATTAACATTCTCCACGAGACTTATCCTC.TAAGTTAGAAGGTg
AAGAACTTTCACAACTACATAACGAACCCATCATGAACAC.TAATTCTACTGGtTTTt
TAGAGTACCTGAGGTTAGACTGAATTGATCTTTAATTTA..TTTCCTGCTGTAg
ntcA (P1)
cox2
cox3
cphBA1 (P1)
TTGGGTATCATTATGAACAAAT……....(71
TTCTGTACCAAAAAATACCGAG……..(212
GATGGTATTTTTAATTACAAAT…..…(159
AATAGTATCTAAAAGTACTAGA……....(68
Consensus
WWYWGTA.CAR.WR.TACAAWW
NtcA-binding site
bp)………....TATTCTTAGGTa
bp)…..……..TAAGTTAAAAGTTAAta
bp)…...….…TAAGCTAATAg
bp)…..…..….TACCATTTAAATAa
-188
-132/-128
-116
-49
-183
-281
-339
TA … T
-10 promoter hexamer
Fig. 4. Sequence comparisons of NtcA-dependent promoters of genes involved in heterocyst development or function in Anabaena sp. strain PCC
7120. Transcription start sites are indicated by boldface lower case letters (see the text for references). The location of the tsp with respect to the
translation start of the corresponding gene is indicated, as is the distance between the )10 box and the NtcA-binding site. The consensus for NtcAbinding site and )10 hexamer of NtcA-dependent promoters [5] are also shown at the bottom of the figure, and those bases of the depicted promoters
matching the consensus are indicated in capital boldface. W, A or T; Y, C or T; R, A or G.
mature heterocysts and require HetR for expression.
This would not exclude an additional, non-NtcA-mediated positive effect of HetR on the expression of those
late genes.
From the above considerations, it seems evident that
a hierarchy exists in the activation of NtcA-dependent
promoters during heterocyst development. To gain insight into the molecular mechanism for this selective
NtcA action, a comparison can be made of the structure
of the N-regulated, NtcA-dependent promoters of heterocyst genes characterized to date (see Fig. 4).
In Anabaena sp. strain PCC 7120, the NtcA-dependent promoters of the genes hetC [127], devBCA [131]
and glnA (P1 ) [66] conform to the structure of the canonical NtcA-activated promoter including NtcAbinding sites with the sequence signature GTAN8 TAC
separated by ca. 22 nucleotides from a )10 box with the
consensus sequence TAN3 T, a structure similar to that
of Class II bacterial activated promoters [15] (Fig. 4, see
also Fig. 5). The NtcA-regulated promoters of petH and
nifHDK and the NtcA-regulated PcphA1 -2 conform to the
structure of canonical NtcA-activated promoters but
their putative NtcA-binding sites resemble but do not
match the sequence signature GTAN8 TAC. Instead, the
sequence GACN8 AAC, in the case of petH, the sequence ACTN8 TAC, in the case of nifH [104], and the
sequence GTAN8 TAG in the case of PcphA1 -2 [119] are
found 21–22 nucleotides upstream from their respective
)10 promoter boxes (Fig. 4, see also Fig. 5). In the three
cases, specific in vitro binding of NtcA to DNA fragments including these putative NtcA-binding sequences
has been obtained [104,119].
Some NtcA-dependent promoters of the ntcA gene
and the cphBA1 operon and those of the cox2 and cox3
operons include NtcA-binding boxes, but located upstream from its canonical position in NtcA-activated
promoters. The NtcA-activated promoter of the ntcA
gene that generates tsp )49 includes the sequence
GTAN8 AAC, which is strongly similar to the consensus
sequence for NtcA binding (and indeed, NtcA footprinting to this sequence has been reported [128]) but is
centered at 93.5 nucleotides upstream of that tsp
(Fig. 4). On their part, the cox2 and cox3 promoter regions include consensus GTAN8 TAC NtcA-binding
Fig. 5. Schematic representation of different types of NtcA-dependent promoters of genes involved in heterocyst development or function. See text for
details. hetR indicate promoters producing tsps )271 and )278; ntcA (P2 ) represents the promoter producing tsp )180 (see the text for references).
Other indicated promoters correspond to those shown in Fig. 4.
482
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
boxes, but centered at 238.5 and 180.5 bp, respectively,
upstream from the tsps (Fig. 4) (A. Valladares, A.
Herrero and E. Flores, unpublished). In both cases, in
vitro binding of NtcA to DNA fragments containing
these sites has been obtained and, in addition, in the case
of cox2, mutagenesis of the putative NtcA-binding site
changing the GTA triplet to CAT or the TAC triplet to
ATG abolishes activation of expression (A. Valladares,
A. Herrero and E. Flores, unpublished). Also, the NtcAdependent promoter PcphB1 -1 of the cphBA1 operon includes a consensus GTAN8 TAC box, at which NtcA has
been shown to bind, centered at )92.5 nucleotides from
the corresponding tsp [119] (Fig. 4). These NtcAactivated promoters resemble Class I CAP-dependent
promoters in which the binding site for the transcriptional
activator is located upstream of the DNA site for RNA
polymerase [139], thus representing a new mechanism
for NtcA-mediated transcription activation (see Fig. 5).
Finally, no NtcA binding could be demonstrated to,
and no recognizable NtcA-binding box could be found
in, DNA upstream from any of the two NtcA-dependent
tsps of the hetR gene (located at nucleotides )271 and
)728 from the gene) [124] or the NtcA-dependent )180
tsp of the ntcA gene, all of which are activated during
heterocyst development (see Fig. 5).
The consensual nature of the NtcA-dependent promoters of the glnA, hetC and devBCA genes would be
consistent with their early activation during heterocyst
differentiation. NtcA would be expected to exhibit high
affinity for these promoters, not requiring for binding the
HetR-mediated increase of the cellular levels of the NtcA
protein. On the other hand, the imperfect NtcA-binding
box of the nifH gene (for which NtcA indeed shows a
relatively low affinity in vitro) would be consistent with a
late activation based on the requirement for increased
amounts of NtcA protein (and perhaps also of other lateacting factors). With regard to PcphA1 -2, although NtcA
exhibits in vitro a high affinity for binding to it, interference by an overlapping promoter could explain its in vivo
late activation [119]. It would remain to be interpreted
how the NtcA-dependent promoter of the petH gene,
which exhibits a non-consensus NtcA-binding box (with
poor in vitro NtcA binding [104]), is activated early. On
the other hand, we currently cannot make a prediction on
how the order of activation of Class I- versus Class II-type
NtcA-activated promoters is established. Finally, NtcAmediated regulation of the expression of hetR and ntcA
promoters that do not show hints of direct NtcA binding
could involve another NtcA-dependent factor yet to be
identified.
7. Concluding remarks and prospects
Some filamentous cyanobacteria can undergo a suite
of cellular differentiation processes that permit their
better adaptation to changing environmental conditions.
Whereas the differentiation of both hormogonia and
akinetes can be triggered by a variety of environmental
cues, the principal factor leading to the differentiation of
heterocysts, which allow the cyanobacterium to make
use of atmospheric nitrogen as a source of nitrogen, is
lack of combined nitrogen. The molecular basis for the
differentiation process has been more thoroughly studied in the case of heterocyst development. The decision
of whether to differentiate a heterocyst seems to be
reached through the interplay between a number of
positively and negatively acting factors, some of which
have been identified in recent years. The transcription
factor NtcA, that operates global N control in cyanobacteria by regulating the expression of multiple genes
involved in nitrogen assimilation, has a crucial role in
the triggering of heterocyst differentiation by perceiving
the nitrogen status of the cell and initiating a series of
gene promoter activation events that sustain the differentiation process. This cascade of gene activation events
includes activation of the ntcA gene itself and of another
positive-acting gene, hetR, whose product is also pivotal
for the initiation of differentiation. HetR could be a
regulator not exclusively responding to the nitrogen
status, but able to integrate information of more than
one environmental factor and/or cellular condition. This
would be evident if hetR were required for akinete development, a process that could be triggered by environmental cues not related to nitrogen nutrition (see
above). In this scenario, NtcA would be the factor
transmitting to HetR information about the nitrogen
status of the cell to engage it in initiation of heterocyst
development. Gene activation events at the initiation of
heterocyst differentiation can also be influenced by the
action of some other positive (such as the hetC gene
product) or negative (such as PatS) elements. While the
action of NtcA as a transcriptional activator (or repressor) has been reasonably well established, the
mechanism of action of some other factors decisive for
heterocyst development, including HetR, is currently
unknown and should be the subject of research in the
near future. In this context, the recent report of DNAbinding activity of HetR can orient future research.
The action of NtcA is not only required at the initiation of heterocyst differentiation, but also for the
continuation of the process and for the function of the
mature heterocyst. This requirement is based on the role
of NtcA as a transcriptional activator of structural, and
possibly also regulatory, genes whose products participate throughout the differentiation process or in the
distinctive metabolism of the heterocyst. These genes
may or may not be specific for these cells, since some
NtcA-activated genes that encode products active in the
heterocyst are also activated by NtcA in vegetative cells
under conditions of combined nitrogen deprivation. The
molecular basis for the selective action of NtcA in the
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
activation of certain, and not other, NtcA-dependent
genes at precise points during the process of heterocyst
development is unknown, but the cooperation between
NtcA and other regulatory factors that may accumulate
at specific stages of the developmental process could
have a role. Also, the differences found in the features of
the NtcA-activated promoters are expected to have a
role in the establishment of a hierarchy of activation of
NtcA-dependent genes, possibly by influencing the level
of active NtcA required for their activation. Thus, the
study of how changes in the sequence of the NtcAbinding box and how its position in the NtcA-activated
promoters influence the affinity of NtcA, of how NtcA
binding could be affected by the action of other possible
regulatory factors, and of how the cellular levels of
active NtcA protein change during the course of
heterocyst development, together with the effects of 2oxoglutarate and the PII protein, can be regarded as
crucial areas of research in this field.
Acknowledgements
We thank Dr. Jose Enrique Frıas for help with photographs shown in Fig. 1 and Silvia Picossi for help with
the preparation of the manuscript. Work in the authors’
laboratory is currently supported by Grants No.
BMC2001-0509 and BMC2002-03902 from the Ministerio de Ciencia y Tecnologıa (Spain) and by Plan Andaluz
de Investigaci
on, research group CVI129. Strain 9v
shown in Fig. 1 was isolated in the context of Project
ICA4-CT-2001-10058 from The European Community.
References
[1] Olsen, G.J., Woese, C.R. and Overbeek, R. (1994) The winds of
(evolutionary) change: breathing new life into microbiology. J.
Bacteriol. 176, 1–6.
[2] Falkowski, P.G., Barber, R.T. and Smetacek, V. (1998) Biogeochemical controls and feedbacks on ocean primary production.
Science 281, 200–206.
[3] Rippka, R., Deruelles, J., Waterbury, J.B., Herdman, M. and
Stanier, R.Y. (1979) Generic assignments, strain stories and
properties of pure cultures of cyanobacteria. J. Gen. Microbiol.
111, 1–61.
[4] Flores, E. and Herrero, A. (1994) Assimilatory nitrogen metabolism and its regulation. In: The Molecular Biology of Cyanobacteria (Bryant, D.A., Ed.), pp. 487–517. Kluwer Academic
Publishers, Dordrecht, The Netherlands.
[5] Herrero, A., Muro-Pastor, A.M. and Flores, E. (2001) Nitrogen
control in cyanobacteria. J. Bacteriol. 183, 411–425.
[6] Ninfa, A.J. and Atkinson, M.R. (2000) PII signal transduction
proteins. Trends Microbiol. 8, 172–179.
[7] Arcondeguy, T., Jack, R. and Merrick, M. (2001) PII signal
transduction proteins, pivotal players in microbial nitrogen
control. Microbiol. Mol. Biol. Rev. 65, 80–105.
[8] Coutts, G., Thomas, G., Blakey, D. and Merrick, M. (2002)
Membrane sequestration of the signal transduction protein GlnK
by the ammonium transporter AmtB. EMBO J. 21, 536–545.
483
[9] Little, R., Reyes-Ramırez, F., Zhang, Y., van Heeswijk, W.C.
and Dixon, R. (2000) Signal transduction to the Azotobacter
vinelandii NIFL–NIFA regulatory system is influenced directly
by interaction with 2-oxoglutarate and the PII regulatory protein.
EMBO J. 19, 6041–6050.
[10] Fisher, S.H. (1999) Regulation of nitrogen metabolism in
Bacillus subtilis: vive la difference!. Mol. Microbiol. 32, 223–232.
[11] Wray Jr., L.V., Zalieckas, J.M. and Fisher, S.H. (2001) Bacillus
subtilis glutamine synthetase controls gene expression through a
protein-protein interaction with transcription factor TnrA. Cell
107, 427–435.
[12] Jakoby, M., Nolden, L., Meier-Wagner, J., Kr€amer, R. and
Burkovski, A. (2000) AmtR, a global repressor in the nitrogen
regulation system of Corynebacterium glutamicum. Mol. Microbiol. 37, 964–977.
[13] Nolden, L., Ngouoto-Nkili, C.E., Bendt, A.K., Kr€amer, R. and
Burkovski, A. (2001) Sensing nitrogen limitation in Corynebacterium glutamicum: the role of glnK and glnD. Mol. Microbiol. 42,
1281–1295.
[14] Lie, T.J. and Leigh, J.A. (2003) A novel repressor of nif and glnA
expression in the methanogenic archaeon Methanococcus maripaludis. Mol. Microbiol. 47, 235–246.
[15] Luque, I., Flores, E. and Herrero, A. (1994) Molecular mechanism for the operation of nitrogen control in cyanobacteria.
EMBO J. 13, 2862–2869.
[16] Vazquez-Berm
udez, M.F., Flores, E. and Herrero, A. (2002)
Analysis of binding sites for the nitrogen-control transcription
factor NtcA in the promoters of Synechococcus nitrogenregulated genes. Biochim. Biophys. Acta 1578, 95–98.
[17] Luque, I., Vazquez-Berm
udez, M.F., Paz-Yepes, J., Flores, E.
and Herrero, A. (2004). In vivo activity of the nitrogen control
transcription factor NtcA is subjected to metabolic regulation in
Synechococcus sp. strain PCC 7942. FEMS Microbiol. Lett. (in
press).
[18] Vazquez-Berm
udez, M.F., Herrero, A. and Flores, E. (2002) 2Oxoglutarate increases the binding affinity of the NtcA (nitrogen
control) transcription factor for the Synechococcus glnA promoter. FEBS Lett. 512, 71–74.
[19] Tanigawa, R., Shirokane, M., Maeda, S.-I., Omata, T., Tanaka,
K. and Takahashi, H. (2002) Transcriptional activation of NtcAdependent promoters of Synechococcus sp. PCC 7942 by
2-oxoglutarate in vitro. Proc. Natl. Acad. Sci. USA 99, 4251–4255.
[20] Vazquez-Berm
udez, M.F., Herrero, A. and Flores, E. (2003)
Carbon supply and 2-oxoglutarate effects on expression of nitrate
reductase and nitrogen-regulated genes in Synechococcus sp.
strain PCC 7942. FEMS Microbiol. Lett. 221, 155–159.
[21] Vazquez-Berm
udez, M.F., Paz-Yepes, J., Herrero, A. and Flores,
E. (2002) The NtcA-activated amt1 gene encodes a permease
required for uptake of low concentrations of ammonium in the
cyanobacterium Synechococcus sp. PCC 7942. Microbiology 148,
861–869.
[22] Merida, A., Candau, P. and Florencio, F.J. (1991) Regulation of
glutamine synthetase activity in the unicellular cyanobacterium
Synechocystis sp. strain PCC 6803 by the nitrogen source: effect
of ammonium. J. Bacteriol. 173, 4095–4100.
[23] Coronil, T., Lara, C. and Guerrero, M.G. (1993) Shift in carbon
flow and stimulation of amino-acid turnover induced by nitrate
and ammonium assimilation in Anacystis nidulans. Planta 189,
461–467.
[24] Tapia, M.I., Ochoa de Alda, J.A.G., Llama, M.J. and Serra, J.L.
(1996) Changes in intracellular amino acids and organic acids
induced by nitrogen starvation and nitrate or ammonium
resupply in the cyanobacterium Phormidium laminosum. Planta
198, 526–531.
[25] Muro-Pastor, M.I., Reyes, J.C. and Florencio, F.J. (2001)
Cyanobacteria perceive nitrogen status by sensing intracellular
2-oxoglutarate levels. J. Biol. Chem. 276, 38320–38328.
484
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
[26] Smith, A.J., London, J. and Stanier, R.Y. (1967) Biochemical
basis of obligate autotrophy in blue-green algae and thiobacilli. J.
Bacteriol. 94, 972–983.
[27] V
azquez-Berm
udez, M.F., Herrero, A. and Flores, E. (2000)
Uptake of 2-oxoglutarate in Synechococcus strains transformed with the Escherichia coli kgtP gene. J. Bacteriol. 182,
211–215.
[28] Forchhammer, K. (2004) Global carbon/nitrogen control by PII
signal transduction in cyanobacteria: from signals to targets.
FEMS Microbiol. Rev. 28, 319–333.
[29] Lee, H.-M., Flores, E., Herrero, A., Houmard, J. and Tandeau
de Marsac, N. (1998) A role for the signal transduction protein
PII in the control of nitrate/nitrite uptake in a cyanobacterium.
FEBS Lett. 427, 291–295.
[30] Lee, H.-M., Flores, E., Forchhammer, K., Herrero, A. and
Tandeau de Marsac, N. (2000) Phosphorylation of the signal
transducer PII protein and an additional effector are required for
the PII -mediated regulation of nitrate and nitrite uptake in the
cyanobacterium Synechococcus sp. PCC 7942. Eur. J. Biochem.
267, 591–600.
[31] Aldehni, M.F., Sauer, J., Spielhaupter, C., Schmid, R. and
Forchhammer, K. (2003) Signal transduction protein PII is
required for NtcA-regulated gene expression during nitrogen
deprivation in the cyanobacterium Synechococcus elongatus
strain PCC 7942. J. Bacteriol. 185, 2582–2591.
[32] Paz-Yepes, J., Flores, E. and Herrero, A. (2003) Transcriptional
effects of the signal transduction protein PII (glnB gene product)
on NtcA-dependent genes in Synechococcus sp. PCC 7942. FEBS
Lett. 543, 42–46.
[33] Hanson, T.E., Forchhammer, K., Tandeau de Marsac, N. and
Meeks, J.C. (1998) Characterization of the glnB gene product of
Nostoc punctiforme strain ATCC 29133: glnB or the PII protein
may be essential. Microbiology 144, 1537–1547.
[34] Garcıa-Domınguez, M., Reyes, J.C. and Florencio, F.J. (1999)
Glutamine synthetase inactivation by protein–protein interaction. Proc. Natl. Acad. Sci. USA 96, 7161–7166.
[35] Garcıa-Domınguez, M., Reyes, J.C. and Florencio, F.J. (2000)
NtcA represses transcription of gifA and gifB, genes that encode
inhibitors of glutamine synthetase type I from Synechocystis sp.
PCC 6803. Mol. Microbiol. 35, 1192–1201.
[36] Fredriksson, C. and Bergman, B. (1997) Ultrastructural characterization of cells specialized for nitrogen fixation in a nonheterocystous cyanobacterium, Trichodesmium. Protoplasma
197, 76–85.
[37] El-Shehawy, R., Lugomela, C., Ernst, A. and Bergman, B. (2003)
Diurnal expression of hetR and diazocyte development in the
filamentous non-heterocystous cyanobacterium Trichodesmium
erythraeum. Microbiology 149, 1139–1146.
[38] Herdman, M. and Rippka, R. (1988) Cellular differentiation:
hormogonia and baeocytes. Methods Enzymol. 167, 232–242.
[39] Meeks, J.C. and Elhai, J. (2002) Regulation of cellular differentiation in filamentous cyanobacteria in free-living and plantassociated symbiotic growth states. Microbiol. Mol. Biol. Rev. 66,
94–121.
[40] Doherty, H.M. and Adams, D.G. (1999) The organisation and
control of cell division genes expressed during differentiation in
cyanobacteria. In: The Phototrophic Prokaryotes (Peschek,
G.A., L€
offelhardt, W. and Schmetterer, G., Eds.), pp. 453–461.
Kluwer Academic/Plenum Publishers, New York, NY.
[41] Tandeau de Marsac, N. (1994) Differentiation of hormogonia
and relationships with other biological processes. In: The
Molecular Biology of Cyanobacteria (Bryant, D.A., Ed.), pp.
825–842. Kluwer Academic Publishers, Dordrecht, The
Netherlands.
[42] Meeks, J.C., Campbell, E.L., Summers, M.L. and Wong, F.C.
(2002) Cellular differentiation in the cyanobacterium Nostoc
punctiforme. Arch. Microbiol. 178, 395–403.
[43] Campbell, E.L., Wong, F.C. and Meeks, J.C. (2003) DNA
binding properties of the HrmR protein of Nostoc punctiforme
responsible for transcriptional regulation of genes involved in the
differentiation of hormogonia. Mol. Microbiol. 47, 573–582.
[44] Damerval, T., Guglielmi, G., Houmard, J. and Tandeau de
Marsac, N. (1991) Hormogonium differentiation in the cyanobacterium Calothrix: a photoregulated developmental process.
Plant Cell 3, 191–201.
[45] Wong, F.C. and Meeks, J.C. (2002) Establishment of a
functional symbiosis between the cyanobacterium Nostoc punctiforme and the bryophyte Anthoceros punctatus requires genes
involved in nitrogen control and initiation of heterocyst differentiation. Microbiology 148, 315–323.
[46] Sutherland, J.M., Herdman, M. and Stewart, W.D.P. (1979)
Akinetes of the cyanobacterium Nostoc PCC 7524: macromolecular composition, structure and control of differentiation. J.
Gen. Microbiol. 115, 273–287.
[47] Nichols, J.M. and Adams, D.G. (1982) Akinetes. In: The
Biology of Cyanobacteria (Carr, N.G. and Whitton, B.A.,
Eds.), pp. 387–412. Blackwell Scientific Publications, Oxford,
England.
[48] Adams, D.G. and Duggan, P.S. (1999) Heterocyst and akinete
differentiation in cyanobacteria. New Phytol. 144, 3–33.
[49] Thiel, T. and Wolk, C.P. (1983) Metabolic activities of isolated
akinetes of the cyanobacterium Nostoc spongiaeforme. J. Bacteriol. 156, 369–374.
[50] Koksharova, O.A. and Wolk, C.P. (2002) A novel gene that
bears a DnaJ motif influences cyanobacterial cell division. J.
Bacteriol. 184, 5524–5528.
[51] Fay, P., Lynn, J.A. and Majer, S.C. (1984) Akinete development
in the planktonic blue-green alga Anabaena circinalis. Br. Phycol.
J. 19, 163–173.
[52] Herdman, M. (1988) Cellular differentiation: akinetes. Methods
Enzymol. 167, 222–232.
[53] Wolk, C.P., Ernst, A. and Elhai, J. (1994) Heterocyst metabolism
and development. In: The Molecular Biology of Cyanobacteria
(Bryant, D.A., Ed.), pp. 769–823. Kluwer Academic Publishers,
The Netherlands.
[54] Leganes, F., Fernandez-Pi~
nas, F. and Wolk, C.P. (1994) Two
mutations that block heterocyst differentiation have different
effects on akinete differentiation in Nostoc ellipsosporum. Mol.
Microbiol. 12, 679–684.
[55] Zhou, R. and Wolk, C.P. (2002) Identification of an akinete
marker gene in Anabaena variabilis. J. Bacteriol. 184, 2529–2532.
[56] Kuhn, I., Peng, L., Bedu, S. and Zhang, C.-C. (2000) Developmental regulation of the cell division protein FtsZ in Anabaena
sp. strain PCC 7120, a cyanobacterium capable of terminal
differentiation. J. Bacteriol. 182, 4640–4643.
[57] Nierzwicki-Bauer, S.A., Balkwill, D.L. and Stevens Jr., S.E.
(1984) Heterocyst differentiation in the cyanobacterium Mastigocladus laminosus. J. Bacteriol. 157, 514–525.
[58] Sherman, D.M., Tucker, D. and Sherman, L.A. (2000) Heterocyst
development and localization of cyanophycin in N2 -fixing
cultures of Anabaena sp. PCC 7120 (cyanobacteria). J. Phycol.
36, 932–941.
[59] Fiedler, G., Arnold, M., Hannus, S. and Maldener, I. (1998) The
DevBCA exporter is essential for envelope formation in heterocysts of the cyanobacterium Anabaena sp. strain PCC 7120. Mol.
Microbiol. 27, 1193–1202.
[60] Zhu, J., Jager, K., Black, T., Zarka, K., Koksharova, O. and
Wolk, C.P. (2001) HcwA, an autolysin, is required for heterocyst
maturation in Anabaena sp. strain PCC 7120. J. Bacteriol. 183,
6841–6851.
[61] Wolk, C.P., Thomas, J., Shaffer, P.W., Austin, S.M. and
Galonsky, A. (1976) Pathway of nitrogen metabolism after
fixation of 13 N-labeled nitrogen gas by the cyanobacterium,
Anabaena cylindrica. J. Biol. Chem. 251, 5027–5034.
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
[62] Thomas, J., Meeks, J.C., Wolk, C.P., Shaffer, P.W., Austin, S.M.
and Chien, W.-S. (1977) Formation of glutamine from [13 N]ammonia, [13 N]dinitrogen, and [14 C]glutamate by heterocysts isolated from Anabaena cylindrica. J. Bacteriol. 129, 1545–1555.
[63] Montesinos, M.L., Herrero, A. and Flores, E. (1995) Amino acid
transport systems required for diazotrophic growth in the
cyanobacterium Anabaena sp. strain PCC 7120. J. Bacteriol.
177, 3150–3157.
[64] Martın-Figueroa, E., Navarro, F. and Florencio, F.J. (2000) The
GS-GOGAT pathway is not operative in the heterocysts.
Cloning and expression of glsF gene from the cyanobacterium
Anabaena sp. PCC 7120. FEBS Lett. 476, 282–286.
[65] Curatti, L., Flores, E. and Salerno, G. (2002) Sucrose is involved
in the diazotrophic metabolism of the heterocyst-forming
cyanobacterium Anabaena sp. FEBS Lett. 513, 175–178.
[66] Frıas, J.E., Flores, E. and Herrero, A. (1994) Requirement of the
regulatory protein NtcA for the expression of nitrogen assimilation and heterocyst development genes in the cyanobacterium
Anabaena sp. PCC 7120. Mol. Microbiol. 14, 823–832.
[67] Wei, T.-F., Ramasubramanian, T.S. and Golden, J.W. (1994)
Anabaena sp. strain PCC 7120 ntcA gene required for growth on
nitrate and heterocyst development. J. Bacteriol. 176, 4473–4482.
[68] Liang, J., Scappino, L. and Haselkorn, R. (1992) The patA gene
product, which contains a region similar to CheY of Escherichia
coli, controls heterocyst pattern formation in the cyanobacterium
Anabaena 7120. Proc. Natl. Acad. Sci. USA 89, 5655–5659.
[69] Yoon, H.-S. and Golden, J.W. (1998) Heterocyst pattern
formation controlled by a diffusible peptide. Science 282, 935–
938.
[70] Yoon, H.-S. and Golden, J.W. (2001) PatS and products of
nitrogen fixation control heterocyst pattern. J. Bacteriol. 183,
2605–2613.
[71] Khudyakov, I. and Wolk, C.P. (1996) Evidence that the hanA
gene coding for HU protein is essential for heterocyst differentiation in, and cyanophage A-4(L) sensitivity of, Anabaena sp.
strain PCC 7120. J. Bacteriol. 178, 3572–3577.
[72] Buikema, W.J. and Haselkorn, R. (1991) Characterization of a
gene controlling heterocyst differentiation in the cyanobacterium
Anabaena 7120. Genes Dev. 5, 321–330.
[73] Black, T.A., Cai, Y. and Wolk, C.P. (1993) Spatial expression
and autoregulation of hetR, a gene involved in the control of
heterocyst development in Anabaena. Mol. Microbiol. 9, 77–84.
[74] Zhou, R., Wei, X., Jiang, N., Li, H., Dong, Y., Hsi, K.-L. and
Zhao, J. (1998) Evidence that HetR protein is an unusual serinetype protease. Proc. Natl. Acad. Sci. USA 95, 4959–4963.
[75] Huang, X., Dong, Y. and Zhao, J. (2004) HetR homodimer is a
DNA-binding protein required for heterocyst differentiation and
the DNA-binding activity is inhibited by PatS. Proc. Natl. Acad.
Sci. USA 101, 4848–4853.
[76] Khudyakov, I. and Wolk, C.P. (1997) hetC, a gene coding for a
protein similar to bacterial ABC protein exporters, is involved in
early regulation of heterocyst differentiation in Anabaena sp.
strain PCC 7120. J. Bacteriol. 179, 6971–6978.
[77] Fern
andez-Pi~
nas, F., Leganes, F. and Wolk, C.P. (1994) A third
genetic locus required for the formation of heterocysts in
Anabaena sp. strain PCC 7120. J. Bacteriol. 176, 5277–5283.
[78] Liu, D. and Golden, J.W. (2002) hetL overexpression stimulates
heterocyst formation in Anabaena sp. strain PCC 7120. J.
Bacteriol. 184, 6873–6881.
[79] Wong, F.C. and Meeks, J.C. (2001) The hetF gene product is
essential to heterocyst differentiation and affects HetR function in
the cyanobacterium Nostoc punctiforme. J. Bacteriol. 183, 2654–
2661.
[80] Hebbar, P.B. and Curtis, S.E. (2000) Characterization of devH, a
gene encoding a putative DNA binding protein required for
heterocyst function in Anabaena sp. strain PCC 7120. J.
Bacteriol. 182, 3572–3581.
485
[81] Black, T.A. and Wolk, C.P. (1994) Analysis of a Het mutation
in Anabaena sp. strain PCC 7120 implicates a secondary metabolite in the regulation of heterocyst spacing. J. Bacteriol. 176,
2282–2292.
[82] Bauer, C.C., Ramaswamy, K.S., Endley, S., Scappino, L.A.,
Golden, J.W. and Haselkorn, R. (1997) Suppression of heterocyst differentiation in Anabaena PCC 7120 by a cosmid carrying
wild-type genes encoding enzymes for fatty acid synthesis. FEMS
Microbiol. Lett. 151, 23–30.
[83] Callahan, S.M. and Buikema, W.J. (2001) The role of HetN in
maintenance of the heterocyst pattern in Anabaena sp. PCC 7120.
Mol. Microbiol. 40, 941–950.
[84] Campbell, E.L., Cohen, M.F. and Meeks, J.C. (1997) A
polyketide-synthase-like gene is involved in the synthesis of
heterocyst glycolipids in Nostoc punctiforme strain ATCC 29133.
Arch. Microbiol. 167, 251–258.
[85] Black, K., Buikema, W.J. and Haselkorn, R. (1995) The hglK
gene is required for localization of heterocyst-specific glycolipids
in the cyanobacterium Anabaena sp. strain PCC 7120. J.
Bacteriol. 177, 6440–6448.
[86] Campbell, E.L., Hagen, K.D., Cohen, M.F., Summers, M.L. and
Meeks, J.C. (1996) The devR gene product is characteristic of
receivers of two-component regulatory systems and is essential
for heterocyst development in the filamentous cyanobacterium
Nostoc sp. strain ATCC 29133. J. Bacteriol. 178, 2037–2043.
[87] Zhu, J., Kong, R. and Wolk, C.P. (1998) Regulation of hepA of
Anabaena sp. strain PCC 7120 by elements 5’ from the gene and
by hepK. J. Bacteriol. 180, 4233–4242.
[88] Zhou, R. and Wolk, C.P. (2003) A two-component system
mediates developmental regulation of biosynthesis of a heterocyst polysaccharide. J. Biol. Chem. 278, 19939–19946.
[89] Holland, D. and Wolk, C.P. (1990) Identification and characterization of hetA, a gene that acts early in the process of
morphological differentiation of heterocysts. J. Bacteriol. 172,
3131–3137.
[90] Koksharova, O.A. and Wolk, C.P. (2002) Novel DNA-binding
proteins in the cyanobacterium Anabaena sp. strain PCC 7120. J.
Bacteriol. 184, 3931–3940.
[91] Lazaro, S., Fernandez-Pi~
nas, F., Fernandez-Valiente, E., BlancoRivero, A. and Leganes, F. (2001) pbpB, a gene coding for a
putative penicillin-binding protein, is required for aerobic nitrogen fixation in the cyanobacterium Anabaena sp. strain
PCC7120. J. Bacteriol. 183, 628–636.
[92] Xu, X., Khudyakov, I. and Wolk, C.P. (1997) Lipopolysaccharide dependence of cyanophage sensitivity and aerobic nitrogen
fixation in Anabaena sp. strain PCC 7120. J. Bacteriol. 179, 2884–
2891.
[93] Zhang, C.-C. and Libs, L. (1998) Cloning and characterisation of
the pknD gene encoding an eukaryotic-type protein kinase in the
cyanobacterium Anabaena sp. PCC7120. Mol. Gen. Genet. 258,
26–33.
[94] Zhang, C.-C., Friry, A. and Peng, L. (1998) Molecular and
genetic analysis of two closely linked genes that encode,
respectively, a protein phosphatase 1/2A/2B homolog and a
protein kinase homolog in the cyanobacterium Anabaena sp.
strain PCC 7120. J. Bacteriol. 180, 2616–2622.
[95] Golden, J.W. and Yoon, H.-S. (1998) Heterocyst formation in
Anabaena. Curr. Opin. Microbiol. 1, 623–629.
[96] Ramaswamy, K.S., Carrasco, C.D., Fatma, T. and Golden, J.W.
(1997) Cell-type specificity of the Anabaena fdxN-element rearrangement requires xisH and xisI. Mol. Microbiol. 23,
1241–1249.
[97] Liang, J., Scappino, L. and Haselkorn, R. (1993) The patB gene
product, required for growth of the cyanobacterium Anabaena sp.
strain PCC 7120 under nitrogen-limiting conditions, contains
ferredoxin and helix-turn-helix domains. J. Bacteriol. 175, 1697–
1704.
486
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
[98] Jones, K.M., Buikema, W.J. and Haselkorn, R. (2003) Heterocyst-specific expression of patB, a gene required for nitrogen
fixation in Anabaena sp. strain PCC 7120. J. Bacteriol. 185, 2306–
2314.
[99] Summers, M.L., Wallis, J.G., Campbell, E.L. and Meeks, J.C.
(1995) Genetic evidence of a major role for glucose-6-phosphate
dehydrogenase in nitrogen fixation and dark growth of the
cyanobacterium Nostoc sp. strain ATCC 29133. J. Bacteriol. 177,
6184–6194.
[100] Hagen, K.D. and Meeks, J.C. (2001) The unique cyanobacterial
protein OpcA is an allosteric effector of glucose-6-phosphate
dehydrogenase in Nostoc punctiforme ATCC 29133. J. Biol.
Chem. 276, 11477–11486.
[101] Jones, K.M. and Haselkorn, R. (2002) Newly identified cytochrome c oxidase operon in the nitrogen-fixing cyanobacterium
Anabaena sp. strain PCC 7120 specifically induced in heterocysts.
J. Bacteriol. 184, 2491–2499.
[102] Valladares, A., Herrero, A., Pils, D., Schmetterer, G. and Flores,
E. (2003) Cytochrome c oxidase genes required for nitrogenase
activity and diazotrophic growth in Anabaena sp. PCC 7120.
Mol. Microbiol. 47, 1239–1249.
[103] Razquin, P., Fillat, M.F., Schmitz, S., Stricker, O., B€
ohme, H.,
G
omez-Moreno, C. and Peleato, M.L. (1996) Expression of
ferredoxin-NADPþ reductase in heterocysts from Anabaena sp.
Biochem. J. 316, 157–160.
[104] Valladares, A., Muro-Pastor, A.M., Fillat, M.F., Herrero, A.
and Flores, E. (1999) Constitutive and nitrogen-regulated promoters of the petH gene encoding ferredoxin:NADPþ reductase
in the heterocyst-forming cyanobacterium Anabaena sp. FEBS
Lett. 449, 159–164.
[105] B€
ohme, H. and Haselkorn, R. (1988) Molecular cloning and
nucleotide sequence analysis of the gene coding for heterocyst
ferredoxin from the cyanobacterium Anabaena sp. strain PCC
7120. Mol. Gen. Genet. 214, 278–285.
[106] Masepohl, B., Scholisch, K., G€
orlitz, K., Kutzki, C. and B€
ohme,
H. (1997) The heterocyst-specific fdxH gene product of the
cyanobacterium Anabaena sp. PCC 7120 is important but not
essential for nitrogen fixation. Mol. Gen. Genet. 253, 770–776.
[107] Mulligan, M.E. and Haselkorn, R. (1989) Nitrogen fixation (nif )
genes of the cyanobacterium Anabaena species strain PCC 7120.
The nifB-fdxN-nifS-nifU operon. J. Biol. Chem. 264, 19200–19207.
[108] Masepohl, B., G€
orlitz, K., Monnerjahn, U., Mosler, B. and
B€
ohme, H. (1997) The ferredoxin-encoding fdxN gene of the
filamentous cyanobacterium Anabaena variabilis is not essential
for nitrogen fixation ATCC 29413. New Phytol. 136, 419–423.
[109] Haselkorn, R., Rice, D., Curtis, S.E. and Robinson, S.J. (1983)
Organization and transcription of genes important in Anabaena
heterocyst differentiation. Ann. Microbiol. 134B, 181–193.
[110] B€
ohme, H. (1998) Regulation of nitrogen fixation in heterocystforming cyanobacteria. Trends Plant Science 3, 346–351.
[111] Carrasco, C.D., Buettner, J.A. and Golden, J.W. (1995) Programmed DNA rearrangement of a cyanobacterial hupL gene in
heterocysts. Proc. Natl. Acad. Sci. USA 92, 791–795.
[112] Oxelfelt, F., Tamagnini, P. and Lindblad, P. (1998) Hydrogen
uptake in Nostoc sp. strain PCC 73102. Cloning and characterization of a hupSL homologue. Arch. Microbiol. 169, 267–274.
[113] Happe, T., Schutz, K. and B€
ohme, H. (2000) Transcriptional and
mutational analysis of the uptake hydrogenase of the filamentous
cyanobacterium Anabaena variabilis ATCC 29413. J. Bacteriol.
182, 1624–1631.
[114] Potts, M., Angeloni, S.V., Ebel, R.E. and Bassam, D. (1992)
Myoglobin in a cyanobacterium. Science 256, 1690–1692.
[115] Hill, D.R., Belbin, T.J., Thorsteinsson, M.V., Bassam, D., Brass,
S., Ernst, A., B€
oger, P., Paerl, H., Mulligan, M.E. and Potts, M.
(1996) GlbN (cyanoglobin) is a peripheral membrane protein
that is restricted to certain Nostoc spp. J. Bacteriol. 178,
6587–6598.
[116] Tumer, N.E., Robinson, S.J. and Haselkorn, R. (1983) Different
promoters for the Anabaena glutamine synthetase gene during
growth using molecular of fixed nitrogen. Nature 306, 337–342.
[117] Leganes, F., Fernandez-Pi~
nas, F. and Wolk, C.P. (1998) A
transposition-induced mutant of Nostoc ellipsosporum implicates
an arginine-biosynthetic gene in the formation of cyanophycin
granules and of functional heterocysts and akinetes. Microbiology 144, 1799–1805.
[118] Ziegler, K., Stephan, D.P., Pistorius, E.K., Ruppel, H.G. and
Lockau, W. (2001) A mutant of the cyanobacterium Anabaena
variabilis ATCC 29413 lacking cyanophycin synthetase: growth
properties and ultrastructural aspects. FEMS Microbiol. Lett.
196, 13–18.
[119] Picossi, S., Valladares, A., Flores, E. and Herrero, A. (2004)
Nitrogen-regulated genes for the metabolism of cyanophycin, a
bacterial nitrogen reserve polymer. Expression and mutational
analysis of two cyanophycin synthetase and cyanophycinase gene
clusters in the heterocyst-forming cyanobacterium Anabaena sp.
PCC 7120. J. Biol. Chem. 279, 11582–11592.
[120] Papen, H., Neuer, G., Refaian, M. and Bothe, H. (1983) The
isocitrate dehydrogenase from cyanobacteria. Arch. Microbiol.
134, 73–79.
[121] Wolk, C.P. (2000) Heterocyst formation in Anabaena. In: Prokaryotic Development (Brun, Y.V. and Shimkets, L.J., Eds.), pp.
83–104. American Society for Microbiology, Washington, DC.
[122] Thiel, T. and Pratte, B. (2001) Effect on heterocyst differentiation
of nitrogen fixation in vegetative cells of the cyanobacterium
Anabaena variabilis ATCC 29413. J. Bacteriol. 183, 280–286.
[123] Li, J.-H., Laurent, S., Konde, V., Bedu, S. and Zhang, C.-C.
(2003) An increase in the level of 2-oxoglutarate promotes
heterocyst development in the cyanobacterium Anabaena sp.
PCC 7120. Microbiology 149, 3257–3263.
[124] Muro-Pastor, A.M., Valladares, A., Flores, E. and Herrero, A.
(2002) Mutual dependence of the expression of the cell differentiation regulatory protein HetR and the global nitrogen regulator
NtcA during heterocyst development. Mol. Microbiol. 44, 1377–
1385.
[125] Buikema, W.J. and Haselkorn, R. (2001) Expression of the
Anabaena hetR gene from a copper-regulated promoter leads to
heterocyst differentiation under repressing conditions. Proc.
Natl. Acad. Sci. USA 98, 2729–2734.
[126] Xu, X. and Wolk, C.P. (2001) Role for hetC in the transition to a
nondividing state during heterocyst differentiation in Anabaena
sp. J. Bacteriol. 183, 393–396.
[127] Muro-Pastor, A.M., Valladares, A., Flores, E. and Herrero, A.
(1999) The hetC gene is a direct target of the NtcA transcriptional regulator in cyanobacterial heterocyst development. J.
Bacteriol. 181, 6664–6669.
[128] Ramasubramanian, T.S., Wei, T.-F., Oldham, A.K. and Golden,
J.W. (1996) Transcription of the Anabaena sp. strain PCC 7120
ntcA gene: multiple transcripts and NtcA binding. J. Bacteriol.
178, 922–926.
[129] Li, B., Huang, X. and Zhao, J. (2002) Expression of hetN during
heterocyst differentiation and its inhibition of hetR up-regulation
in the cyanobacterium Anabaena sp. PCC 7120. FEBS Lett. 517,
87–91.
[130] Cai, Y. and Wolk, C.P. (1997) Anabaena sp. strain PCC 7120
responds to nitrogen deprivation with a cascade-like sequence of
transcriptional activations. J. Bacteriol. 179, 267–271.
[131] Fiedler, G., Muro-Pastor, A.M., Flores, E. and Maldener, I.
(2001) NtcA-dependent expression of the devBCA operon,
encoding a heterocyst-specific ATP-binding cassette transporter
in Anabaena spp. J. Bacteriol. 183, 3795–3799.
[132] Golden, J.W., Robinson, S.J. and Haselkorn, R. (1985) Rearrangement of nitrogen fixation genes during heterocyst differentiation in the cyanobacterium Anabaena. Nature 314,
419–423.
A. Herrero et al. / FEMS Microbiology Reviews 28 (2004) 469–487
[133] Golden, J.W., Carrasco, C.D., Mulligan, M.E., Schneider, G.J.
and Haselkorn, R. (1988) Deletion of a 55-kilobase-pair
DNA element from the chromosome during heterocyst differentiation of Anabaena sp. strain PCC 7120. J. Bacteriol. 170,
5034–5041.
[134] Chastain, C.J., Brusca, J.S., Ramasubramanian, T.S., Wei, T.-F.
and Golden, J.W. (1990) A sequence-specific DNA-binding
factor (VF1) from Anabaena sp. strain PCC 7120 vegetative cells
binds to three adjacent sites in the xisA upstream region. J.
Bacteriol. 172, 5044–5051.
[135] Elhai, J. and Wolk, C.P. (1990) Developmental regulation and
spatial pattern of expression of the structural genes for nitrogenase in the cyanobacterium Anabaena. EMBO J. 9, 3379–3388.
487
[136] Ramasubramanian, T.S., Wei, T.-F. and Golden, J.W. (1994)
Two Anabaena sp. strain PCC 7120 DNA-binding factors
interact with vegetative cell- and heterocyst-specific genes. J.
Bacteriol. 176, 1214–1223.
[137] Nagaraja, R. and Haselkorn, R. (1994) Protein HU from the
cyanobacterium Anabaena. Biochimie 76, 1082–1089.
[138] Bauer, C.C. and Haselkorn, R. (1995) Vectors for determining
the differential expression of genes in heterocysts and vegetative
cells of Anabaena sp. strain PCC 7120. J. Bacteriol. 177,
3332–3336.
[139] Busby, S. and Ebright, R.H. (1999) Transcription activation
by catabolite activator protein (CAP). J. Mol. Biol. 293,
199–213.