Journal of Biotechnology 87 (2001) 67 – 82
www.elsevier.com/locate/jbiotec
Engineering zucchini yellow mosaic potyvirus as a
non-pathogenic vector for expression of heterologous
proteins in cucurbits
Tzahi Arazi a, Shalom Guy Slutsky c, Yoel Moshe Shiboleth a,
Yongzeng Wang b, Menachem Rubinstein c, Sara Barak c, Jie Yang b,
Amit Gal-On b,*
b
a
ViroGene Limited, Har-Hotz6im, P.O. Box 45010, Jerusalem 91045, Israel
Department of Virology, Agricultural Research Organization, the Volcani Center, P.O. Box 6, Bet Dagan 50 -250, Israel
c
Department of Molecular Genetics, Weizmann Institute of Science, Reho6ot 76100, Israel
Received 11 September 2000; received in revised form 20 December 2000; accepted 3 January 2001
Abstract
Plant virus vectors provide an attractive biotechnological tool for the transient expression of foreign genes in whole
plants. As yet there has been no use of recombinant viruses for the improvement of commercial crops. This is mainly
because the viruses used to create vectors usually cause significant yield loss and can be transmitted in the field. A
novel attenuated zucchini yellow mosaic potyvirus (AG) was used for the development of an environmentally safe
non-pathogenic virus vector. The suitability of AG as an expression vector in plants was tested by analysis of two
infectious viral constructs, each containing a distinct gene insertion site. Introduction of a foreign viral coat protein
gene into AG genome between the P1 and HC-Pro genes, resulted in no expression in planta. In contrast, the same
gene was stably expressed when inserted between NIb and CP genes, suggesting that this site is more suitable for a
gene vector. Virus-mediated expression of reporter genes was observed in squash and cucumber leaves, stems, roots
and edible fruit. Furthermore, AG stably expressed human interferon-alpha 2, an important human anti-viral drug,
without affecting plant development and yield. Interferon biological activity was measured in cucumber and squash
fruit. Together, these data corroborate a biotechnological utility of AG as a non-pathogenic vector for the expression
of a foreign gene, as a benefit trait, in cucurbits and their edible fruit. © 2001 Elsevier Science B.V. All rights
reserved.
Keywords: ZYMV; Potyvirus; Virus-vector; Cucurbits; Interferon
The first three authors contributed equally.
* Corresponding author. Tel.: + 972-3-9683563; fax: + 9723-9683543.
E-mail address: [email protected] (A. Gal-On).
1. Introduction
In the last decade the use of plant viruses as
gene vectors for expression of numerous proteins
0168-1656/01/$ - see front matter © 2001 Elsevier Science B.V. All rights reserved.
PII: S 0 1 6 8 - 1 6 5 6 ( 0 1 ) 0 0 2 2 9 - 2
68
T. Arazi et al. / Journal of Biotechnology 87 (2001) 67–82
has received considerable attention, and several
RNA virus vectors have been developed (Takamatsu et al., 1987; Chapman et al., 1992; Dolja et
al., 1992; Kumagai et al., 1993; Rommens et al.,
1995; Porta and Lomonossoff, 1996; Scholthof et
al., 1996). These vectors have been successfully
used for in planta expression of plant genes
(Hammond-Kosack et al., 1995; Sablowski et al.,
1995; Kumagai et al., 2000) and heterologous
genes (Hamamoto et al., 1993; Hendy et al., 1999;
McCormick et al., 1999; Gopinath et al., 2000;
Zhang et al., 2000). However, to date, plant virus
vectors cannot be used for the production of
commercial crops with improved agronomic
traits, or increased nutritional or pharmaceutical
value, mainly because most known plant viruses
cause significant yield losses to host plants. In
addition, viruses are transmitted to other plants
by their natural vectors in the field (Matthews,
1991). To make a plant virus vector useful for
improvement of commercial crops, it should not
affect plant development or reduce crop yield, nor
should it be vector transmissible.
Zucchini yellow mosaic virus (ZYMV) is one of
the most devastating diseases worldwide of cucurbit species such as cucumber, squash, melon and
watermelon (Desbiez and Lecoq, 1997). ZYMV is
a member of the potyviridae family, the largest
group of plant-infecting viruses (Shukla et al.,
1994). As in all potyviruses, the ZYMV genome
consists of a single messenger-polarity RNA
molecule of about 10 kb, encapsidated in a flexuous filamentous particle. Viral RNA is translated
into a large polyprotein that is proteolytically
processed to 8–9 functional proteins by three
virus-encoded proteases: P1, HC-Pro and NIa
(Riechmann et al., 1992; Revers et al., 1999). The
P1 (Verchot et al., 1991) and HC-Pro (Carrington
et al., 1989) proteinases are located at the N%-terminus region of the polyprotein and catalyze autoproteolytic cleavage at their own C%-terminus.
The NIa protease is responsible for cis and trans
proteolytic cleavages of the remainder of the viral
polyprotein (Carrington et al., 1988; Riechmann
et al., 1992).
Potyviruses can be envisaged as promising expression vectors, since their proteolytic processing
strategy of gene expression ensures that a foreign
protein, synthesized as part of the viral
polyprotein, is produced in equimolar amounts
with all viral proteins (Scholthof et al., 1996;
Valerie et al., 1997). Moreover, taking into account the helicoidal morphology of viral particles,
no packaging limitations would be expected for
rather large genome insertions (Scholthof et al.,
1996). Expression of foreign genes by potyviruses
has been demonstrated in tobacco etch virus
(TEV) (Dolja et al., 1992), plum pox virus (PPV)
(Guo et al., 1998), and recently, in lettuce mosaic
virus (LMV) (Choi et al., 2000; German-Retana
et al., 2000). In these studies, foreign genes were
inserted between the P1 and the HC-Pro genes,
and were expressed as an insertional fusion with
the N-terminus of the HC-Pro gene. Alternatively,
a non-fused foreign gene expression was established by addition of the appropriate proteolytic
cleavage sites to the ends of the foreign gene
sequence (Dolja et al., 1997; Guo et al., 1998;
Choi et al., 2000; Masuta et al., 2000). However,
the utility of most constructs was limited by their
genetic instability due to RNA recombination
events that rapidly eliminated foreign sequences
(Dolja et al., 1993; Guo et al., 1998; Choi et al.,
2000). Recently, Masuta et al. (2000) demonstrated that a foreign gene expressed via clover
yellow vein virus vector in legumes was genetically
stable.
To investigate the utility of ZYMV as a nonpathogenic expression vector in cucurbits, we utilized an attenuated ZYMV (AG) virus as a viral
vector, the attenuation achieved by the engineering of a single amino acid in the HC-Pro gene
(Gal-On, 2000). In the present paper, we describe
the engineering and analysis of AG, as an environmentally safe virus vector for the expression of
various foreign genes.
2. Material and methods
2.1. Construction of a non-aphid-transmissible
AG
The aphid non-transmissible mutation was introduced in two steps. First, a PstI site was
introduced in the NIa protease motif (DTVMLQ)
T. Arazi et al. / Journal of Biotechnology 87 (2001) 67–82
69
within the NIb gene, between the encoding sequences of Leu and Glu (LQ), by site-directed
mutagenesis on AG (Gal-On, 2000), with the partial clone pKSDSacI22 (7515 – 9591) used as a
template. The resulting mutant clone was designated pKSDSacI-PstI. A nucleotide change, altering coat protein (CP) residue Ala9 to Thr, was
then introduced by PCR on pKSDSacI-PstI as a
template with an appropriate sense oligonucleotide 5%ATGCTGCAGTCAGGCACTCAGCCAACTGTGGCAGATACTGGAGCT-3% containing the nucleotide change (bold). The mutated
pKSDSacI-PstI SacI – MluI fragment was then
introduced into c– MluI sites of AG to create
AGI.
ate sites within the pKSDSacI-PstI clone to create
pKSDSacI-PstI-poly. pKSDSacI-PstI-poly SacI–
MluI fragment was then introduced into SacI–
MluI sites of AGI to create AGII.
2.2. Construction of a gene insertion cassette
between P1 and HC-Pro
2.5. Insertion of jellyfish green fluorescent protein
(GFP), uidA (i-glucuronidase; GUS) and human
interferon-alpha 2 (IFN) genes into the AGII
genome
Clone pKSB16 of AG (nucleotides 1 – 2272)
contains unique SalI and BamHI sites (Kadouri
et al., 1998). This clone served as template for the
insertion of the NIa protease motif by PCR with
suitable oligonucleotides. The amplified fragment
was double-digested with SalI and BamHI and
introduced into the appropriate sites within clone
pKSB16, to create pKSB16-NIa. A polylinker was
then inserted by PCR on pKSB16-NIa with an
oligonucleotide harboring NheI and SpeI sites.
The amplified fragment was digested by SalI and
BamHI and cloned into the full-length infectious
clone, AGI. The new clone, harboring NheI and
SpeI sites and the NIa protease motif, was designated AGIII and used for insertion of foreign
genes between the P1 and the HC-Pro.
2.3. Construction of a gene insertion cassette
between NIb and CP
A polylinker containing the restriction sites
(PstI, ScaI, SpeI, NheI and SalI) with the NIa
protease sequence (bold) was cloned by PCR with
the oligonucleotide 5%CAGCTGCAGAGTACTAGTGCTAGCGTCGACACTGTGATGCTCCAA3% on pKSDSacI-PstI used as a template. The
PCR product was digested with PstI and XbaI
(position 9461) and introduced into the appropri-
2.4. Insertion of cucumber mosaic 6irus (CMV)
coat protein genes into the AGIII genome
The coat protein coding region of CMV (accession no. NC001440) was amplified by PCR, using
sense and antisense oligonucleotides that are
flanked with NheI and SpeI, respectively. The
amplified fragments were digested by NheI and
SpeI and cloned into AGIII to create AGIIICMV-CP.
The coding region of GFP (accession no.
U17997) and CMV-CP were amplified by PCR,
using sense and antisense oligonucleotides that
were both flanked by PstI sites. The amplified
fragments were digested by PstI and cloned into
the partial clone pKSDSacI-PstI-poly. A similar
cloning strategy was used for uidA (accession no.
S69414), and IFN (accession no. CAA25770)
genes, except that the antisense primer contained
a flanking SalI site instead of PstI. Amplified
PCR fragments were then digested by PstI and
SalI and cloned into pKSDSacI-PstI-poly. For all
genes, pKSDSacI-PstI-poly clones were doubledigested by SacI–MluI, and the resulting fragment containing the foreign gene was cloned into
AGII genome to create AGII-GFP, AGII-CMVCP, AGII-GUS and AGII-IFN.
2.6. Plant growth, inoculation and symptom
e6aluation
Commercial cultivars of squash (Cucurbita pepo
L. cv. Ma’ayan) and cucumber (Cucumis sati6us
L. cv. Delila and cv. Muhasan) plants were grown
in a growth chamber under continuous light at
23°C. For test under industrial conditions, plant
70
T. Arazi et al. / Journal of Biotechnology 87 (2001) 67–82
were grown in 20–l pails with automatic irrigation and fertilization, in an insect-proof nethouse. Seedlings were selected for experimental
use when the cotyledons were fully expanded.
Particle bombardment inoculation was performed with a handheld device, the handgun
with plasmids containing virus cDNA under the
control of the cauliflower mosaic virus 35S promoter (Gal-On et al., 1997). Mild virus symptoms would be observable only in squash, as the
AG virus is symptomless on other cucurbits,
therefore, it was chosen for testing the infectivity
of various viral constructs. After bombardment
or mechanical inoculation, squash seedlings were
grown and examined daily for symptom development, and the first appearance of symptoms
was recorded.
2.7. RT-PCR analysis of recombinant 6irus
progeny
RT-PCR was conducted in a one-tube singlestep method modified from Sellner et al. (1992)
in 50 ml volume with the following mixture: 1.5
mM MgCl2; 125 mM dNTPs; 1X Sellner buffer:
0.03% Triton X-100; 8% PBS-Tween (8 mg ml − 1
NaCl, 0.2 mg ml − 1 KH2PO4, 1.15 mg ml − 1
Na2HPO4, 0.2 mg ml − 1 KCl, Tween-20 0.05%);
100 ng of each specific primer; two units of Taq
polymerase; five units of AMV-RT (Chimerex
USA); 2–5 mg total RNA. RT-PCR cycles were
as follows: 46°C 30 min; 94°C 2 min, followed
by 33 cycles at 94, 60 and 72°C, each of 30 s,
and one final cycle of 5 min at 72°C. For AGIIGUS the polymerization cycle was extended to 2
min.
2.8. GUS assay and 6isualization of green
fluorescence protein
In situ GUS assay was performed using a
calorimetric substrate according to Jefferson et
al. (1987). Plant tissues were vacuum infiltrated
with the substrate 5-bromo-4-chloro-3-indolyl bD-glucoronic acid, cyclohexylammonium salt (Xgluc) (1.2 mM) in 0.5 mM potassium ferricyanide, 0.5 mM potassium ferrocyanide and 10
mM EDTA. Leaves, manually cross-sectioned
stems, and roots were washed with sterile water,
blotted and placed directly into the substrate solution. A visible calorimetric reaction was obtained after overnight incubation at 37°C,
following removal of the chlorophyll with ethanol. Photographs were taken under bright light
with a binocular microscope. GFP fluorescence
in different plant organs was visualized with a
40 W UV lamp (F40BLB, General Electric
USA) and photographed with a Nikon F3 camera with automatic exposure of 1600 ISO film.
2.9. ELISA assays for e6aluation of 6iral titer
Infected plant material was subjected to enzyme-linked immunosorbent assay (ELISA) with
anti-ZYMV CP polyclonal antibody, as described previously by Antignus et al. (1989). The
quantity of AGII-IFN was estimated by checking against a known amount of purified AGII
virion in the ELISA plate.
2.10. IFN acti6ity assay and immunoblot analysis
Plant tissue was collected, frozen in liquid N2
and lyophilized for 24 h. Lyophilized tissue was
ground by pestle and mortar and extracted in
PBS with a ratio of 1:1 –1.5 (wet weight tissue
per unit volume of PBS). One milliliter of the
homogenate was centrifuged for 10 min at
10 000×g in an Eppendorf minifuge, and the
supernatant was used for ELISA, immunoblot
analysis and interferon activity assay. IFN activity was assayed in 96-well microtiter plates by
the inhibition of vesicular stomatitis virus cytopathic effect on human Wish (ATCC CCL-25)
cells, as described previously (Rubinstein et al.,
1981). Calibration standards of IFN were included in every plate. IFN activity was expressed
in international units per milliliter (IU ml − 1),
2× 108 IU are equivalent to 1 mg IFN. For
immunoblot (ECL, Amersham-Pharmacia Biotech, UK), extracts were separated on 15% SDSPAGE and immunoblotted with an anti-IFN
polyclonal antibody at 1:1000 dilution.
T. Arazi et al. / Journal of Biotechnology 87 (2001) 67–82
3. Results
3.1. Engineering AG to be an aphid
non-transmissible 6irus
ZYMV, like other potyviruses, is naturally transmitted by aphids in a non-persistent manner (Desbiez and Lecoq, 1997). It has been shown that the
CP Asp8Ala9Gly10 (DAG) motif is involved in
transmission of ZYMV by aphids, and that mutation of alanine to threonine abolishes ZYMV
transmission by aphids (Gal-On et al., 1992). A
site-directed mutagenesis was performed to switch
Ala9 residue to Thr in the DAG motif of the AG
CP, and the resultant mutant virus was designated
AGI. Inoculation of AGI cDNA on squash plants
resulted in infection indistinguishable from that
caused by AG. The Ala-to-Thr alteration in the
AGI progeny virus was verified by RT-PCR and
sequencing. Aphid transmission assay (Antignus et
al., 1989) demonstrated that the AGI could not be
transmitted by aphids, and this characteristic remained stable for prolonged propagation and several plant-to-plant mechanical inoculation passages
(data not shown).
3.2. Analysis of foreign genes expression inserted
between AGI P1 and HC-Pro
Expression of foreign genes via AGI virus, as
non-fused proteins, initially followed the strategy
of Dolja et al. (1997) in engineering the tobacco
etch virus (TEV) vector. A gene insertion cassette
was constructed into the AGI genome between the
P1 and HC-Pro genes to create AGIII (Fig. 1A).
Inserted genes were designed to create an in-frame
translational fusion with flanking P1 and NIa
processing sites. Proteolysis of the nascent viral
polyprotein by P1 in cis and NIa proteases in trans,
was predicted to yield a foreign protein with an
additional three amino acid residues (SAS) at its
N%-terminus and nine amino acid residues
(TSVDTVMLQ) at its C%-terminus (Fig. 1B). By
means of this insertion site the coat protein gene of
CMV was inserted into the AGIII genome. The
resultant recombinant cDNA was infectious on
various cucurbit plants, and typical mild vein
clearing symptoms appeared 6 – 10 days post-inoc-
71
ulation (dpi) on squash. Immunoblot analysis of
AGIII-CMV-CP infected squash leaves failed to
detect the expression of CMV-CP in planta (Fig.
1C), although recombinant ZYMV CP accumulated in infected leaves (Fig. 1D). RT-PCR and
sequencing of progeny viral RNA revealed that the
inserted CMV-CP coding sequence was inserted in
frame and partially deleted (data not shown).
Similar results were obtained when the watermelon
mosaic virus (WMV) CP gene was inserted in the
same site (data not shown).
3.3. Insertion of CMV-CP gene between AGII
NIb and CP results in stable expression
Because of the instability of inserted genes at the
P1-HC-Pro site, an alternative insertion site between NIb and CP genes was constructed (Fig. 2A).
This was done by the addition of a polylinkercloning site next to the NIa proteinase cleavage site
in the NIb 3% end to create AGII (Fig. 2A). Inserted
genes were designed to create an in-frame translational fusion with both flanking NIa processing
sites. Proteolysis of the nascent AGII polyprotein
by NIa protease in trans was predicted to yield a
foreign protein with one additional serine residue
at its N%-terminus and seven amino acid residues
(VDTVMLQ) at its C%-terminus (Fig. 2B). The
inoculation of squash with AGII cDNA resulted in
similar symptoms to those elicited by AG 5–7 dpi
(Gal-On, 2000). To test the stability of the NIb-CP
gene insertion site, the CMV-CP coding sequence
was introduced into it (Fig. 2B). The resultant
recombinant cDNA (AGII-CMV-CP) was infectious on various cucurbit plants, and typical mild
vein clearing appeared on squash, 6–10 dpi. However, in contrast to AGIII-CMV-CP infected
plants, AGII-CMV-CP infected plants expressed
CMV-CP (Fig. 2C), and sequence analysis of
progeny virus revealed that the inserted sequence
was not modified.
3.4. Characterization of AGII 6irus in planta by
expression of reporter genes
To study AGII spread and localization of the
expressed foreign protein in different organs, the
bacterial uidA and GFP genes were inserted into
72
T. Arazi et al. / Journal of Biotechnology 87 (2001) 67–82
the NIb-CP site (Fig. 2B). Approximately 100%
of squash plants inoculated by particle bombardment with the recombinant cDNA corresponding
to AGII-GFP and -GUS became infected. Typical
vein clearing and mild mosaic symptoms appeared
in AGII-GFP infected squash 5 – 7 dpi. For AGII-
GUS, a 4 day delay of symptom appearance was
observed.
The stability of GFP and uidA genes within the
AGII genome was tested at different times postplant-inoculation. RT-PCR analysis of viral
progeny RNA verified that the GFP gene was
Fig. 1. Expression of CMV-CP by AGIII. (A) Schematic presentation of AGIII genome. AGIII non-coding (hatched shading), and
coding (open boxes) regions including the inserted foreign gene (FG) are shown. Arrows indicate proteases involved in proteolysis
of foreign gene product. Protease cleavage sites are indicated by /. Restriction enzyme sites used for sub-cloning are indicated.
Nucleotides specifying restriction endonuclease recognition sites, inserted to create the polylinker and their encoded amino acid
residues are indicated in bold. (B) Insertion of CMV-CP between the P1 and HC-Pro genes. Amino acid sequences corresponding
to the CMV-CP coding sequence are indicated by italics. (C) Immunoblot analysis of total leaf extracts from AGIII or
AGIII-CMV-CP infected squash plants 14 dpi. Equal volumes (25 ml) of total leaf extracts were analyzed by using anti-CMV-CP
polyclonal antibody. Purified CMV (24 kDa) was used as a control for gel mobility. (D) Immunoblot analysis of samples described
in (C) with a polyclonal antibody against ZYMV-CP (31 kDa). Non-infected plants (virus-free) were used as negative control.
T. Arazi et al. / Journal of Biotechnology 87 (2001) 67–82
73
Fig. 2. Construction of AGII and foreign genes inserted into its genome. (A) Schematic presentation of AGII genome. AGII
non-coding (hatched shading), and coding (open boxes) regions including the inserted foreign gene (FG) are shown. Arrows indicate
NIa protease involved in proteolysis of foreign gene product. NIa cleavage sites are indicated by (/). Restriction enzyme sites used
for sub-cloning are indicated. Nucleotides specifying restriction endonuclease recognition sites, inserted to create the polylinker and
their encoded amino acid residues are indicated in bold. (B) Insertion of indicated foreign genes between the NIb and CP genes.
Amino acid sequences corresponding to each gene coding sequence are indicated by italics. (C) Immunoblot analysis of total leaf
extracts from AGII or AGII-CMV-CP infected squash plants 14 dpi. Non-infected plants (virus-free) were used as negative controls.
Equal volumes (25 ml) of total leaf extracts were analyzed by using anti-CMV-CP polyclonal antibody. Purified CMV (27 kDa) was
used as a control for gel mobility.
intact in the AGII genome 24 dpi, as predicted
from the increase in size of the AGII-GFP amplified product compared with AGII (Fig. 3A).
Stability of the GFP gene was maintained in
squash and cucumber after four serial passages (at
3 week intervals) from plant to plant by mechanical inoculation, and through extended growth periods of 2 months. However, in contrast to the
GFP gene, that was maintained intact, the uidA
gene exhibited deletions 14 dpi, that resulted in a
truncated RT-PCR amplified product (Fig. 3A).
The accumulation levels of recombinant AGIIGFP, AGII-GUS and AGII viruses were estimated in systemic squash leaves by quantitative
ELISA at 14 and 24 dpi (Fig. 3B). At 14 dpi,
AGII-GFP and AGII-GUS viruses accumulated
74
T. Arazi et al. / Journal of Biotechnology 87 (2001) 67–82
Fig. 3. Stability and accumulation of recombinant AGII containing foreign genes between NIb and CP. (A) RT-PCR
analysis of progeny viral RNA. Total RNA was extracted
from systemically infected leaves by the indicated virus, at 14
or 24 dpi, and subjected to RT-PCR with primers flanking the
NIb-CP insertion site. Plasmids harboring cDNA of AGIIGFP (pAGII-GFP), AGII-GUS (pAGII-GUS) and AGII-IFN
(pAGII-IFN) were subjected to PCR as a control. Amplified
products were then analyzed on an EtBr agarose gel (image
negative is shown). The expected size (bp) of each amplified
fragment, containing the inserted gene and flanking 476 bp of
AGII, is marked by an arrow. HindIII– EcoRI digested
Lambda DNA was used as molecular weight marker (M). (B)
Accumulation AGII-GFP, AGII-GUS and AGII-IFN in
squash plants. For each recombinant virus, accumulation is
expressed as the percentage of AGII accumulation (100%).
The level of each virus was determined by DAS-ELISA and is
the average of three independent samples taken from three
independent plants. All samples were collected from developmentally equivalent leaves at the indicated dpi.
to 64 and 41%, respectively of AGII titer (Fig.
3B). Ten days later, the AGII-GFP titer remained
constant, whereas a higher titer of AGII-GUS
was measured. In view of the RT-PCR results
(Fig. 3A), it is most likely that AGII-GUS virus
population detected by ELISA contains a mixture
of AGII-GUS and its deletion mutants.
To follow the localization of foreign proteins
expressed through the AGII virus vector, squash
and cucumber seedlings were inoculated with
AGII-GUS and AGII-GFP, respectively. AGIIGUS infected squash was analyzed for GUS activity 15 dpi, and GUS staining was observed in
leaves, stems and roots (Fig. 4A–D). The distribution of GUS staining was not uniform in infected leaves, and staining concentrated around
the major veins and neighboring cell clusters (Fig.
4A). Stems showed uniform staining, concentrated around the vascular tissue (Fig. 4B, C).
Interestingly, strong GUS staining was detected in
adventive (Fig. 4C) and lateral roots (Fig. 4D).
AGII-GFP infected cucumbers were analyzed for
GFP by visualization under UV light. Green
fluorescence was observed in AGII-GFP infected
leaves, stems, flowers and fruit (Fig. 4E, F-right,
G, H-left), indicating GFP expression in these
organs. Similar fluorescence was not observed in
identically developed organs infected with AGII
(Fig. 4F-left, H-right); a non-uniform fluorescence
was seen in leaves (Fig. 4E) and male flowers (Fig.
4G). Nevertheless, the AGII-GFP virion was also
detected in the non-fluorescent areas of the leaf
(data not shown). In fruits, fluorescence was located mainly in the embryonic tissue and not in
the peel layer or mesocarp (Fig. 4H-left).
3.5. Expression of a biologically acti6e human
interferon-alpha 2 6ia AGII in cucurbits
To quantify foreign gene expression in host
plant organs, and to demonstrate the biotechnological potential of the AGII expression vector in
cucurbits, we inserted the IFN coding sequence
into the NIb-CP insertion site (Fig. 2A, B). Plasmids containing AGII-IFN cDNA were inoculated on squash and cucumber plants yielding full
infectivity. Symptoms similar to those elicited by
the parental virus AGII were observed within 5–7
T. Arazi et al. / Journal of Biotechnology 87 (2001) 67–82
Figs. 4 and 5.
75
76
T. Arazi et al. / Journal of Biotechnology 87 (2001) 67–82
dpi. The presence of the IFN gene within the
AGII genome was verified by RT-PCR analysis of
the progeny virus. The IFN gene was maintained
intact in the AGII genome at least 24 dpi (Fig.
3A) and accumulated to similar levels as AGII
(Fig. 3B). Moreover, stability of the IFN gene
was maintained after six serial passages (at 3 week
intervals) from plant to plant.
Commercial cultivars of squash (Cucurbita pepo
L. cv. Ma’ayan) and parthenocarpic cucumber
(Cucumis sati6us L. cv. Muhasan) seedlings were
infected by sap inoculation of AGII-IFN (eight
plants) or AGII (four plants). As a control, noninfected plants (four plants) were included. Plants
were grown vertically in a semi-industrial net
house under automatic irrigation and fertilization
(Fig. 5A). Plant infection was verified by DASELISA. The effects of AGII-IFN infection on
plant growth and development were evaluated by
monitoring the plant phenotype and symptom
expression, and by estimating the crop yield. During the growth period, cucumber plants infected
with AGII-IFN developed normally: these plants
did not show any visible symptoms on their leaves
or fruit, and were phenotypically indistinguishable
from virus-free plants (Fig. 5A). Infected squash
plants developed normally and showed only mild
diffused mosaic symptoms on their leaves, and no
symptoms on their fruits (data not shown). Crop
yield was measured by collecting marketable cucumber fruits (about 60 g each) for a period of 1
month, beginning 3 weeks post-inoculation. A
yield of about 2 kg of fruit per plant was obtained
in virus-free plants (Fig. 5B), and a comparable
yield was obtained in AGII-IFN and AGII inoculated plants (Fig. 5B). Similar levels of virus accumulation were measured in the leaves of these
plants (Fig. 5C), suggesting that virus infection
did not affect fruit production. It is noteworthy
that the IFN gene within AGII-IFN remained
intact in tested plants (plant numbers 17 and 20
are shown), even 2 months post-inoculation, as
confirmed by RT-PCR (Fig. 5D).
Infected leaves from the above cucumber (representative plants 17 and 20) and squash plants
were analyzed for IFN activity at 60 and 30 dpi,
respectively. Activities of 157× 103 and 34 × 103
IU per gram fresh weight (gFW) were measured
in young leaves (2nd leaf; Fig. 6A). Much higher
IFN activity was found in older leaves (4th –6th
leaves; Fig. 6A). However, after leaves had fully
expanded (8th leaf), a sharp decrease in IFN
activity occurred (Fig. 6A). An average activity of
21×103 IU g − 1FW was measured in stems. Immunoblot analysis of samples which had been
analyzed for interferon revealed the presence of a
protein band that reacted with an anti-IFN antibody. Moreover, band intensity correlated with
the level of IFN activity, indicating that this band
represented IFN (Fig. 6B). However, this band
exhibited a slightly slower gel mobility than that
of recombinant hIFN-2a, as predicted from the
addition of eight amino acid residues to the IFN
sequence (Fig. 2B). In squash, IFN activity in
Fig. 4. Localization of GUS activity and GFP fluorescence in infected squash and cucumber plants, respectively. (A – D)
Visualization of GUS histochemical staining of squash plant organs infected with AGII-GUS. Whole organs were vacuum-infiltrated
with the histochemical GUS substrate X-gluc, 15 dpi. As a negative control, organs from identically developed squash, infected with
AGII, were used (unstained organs): (A) leaf; (B) stem; (C) root crown; (D) lateral root. (E – H) Visualization of GFP fluorescence
of AGII-GFP infected cucumber plant organs 60 dpi, under UV light. The red color represent the natural fluorescence of
chlorophyll: (E) leaf; (F) stem; (G) male flower; (H) fruit. The peel layer (Pe), mesocarp (Me) and embryonic tissue (Em) of the fruit
are marked by arrows. As a negative control, organs from identically developed AGII infected stem (left) and fruit (right) were used.
Fig. 5. Recombinant AGII-IFN does not affect cucumber development or yield, and is stable in planta. (A) AGII-IFN infected and
virus-free plants were photographed 45 days after seedling inoculation. (B) Comparison of cucumber yield among virus-free plants,
and AGII- and AGII-IFN infected plants. Fruits (average size of 60 g) were collected from plants during 1 month. Data are given
as the mean9SD of three or four independent plants. (C) Accumulation of AGII and AGII-IFN viruses in cucumber plants. The
level of virus was determined by DAS-ELISA in four samples from independent plants. All samples were collected from
developmentally equivalent leaves at 45 dpi. (D) Analysis by RT-PCR of progeny viral RNA. Total RNA was extracted from leaves
of recombinant virus (as indicated) infected plants or from virus-free plants, and subjected to RT-PCR with primers flanking the
IFN insertion point. A plasmid harboring AGII-IFN cDNA (pAGII-IFN) was subjected to PCR as a control. The expected size
(bp) of the fragment with (995) or without (476) the IFN is marked by an arrow. HindII–EcoRI-digested Lambda DNA was used
as a molecular weight marker (M).
T. Arazi et al. / Journal of Biotechnology 87 (2001) 67–82
77
Fig. 6. AGII-IFN-mediated synthesis of IFN in squash and cucumber leaves. (A) IFN activity measured in leaves of AGII-IFN-inoculated cucumber at 60 dpi. The values were obtained after subtracting the background activity (of AGII infected cucumber). Data
are given as the mean 9 SD of three independent measurements. Tested leaf developmental stage (weight and position from the top)
and AGII-IFN virus amount are presented below the histogram. n.d., not determined. (B) Immunoblot analysis of samples tested
in (A). Soluble protein extracts (70 mg) were analyzed by using anti-IFN polyclonal antibody. Recombinant IFN (Rec, 4 ng) was
used as a control for gel mobility. (C) IFN activity measured in leaves of AGII-IFN inoculated squash at 30 dpi. The values
obtained after subtracting the background activity (of AGII infected squash). Data are given as the mean 9SD of three independent
measurements.
young leaves (4th from the top, Fig. 6C) was
comparable with that in those of cucumber (Fig.
6A). No activity was found in leaves of control
plants. To correlate between virus accumulation
and protein expression in leaves, the amount of
AGII-CP in the tested leaves was measured by
quantitative DAS-ELISA (Fig. 6A, below
histogram). An increase in the amount of
AGII-CP was measured as the leaf matured. No
correlation
was
obtained
between
CP
accumulation and the biological activity of IFN.
This was especially prominent in fully expanded
leaves that contained the greatest amount of
AGII-CP and exhibited the lowest IFN activity
(Fig. 6A).
IFN activities measured in fruits from the same
cucumber and squash plants (Fig. 7A, B) was
two-to-fourfold lower than those in leaves (Fig. 6A,
C). The highest activities was found in the youngest
immature fruits of both cucumber and squash (Fig.
7A, B). On average, a twofold greater in IFN
activity was measured in squash fruits than in those
of cucumber (Fig. 7A, B). Accumulation of
AGII-CP in cucumber fruits was two orders of
magnitude less than in leaves, which is consistent
with the IFN activity difference between the two
organs. Interestingly, analysis of IFN activity in
cucumber and squash fruit parts shows that most
of the activity was located in the fruit placental
tissue and/or embryonic tissue (core) and much
lower in the mesocarp and peel layer (Fig. 7C, D).
78
T. Arazi et al. / Journal of Biotechnology 87 (2001) 67–82
4. Discussion
In the present study we exploited the ZYMV
virus, as a platform for the development of a
novel virus-based vector system for the expression of foreign genes in cucurbits. As opposed
to other known viral vectors, that cause severe
diseases to host plants, our virus vector was created from an attenuated engineered ZYMV potyvirus (AG). AG accumulates to the same levels
as the severe ZYMV strain in cucurbits, without
eliciting any phenotypic and developmental impairment (Gal-On, 2000). Indeed, infection of
field-grown squash, melon and watermelon
plants with AG did not cause apparent damage
or yield reduction compared with virus-free
plants (Gal-On, unpublished results). In addition, by insertion of an aphid non-transmission
motif, DTG (Gal-On et al., 1992) within the CP
N%-terminus, we generated an aphid non-transmissible virus. This characteristic was found to
be stable in different cucurbits under diverse
conditions. Abolition of virus transmission from
plant to plant is an important environmental issue which may facilitate future use in the field.
Foreign genes could theoretically be introduced in between each of the eight virally-encoded proteins of a potyvirus (Dolja et al., 1997;
Guo et al., 1998; Choi et al., 2000; Masuta et
al., 2000). Nevertheless, we could not detect
CMV- or WMV-CP expression when these genes
were inserted between the P1 and HC-Pro genes
of the AGIII vector. This most likely due to the
instability and rearrangement of the CMV- and
WMV-CP sequences in the virus genome, and
suggests that the viral RNA may have a high
recombination potential in this site (Dolja et al.,
1993; reviewed in Simon and Bujarski, 1994).
We have previously demonstrated that RNA recombination occurs in ZYMV (Gal-On et al.,
1998), but, our results demonstrated that a foreign gene inserted between the replicase (NIb)
Fig. 7. AGII-IFN mediated synthesis of IFN in squash and cucumber fruits and fruit parts. (A, B) IFN activity found in fruit
extracts from AGII-IFN inoculated cucumber (A) or squash (B) plants, 60 or 30 dpi, respectively. The values obtained after
subtracting the background activity (of AGII infected plants). Data are given as the mean 9 SD of three independent measurements.
Tested fruit developmental stage (weight) and AGII-IFN virus amount are presented below the histogram. n.d., not determined. (C,
D) IFN activity found in fruit parts from AGII-IFN inoculated cucumber plants 20 (B) or squash (D) 60 or 30 dpi, respectively.
The values obtained after subtracting the background activity (of AGII infected fruit). Data are given as the mean 9SD of three
independent measurements.
T. Arazi et al. / Journal of Biotechnology 87 (2001) 67–82
and coat protein genes is relatively less prone to
recombination events than genes inserted between
the P1 and HC-Pro. This may be because sequences
flanking this site do not promote a high frequency
of recombination events. On the other hand, the
instability of the uidA gene (1.8 kb long), in contrast
to the stability of CMV-CP, GFP and IFN genes
( B 0.8 kb long), suggests that long foreign insertions (\0.8 kb) between NIb and CP, are susceptible to recombination events. Other genes should
be inserted in order to elucidate the stability of
sequences inserted in this site.
Expression of foreign genes via a potyvirus
vector has been shown to reduce virus titer and to
change symptom development (Dolja et al., 1997;
Guo et al., 1998; German-Retana et al., 2000). No
major alteration of symptom development was
observed in cucurbits infected by any of the recombinant viruses AGII-GFP, AGII-GUS and AGIIIFN. Nevertheless, changes in virus accumulation
were observed following the expression of each
gene. The lower titers of AGII-GFP and AGIIGUS than of AGII-IFN and parental AGII could
be due to a direct effect of increased virus size on
virus replication, as demonstrated with TEV (Dolja
et al., 1997) and PPV (Guo et al., 1998). Higher
accumulation of AGII-GUS than of AGII-GFP
may indicate that insert size is not the only factor
that affects virus titer. An indirect cellular toxicity
of the expressed gene product is another possibility.
To follow in planta recombinant virus distribution we used expression of GUS and GFP reporter
genes. This approach has been used previously to
follow various plant RNA viruses (Dolja et al.,
1992; Baulcombe et al., 1995). AGII was distributed in all host plant organs tested, including
the roots and fruits. In the leaf, non-uniform
activities of GUS and GFP were observed, with
higher activity concentrated around the main and
lateral veins, suggesting active virus replication in
these areas. Similar expression patterns have been
demonstrated for other potyviral vectors (Dolja et
al., 1992; German-Retana et al., 2000). Interestingly, the green fluorescent areas in the leaf were
observed to be dynamic, appearing and disappearing as a function of time. Nevertheless, accumulation of AG-GFP virions was detected by ELISA in
non-fluorescencing areas, which may imply a low
79
rate of virus replication in those areas (Gal-On,
unpublished results).
Our results have provided evidence that AG can
mediate the synthesis of a biologically active Interferon-alpha 2 (IFN) in edible cucurbit fruit and
leaves. IFN is a naturally occurring protein with
immuno-modulatory and anti-viral properties, that
is produced in cultured human cells as a drug
(reviewed by Walter et al., 1998). A recombinant
IFN is currently used for the treatment of cancer
(Walter et al., 1998), and Hepatitis B and C
(Zavaglia et al., 2000).
The highest activity of IFN that was measured
in cucumber and squash leaves (430 000 IU g − 1
FW) is similar to the interferon 2 d activity obtained in turnip when CaMV was used as a DNA
virus vector (De Zoeten et al., 1989), and is
equivalent to about 2 mg g − 1FW of active protein.
Fruit, having a higher water content (98.5% vs.
83%) and lower cell number per gram fresh weight,
had an activity 2–8 times lower. In contrast, no
IFN activity and only about one-tenth of the
interferon-b activity were measured in transgenic
plants (Edelbaum et al., 1992).
As AGII virus is not pathogenic, the amount and
quality of fruit produced by AGII-IFN infected
cucumber plants was comparable to those of fruit
from virus-free plants. Consistent with GFP expression in the fruits, IFN activity measured in
squash and cucumber was concentrated mainly in
fruit embryonic tissue. The accumulation of AGIIIFN virion in fruits suggests that foreign gene
expression is mediated by viral spread, rather than
by independent translocation of gene products.
The activity of IFN in cucumber leaves varied in
accordance with the leaf developmental stage. In
fully expanded leaves, weighing more than 10 g, the
IFN activity had declined while virus accumulation
remained stable. Similar variations of interferon 2
d activity were demonstrated in various developmental stages of turnip leaves infected with the
CaMV vector (De Zoeten et al., 1989). This miscorrelation between AGII-IFN virion accumulation
and foreign gene expression levels was probably
due to a decrease of virus replication in mature
tissue, together with a relatively rapid turnover of
interferon compared with the stability of the virion.
The highest IFN activity was much lower than that
80
T. Arazi et al. / Journal of Biotechnology 87 (2001) 67–82
expected by the molar equivalent amount of viral
CP in the leaves. This could have resulted from an
instability or misfolding of the protein, possibly
promoted by the extra amino acids which were
artificially added at both ends of IFN. However, it
has been shown that addition of amino acid
residues to the termini of interferon did not affect
its activity (Pestka et al., 1987). It is noteworthy
that no IFN activity was lost when tissue was
lyophilized.
While orally administrated interferon was recently shown to be an efficient drug in animals
(Marcus et al., 1999) and humans (Cummins et al.,
1999). It is conceivable that an interferon which is
expressed in cucurbit fruit might be applied orally
to treat patients. However, further studies are
needed to determine whether the expressed IFN is
active in vivo.
In summary, in the present report, we have
demonstrated the feasibility of using attenuated
ZYMV as an expression vector in cucurbits. Such
a virus could potentially protect cucurbits from
severe ZYMV infection (Gal-On, 2000) with the
benefit of an added foreign trait. This vector may
also be useful as a tool for in planta genomic
studies, as it can express a gene without affecting
plant development. For stable expression of large
genes, studies are underway to refine the construct
in order to reduce RNA recombination in the viral
progeny.
Acknowledgements
This research was supported in part by the Chief
Scientist of the Ministry of Agriculture (136-030297, 136-0352-98). Contribution from Agricultural
Research Organization, The Volcani Center Israel
No. 544-00. The author is grateful to Victor Gaba
for comments on the manuscript prior to submission and for reviewing and editing the manuscript,
and to Gideon Schreiber for providing the human
Interferon alpha 2 cDNA.
References
Antignus, Y., Raccah, B., Gal-On, A., Cohen, S., 1989. Biological and serological characterization of zucchini yellow
mosaic virus and watermelon mosaic virus-2 isolates in
Israel. Phytoparasitica 17, 287– 289.
Baulcombe, D.C., Chapman, S., Santa Cruz, S., 1995. Jellyfish
green fluorescent protein as a reporter for virus infections.
Plant J. 7, 1045– 1053.
Carrington, J.C., Cary, S.M., Dougherty, W.G., 1988. Mutational analysis of tobacco etch virus polyprotein processing: cis and trans proteolytic activities of polyproteins
containing the 49-kilodalton proteinase. J. Virol. 62, 2313–
2320.
Carrington, J.C., Cary, S.M., Parks, T.D., Dougherty, W.G.,
1989. A second proteinase encoded by a plant potyvirus
genome. EMBO J. 8, 365– 370.
Chapman, S., Kavanagh, T., Baulcombe, D.C., 1992. Potato
virus X as a vector for gene expression in plants. Plant J.
2, 549– 557.
Choi, I.R., Stenger, D.R., Morris, T.J., French, R., 2000. A
plant virus vector for systemic expression of foreign genes
in cereals. Plant J. 23, 547– 555.
Cummins, J.M., Beilharz, M.W., Krakowka, S., 1999. Oral use
of interferon. J. Interferon Cytokine Res. 19, 853– 857.
Desbiez, C., Lecoq, H., 1997. Zucchini yellow mosaic virus.
Plant Pathol. 46, 809– 829.
De Zoeten, G.A., Penswick, J.R., Horisberger, M.A., Ahl, P.,
Schultze, M., Hohn, T., 1989. The expression, localization,
and effect of a human interferon in plants. Virology 172,
213– 222.
Dolja, V.V., McBride, H.J., Carrington, J.C., 1992. Tagging of
plant potyvirus replication and movement by insertion of
b-glucuronidase into the viral polyprotein. Proc. Natl.
Acad. Sci. USA 89, 10 208– 10 212.
Dolja, V.V., Herndon, K.L., Pirone, T.P., Carrington, J.C.,
1993. Spontaneous mutagenesis of a plant potyvirus
genome after insertion of a foreign gene. J. Virol. 67,
5968– 5975.
Dolja, V.V., Hong, J., Keller, K.E., Martin, R.R., Peremyslov,
V.V., 1997. Suppression of potyvirus infection by coexpressed closterovirus protein. Virology 234, 243– 252.
Edelbaum, O., Stein, D., Holland, N., Gafni, Y., Livneh, O.,
Novick, D., Rubinstein, M, Sela, I., 1992. Expression of
active human interferon-beta in transgenic plants. J. Interferon Res. 12, 449– 453.
Gal-On, A., Antignus, Y., Rosner, A., Raccah, B., 1992. A
coat protein gene mutation of zucchini yellow mosaic virus
restored aphid transmissibility but has no effect on multiplication. J. Gen. Virol. 73, 2183– 2187.
Gal-On, A., Meiri, A., Elman, C., Gray, D.J., Gaba, V., 1997.
Simple hand-held devices for the efficient infection of
plants with viral-encoding constructs by particle bombardment. J. Virol. Meth. 64, 103– 110.
Gal-On, A., Meiri, E., Raccah, B., Gaba, V., 1998. Recombination of engineered defective RNA species produces infective potyvirus in planta. J. Virol. 72, 5268– 5270.
Gal-On, A., 2000. A point mutation in the FRNK motif of the
potyvirus HC-Pro gene alters symptom expression in cucurbits and exhibits protection against the severe homologous virus. Phytopathology 90, 467– 473.
T. Arazi et al. / Journal of Biotechnology 87 (2001) 67–82
German-Retana, S., Candresse, T., Alias, E., Delbos, R.P.,
Le Gall, O., 2000. Effects of green fluorescent protein or
beta-glucuronidase tagging on the accumulation and
pathogenicity of a resistance-breaking Lettuce mosaic
virus isolate in susceptible and resistant lettuce cultivars.
Mol. Plant Microbe Interact. 13, 316–324.
Gopinath, K., Wellink, J., Porta, C., Taylor, K.M.,
Lomonossoff, G.P., van Kammen, A., 2000. Engineering
cowpea mosaic virus RNA-2 into a vector to express
heterologous proteins in plants. Virology 267, 159–173.
Guo, H.S., Lopez-Moya, J.J., Garcia, J.A., 1998. Susceptibility to recombination rearrangements of a chimeric
plum pox potyvirus genome after insertion of a foreign
gene. Virus Res. 57, 183–195.
Hamamoto, H., Suglyama, Y., Nakagawa, N., Hashida, E.,
Matsunaga, Y., Takemoto, S., Watanabe, Y., Okada, Y.,
1993. A new tobacco mosaic virus vector and its use for
the systemic production of angiotensin-I-converting enzyme inhibitor in transgenic tobacco and tomato. Biotechnology 11, 930– 932.
Hammond-Kosack, K.E., Staskawicz, B.J., Jones, J.D.G.,
Baulcombe, D.C., 1995. Function expression of a fungal
avirulence gene from a modified potato virus X genome.
Mol. Plant Microbe Interact. 8, 181–185.
Hendy, S, Chen, Z.C., Barker, H., Santa-Cruz, S., Chapman, S., Torrance, L., Cockburn, W., Whitelam, G.C.,
1999. Rapid production of single-chain Fv fragments in
plants using a potato virus X episomal vector. J. Immunol. Meth. 231, 137–146.
Jefferson, R.A., Kavanagh, T.A., Bevan, M.W., 1987. GUS
fusions: beta-glucuronidase as a sensitive and versatile
gene fusion marker in higher plants. EMBO J. 6, 3901–
3907.
Kadouri, D., Yan-hua, P., Wang, Y., Singer, S., Huet, H.,
Raccah, B., Gal-On, A., 1998. Affinity purification of
HC-Pro of potyviruses with Ni2 + -NTA resin. J. Virol.
Meth. 76, 19 – 29.
Kumagai, M.H., Turpen, T.H., Weinzettl, N., della-Cioppa,
G., Turpen, A.M., Donson, J., Hilf, M.E., Grantham,
G.L., Dawson, W.O., Chow, T.P., Piatak, M., Jr., Grill,
L.K., 1993. Rapid, high-level expression of biologically
active a-trichosanthin in transfected plants by an RNA
viral vector. Proc. Natl. Acad. Sci. USA 90, 427–430.
Kumagai, M.H, Donson, J., della-Cioppa, G., Grill, L.K.,
2000. Rapid, high-level expression of glycosylated rice
alpha-amylase in transfected plants by an RNA viral vector. Gene 245, 169– 174.
Marcus, P.I., van der Heide, L., Sekellick, M.J., 1999. Interferon action on avian viruses. I. Oral administration of
chicken interferon-alpha ameliorates Newcastle disease. J.
Interferon Cytokine Res. 19, 881–885.
Masuta, C., Yamana, T., Tacahashi, Y., Uyeda, I., Sato,
M., Ueda, S., Matsumura, T., 2000. Development of
clover yellow vein virus as an efficient stable gene-expression system for legume species. Plant J. 23, 539–546.
.
81
Matthews, R.E.F., 1991. Plant Virology, 3rd. Academic
Press, New York.
McCormick, A.A., Kumagai, M.H., Hanley, K., Turpen,
T.H., Hakim, I, Grill, L.K., Tuse, D, Levy, S., Levy, R.,
1999. Rapid production of specific vaccines for
lymphoma by expression of the tumor-derived singlechain Fv epitopes in tobacco plants. Proc. Natl. Acad.
Sci. USA 96, 703– 708.
Pestka, S., Langer, J.A., Zoon, K.C., Samuel, C.E., 1987.
Interferons and their actions. Annu. Rev. Biochem. 56,
727– 777.
Porta, C., Lomonossoff, G.P., 1996. Use of viral replicons
for the expression of genes in plants. Mol. Biotechnol. 5,
209– 221.
Revers, F., Gall, O.L., Candresse, T., Maule, A.J., 1999.
New advances in understanding the molecular biology of
plant potyvirus interactions. Mol. Plant Microbe Interact. 12, 367– 376.
Riechmann, J.L., Lain, S., Garcia, J.A., 1992. Highlights
and prospects of potyvirus molecular biology. J. Gen.
Virol. 73, 1 – 16.
Rommens, C.M., Salmeron, J.M., Baulcombe, D.C.,
Staskawicz, B.J., 1995. Use of a gene expression system
based on potato virus X to rapidly identify and characterize a tomato pto homolog that controls fenthion sensitivity. Plant Cell 7, 249– 257.
Rubinstein, S., Familletti, P.C., Pestka, S., 1981. Convenient
assay for interferons. J. Virol. 37, 755– 758.
Sablowski, R.W.M., Baulcombe, D.C., Bevan, M., 1995.
Expression of a flower-specific Myb protein in leaf
cells using a viral-vector causes ectopic activation of a
target promoter. Proc. Natl. Acad. Sci. USA 92, 6901–
6905.
Scholthof, H.B., Scholthof, K.-B.G., Jackson, A., 1996.
Plant virus gene vectors of transient expression of foreign
proteins in plants. Ann. Rev. Phytopathol. 34, 299– 323.
Sellner, L.N., Coelen, R.J., Mackenzie, J.S., 1992. A onetube, one manipulation RT-PCR reaction for detection
of Ross River virus. J. Virol. Meth. 40, 255– 263.
Shukla, D.D., Ward, C.W., Brunt, A.A., 1994. The Potyviridae, CABI Wallingford.
Simon, A.E., Bujarski, J.J., 1994. RNA– RNA recombination and evolution in virus-infected plants. Annu. Rev.
Phytopathol. 32, 337– 362.
Takamatsu, N., Ishikawa, M., Meshi, T., Okada, Y., 1987.
Expression of bacterial chloramphenicol acetyltransferase
gene in tobacco plants mediated by TMV-RNA. EMBO
J. 6, 307– 311.
Valerie, E., Spall, M., Shanks, M., Lomonossoff, G.P., 1997.
Polyprotein processing as a strategy for gene expression
in RNA viruses. Semin. Virol. 8, 15 – 23.
Verchot, J., Koonin, E.V., Carrington, J.C., 1991. The 35kDa protein from the N-terminus of a potyviral
polyprotein functions as a third virus-encoded proteinase.
Virology 185, 527– 535.
82
T. Arazi et al. / Journal of Biotechnology 87 (2001) 67–82
Walter, M.R., Bordens, R., Nagabhushan, T.L., Williams,
B.R., Herberman, R.B., Dinarello, C.A., Borden, E.C.,
Trotta, P.P., Pestka, S., Pfeffer, L.M., 1998. Review of
recent developments in the molecular characterization of
recombinant alfa interferons on the 40th anniversary of the
discovery of interferon. Cancer Biother. Radiopharm. 13,
143– 154.
Zavaglia, C., Airoldi, A., Pinzello, G., 2000. Antiviral therapy
of HBV- and HCV-induced liver cirrhosis. J. Clin. Gastroenterol. 30, 234– 241.
Zhang, G., Leung, C., Murdin, L., Rovinski, B., White, K.A.,
2000. In planta expression of HIV-1 p24 protein using an
RNA plant virus-based expression vector. Mol. Biotechnol. 14, 99 – 107.
.