Plant Molecular Biology 23: 453-463, 1993.
© 1993 Kluwer Academic Publishers. Printed in Belgium.
453
DNA-protein interactions on a cis-DNA element essential for ethylene
regulation
Yael Meller, Guido Sessa, Yoram Eyal and Robert Fluhr
Department of Plant Genetics, Weizmann Institute of Science, Rehovot 76100, Israel (* author for
correspondence)
Received 25 March 1993; accepted in revised form 30 June 1993
Key words: transgenic plant, pathogenesis-related proteins, gel retardation assay, G-box, trans-acting
factor
Abstract
The PRB-lb gene encodes for a basic-type component of the pathogenesis-related PR-1 protein family. In leaves of tobacco plants, PRB-lb mRNA accumulation is rapidly induced by the application of
exogenous ethylene. Promoter deletion analysis was performed in transgenic tobacco plants to delineate
cis-acting elements necessary for ethylene responsiveness of the PRB-Ib gene. The promoter sequence
from position -213 was sufficient to enhance a 20 fold increase of/?-glucuronidase reporter gene expression in transgenic tobacco leaves exposed to 20/~1/1 of ethylene, however -141 bp were not. The
functional study was correlated with in vitro analysis of the nuclear protein-DNA complexes formed on
the promoter element identified as necessary for ethylene induction. Gel-shift analysis using restriction
fragments spanning the sequence between position -237 and - 143 revealed two distinct nuclear proteinDNA interactions. The protein-binding sequences were mapped to the contiguous regions G (-200 to
- 178) and Y ( - 179 to - 154) by gel-shift analysis using oligonucleotides. Fractionation of crude nuclear
extract by heparin-agarose chromatography resulted in the differential elution of the two binding activities. The DNA-nuclear protein interactions characterized in vitro can be part of the molecular events
which mediate the transcriptional regulation of the PRB-lb gene by ethylene.
Introduction
The hypersensitive-response of tobacco Samsun
NN to tobacco mosaic virus (TMV) infection induces the synthesis and accumulation of pathogenesis-related (PR) proteins by the host plant.
PR proteins form a heterogeneous family of proteins, targeted through the exocytic pathway [ 11 ].
They also accumulate in plant leaves in response
to various stimuli such as hormones, chemical
elicitors and stress. In addition, members of the
PR proteins are expressed in a developmentally
regulated manner, in flower tissues [21] and abscission zone tissues [13]. While the pathogeninduced accumulation of PR proteins may indicate a role in defense mechanisms, their
developmentally regulated presence in the flower
suggests a function in physiological processes of
the healthy plant.
PR proteins have been divided into five groups
[38], which include several gene families composed by basic and acidic isoforms [2, 20]. The
454
PRB-Ib gene encoding a basic-type protein has
been recently characterized [ 12]. It belongs to an
ethylene-responsive PR-I gene subfamily regulated in a manner distinct from the acidic-type
PR-1 genes [3, 24]. PRB-lb expression is regulated by ethylene at the level of transcription in a
light-dependent manner [12, 13]. Other elicitors
of PRB-lb expression, such as xylanase, are lightindependent in their action [ 12]. In the dark, a
second type of induction occurs determining
elicitor-independent accumulation of transcripts
[12].
The plant hormone ethylene is involved in many
different stages of plant development and fruitripening, and acts through regulation of transcription of its target genes [4, 5, 6, 7, 12, 26, 29, 32].
The signal transduction pathways and the molecular mechanisms which mediate the activation
of responses triggered by ethylene have begun to
be elucidated. The ethylene-dependent pathway
of PR proteins elicitation has been shown to require the presence of calcium [30], and an intact
protein phosphorylation machinery [31]. In addition, a gene encoding a putative serine/threonine
protein kinase has been cloned and shown to be
involved in modulating cellular responses to ethylene [ 18 ].
Cis-regulatory elements responsive to ethylene
have been identified in several genes [4, 8, 32]. A
122 bp ethylene-responsive bean promoter sequence was characterized in transgenic tobacco
plants and in bean protoplasts [4, 32]. In tomato
the ethylene-induced E4 and E8 genes were
shown to contain, in their promoters, sequences
that bind nuclear factors in a ripening-dependent
manner [6, 7]. However, these sequences are not
necessary for ethylene responsiveness [8]. The
accumulation in leaves of PRB-lb transcript in
response to ethylene is rapid (within minutes)
[31 ]. This makes the PRB-lb gene a good model
system to elucidate the molecular events responsible for transcription regulation by ethylene. The
PRB-lb promoter sequence of 213 bases upstream to the translation start-site interacts specifically with nuclear proteins in vitro and is sufficient to direct ethylene responsiveness of a
reporter gene in transgenic tobacco plants [ 13].
In addition to ethylene sensitivity in the leaves,
transgenes showed vascular specific activity
throughout the plant which was present constitutively in Petiole and abscission zones [13]. We
were interested in further localizing promoter sequences responsible for ethylene-induction, in
vivo, and in characterizing the interactions of these
sequences with nuclear proteins in vitro. In this
paper, we show that a 71 bp fragment spanning
positions - 2 ! 3 to -142 is necessary for ethylene
induction of a fl-glucuronidase reporter gene in
transgenic plants. We further characterize this sequence by a gel mobility-shift assay and show the
presence of two distinct promoter elements interacting with at least two different types of binding
activities.
Materials and methods
Constructs preparation and plant transformation
A synthetic Barn HI site was introduced by sitedirected mutagenesis into the PRB-lb upstream
region at position -7, relative to the translation
initiation codon. A Sal I-Bam HI fragment containing PRB-lb promoter sequences from -863
to - 7 was cloned upstream of the fl-glucuronidase
(GUS) gene in a Bluescript plasmid (Stratagene).
Two site-directed mutants of this construct were
created at sites -213 (Xba I site) and -67 (Bgl II
site). Promoter deletions were carried out by digesting with Sal I and Xba I for -213-GUS, Sal I
and Nde I (original site) for - 142-GUS, and Sal I
and Bgl II for -67-GUS. The resulting deletion
constructs were subcloned into the plant transformation vector pMON200. Triparental mating
and Agrobacterium-mediated transformation of
Nicotiana tabacum cv. Samsun N N leaf disks were
performed as previously described [16].
Fluorimetric assay of GUS activity
Leaf disks were homogenized in 200 #1 of G U S
lysis buffer (50 m M sodium phosphate pH 7.0,
10 mM EDTA, 10 m M 2-mercaptoethanol). Ex-
455
tracts were assayed fluorimetrically using the substrate 4-methylumbelliferyl glucuronide (MUG)
as described by Jefferson et aL [17].
Extraction of nuclei from tobacco leaves
Young tobacco plants (bearing 4 to 6 leaves) were
incubated in the presence of 20 #1/1 ethylene for
5 h. After treatment, leaves were harvested, frozen in liquid nitrogen, and stored at -80 °C until
use. The extraction of nuclei was performed according to a method adapted from Watson and
Thompson [39]. Frozen tissues (500 g) were homogenized with mortar and pestle under liquid
nitrogen with 2 1 of cold homogenization buffer
(1 M 2-methyl-2,4-pentanediol (hexylene glycol),
10 mM PIPES/KOH pH 7.0, 10 mM MgC12,
0.5~o v/v Triton X-100, 5 mM 2-mercaptoethanol, 0.8 mM PMSF). The suspension was filtrated through 2 layers of Miracloth and 4 layers
of cheese cloth, and centrifuged for 10 rain at
3000 x g. The crude nuclear pellet was gently resuspended in 40 ml of nuclear wash buffer (0.5 M
hexylene glycol, 10 mM PIPES/KOH pH 7.0, 10
mM MgCI> 5 mM 2-mercaptoethanol, 0.8 mM
PMSF) containing 0.5~o v/v Triton X-100, and
centrifuged for 5 rain at 3000 x g. After centrifugation, the pellet was washed with 20 ml of
nuclear wash buffer and resuspended in 3 ml of
nuclear wash buffer. After the addition of 1/3
volume of 80~o glycerol the suspension was frozen in liquid nitrogen and stored at -80 °C. Extraction of nuclear proteins was adapted from
Parker and Topoi [28]. The frozen nuclei suspension was thawed on ice, and the whole procedure carried out at 4 ° C. One volume of nuclei
wash buffer was added, and the nuclei were sedimented at 3000 x g for 5 rain. The pellet was resuspended in 8 ml of nuclear lysis buffer (110 mM
KC1, 15 mM Hepes/KOH pH 7.5, 5 mM MgCI2,
1 mM DTT, 5 #g/ml antipain, 5 #g/ml leupeptin)
and the suspension was transferred to polyallomer centrifuge tubes (13 mm x 51 mm). The
DNA was precipitated by the addition of four
aliquots of 200 #1 of 4 M ammonium sulfate on a
rocking device for 30 min. The precipitate was
pelleted at 40000 rpm for 60 min. The supernatant was transferred to a new tube, and 0.3 g/
ml of freshly ground ammonium sulfate was
slowly added to it, with gentle stirring for 30 rain.
The protein precipitate was pelleted at 10000 x g
for 15 min, resuspended in 0.5 ml per 500 g tissue
of nuclear extract buffer (40 mM KC1, 25 mM
Hepes/KOH pH 7.5, 0.1 mM EDTA, 10~o glycerol, 1 mM DTT, 5/~g/ml antipain, 5/~g/ml leupeptin), and dialyzed for 2 to 4 h against 500 ml
of nuclear extract buffer with 3 changes. Insoluble
material was pelleted in a microfuge for 10 min.
The protein concentration was determined by
the Bradford reaction (BioRad), and fractions
were frozen in liquid nitrogen and stored at
-80 °C.
Fractionation of crude nuclear extract
The dialyzed extract was loaded on a 1.5 ml
heparin-agarose column (type II, Sigma) previously equilibrated with 10 columns volumes of
nuclear extract buffer. The absorbed proteins were
eluted in three steps with 0.2 M KCI, 0.6 M KC1,
and 1 M KC1. For each step, 3 fractions of 500/~1
were collected. The elutes were dialyzed against
nuclear extract buffer, frozen in liquid nitrogen,
and stored at -80 °C.
Gel shift assay
Probes were prepared by 3' end-labeling using
the Klenow enzyme, according to Maniatis et al.
[22]. Binding reactions (15 #1) contained 5 to
10fmol of end-labeled DNA probe, 125 mM
Hepes pH 7.9, 50mM MgCI2, 1 mM CaC12,
5 m M DTT, 50~o glycerol, double-stranded
poly(dI-dC) and specific competitor DNA sequences, as indicated. Reactions were begun by
the addition of total nuclear extract (0.3 to 0.7/~g/
#1) or fractions from heparin-agarose chromatography. After 30 min of incubation at room temperature, reactions were loaded on a prerun 5~0
acrylamide/bisacrylamide gel in glycine buffer
(400 mM Tris-HC1 pH 8.5, 1.95 M glycine). After
456
sitions -142 and -67 resulted in a loss of responsiveness. These results indicate that
regulatory sequences necessary for activation of
the PRB-lb gene by ethylene are located in the
promoter sequence spanning position -213 to
-142.
3 h of electrophoresis (16 V/cm), the gel was dried
on Whatman paper and autoradiographed.
Results
The region of the PRB-lb promoter between positions -213 and -142 is necessary for ethylene induction
Fragment E harbors two contiguous protein-binding
sites
Transcription of the pathogenesis-related PRB-Ib
gene is activated by the plant hormone ethylene.
We have previously shown that a promoter fragment -213 upstream to the translation start site
is sufficient to confer ethylene responsiveness to
a fl-glucuronidase (GUS) reporter gene in transgenic tobacco plants [13]. In order to further
characterize ethylene-responsive elements we
tested ethylene inducibility of deletion constructs
containing -213, - 142 or -67 bp of the PRB-lb
promoter fused to a GUS reporter gene in transgenic tobacco plants (Fig. 1A). Three independent transformants for each construct were
treated with 20 ppm ethylene for 48 h, and leaf
protein extracts tested for GU S activity by a fluorimetric assay. As shown in Fig. 1B, the construct
harboring 213 bp of the promoter retained ethylene inducibility. However, further deletions to po-
In a survey of 863 bp of PRB-Ib promoter-nuclear
protein interactions, we previously observed two
specific protein-DNA complexes, termed E1 and
E2, between positions -237 and -143 ([13];
Fig. 2B, lane 10). No differences in complex number or intensity were observed using extract from
untreated or treated plants. Similar constitutive
interactions between cis-acfing sequences belonging to inducible genes and their cognate nuclear
protein factors have been reported [ 13]. As this
segment is required for ethylene induction, we
wished to localize more precisely the proteinbinding sites by a gel-shift assay. A schematic
representation of fragment E, including relevant
restriction sites, is shown in Fig. 2A. The E sequence was end-labeled at either the Hind III site
(H), or at the Eco RI site (E), and subsequently
B
A
150.
-213
BamH I
I
N~Ie I +1
GUS coding region
NOS
terminator
EcoiR I
>-
D-
•
,E 125.
.c_
2
Untreated
I-1 Ethylene treated
lOO-
-142
¢..)
+1
75.
o.
-67
50.
II
+1
25.
-213
-142"
"-67 "
Fig. 1. Ethylene induction of PRB-Ib promoter deletions in transgenic tobacco plants. A. Constructs containing deletions of the
PRB-lb promoter fused to a G U S reporter gene. The length of promoter and start site of transcription are indicated. B. G U S activity
of the deletion constructs in ethylene treated and untreated transgenic plants. Three independent transformant plants were tested
for each construct. GUS activity is expressed in pmol 4-methylumbelliferone (4-MU) produced in 1 h assay by 1 #g total protein
extract.
457
Fig. 2. Gel-shift analysis of restriction fragments generated on fragment E. A. Restriction map of fragment E. Restriction sites are
Hind III (H), Fnu4 HI (F), Mae II (MII), Mae III (MIII), Mse I (MS), Eco RI (E). B. Binding analysis of nuclear factors to
fragment E and its subfragments. Fragment E was end-labeled either at Hind III site or at Eco RI site, and subsequently digested
with one of the four restriction enzymes Fnu4 HI, Mae II, Mae III or Mse I. Each probe (10 fmols) was incubated with ( + ) or
without ( - ) 20/~g of nuclear protein extract from ethylene-treated plants, in the presence of 3/~g of double-stranded poly(dI-dC).
Lanes with odd numbers contain probes alone, lanes with even numbers contain binding reactions. E1 and E2 refer to complexes
formed on fragment E, shown in lane 10.
digested by restriction enzymes Fnu4 HI (F),
Mae II (MII), Mae Ill (Mill), or Mse I (MS).
When gel-shift assays with nuclear extracts were
conducted on fragments labeled at the Hind III
site, binding was detected with the restriction
fragments HMIII and HMS (Fig. 2B, lanes 6 and
8), but not with H F or HMII (Fig. 2B, lanes 2
and 4). Slow migrating complexes, with a mobility consistent with the fragment length, appeared
qualitatively similar to the complex E1 detected
on the full E fragment (Fig. 2B, lane 10), and are
designated as El-like. They are presumably
formed by DNA-binding proteins identical to
those responsible for the E1 complex formation.
In addition, an E2-1ike complex was formed with
the HMIII probe (Fig. 2A, lane 6), giving a sharp
band more intense than the signal obtained with
the El-like complex. When the E fragment was
labeled at the Eco RI site, three out of the four
generated restriction fragments bound nuclear
proteins in a sequence-specific manner, forming
E l-like complexes, with mobilities consistent with
the fragment lengths (Fig. 2B, lanes 12, 14, 16).
The 13 bp long EMS fragment did not show any
specific affinity for nuclear proteins (Fig. 2B,
lane 16). These results indicate that sequences
critical for nuclear protein binding on fragment E
are located between positions -185 and -156
(Mae II and Mse I restriction sites, respectively).
This sequence harbors at least two distinct in vitro
binding sites, which interact with nuclear proteins
to form E1 and E2 complexes.
Oligonucleotides G ( - 2 0 1 to -178) and Y ( - 1 7 9 to
-154) contain the two protein-binding sites
To further delineate the sequence of the two putative binding sites present on fragment E, oligonucleotides spanning positions -201 to -178 and
- 179 to - 154 corresponding to both strands were
synthesized, and annealed to form G and Y se-
458
quences, respectively (Fig. 3). Sequence G contains a G box motif (5'-C/A C A C G T G G C A - 3 ' ),
found in the promoters of rbcS genes of many
plant species [ 15, 41] and in the chlorophyll a/bbinding protein gene (cab-E) of Nicotiana plumbaginifolia [35]. In addition, it contains an 11 bp
consensus sequence (5'-TAAGAGCCGCC-3'),
highly conserved in ethylene-responsive promoters [13]. Sequence Y does not contain any previously characterized binding motif. The two oligonucleotides, in the double-stranded form, were
used as competitors in binding reactions involving the whole E fragment (Fig. 4, lanes 1 to 5),
restriction fragment H M I I I (Fig. 4, lanes 6 to 8),
and EMIII (Fig. 4, lanes 9 to 11). When preincubated in the binding reaction at a 100-fold molar
excess, oligonucleotide Y competed for the formation of both E1 and E2 complexes on fragment
E (Fig. 4, lane 3). Oligonucleotide Y was also an
efficient competitor of E l-like complex on EMIII
fragment (Fig. 4, lane 11), and of El- and E2-1ike
complexes on HMIII fragment at 30-fold molar
excess (Fig. 4, lane 8). These results suggest that
both regions EMIII and HMIII of the E fragment contain protein binding sequences homologous to oligonucleotide Y. In contrast, the presence of 30- or 100-fold excess of G (Fig. 4, lanes 4
and 5) had no detectable impact on the stability
of complexes E1 and E2 formed on fragment E,
or on the stability of the E l-like complex on fragment EMIII (Fig. 4, lane 10). The presence of
500-fold molar excess of G had no effect either
(data not shown).
However, a 30-fold molar excess of G oligonucleotide competed the E2-1ike binding on
-201
- 178
agct TGGCGGCTCTTATCTCACGTGATG
ACCGCCGAGAATAGAGTGCAC TACt t a a
-179
O]igO
-154
att cTGTGACATTGAAATTCT TTGACT TTA
gACACTGTAACTTTAAGAAACTGAAAT cga
oHgo Y
Fig. 3. Nucleotide sequence of oligonucleotides used in the
binding analysis. Numbers above the sequence correspond to
nucleotide positions relative to the translation start codon.
Sequence in lower case correspond to introduced restriction
sites Hind III and Eco RI. Arrows indicate area of homology
between G and Y fragments.
Fig. 4. Competition by oligonucleotides G and Y of nuclear
extract binding on fragment E. Binding assays contained 18/~g
of crude nuclear extracts, 3 #g of double-stranded poly(dIdC), and labeled fragment E (40 fmol), or fragments HMIII
(25 fmol), or EMIII (25 fmol). Before the addition of probe,
a 30-fold (lanes 2, 4, 7, and 10) or a 100-fold (lanes 3 and 5)
molar excess of the indicated competitors was preincubated
with the binding reactions. E1 and E2 indicate protein-DNA
complexes. F indicates free probe.
H M I I I (Fig. 4, lane 7). These results indicate that
the Y sequence contains the protein binding sites
present on both fragments HMIII, and EMIII,
while the G sequence harbors only the site present
on the HMIII fragment.
At least two distinct binding activities interact with
sequence G and sequence Y
The binding potential of oligonucleotide G and Y
were tested directly by gel-shift assay (Fig. 5).
When labeled G oligonucleotide was incubated
with nuclear proteins, three distinct retarded mobilities, labeled G1, G2, and G3, were detected
(Fig. 5A, lane 2). The specificity of each complex
was tested by competition analysis. A 100-fold
molar excess of G, preincubated with the binding
reaction, competed for the formation of all the
three complexes (Fig. 5A, lane 3). The competition was total when a 500-fold molar excess was
used (Fig. 5A, lane 5). Interestingly, the presence
of 100- or 500-fold molar excess of Y had impact
mainly on G1 stability (Fig. 5A, lanes 4 and 6
respectively). This competition was the result of
459
Two binding activities, Gf and Yf are differentially
fractionated by heparin-agarose chromatography
Fig. 5. Gel-shift assay of G and Y oligonucleotides. Oligonucleotides (3 fmol) were used in gel-shift assays with 18 pg
of nuclear extract in the presence of 1 #g of double-stranded
poly(dl-dC). For competitions, the binding reactions were preincubated with 100-fold (lanes 3 and 4) or 500-fold (lanes 5
and 6) molar excess of the indicated competitor. G1, G2, G3
and Y1 indicate protein-DNA complexes. F indicates free
probe.
a specific interaction, since the G1 complex was
stable in the presence of additional amounts of
double-stranded poly(dI-dC) (data not shown).
When labeled oligonucleotide Y was incubated
with nuclear extract, one complex designated as
Y1 was observed (Fig. 5B, lane 2). When challenged by preincubation with excess amounts of
Y and G, the complex Y1 showed a high specificity for the Y sequence. It was displaced by a
100- or 500-fold molar excess of Y (Fig. 5B,
lanes 3 and 5), while remained stable in the presence of a 500-fold molar excess of G (Fig. 5B,
lane 6).
It appears therefore that fragment E contains
binding sites for two distinct in vitro binding activities. The first interacts with sequence Y to form
Y1 complex, and possesses some affinity for G
sequence, where it forms G 1 complex. Thus one
of the factors involved in the formation of E1
and E2 complexes binds to both sequence Y
and G. The other binding activity interacts specifically with sequence G to form G2 and G3
complexes.
Heparin-agarose chromatography was performed
to differentiate between the nuclear proteins binding to the E fragment. Nuclear proteins bound to
the column were eluted with low (0.2 M KC1),
medium (0.6 M KC1), or high (1 M KCI) salt concentrations. The affinity of each eluted fraction
for D N A was tested by gel mobility-shift assay
with E fragment or oligonucleotides G or Y as
probes (Fig. 6). Figure 6A shows the fractionated
binding activities detected with labeled E fragment. By analogy to the binding pattern obtained
with the crude nuclear extract (Fig. 6A, lane 2),
slow-migrating complexes and fast-migrating
complexes are called El-like and E2-1ike complexes, respectively. Three distinct binding patterns were observed. Fractions eluted with low
salt concentration formed mostly E2-1ike complex (Fig. 6A, lanes 3 and 4), while fractions
eluted with intermediate salt concentrations
showed equal amounts of El- and E2-1ike complexes (Fig. 6A, lanes 5 to 7). Fractions eluted
with high salt concentrations mainly formed Ellike complex (Fig. 6A, lanes 8 and 9). These observations suggest that crude nuclear extracts
harbor at least two types of factors with distinct
binding activities towards fragment E. When the
G sequence was used as a probe in binding reactions with the nuclear fractions, two distinct
binding patterns were obtained (Fig. 6B). Fractions eluted with low and medium salt concentrations contained one type of binding activity
which formed predominantly the G1 complex
(Fig. 6B, lanes 3 to 6). Complexes G2 and G3
were formed with the fractions eluted with high
salt concentration (Fig. 6B, lanes 7 and 8). When
the Y sequence was used as a probe, one major
binding activity, predominant in fractions eluted
with low and medium salt concentrations, formed
Y1 complex (Fig. 6C).
The Y sequence specificity of Y 1 .and G 1 complexes suggest that a D N A binding activity specific to sequence Y, eluted from the heparinagarose column with buffers containing low and
medium salt, binds to G and Y sequences form-
460
ing protein-DNA complexes G1 and Y1, respectively. This suggests that the same binding activity, termed Yf, is involved in the G1 and Y1
DNA-protein interactions. A second hypothetical type of binding activity, Gf, eluted exclusively
by high salt concentrations, forms complexes G2
and G3, previously shown to be G sequencespecific.
E1 complex is formed on both G- and Y-binding
sites, E2 complex is formed on the Y-binding site
only
We wished to establish a correlation between the
activities Yf and Gf, and the nuclear proteins
responsible for E1 and E2 complexes formed on
fragment E. For that purpose, oligonucleotides G
and Y were tested as competitors of DNA-protein
interactions on fragment E. Figure 7 shows that
the E2-1ike complex, containing nuclear proteins
eluted with low salt concentrations, was displaced
by 500-fold molar excess of oligonucleotide Y,
but was stable in the presence of the same amount
of oligonucleotide G (Fig. 7, lanes 1 to 3). Since
Yf binding activity is highest in those fractions
(Fig. 6C), it is probable that E2-1ike complex involves the binding ofYfto Y domain. The El-like
Fig. 6. Gel-shift analysis of nuclear fractions eluted from a
heparin-agarose column. A. Binding affinity for E fragment of
heparin-agarose eluted fractions. B. Binding affinity for oligonucleotide G of heparin-agarose-eluted fractions. C. Binding
affinity for oligonucleotide Y of heparin-agarose eluted fractions. Proteins of each eluted fraction (1/~g in A, 2/tg in B and
C) were incubated with 15 fmol (A) or 3 fmol (B and C) of
probe, in the presence of 3 #g (A), or 1/~g (B and C) of
double-stranded poly(dl-dC). Lanes 1, probe alone, lanes 2,
binding reaction with 9 #g of crude nuclear extract, lanes 3 to
9, binding reactions with eluted fractions. Low, Medium, and
High designate fractions eluted from heparin-agarose with
buffer containing 0.2 M, 0.5 M, 1 M, of KC1, respectively. El,
E2, G1, G2, G3, and Y1 indicate the specific protein-DNA
complexes. F indicates free probe.
Fig. 7. Competition analysis by oligonucleotide G and Y of
interactions of fractionated nuclear extract with fragment E.
Labeled fragment E (15 fmol) was incubated with 1/~g of fractionated extract and 3/~g of double-stranded poly(dI-dC).
Competition was carried out by preincubation with 500-fold
molar excess of non labeled oligonucleotide. E1 and E2 indicate protein-DNA complexes. F indicates free probe.
461
complex, containing nuclear proteins eluted with
high salt concentrations, was partially competed
by a 500-fold molar excess of oligonucleotide G,
and completely disrupted by the same excess of
oligonucleotide Y (Fig. 7, lanes 4 to 6). Therefore
the El-like complex represents interactions of
both G and Y sequences with their respective
binding activities.
Discussion
We identified an ethylene-responsive c/s-acting
DNA element of the PRB-I b promoter and characterized it by the specific interactions it forms
in vitro with cognate trans-acting factors. A sequence necessary for ethylene induction in transgenic plants was localized on a 71 bp segment
between positions -213 and -142, relative to the
translation-start site. Gel mobility-shift assays
using subfragments of this area, clearly demonstrated that this fragment harbors two contiguous
protein-binding sequences localized on sequences
G (-200 to -178) and Y (-179 to -154).
Fractionation of the crude nuclear extract by
heparin-agarose chromatography separated two
binding activities with differential specificities towards sequences G and Y. Characterization of
the binding specificities of sequences G and Y, by
competition analysis, confirmed that they interact
with a minimum of two nuclear factors. The binding activity specific to oligonucleotide G, determined the concomitant formation of G2 and G3
complexes with proteins from high-salt fractions.
This result could represent either a singular factor binding the G sequence in monomeric and
dimeric form, or two distinct co-eluting proteins
able to interact with a G-binding site. In the
former possibility, the higher intensity of the retarded band corresponding to complex G3
(Fig. 6B, lane 2) would suggest that under the
conditions used monomerization is the preferential state for factor Gf. Interestingly, the G region
contains an 11 bp sequence, TAAGAGCCGCC,
which is highly conserved in the promoter of
ethylene-induced PR genes of Nicotiana species
and partially present in the minimal ethylene responsive promoter of the bean chitinase [ 13]. The
presence of this element in the PRB-Ib promoter
region necessary for ethylene responsiveness
makes it a possible candidate for the Gf-binding
site, and a putative target for the ethylene signal
transduction pathway. Additionally, the G sequence contains a G-box motif, which is also
found in a number of plant genes promoters,
where it interacts specifically with nuclear proteins [9, 14, 23, 25, 34, 35, 36, 37]. Based on
competition studies Gf did not interact with the
hexl sequence of the wheat histone H3 promoter
(data not shown) which was shown to bind to the
cloned tobacco G box binding factor TAF [27].
However, G-box motif-binding proteins exhibit
differential sequence specificity, depending on sequences flanking the hexameric core motif [41].
Thus, the G-box motif remains a candidate for
the Gf-binding site. Furthermore, site-directed
mutations in the G region which alter the GCC
repeat or the G-box motif, disrupt factor binding
and abolish the ethylene inducibility of the minimum -213 PRB-lb transgene (G. Sessa, unpublished).
A second binding activity, Yf, displays affinity
for both G and Y sequences where it forms G1
and YI complexes, respectively. It may have a
higher specificity for sequence Y, as suggested by
the asymmetrical intercompetition between oligonucleotides G and Y. The dual binding affinity of
Yf suggests that it recognizes part of its binding
site on sequence G. It is possible that a 7 base
sequence, GTGACAT, present in the Y sequence
starting at position -178, and in reverse orientation as GTGAGAT in the G sequence, starting
at position -183 (Fig. 3), forms a part of the
target sequence of Yf binding activity.
The interactions of Y and G sequences with
their cognate nuclear factors were integrated into
interactions in the context of the whole E fragment by competition analysis. Strikingly, DNAprotein complexes E1 and E2, formed on the E
fragment, were both displaced by molar excess of
sequence Y, while sequence G was a very poor
competitor of those interactions. Only in high-salt
fractions, where Gf binding activity predominates, was partial competition achieved. This evidence leads us to the conclusion that the Gf bind-
462
ing activity is either masked or does not take
place in the context of the whole E fragment. On
the other hand Yf binding activity to E was maintained in low- and high-salt heparin fractions as
well, despite its low level in high-salt fractions, as
revealed by binding to the Y oligonucleotide. Possibly, cooperativity between Gf and Yf in highsalt fractions could enhance Yf binding activity
and compensate for its lower availability. Alternatively, a third DNA-binding activity targeted in
the whole E fragment to the region of the sequence Y, but having a very weak affinity for
oligonucleotide Y, could elute in high-salt fractions.
The characterization of distinct binding activities, interacting with the E fragment on the
PRB-Ib promoter, opens the possibility for combinatorial interactions between different nuclear
factors, representing components of the ethyleneresponsive machinery. A combinatorial organization of cis-acting elements has been observed in
agibberellin-responsive gene [ 19, 33]. In that case
two contiguous promoter elements interacting
separately with nuclear factors were defined as a
'response element' and a 'coupling element', respectively, and were shown to be required for
promoting gibberellin-induced gene expression.
Interestingly, similar interactions have been found
to occur in functional elements involving G-box
motifs. In one example, the G-box found in Arabidopsis rbcS-IA promoter is flanked by two
I-boxes that interact with nuclear proteins and
are necessary for maximum expression levels
[ 10, 34]. Similarly, a nucleoprotein binding site,
box I, flanking a G-box motif on parsley chalcone
synthase promoter cooperates with the G-box element for light-induced expression [ 1, 35, 40]. It
remains to be seen if this kind of combinatorial
interaction indeed takes place in the ethyleneinduced activation of the PRB-lb promoter.
References
1. Block A, Dangl JL, Hahlbrock K, Schulze-Lefert P:
Functional borders, genetic fine structure, and distance
requirements of cis elements mediating light responsiveness of the parsley chalcone synthase promoter. Proc
Natl Acad Sci USA 87:5387-5391 (1990).
2. Bol JF, Linthorst HJM, Cornelissen BJC: Plant pathogenesis-related proteins induced by virus infection. Annu
Rev Phytopath 28:113-138 (1990).
3. Brederode FTh, Linthorst HJM, Bol JFM: Differential
induction of acquired resistance and PR gene expression
in tobacco by virus infection, ethephon treatment, UV
light, and wounding. Plant Mol Biol 17:1117-1125
(1991).
4. Broglie KE, Biddle P, Cressman R, Broglie R: Functional
analysis of DNA sequences responsible for ethylene regulation of a bean chitinase gene in transgenic tobacco.
Plant Cell 1:599-607 (1989).
5. Cass KG, Kirven A, Chrisoffersen RE: Isolation and
characterization of a cellulases gene family member expressed during avocado fruit ripening. Mol Gen Genet
223:76-86 (1990).
6. Cordes S, Deikman J, Margosian LJ, Fisher RL: Interaction of a developmentally regulated DNA-binding factor with sites flanking two different fruit-ripening genes
from tomato. Plant Cell 1:1025-1034 (1989).
7. Deikman J, Fischer RL: Interaction of a DNA binding
factor with the 5' flanking region of an ethylene responsive fruit ripening gene from tomato. EMBO J 7:33153320 (1988).
8. Deikman J, Kline R, Fischer RL: Organization of ripening and ethylene regulatory regions in a fruit-specific promoter from tomato (Lycopersicon esculentum). Plant
Physiol 100:2013-2017 (1993).
9. DeLisle AJ, Fed RJ: Characterization &the Arabidopsis
Adh G-box binding factor. Plant Cell 2:547-557 (1990).
10. Donald RGK, Cashmore AR: Mutation of either G box
or I box sequences profoundly affects expression from the
Arabidopsis rbcs-IA promoter. EMBO J 9:1717-1726
(1990).
11. Eyal Y, Fluhr R: Cellular and molecular biology of
pathogen-related proteins. Oxf Surv Plant Mol Cell Biol
7:223-254 (1991).
12. Eyal Y, Sagee O, Fluhr R: Dark-induced accumulation of
a basic pathogenesis-related (PR-1) transcript and a light
requirement for its induction by ethylene. Plant Mol Biol
10:589-599 (1992).
13. Eyal Y, Meller Y, Lev-Yadun S, Fluhr R: A basic-type
PR-1 promoter directs ethylene responsiveness, vascular
and abscission zone-specific expression. Plant J, in press
(1993).
14. Ferl RJ, Laughner BH: In vivo detection of regulatory
factor binding sites ofArabidopsis thaliana Adh. Plant Mol
Biol 12:357-356 (1989).
15. Giuliano G, Pichersky E, Malik VS, Timko MP, Scolnik
PA, Cashmore AR: An evolutionary conserved protein
binding sequence upstream of a plant light-regulated gene.
Proc Natl Acad Sci USA 85:7089-7093 (1988).
16. Horsch RB, Fry JE, Hoffmann NL, Eichholtz D, Rogers
SG, Fraley RT: A simple and general method for
transferring genes into plants. Science 227:1229-1231
(1985).
463
17. Jefferson RA, Kavanagh TA, Bevan MW: GUS fusions:
fl-glucuronidase as a sensitive and versatile gene fusion
marker in higher plants. EMBO J 6:3901-3907 (1987).
18. Kieber JJ, Rothenberg M, Roman G, Feldmann KA,
Ecker JR: CTR1, a negative regulator of the ethylene
response pathway in Arabidopsis, encodes a member
of the Raf family of protein kinases. Cell 72:427-441
(1993).
19. Lanahan MB, Ho T-HD, Rogers SW, Rogers JC: A gibberellin response complex in cereal a-amylase gene promoters. Plant Cell 4:203-211 (1992).
20. Linthorst HJM: Pathogenesis-related proteins of plants.
Crit Rev Plant Sci 10:123-150 (1991).
21. Lotan T, Ori N, Fluhr R: Pathogenesis-related proteins
are developmentally regulated in tobacco flowers. Plant
Cell 1:881-887 (1989).
22. Maniatis T, Fritsch EF, Sambrook J: Molecular Cloning:
A Laboratory Manual, 2nd ed. Cold Spring Harbor
Laboratory, Cold Spring Harbor, NY (1989).
23. McKendree WL, Paul A-L, DeLisle AJ, Fed RJ: In vivo
and in vitro characterization of protein interactions with
the dyad G-box of the Arabidopsis Adh gene. Plant Cell 2:
207-214 (1990).
24. Memelink J, Linthorst HJM, Schilperoort RA, Hoge
JHC: Tobacco genes encoding acidic and basic isoforms
of pathogenesis-related proteins display different expression patterns. Plant Mol Biol 14:119-126 (1990).
25. Mundy J, Yamagushi-Shinozaki K, Chua N-H: Nuclear
proteins bind conserved elements in the abscissic acidresponsive promoter of a rice tab gene. Proc Natl Acad
Sci USA 87:1406-1410 (1990).
26. O'Brien T, Bell FD, Smith H: De-etiolation and plant
hormones. In: Pharis RP, Reid DM (eds) Encyclopedia
of Plant Physiology New Series Vol 11. Hormonal Regulation of Development III, pp. 282-307. Springer-Verlag,
Berlin (1985).
27. Oeda K, Salinas J, Chua N-H: A tobacco bZip transcription activator (TAF-1) binds to a G-box-like motif conserved in plant genes. EMBO J 10:1793-1802 (1991).
28. Parker CS, Topol J: A Drosophila RNA polymerase I1
transcription factor contains a promoter region specific
DNA-binding activity. Cell 36:357-369 (1984).
29. Raghothama KG, Lawton KA, Goldsbrough PB, Woodson WR: Characterization of an ethylene-regulated flower
senescence-related gene from carnation. Plant Mol Biol
17:61-71 (1991).
30. Raz V, Fluhr R: Calcium requirement for ethylenedependent responses. Plant Cell 4:1123-1130 (1992).
31. Raz V, Fluhr R: Ethylene responsiveness is transduced
via phosphorylation events in the plants. Plant Cell, in
press (1993).
32. Roby D, Broglie K, Gaynor J, Broglie R: Regulation of
a chitinase gene promoter by ethylene and elicitors in
bean protoplasts. Plant Physiol 97:433-439 (1991).
33. Rogers JC, Rogers SW: Definition and functional implications of gibberellin and abscissic acid cis-acting hormone response complexes. Plant Cell 4:1443-1451
(1992).
34. Schindler U, Cashmore AR: Photoregulated gene expression may involve ubiquitous DNA binding proteins.
EMBO J 9 : 3 4 1 5 - 3 4 2 7 (1989).
35. Schulze-Lefert P, Dangl JL, Becker-Andr6 M, Hahlbrock
K, Schulze W: Inducible in vivo DNA footprints define
sequences necessary for UV light activation of the parsley chalcone synthase gene. EMBO J 8:651-656 (1989).
36. Staiger D, Kaulen H, Schell J: A CACGTG motif of the
Antirrhinum majus chalcone synthase promoter is recognized by an evolutionary conserved nuclear protein. Proc
Natl Acad Sci USA 86:6930-6934 (1989).
37. Staiger D, Becker F, Schell J, Koncz C, Palme K: Purification of tobacco nuclear proteins binding to CACGTG
motif of the chalcone synthase promoter by DNA affinity chromatography. EurJ Biochem 199:519-527 (1991).
38. Van Loon LC, Gerritsen YAM, Ritter CE: Identification,
purification and characterization of pathogenesis-related
proteins from virus-infected Samsun NN tobacco leaves.
Plant Mol Biol 9:593-609 (1987).
39. Watson JC, Thompson WF: Purification and restriction
endonucleases analysis of plant nuclear DNA. Meth Enzymol 118:57-75 (1986).
40. Weisshaar B, Armstrong GA, Block A, da Costa e Silva
O, Hahlbrock K: Light inducible and constitutively expressed DNA-binding proteins recognizing a plant promoter element with functional relevance in light responsiveness. EMBO J 10:1777-1786 (1991).
41. Williams ME, Foster R, Chua N-H: Sequences flanking
the hexameric G-box core CACGTG affect the specificity of protein binding. Plant Cell 4:485-496 (1992).