Arch Environ Contam Toxicol (2008) 55:348–357
DOI 10.1007/s00244-007-9128-8
The Effects of Microbial Materials Adhered to Asian Sand Dust
on Allergic Lung Inflammation
T. Ichinose Æ S. Yoshida Æ K. Hiyoshi Æ K. Sadakane Æ H. Takano Æ
M. Nishikawa Æ I. Mori Æ R. Yanagisawa Æ H. Kawazato Æ A. Yasuda Æ
T. Shibamoto
Received: 31 August 2007 / Accepted: 26 December 2007 / Published online: 29 January 2008
Ó Springer Science+Business Media, LLC 2008
Abstract Asian sand dust (ASD) containing microbiological materials, sulfate (SO24), and nitrate (NO3 ) derived
from air pollutants in East China, reportedly cause adverse
respiratory health effects. ASD aggravates ovalbumin
(OVA)-associated experimental lung eosinophilia. In this
study, the toxic materials adsorbed onto ASD were excluded by heat treatment at 360°C for 30 min. The effects of
nonheated ASD or heated ASD (H-ASD) toward the
allergic lung inflammation were compared in murine lungs.
ICR mice were administered intratracheally with normal
saline (control), H-ASD, ASD, OVA, OVA + H-ASD, and
OVA + ASD, four times at 2-week intervals. ASD only
increased neutrophils in bronchoalveolar lavage fluids
(BALFs) along with pro-inflammatory mediators, such as
keratinocyte chemoattractant (KC). H-ASD and ASD
enhanced eosinophil recruitment induced by OVA in the
alveoli and in the submucosa of the airway, which has a
goblet cell proliferation in the bronchial epithelium. The
two ASDs synergistically increased interleukin-5 (IL-5),
monocyte chemotactic protein-3 (MCP-3), and eotaxin,
which were associated with OVA, in BALF. The enhancing
effects were much greater in ASD than in H-ASD. The two
ASDs induced the adjuvant effects to specific IgE and IgG1
production by OVA. In the in vitro study using RAW264.7
cells, ASD increased the expression of Toll-like receptor 2
(TLR 2) mRNA but not TLR4 mRNA. H-ASD caused no
expression of either TLR mRNA. These results suggest that
the aggravated lung eosinophilia by ASD may be due to
activation of Th2-associated immune response via the
activation of TLR2 by microbial components adhered to
ASD.
T. Ichinose S. Yoshida K. Hiyoshi K. Sadakane
Department of Health Sciences, Oita University of Nursing and
Health Sciences, Notsuharu, Oita, Japan
Asian dust storms occur in arid and semi-arid areas of middle
and northwestern China (the Gobi Desert and the Ocher
Plateau) during the spring season. Asian sand dust (ASD)
aerosol spreads over large areas, including East China, the
Korean Peninsula, and Japan. Sometimes the aerosol is
transported across the Pacific Ocean to the United States
(Duce et al. 1980; Kim et al. 2001; Husar et al. 2001). ASD
contains various chemical species such as sulfate (SO24 ) or
nitrate (NO3 ) derived from alkaline soil, which captures acid
gases, such as sulfur oxides (SO2) and nitrogen oxides (NO2)
(Choi et al. 2001; Mori et al. 2003). These gases are
by-products formed from coal and other fossil fuels combusted in industrialized eastern China. ASD also contains
microbiological materials (Ichinose et al. 2005).
Therefore, respiratory health effect caused by ASD
events originating in the deserts of China has become a
H. Takano R. Yanagisawa
Pathophysiology Research Team, National Institute for
Environmental Studies, Tsukuba, Ibaraki, Japan
M. Nishikawa I. Mori
Environmental Chemistry Division, National Institute for
Environmental Studies, Tsukuba, Ibaraki, Japan
H. Kawazato A. Yasuda
Faculty of Medicine, Oita University, 1-1 Idaigaoka,
Hasama-machi, Oita 879–5507, Japan
T. Shibamoto (&)
Department of Environmental Toxicology, University of
California, One Shields Avenue, Davis, CA 95616, USA
e-mail: [email protected]
123
Arch Environ Contam Toxicol (2008) 55:348–357
serious concern in China and her neighboring countries.
Epidemiologic studies have shown that ASD events are
associated with cardiovascular and respiratory problems
and an increase in daily mortality in Seoul, Korea (Kwon
et al. 2002), and Taipei, Taiwan (Chen et al. 2004; Chen
and Yang 2005). Recent epidemiologic studies have shown
that Asian dust storm events coincide with an increase in
daily admissions and clinic visits for asthma (Yang et al.
2005), allergic rhinitis (Chang et al. 2006) or conjunctivitis
(Yang 2006) in Taipei, Taiwan. Therefore, experimental
studies to confirm the epidemiological results that report
adverse respiratory health effects caused by ASD during a
dust storm event are in order.
In recent experimental studies, we reported the toxic
effects of ASD to murine lungs (Ichinose et al. 2005) and
the aggravating effect of ASD on allergen-induced eosinophilic inflammation in the murine airway (Hiyoshi et al.
2005; Ichinose et al. 2006). However, it is not clear what
kind of organic substances (microbiological materials,
sulfate, etc.) or inorganic components (mineral elements)
in ASD are involved in the aggravating effect on the
allergic inflammation.
In the present study, the aggravating effects of ASD
excluded toxic materials (microbiological materials, sulfate, etc.) by heating and crude ASD on the allergic
inflammation were compared in the murine lungs. On the
other hand, Toll-like receptors (TLRs) in antigen presenting cells are well known to lead to the induction of
adaptive immune responses through the recognition of
microbial components (Beutler 2004). In the in vitro
study, the expression of TLR2 and TLR4 mRNA in
RAW264.7 cells was measured in the presence of heated
ASD (H-ASD) and ASD.
Materials and Methods
349
Preparation of Particles
ASD used in the present study was collected from surface
soils in the Shapotou Desert located on the southern fringe
of the Tengger Desert, where dust storms occur frequently
in north central China (Hiyoshi et al. 2005). The particle
diameter of the samples (a total of 600 particles) was
measured under a scanning electron microscope (JSM5800 JEOL Ltd., Tokyo). The size distribution peak was
observed at 6 lm. ASD was heated at 360°C for 30 min
under 80% nitrogen gas in an electric heater to exclude
toxic materials (microbiological materials, sulfate, etc.)
adhered to the ASD.
Analysis of Sulfate, Nitrate and Elements,
Lipopolysaccharide, and b-Glucan in Particles
Sulfate (SO24 ) and nitrate (NO3 ) in the samples were
analyzed using an ion chromatograph (DX-100; Dionex,
Sunnyvale, CA, USA). The concentration of each element
was determined by inductively coupled plasma atomic
emission spectroscopy (ICP-AES, 61E Trace, and ICP-750,
Thermo Jarrell-Ash, Grand Junction, MA). The contents of
LPS and b-glucan in each particle sample were measured
by kinetic assay using the Endospec ES test MK (Seikagaku Corp., Tokyo) for LPS activity and Fungitec
GtestMK (Seikagaku Corp.) for b-glucan activity, according to the manufacturer’s protocol. In brief, approximately
2.5 mg of each particle sample was suspended in 1 ml of
water (LPS- and b-glucan-free; Otuka Co., Kyoto, Japan)
for 1 h and placed on the bench top at room temperature for
2 h. The supernatants were then recovered and tested for
LPS and b-glucan concentration. The limits of detection in
LPS and b-glucan assays were\0.001 EU/ml and 2 pg/ml,
respectively.
Animals
Study Protocol
A total of 96 male ICR mice (5 weeks of age) were purchased from Charles River Japan, Inc. (Kanagawa, Japan).
After body weight and absence of infection were checked
for 1 week, mice were used at 6 weeks of age. They were
fed a commercial diet CE-2 (CLEA Japan, Inc., Tokyo)
and given water ad libitum. Mice were housed in plastic
cages lined with soft wood chips. The cages were placed in
a conventional room, which was air-conditioned at 23°C
and 55–70% humidity, with a 12/12-h light/dark cycle. The
study adhered to the US National Institutes of Health
guidelines for the use of experimental animals. The animal
care method was approved by the Animal Care and Use
Committee at Oita University of Nursing and Health Sciences in Oita, Japan.
ICR mice were divided into six groups (n = 16) according
to treatment with two kinds of ASD: saline, ovalbumin
(OVA) alone, H-ASD alone, crude ASD (ASD) alone,
OVA + H-ASD, and OVA + ASD. These particles were
suspended in normal saline (0.9% NaCl) for instillation
(Otsuka Co., Kyoto, Japan). This suspension was sonicated
for 5 min with an ultrasonic disrupter, UD-201 type with
micro tip (Tomy, Tokyo), under cooling conditions. OVA
was dissolved in the same saline. The instillation dose of
particles was 0.1 mg per mouse according to a previously
reported protocol (Hiyoshi et al. 2005). A maximum
deposition of approximately 30 lg into the lungs of a single
mouse equals 100% deposition according to the Japanese
123
350
national air quality standard for suspended particulate
matter (0.1 mg/m3) to be acculumulated in the lungs of one
mouse per week (deposition efficiencies calculated by tidal
volume, 0.15 ml per mouse, and breathing rate, 200 breaths
per minute). The instillation dose (0.1 mg per mouse) of
particles in the present study was 3.3 times that amount.
However, the deposition rate into an alveoli, in the case of
the Human Respiratory Tract Model for Radiological
Protection (James et al. 1994), is approximately 3% at 5.5lm particle diameter. The instillation dose of particles in
the present study was 111 times the amount of approximately 0.9 lg in the case of 3% deposition. The instillation
dose of OVA was set to 1 lg per mouse according to the
method described in a previous report (Hiyoshi et al.
2005). Mice were intratracheally instilled with these particles through a polyethylene tube under anesthesia with
4% halothane (Takeda Chemical, Osaka, Japan). The
control mice were instilled intratracheally with 0.1 ml of
normal saline (Otsuka Co., Kyoto) per mouse, and with
0.1 ml containing 1 lg OVA mixed with or without 0.1 mg
particle per mouse. Asian dust storms with the ASD aerosol
intermittently come flying over Japan during March and
April (2 months). Intratracheal instillation of OVA repeated four times at 2-week intervals is needed for the
induction of allergic lung inflammation (Hiyoshi et al.
2005; Ichinose et al. 2006). Therefore, this repeated
instillation method was chosen to investigate the aggravating effect of ASD on allergen-related lung eosinophilia.
One day after the last intratracheal administration, the mice
from all groups were killed by exsanguination under deep
anesthesia by i.p. injection of pentobarbital at 12 weeks of
age.
Arch Environ Contam Toxicol (2008) 55:348–357
with PAS; mild, as 20% to 30% of the airway; moderate, as
40% to 50%; moderate to marked, as 60% to 70%; and
marked, as more than 80% of the airway (Ichinose et al.
2003; Hiyoshi et al. 2005; Ichinose et al. 2006). The
remaining eight mice were used for examination of free
cell contents from bronchoalveolar lavage fluids (BALFs).
BALF and cell counts were conducted by a previously
reported method (Hiyoshi et al. 2005; Ichinose et al. 2006).
The BAL supernatants were stored at –80°C until analysis
for cytokines and chemokines.
Quantitation of Cytokines, Chemokines, and Lactate
Dehydrogenase in BALF
The cytokine protein levels in BALF were determined
using enzyme-linked immunosorbent assays (ELISA).
Interleukin (IL)-5, IL-12, interferon (IFN)-c, and tumor
necrosis factor (TNF)-a were measured using an ELISA kit
from Endogen, Inc. (Cambridge, MA). Keratinocyte chemoattractant (KC), monocyte chemotactic protein (MCP)1, macrophage inflammatory protein (MIP)-1a, regulated
on activation of normal T cells expressed and presumably
secreted (RANTES), IL-13, and eotaxin were measured
using an ELISA kit from R&D Systems Inc. (Minneapolis,
MN). Monocyte chemotactic protein (MCP)-3 was measured using an ELISA kit from Bender MedSystems Inc.
(Burlingame, CA). Lactate dehydrogenase (LDH) was
measured using a LDH C II-Test from Wako Chemicals,
Ltd. (Osaka, Japan).
Antigen-specific IgE and IgG1Antibodies
Pathological Evaluation and Bronchoalveolar Lavage
Eight of 16 mice from each group were used for pathologic
examination. The lungs were fixed by 10% neutral phosphate-buffered formalin and stained with hematoxylin and
eosin (H&E) to evaluate the degree of infiltration of eosinophils or lymphocytes in the airway from proximal to
distal. The lung samples also were stained with periodic
acid-shiff (PAS) to evaluate the degree of proliferation of
goblet cells in the bronchial epithelium. Pathological
analysis of inflammatory cells and epithelial cells in the
airway was performed using a Nikon ECLIPES light
microscope (Nikon Co., Tokyo). The degree of infiltration
of eosinophils and lymphocytes in the airway or proliferation of goblet cells in the bronchial epithelium was graded
accordingly: (0) not present; (1) slight; (2) mild; (3)
moderate; (4) moderate to marked; and (5) marked. Slight
was defined as less than 10% of the airway with eosinophilic inflammatory reaction or with goblet cells stained
123
OVA-specific IgE and IgG1 antibodies were measured using
the Mouse OVA-IgE ELISA kit and Mouse OVA-IgG1
ELISA kit (Shibayagi Co., Shibukawa, Japan). Absorption
at 450 nm (sub-wave length, 620 nm) for OVA-specific IgE
and IgG1antibodies was measured using a microplate reader
(SPECTRAFluor,; TECAN, Salzburg, Austria).
In vitro Study for Measurement of Toll-like Receptors
(TLR2 and TLR4)
RAW264.7 cells, which are macrophage-like cells derived
from BALB/c male mice, were cultured at 37°C in a
humidified atmosphere of 5% CO2–95% air and maintained
in Dulbecco’s modified Eagle’s medium with 10% heatinactivated fetal bovine serum (FBS). They were plated at a
concentration of 4 9 105 cells per 60-mm dish, and then
ASD with or without heating treatment was added to cells
to give a final concentration of 30 lg/ml for 3 h.
Arch Environ Contam Toxicol (2008) 55:348–357
351
Gene Expression Analysis
Total RNA was extracted by standard procedures using
0.5 ml of Isogen (Nippon Gene) per dish. After DNase
treatment of the total RNA, cDNA was synthesized by
reverse transcription using M-MLV. Quantitative PCR was
performed using an ABI Prism 7000 Sequence Detection
System (ABI) under the same conditions as in our previous
study (Yoshida et al. 2006). Two wells were used for each
sample. The relative expression of each sample was calculated as the mean value divided by the mean value for
GAPDH. The following primers and probes were used:
GAPDH sense, TGCACCACCAACTGCTTAG; GAPDH
antisense, GGAT GCAGGGATGATGTTC; GAPDH probe,
CAGAAGACTGTGGATGGCCCCTC;
TLR2
sense,
GAATTGCATCAC CGGTCAGAA; TLR2 antisense,
CTGAGCAGA
ACAGCGTTTGC;
TLR2
probe,
CGTCAAATCTCAGAGGATGCTACGAGC;
TLR4
sense, AGGACTCTGATCA TGGCACTGTT; TLR4 antisense, GAGTTTCTGATC CATGCATTGG; and TLR4
probe, CCAGGAAGCTTGAATCCCTGCATAGAGG.
500 lg/g in ASD and also nondetectable in H-ASD samples. The amounts of LPS and b-glucan in both samples
were consistent. The contents of elements with oxide were
60% for SiO2, 11.1% for Al2O3, 4.1% for Fe2O3, 1.8% for
Na2O, 9.0% for CaO, 2.5% for MgO, 0.7 for TiO2, 2.2%
for K2O, and 8.6% for loss on ignition.
Enhancement of Pathologic Changes in the Airway by
ASDs
Statistical analyses of the pathologic evaluation in the airway, and cytokine and chemokine proteins in BALF, were
conducted using Fisher’s protected least significant difference (PLSD) test in ANOVA (Statview, Abacus Concepts,
Inc., Berkeley, CA). Differences among groups were
determined as statistically significant at a level of p\0.05.
ASD alone caused bronchitis, alveolitis, and a slight
accumulation of lymphocytes in the submucosa (Fig. 1c)
of the airway (Table 2). These pathological changes were
very slight in H-ASD samples. Treatment with OVA alone
caused slight infiltration of eosinophils and lymphocytes
in the submucosa of the airway, with slight goblet cell
proliferation in the bronchial epithelium (Fig. 1d).
OVA + H-ASD and OVA + ASD caused moderate to
marked eosinophil infiltration in the airway (Figs. 1e and
f). The changes were significantly different (p \ 0.001)
from those with OVA or sand dust alone. The magnitude
of eosinophil infiltration was higher in OVA + ASD than
in OVA + H-ASD. OVA + H-ASD and OVA + ASD
also caused moderate to marked accumulation of lymphocytes in the airway (Figs. 1e and f). The degree of
accumulation was higher in OVA + ASD than in
OVA + H-ASD. OVA + H-ASD (Fig. 1e) and OVA +
ASD (Fig. 1f) increased proliferation of goblet cells
(p \ 0.001) in the airway compared with OVA or sand
dust alone.
Results
Enhancement of Cell Numbers in BALF by ASDs
Contents of Sulfate, Nitrate, LPS, b-Glucan, and
Elements in ASDs
Table 3 reports the cellular profile in BALF. ASD significantly increased the cell number of neutrophils
(p \ 0.001) compared with the control, but H-ASD did
not. The increased level by ASD was constant with the
increased level by OVA + ASD. OVA + H-ASD significantly increased the cell number compared with H-ASD
alone (p \ 0.001). H-ASD, ASD, and OVA alone caused
no significant increases in eosinophils compared with the
control. OVA + H-ASD and OVA + ASD caused synergistic increases in eosinophil cell number compared
with H-ASD, ASD, or OVA alone (p \ 0.001). OVA +
ASD caused a 2.3-fold increase in the eosinophil cell
number compared with OVA + H-ASD. H-ASD, ASD,
or OVA alone caused no significant increases in lymphocytes compared with the control. The combination
treatment with OVA synergistically increased the lymphocyte cell number compared with single treatment
(p \ 0.001).
Statistical Analysis
Table 1 lists concentrations of sulfate, nitrate, elements,
LPS, and b-glucan in the sand dusts. The concentrations of
SO24 were 900 lg/g in ASD samples and nondetected in
H-ASD samples. The concentrations of NO-3 were less than
Table 1 Contents of sulfate (SO24 ), nitrate (NO3 ), lipopolysaccharide (LPS), and b-glucan in ASD
Particle
SO24
(lg/ g)
NO3 (lg/ g)
LPS
(EU/mg)
b-Glucan
(pg/mg)
ASD
900
\500
3.66
15.20
H-ASD
ND
ND
ND
ND
Note: ND, not detected; ASD, crude ASD collected from the
Shapotou Desert in north-central China; H-ASD, ASD heated at
360°C for 30 min under 80% nitrogen gas in an electric heater
123
352
Arch Environ Contam Toxicol (2008) 55:348–357
Fig. 1 Effects of Asian sand dust (with or without heat treatment) on
pathological changes in the lungs. (A) No pathological changes in
lungs treated with saline. (B) Slight infiltration of lymphocytes in the
connective tissue around the airway treated with Asian sand dust with
heat treatment. (C) Slight proliferation of epithelial cells in the airway
treated with crude Asian sand dust. (D) Slight proliferation of goblet
cells that have mucus stained pink with PAS solution in the airway
epithelium and slight infiltration of inflammatory cells into connective
tissue around the airway treated with OVA alone. (E) Moderate
proliferation of goblet cells in the airway and moderate infiltration of
eosinophils and lymphocytes into connective tissue around the airway
treated with OVA + H-ASD. (F) Marked proliferation of goblet cells
in the airway and numerous eosinophils and lymphocytes in the
lamina propria of the airway treated with OVA + ASD. (PAS; A–F,
9–50)
Table 2 Evalution of pathologic changes in the murine airway
Group
No. of animals
Pathologic change
Lymphocytes
Eosinophils
Proliferation of goblet cells
Control
8
0.25 ± 0.16
0
0
H-ASD
8
0.50 ± 0.23
0
0
ASD
8
1.75 ± 0.13
0.13 ± 0.08
8
OVA
OVA + H-ASD
1.31 ± 0.25
§II
8
OVA + ASD
3.13 ± 0.23
§}
8
3.63 ± 0.13
0.25 ± 0.13
0.88 ± 0.32
1.00 ± 0.33
3.00 ± 0.26
§II
2.94 ± 0.31§II
3.69 ± 0.13
§}
3.50 ± 0.10§}
Note: Six groups of mice were treated intratracheally with normal saline (control), H-ASD (heated Asian sand dust), ASD (crude Asian sand
dust), ovalbumin (OVA), OVA + H-ASD, and OVA + ASD four times at 2-week intervals. Lung tissues were taken 24 h after the last
intratracheal instillation. All values are expressed as mean ± SE. p \ 0.01 versus control. p \ 0.001 versus control. § p \ 0.001 versus OVA.
II
p \ 0.001 versus H-ASD. } p \ 0.001 versus ASD
Table 3 Cellular profile in bronchoalveolar lavage fluids (BALFs)
Group
No. of animals
No. of cells (9104/total BALF)
Total cells
Macrophages
Eosinophils
Neutrophils
0
Lymphocytes
Control
8
18.0 ± 1.20
17.7 ± 1.24
0.24 ± 0.07
0.10 ± 0.04
H-ASD
ASD
8
8
30.3 ± 1.98
60.6 ± 4.77
27.4 ± 3.92
19.6 ± 0.86
0.01 ± 0.01
0.91 ± 0.42
2.58 ± 0.86
39.4 ± 4.15
0.32 ± 0.09
0.99 ± 0.17
0.63 ± 0.11
OVA
8
28.6 ± 3.55
23.3 ± 2.67
2.17 ± 0.74
2.57 ± 1.08
OVA + H-ASD
8
81.3 ± 16.5§}
41.1 ± 7.13II
13.0 ± 3.35§}
21.4 ± 6.27§}
OVA + ASD
8
§
132 ± 5.90 **
§
53.3 ± 4.15 **
§
29.9 ± 3.19 **
39.4 ± 2.07
§
5.81 ± 1.18§}
9.19 ± 1.10§**
Note: Six groups of mice were treated intratracheally with normal saline (control), H-ASD (heated Asian sand dust), ASD (crude Asian sand
dust), ovalbumin (OVA), OVA + H-ASD, and OVA + ASD, four times at 2-week intervals. Bronchoalveolar lavage (BAL) was conducted
24 h after the last intratracheal instillation. All values are expressed as mean ± SE. p \ 0.001 versus control. p \ 0.01 versus OVA. §
p \ 0.001 versus OVA. II p \ 0.01 versus H-ASD. } p \ 0.001 versus H-ASD. ** p \ 0.001 versus ASD
123
Arch Environ Contam Toxicol (2008) 55:348–357
353
Table 4 Expression of cytokines in bronchoalveolar lavage fluid (BAL)
Group
No. of animals
Cytokines (pg protein/total BAL supernatants)
IL-5
IL-12
IL-13
IFN-c
TNF-a
Control
8
2.16 ± 0.69
116 ± 28.0
0
104 ± 20.8
58.2 ± 5.21
H-ASD
8
3.35 ± 0.63
122 ± 18.5
0
311 ± 93.6
78.4 ± 22.0
ASD
8
9.56 ± 1.86
807 ± 90.6
0
604 ± 122
74.3 ± 5.07
OVA
8
36.8 ± 18.8
174 ± 25.7
1.04 ± 0.95
640 ± 87.9
64.6 ± 13.5
OVA + H-ASD
8
159 ± 47.8I
307 ± 65.0}
10.7 ± 3.87§}
602 ± 88.0}
35.0 ± 5.03**
OVA + ASD
8
219 ± 27.3II§§
762 ± 79.0II
25.9 ± 6.07II§§
580 ± 77.6
23.5 ± 4.82§
Note: Six groups of mice were treated intratracheally with normal saline (control), H-ASD (heated Asian sand dust), ASD (crude Asian sand
dust), ovalbumin (OVA), OVA + H-ASD, and OVA + ASD, four times at 2-week intervals. BAL was conducted 24 h after the last intratracheal instillation. All values are expressed as mean ± SE. p \ 0.05 versus control. ** p \ 0.01 versus H-ASD. p \ 0.001 versus control. p \ 0.001 versus H-ASD. § p \ 0.05 versus OVA. p \ 0.01 versus ASD. II p \ 0.001 versus OVA. §§ p \ 0.001 versus ASD. } p \ 0.05
versus H-ASD
Table 5 Expression of chemokines in bronchoalveolar lavage fluid (BAL)
Group
No. of animals
Chemokines (pg protein/total BAL supernatants)
KC
RANTES
MIP-1a
Eotaxin
MCP-1
MCP-3
Control
8
0
0
0.86 ± 0.47
0.33 ± 0.20
1.65 ± 0.55
0
H-ASD
8
25.2 ± 9.44
0.33 ± 0.31
18.8 ± 4.44
1.28 ± 0.50
3.73 ± 0.98
1.28 ± 0.98
ASD
8
645 ± 82.7§
31.8 ± 4.48§
46.4 ± 6.47§
2.54 ± 0.68
150 ± 29.5
56.6 ± 16.8
OVA
8
8.93 ± 6.95
0.77 ± 0.48
0.23 ± 0.17
3.89 ± 1.69
4.21 ± 1.47
17.2 ± 8.40
OVA + H-ASD
8
214 ± 39.4II**
5.48 ± 2.88
8.65 ± 1.63
24.1 ± 9.76II**
133 ± 41.6
155 ± 68.4}
OVA + ASD
8
§}
543 ± 101
§}
25.0 ± 4.88
§}
30.3 ± 5.74
78.3 ± 13.3
§}
§}
757 ± 125
1224 ± 311§}
Note: Six groups of mice were treated intratracheally with normal saline (control), H-ASD (heated Asian sand dust), ASD (crude Asian sand
dust), ovalbumin (OVA), OVA + H-ASD, and OVA + ASD, four times at 2-week intervals. BAL was conducted 24 h after the last intratracheal instillation. All values are expressed as mean ± SE. p \ 0.05 versus control. ** p \ 0.05 versus H-ASD. p \ 0.01 versus control. p \ 0.01 versus ASD. § p \ 0.001 versus control. p \ 0.001 versus ASD. II p \ 0.05 versus OVA. } p \ 0.001 versus OVA
Induction of Cytokines and Chemokines in BALF by
ASDs
ASD significantly increased protein levels of IL-12, IFN-c,
KC, RANTES, and MIP-1a (p \ 0.001) in BALF (Tables 4
and 5) in reference to the control, but H-ASD did not except
for MIP-a. Each increased level was constant with the
increased level of OVA + ASD. On the other hand,
OVA + H-ASD significantly increased IL-12, IFN-c, and
KC (p \ 0.05) compared with H-ASD alone. OVA +
H-ASD and OVA + ASD synergistically increased protein
levels of eosinophil relevant cytokines, chemokines, such as
IL-5 and IL-13, eotaxin, MCP-1, and MCP-3, in BALF
(Tables 4 and 5) compared with each single treatment.
OVA + ASD caused increases of 1.38-fold by IL-5, 2.42fold by IL-13, 3.45-fold by eotaxin, 5.69-fold by MCP-1,
and 7.90-fold by MCP-3 compared with OVA + H-ASD.
The values of LDH were 4.59 ± 0.86 IU/L (mean ± SD)
for control, 4.18 ± 0.95 IU/L for H-ASD, 6.31 ± 1.55
IU/L for ASD, 3.64 ± 1.01 IU/L for OVA, 4.83 ± 3.30
IU/L for OVA + H-ASD, and 22.28 ± 3.30 IU/L for
OVA + ASD. OVA + ASD significantly increased LDH
(p \ 0.001) in BALF compared with the control.
Enhancement of OVA-specific IgE and IgG1 in Serum
by ASDs
OVA + H-ASD and OVA + ASD significantly increased
OVA-specific IgE and IgG1 antibodies (p \ 0.001) compared with OVA alone (Fig. 2). These antibodies were
higher in the OVA + ASD group than in the OVA + HASD group.
In vitro Analysis of TLR mRNA Expression in
RAW264.7 Cells
Figure 3 shows the expression of TLR2 and TLR4 mRNA
in RAW264.7 cells. ASD significantly increased the
expression of TLR2 mRNA compared with saline addition
(p \ 0.001). ASD significantly decreased the expression of
123
354
Arch Environ Contam Toxicol (2008) 55:348–357
Fig. 2 Effects of Asian dust
(with or without heat-treatment)
on OVA-specific IgE and IgG1
production in serum. Results are
expressed as mean ± SE of 16
mice including 8 mice for
pathological evaluation.
*p \ 0.001 vs control, H-ASD,
ASD, and OVA-control
Control
H-ASD
ASD
OVA
*
OVA+H-ASD
*
OVA+ASD
*
0
500
*
0
1000
OVA-specific IgE ( mU/ml)
TLR4 mRNA (p \ 0.001). H-ASD caused no expression of
either TLR mRNA.
Discussion
Epidemiologic studies show that ambient particulates
PM2.5 (particle sizes \ 2.5 lm) and PM10 (particle sizes of
10–2.5 lm) are associated with an increase in hospital
admissions for asthma (Schwartz et al. 1993) as well as
development of respiratory symptoms in childhood asthma
(Romieu et al. 1996; Millign et al. 1998). The windborne
ASD with particles of PM10 levels containing microbiological materials, chemical species, such as SO24 and NO3
(Choi et al. 2001; Mori et al. 2003), may cause serious
respiratory health problems in humans. This study demonstrated that toxic materials, such as organic substances
(microbiological materials), adsorbed on ASD contribute to
the enhancement of the lung eosinophilia, related to
allergen.
Macrophages
Beta-glucan
Peptidoglycan
TLR2
H-ASD
*
30
MCP-3 secretion
Epithelial cells
Eosinophils
adsorbed onto ASD
ASD
20
Crude ASD has been shown to cause bronchitis and
alveolitis. However, H-ASD toxic materials (microbiological materials, sulfate, etc.) excluded by heat treatment
caused very slight pathological changes. ASD and H-ASD
enhanced OVA-associated eosinophilic inflammation in the
alveoli and the airway with goblet cell proliferation along
with the production of OVA-specific IgE and IgG1.
OVA causes slight proliferation of goblet cells and
infiltration of eosinophils and lymphocytes in the airway,
which are the pathological correlates seen in human
asthma. The transformation of airway epithelial cells to
goblet cells by OVA in the nonheated ASD group and the
H-ASD group correlated with the amount of eosinophils
introduced into the submucosa of the airway. Eosinophils
caused epithelial injury and hyperresponsiveness of the
airway upon releasing mediators, including platelet-activating factors, reactive oxygen radicals, leukotrienes, and
major basic proteins (Gleich 1990). Therefore, injury to
airway epithelials along with goblet cell proliferation may
be induced by the activated eosinophils. The aggravating
Antigen + ASD
Control
10
OVA-specific IgG1 (U/ml)
Eotaxin
secretion
IL-5 secretion
Transmission
Silica
Eosinophil recruitment
and activation
IL-13 secretion
Th2-lymphocyte
Phagocytosis
Control
TLR4
H-ASD
TLR-2 activation
Ig E and Ig G1
production
Macrophages
Transmission
ASD
*
0
IL-12
0.1
Relative mRNA expression (Target/GAPDH)
Fig. 3 Effects of Asian dust (with or without heat treatment) on
TLR2 and TLR4 mRNA (relative to GAAPDH mRNA) in RAW264.7
mouse macrophage cells. Results are expressed as mean ± SE of
quadruplicate experiments. *p \ 0.001 vs control and H-ASD
123
Aggravation of
eosinophilic lung
inflammation
IFN-γ secretion
Th1-lymphocyte
KC IL-8)
ASD alone
MIP-1α
TNF-α
Macrophages
activation
Lung
injury
Neutrophil activation
Fig. 4 Possible mechanism by which ASD alone causes lung injury
and leads to aggravated lung eosinophilia
Arch Environ Contam Toxicol (2008) 55:348–357
effects of ASD were greater than those in H-ASD. In a
previous study, we made experimental ASD with SO24 by
reacting a mixture of ASD and SO2 gas. ASD and
ASD + SO24 enhanced eosinophil recruitment induced by
OVA in the alveoli and in the submucosa of the airway.
However, a further increase in eosinophils by addition of
SO24 was not observed. We concluded that extra sulfate
did not contribute to increases in eosinophils in the airway
and BALF (Hiyoshi et al. 2005). It seems that chemical
species, such as sulfate and nitrate produced by sulfur
oxides (SO2) and nitrogen dioxides (NO2), in air pollutants
are not involved in the aggravating effects of allergic diseases. On the other hand, organic substances such as LPS
and b-glucan were adsorbed on the sand dust particles. LPS
is a glycolipid of gram-negative bacteria (Nikaido 1969)
and b-glucan is the major structural component of fungi
walls (Hearn and Sietsma 1994). Fungal spores, many
species of fungi (commonly known as molds), and bacteria
reportedly are included in Asian desert dusts (Shinn et al.
2003). The reduced effects of H-ASD on the pathological
changes could be due to excluding the toxic organic substances by heat treatment. Therefore, it seems that
microbiological materials adsorbed on ASD contribute to
development of bronchitis and alveolitis, and enhancement
of the lung eosinophilia, related to allergen.
The slight inflammatory response caused by H-ASD may
be due to inorganic components (mineral particles) since
mineral dusts, such as mineral fibers (crocidolite asbestos)
and quartz (crystalline silica), are known to cause cytotoxic
and genotoxic effects toward pneumocytes (Liu et al. 2000;
Schins et al. 2002). ASD used in the present study has a
mineral composition that includes montmorillonite, vermiculite, mica, gypsum, chlorite, kaolinite, calcite, feldspar,
and quartz (Quan et al. 1996). The major chemical inorganic
element in the ASD tested in this study was SiO2 (silica),
which was derived mainly from feldspar and quartz (Nishikawa et al. 2000). Quartz, an amorphous and crystalline
silica, has been reported to cause inflammatory responses
with the release of inflammatory cytokines in the lungs of
rats (Murphy et al. 1998; Ernst et al. 2002). Some previous
studies have reported that crystalline silica (standard quartz
DQ12 with particle size \ 5 lm) or amorphous silica
(Mancino and Ovary 1980; Mancino et al. 1984) is able to
stimulate in mice the production of IgE and IgG1 antibody
to a single 1-lg dose of ovalbumin, as does Al(OH)3. In this
study, the adjuvant effects of H-ASD toward OVA-specific
IgE and IgG1 production were detected. The aggravating
effects of H-ASD on the allergic inflammation in murine
lungs may be due to silica and quartz.
The various biological components in BALF may well
reflect an event in the lungs. ASD caused significant
increases in neutrophils along with their relevant chemokines, such as MIP-1a (Standiford et al. 1995), KC
355
(Akahoshi et al. 1994), RANTES (Pan et al. 2000), and
Th1 relevant cytokines, IL-12 (Hsieh et al. 1993) and
IFN-c (Adamthwaite and Cooley 1994), but H-ASD did
not, except for MIP-1a. Further increases in neutrophils
and these proinflammatory mediators by addition of OVA
were not observed in the OVA + ASD group. The neutrophilic inflammation along with these cytokines and
chemokines are induced by LPS (Standiford et al. 1995) or
b-glucan (1?3-b-glucans) (Young et al. 2001). Therefore,
the microbial materials adsorbed on the ASD may cause
neutrophilic inflammation via the expression of these
increased cytokines and chemokines.
H-ASD and ASD alone showed no increase in eosinophils in BALF. OVA + H-ASD and OVA + ASD caused
synergistic increases in eosinophils along with the their
relevant cytokines and chemokines, such as IL-5 (Foster
et al. 1996; Robinson et al. 1993), eotaxin (Rothenberg
et al. 1997), MCP-1 (Dunzendorfer et al. 2001), MCP-3
(Nagase et al. 1999), and Th2 cytokine IL-13 (D’Andrea
et al. 1995) in BALF, compared with H-ASD, ASD, or
OVA alone. The eosinophil number and expressions of
these cytokines and chemokines in OVA + ASD were
much greater than those in OVA + H-ASD, suggesting
that microbial materials adsorbed on ASD are related to the
enhancement of eosinophil recruitment via these chemical
mediators in the alveoli. Thus, the changes of the biological
components in BALF were very consistent with the pathological changes in the lungs.
TLR2 is the receptor for zymosan (b-glucans) and
peptidoglycan of gram-positive bacteria (Schwandner et
al. 1999). TLR4 is a receptor for LPS of gram-negative
bacteria (Beutler 2002). The low level of inhaled LPS
signaling through TLR4 reportedly induces Th2 responses
to inhaled antigens in a mouse model of allergic sensitization (Eisenbarth et al. 2002). In the present study, ASD
increased the expression of TLR2 mRNA but not TLR4
mRNA. H-ASD caused no expression of either TLR
mRNA in the in vitro experiment. Recent study has
shown that the activation of TLR2 by its synthetic ligand
Pam3Cys with OVA induces a prominent Th2-biased
immune response, such as the induction of Th2-associated
effector molecules like IL-13, IL-5, and OVA-specific
IgG1 and IgE. TLR2 ligands can have an effect on the
development of Th2-associated diseases such as experimental asthma (Redecke et al. 2004). Therefore, the
activation of TLR2 during the initial phase by microbial
components adsorbed onto ASD might lead to the
aggravated eosinophilia. The lesser effect of H-ASD may
be exhibiting the mineral-associated adjuvant effect only,
without the activation of TLR2 by microbial components.
Figure 4 shows a possible mechanism by which ASD
alone may cause lung injury and lead to aggravated lung
eosinophilia.
123
356
Conclusion
The present study has shown that ASD caused the aggravating effect on OVA-associated eosinophilic lung
inflammation, which may be due mainly to the microbial
materials contained in ASD. Atmospheric exposure to
molds, bacteria, and silica-carrying ASD may affect human
health directly through allergic induction of respiratory
stress. The experimental findings in the present study may
be a warning about the bad effect of windborne sand dust
on the human respiratory system.
Acknowledgments This study was supported in part by a grant
from the Ministry of Education, Science, and Culture of Japan and by
the Environmental Agency of Japan.
References
Adamthwaite D, Cooley MA (1994) CD8+ T-cell subsets defined by
expression of CD45 isoforms differ in their capacity to produce
IL-2, IFN-gamma and TNF-beta. Immunology 81:253–260
Akahoshi T, Endo H, Kondo H, Kashiwazaki S, Kasahara T, Mukaida
N, Harada A, Matsushima K (1994) Essential involvement of
interleukin-8 in neutrophil recruitment in rabbits with acute
experimental arthritis induced by lipopolysaccharide and interleukin-1. Lymphokine Cytokine Res 13:113–116
Beutler B (2002) TLR4 as the mammalian endotoxin sensor. Curr Top
Microbiol Immunol 27:109–120
Beutler B (2004) Inferences, questions and possibilities in Toll-like
receptor signalling. Nature 430(6996):257–263
Chang CC, Lee IM, Tsai SS, Yang CY (2006) Correlation of Asian
dust storm events with daily clinic visits for allergic rhinitis in
Taipei, Taiwan. J Toxicol Environ Health A 69:229–235
Chen YS, Yang CY (2005) Effects of Asian dust storm events on
daily hospital admissions for cardiovascular disease in Taipei,
Taiwan. J Toxicol Environ Health A 68:1457–1464
Chen YS, Sheen PC, Chen ER, Liu YK, Wu TN, Yang CY (2004)
Effects of Asian dust storm events on daily mortality in Taipei,
Taiwan. Environ Res 95:151–155
Choi JC, Lee M, Chun Y, Kin J, Oh S (2001) Chemical composition
and source signature of spring aerosol in Seoul. Kor J Geophys
Res 106:18067–18074
D’Andrea A, Ma X, Aste-Amezaga M, Paganin C, Trinchieri G
(1995) Stimulatory and inhibitory effects of interleukin (IL)-4
and IL-13 on the production of cytokines by human peripheral
blood mononuclear cells: priming for IL-12 and tumor necrosis
factor alpha production. J Exp Med 181:537–546
Duce AR, Unni CK, Ray BJ, Prospero JM, Merrill JT (1980) Longrange atmospheric transport of soil dust from Asia to the tropical
North Pacific: temporal variability. Science 209:1522–1524
Dunzendorfer S, Kaneiderm NC, Kaser A, Woell E, Frade JM,
Mellado M, Martinez-Alonso C, Wiedermann CJ (2001) Functional expression of chemokine receptor 2 by normal human
eosinophils. J Allergy Clin Immunol 108:581–587
Eisenbarth SC, Piggott DA, Huleatt JW, Visintin I, Herrick CA,
Bottomly K (2002) Lipopolysaccharide-enhanced, toll-like
receptor 4-dependent T helper cell type 2 responses to inhaled
antigen. J Exp Med 196:1645–1651
Ernst H, Rittinghausen S, Bartsch W, Creutzenberg O, Dasenbrock C,
Gorlitz BD, Hecht M, Kairies U, Muhle H, Muller M, Heinrich
U, Pott F (2002) Pulmonary inflammation in rats after
123
Arch Environ Contam Toxicol (2008) 55:348–357
intratracheal instillation of quartz, amorphous SiO2, carbon
black, and coal dust and the influence of poly-2-vinylpyridine-Noxide (PVNO). Exp Toxicol Pathol 54:109–126
Foster PS, Hogan SP, Ramsay AJ, Matthaei KI, Young IG (1996)
Interleukin 5 deficiency abolishes eosinophilia, airway hyperreactivity, and lung damage in a mouse asthma model. J Exp Med
183:195–201
Gleich GJ (1990) The eosinophil and bronchial asthma: current
understanding. J Allergy Clin Immunol 85:422–436
Hearn VM, Sietsma JH (1994) Chemical and immunological analysis of the Aspergillus fumigatus cell wall. Microbiology
140:789–795
Hiyoshi K, Ichinose T, Sadakane K, Takano H, Nishikawa M, Mori I,
Yanagisawa R, Yoshida S, Kumagai Y, Tomura S, Shibamoto T
(2005) Asian sand dust enhances ovalbumin-induced eosinophil
recruitment in the alveoli and airway of mice. Environ Res
99:361–368
Hsieh CS, Macatonia SE, Tripp CS, Wolf SF, O’Garra A, Murphy
KM (1993) Development of TH1 CD4+T cells through IL-12
produced by Listeria-induced macrophages. Science 260:
47–49
Husar RB, Tratt DB, Schichtel BA, Falke SR, Li F, Jaffe D, Gasso S,
Gill T, Laulainen NS, Lu F, Reheis MC, Chun Y, Westphal D,
Holben BN, Gueymard C, McKendry I, Kuring N, Feldman GC,
McClain C, Frouin RJ, Merrill J, DuBois D, Vigonola F,
Sugimoto N, Malm WC (2001) Asian dust events of April 1998.
J Geophys Res 106:18316–18330
Ichinose T, Takano H, Sadakane K, Yanagisawa R, Kawazato H,
Sagai M, Shibamoto T (2003) Differences in airway-inflammation development by house dust mite and diesel exhaust
inhalation among mouse strains. Toxicol Appl Pharmacol
187:29–37
Ichinose T, Nishikawa M, Takano H, Sera N, Sadakane K, Mori I,
Yanagisawa R, Oda T, Tamura H, Hiyoshi K, Quan H, Tomura
S, Shibamoto T (2005) Pulmonary toxicity induced by intratracheal instillation of Asian yellow dust (Kosa) in mice. Environ
Toxicol Pharm 20:48–56
Ichinose T, Sadakane K, Takano H, Yanagisawa R, Nishikawa M,
Mori I, Kawazato H, Yasuda A, Hiyoshi K, Shibamoto T (2006)
Enhancement of mite allergen-induced eosinophil infiltration in
the murine airway and local cytokine/chemokine expression by
Asian sand dust. J Toxicol Environ Health A 69:1571–1585
James AC, Stahlhofen W, Rudolf G, Briant JK, Egan MJ, Nixon W,
Birchall A, Annexe D (1994) Deposition of inhaled particles. In:
International Commission on Radiological Protection (ICRP)
Human Respiratory Tract Model for Radiological Protection.
ICRP Publ 66. Ann ICRP 24(1/4). Pergamon Press, Oxford, UK
Kim BG, Han JS, Park SU (2001) Transport SO2 and aerosol over the
Yellow Sea. Atmos Environ 35:727–737
Kwon HJ, Cho SH, Chun Y, Lagarde F, Pershagen G (2002) Effects
of the Asian dust events on daily mortality in Seoul, Korea.
Environ Res 90:1–5
Liu W, Ernst JD, Courtney BV (2000) Phagocytosis of crocidolite
asbestos induces oxidative stress, DNA damage, and apoptosis in
mesothelial cells. Am J Respir Cell Mol Biol 23:371–378
Mancino D, Ovary Z (1980) Adjuvant effects of amorphous silica and
of aluminium hydroxide on IgE and IgG1 antibody production in
different inbred mouse strains. Int Arch Allergy Appl Immunol
61:253–258
Mancino D, Vuotto ML, Minucci M (1984) Effects of a crystalline
silica on antibody production to T-dependent and T-independent
antigens in Balb/c mice. Int Arch Allergy Appl Immunol 73:
10–13
Milligan PJM, Brabin B J (1998) Association of spatial distribution of
childhood respiratory morbidity with environmental dust pollution. J Toxicol Environ Health A 55:169–184
Arch Environ Contam Toxicol (2008) 55:348–357
Mori I, Nishikawa M, Tanimura T, Quan H (2003) Change in size
distribution and chemical composition of Kosa (Asian dust)
aerosol during long-range transport. Atmos Environ 37:4253–
4263
Murphy SA, BeruBe KA, Pooley FD, Richards RJ (1998) The
response of lung epithelium to well characterised fine particles.
Life Sci 62:1789–1799
Nagase H, Yamaguchi M, Jibiki S, Yamada H, Ohta K, Kawasaki H,
Yoshie O, Yamamoto K, Morita Y, Hirai K (1999) Eosinophil
chemotaxis by chemokines: a study by a simple photometric
assay. Allergy 54:944–950
Nikaido H (1969) Structure of cell wall lipopolysaccharide from
Salmonella typhimurium. I. Linkage between o side chains and R
core. J Biol Chem 244:2835–2845
Nishikawa M, Quan H, Morita M (2000) Preparation and evaluation
of certified reference materials for asian mineral dust. Global
Environ Res 1:103–113
Pan ZZ, Parkyn L, Ray A, Ray P (2000) Inducible lung-specific
expression of RANTES: preferential recruitment of neutrophils.
Am J Physiol Lung Cell Mol Physiol 279:L658–L666
Quan H, Huang Y, Nishikawa M, Liu X, Mori I, Iwasaka Y, Wei Q,
Qiao S (1996) Preparation of artificial kousa aerosol with two
original desert sands. J Environ Chem 6:225–231
Redecke V, Hacker H, Datta SK, Fermin A, Pitha PM, Broide DH,
Raz E (2004) Cutting edge: activation of Toll-like receptor 2
induces a Th2 immune response and promotes experimental
asthma. J Immunol 172:2739–2743
Robinson DS, Ying S, Bentley AM, Meng Q, North J, Durham SR,
Kay AB, Hamid Q (1993) Relationships among numbers of
bronchoalveolar lavage cells expressing messenger ribonucleic
acid for cytokines, asthma symptoms, and airway methacholine
responsiveness in atopic asthma. J Allergy Clin Immunol
92:397–403
Romieu I, Meneses F, Ruiz S, Sienra JJ, Huerta J, White MC. Etzel
RA (1996) Effects of air pollution on the respiratory health of
asthmatic children living in Mexico City. Am J Respir Crit Care
Med 154:300–307
357
Rothenberg ME, MacLean JA, Pearlman E, Luster AD, Leder P
(1997) Targeted disruption of the chemokine eotaxin partially
reduces antigen-induced tissue eosinophilia. J Exp Med
185:785–790
Schins RP, Duffin R, Hohr D, Knaapen AM, Shi T, Weishaupt C,
Stone V, Donaldson K, Borm PJ (2002) Surface modification of
quartz inhibits toxicity, particle uptake, and oxidative DNA
damage in human lung epithelial cells. Chem Res Toxicol
15:1166–1173
Schwandner R, Dziarski R, Wesche H, Rothe M, Kirschning CJ
(1999) Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by toll- like receptor 2. J Biol Chem
274:17406–17409
Schwartz J, Slater T, Larson T, Pierson WE, Koenig JQ (1993)
Particulate air pollution and hospital emergency room visits for
asthma in Seatle. Am Rev Respir Dis 147:826–831
Shinn EA, Griffin DW, Seba DB (2003) Atmospheric transport of
mold spores in clouds of desert dust. Arch Environ Health
58:498–504
Standiford TJ, Kunkel SL, Lukacs NW, Greenberger MJ, Danforth
JM, Kunkel RG, Strieter RM (1995) Macrophage inflammatory
protein-1 alpha mediates lung leukocyte recruitment, lung
capillary leak, and early mortality in murine endotoxemia. J
Immunol 155:1515–1524
Yang CY (2006) Effects of Asian dust storm events on daily clinical
visits for conjunctivitis in Taipei, Taiwan. J Toxicol Environ
Health A 69:1673–1680
Yang CY, Tsai SS, Chang CC, Ho SC (2005) Effects of Asian dust
storm events on daily admissions for asthma in Taipei, Taiwan.
Inhal Toxicol 17:817–821
Yoshida S, Yoshida M, Sugawara I, Takeda K (2006) Mice strain
differences in effects of fetal exposure to diesel exhaust gas on
male gonadal differentiation. Environ Sci 13:117–123
Young SH, Robinson VA, Barger M, Porter DW, Frazer DG,
Castranova V (2001) Acute inflammation and recovery in rats
after intratracheal instillation of a 1?3-beta-glucan (zymosan
A). J Toxicol Environ Health A 64:311–325
123
Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.