Article in press - uncorrected proof
Biol. Chem., Vol. 392, pp. 813–829, Aug/Sep 2011 • Copyright by Walter de Gruyter • Berlin • Boston. DOI 10.1515/BC.2011.083
Evidence that a septin diffusion barrier is dispensable for
cytokinesis in budding yeast*
Carsten Wloka1,2,a, Ryuichi Nishihama3,a, Masayuki
Onishi3, Younghoon Oh1, Julia Hanna1, John R.
Pringle3, Michael Krauß2 and Erfei Bi1,**
1
Department of Cell and Developmental Biology,
University of Pennsylvania School of Medicine,
Philadelphia, PA 19104-6058, USA
2
Institute of Chemistry and Biochemistry, Department of
Membrane Biochemistry, Freie Universität Berlin,
Takustraße 6, D-14195 Berlin, Germany
3
Department of Genetics, Stanford University of School of
Medicine, Stanford, CA 94305, USA
**Corresponding author
e-mail: [email protected]
Abstract
Septins are essential for cytokinesis in Saccharomyces cerevisiae, but their precise roles remain elusive. Currently, it is
thought that before cytokinesis, the hourglass-shaped septin
structure at the mother-bud neck acts as a scaffold for assembly of the actomyosin ring (AMR) and other cytokinesis factors. At the onset of cytokinesis, the septin hourglass splits
to form a double ring that sandwiches the AMR and may
function as diffusion barriers to restrict diffusible cytokinesis
factors to the division site. Here, we show that in cells lacking the septin Cdc10 or the septin-associated protein Bud4,
the septins form a ring-like structure at the mother-bud neck
that fails to re-arrange into a double ring early in cytokinesis.
Strikingly, AMR assembly and constriction, the localization
of membrane-trafficking and extracellular-matrix-remodeling
factors, cytokinesis, and cell-wall-septum formation all occur
efficiently in cdc10D and bud4D mutants. Thus, diffusion
barriers formed by the septin double ring do not appear to
be critical for S. cerevisiae cytokinesis. However, an AMR
mutation and a septin mutation have synergistic effects on
cytokinesis and the localization of cytokinesis proteins, suggesting that tethering to the AMR and a septin diffusion barrier may function redundantly to localize proteins to the
division site.
Keywords: Bud4; chitin synthase; exocyst; membranetrafficking; septum formation; W303.
*Electronic supplementary material to this article with the DOI
10.1515/BC.2011.083SUP is available from the journal’s online
content site at www.reference-global.com/toc/bchm/392/8-9.
a
These authors contributed equally to this work.
Introduction
Cytokinesis, the process of partitioning cellular constituents
from one cell into two, is essential for all cellular life. The
mechanisms of cytokinesis in animal and fungal cells are
largely conserved (Balasubramanian et al., 2004; Strickland
and Burgess, 2004; Barr and Gruneberg, 2007; Pollard,
2008). For example, cytokinesis in both systems involves a
contractile actomyosin ring (AMR), which consists mainly
of myosin-II and actin filaments, and targeted membrane
deposition, which is coupled with extracellular matrix
(ECM) remodeling. The AMR is thought to generate force
that powers the ingression of the plasma membrane (PM), to
guide membrane deposition and ECM remodeling, or both.
Targeted membrane deposition increases surface area and
delivers enzymes for localized ECM remodeling at the division site. The other core components involved in animal and
fungal cytokinesis, including the septins, IQGAP, formins,
cofilin, profilin, F-BAR proteins, myosin-V, the exocyst,
t-SNARES, etc., are also conserved. The current challenge
is to define the specific roles of individual components, protein complexes, and/or molecular pathways in cytokinesis,
and also to determine how these common components are
wired together into the cellular machines that drive cell
cleavage.
There are also notable differences between animal and
fungal cytokinesis. First, the AMR in animal cells functions
to constrict the PM at the division site from its initial size
(typically )10 mm in diameter) to the size of a midbody
(1–2 mm in diameter), an electron-dense structure situated
at the midpoint of an intercellular bridge between the daughter cells (Mullins and Biesele, 1973, 1977; Mullins and
MacIntosh, 1982). The AMR is then disassembled while the
daughter cells remain connected. Eventual cell separation
(abscission) is thought to occur by ESCRT III-mediated
membrane constriction at either side of the midbody (Elia et
al., 2011; Guizetti et al., 2011). In contrast, the AMR in
many fungi, such as the budding yeast Saccharomyces cerevisiae, is involved in constricting the PM at the division site
from its initial size (which can be as small as 1 mm in diameter) to complete closure (Bi et al., 1998; Lippincott and Li,
1998; Pollard and Wu, 2010). Second, although accumulating evidence suggests that membrane-trafficking and ECM
remodeling play important roles in animal cytokinesis (Mizuguchi et al., 2003; Szafer-Glusman et al., 2008; Izumikawa
et al., 2010; Xu and Vogel, 2011), it remains unclear when
and how they are involved. In contrast, membrane-trafficking
and ECM remodeling are required for the entire division
process in S. cerevisiae. AMR constriction is accompanied
by the centripetal growth of a chitinous primary septum (PS),
which is synthesized by the chitin synthase Chs2 (Sburlati
2011/152
Article in press - uncorrected proof
814 C. Wloka et al.
and Cabib, 1986; VerPlank and Li, 2005; Zhang et al., 2006;
Nishihama et al., 2009). The delivery of Chs2 to the division
site depends on vesicle transport by myosin-V, vesicle tethering by the exocyst, and vesicle fusion by SNARES (Johnston et al., 1991; Lillie and Brown, 1994; Chuang and
Schekman, 1996; Guo et al., 1999; Boyd et al., 2004;
VerPlank and Li, 2005). After completion of the PS, secondary septa (SS), which are structurally similar to the general cell wall, are synthesized at either side of the PS (Lesage
and Bussey, 2006; Nishihama et al., 2009). Cell separation
ensues by the synthesis and delivery of endochitinase and
glucanases from the daughter cell to the division site to
degrade the PS and the associated cell wall (Yeong, 2005;
Lesage and Bussey, 2006). Finally, although the core components of cytokinesis are conserved, their order of localization to, and/or assembly at, the division site may differ
significantly (Balasubramanian et al., 2004). For example,
septins, the focus of this study, are the first component
known to arrive at the division site in S. cerevisiae but localize much later than other cytokinesis proteins in the fission
yeast Schizosaccharomyces pombe.
Septins are a conserved family of GTP-binding proteins
that form filaments in vitro and in vivo (Joo et al., 2005;
Hall et al., 2008; Weirich et al., 2008; McMurray and Thorner, 2009; Oh and Bi, 2011). Septins play essential roles in
cytokinesis in animal cells and budding yeast (Hartwell,
1971; Neufeld and Rubin, 1994; Longtine et al., 1996;
Kinoshita et al., 1997; Bi et al., 1998; Lippincott and Li,
1998; Estey et al., 2010), but the underlying mechanisms
remain elusive. In animal cells, septins are co-localized with
the AMR during the entire period of AMR contraction (Fares
et al., 1995; Estey et al., 2010). After AMR disassembly at
the midbody stage, septins are enriched at the midbody, both
ends of the intercellular bridge, and sometimes with the
residual microtubules in the intercellular bridge. In contrast,
septins and the AMR display distinct spatial organizations
during cytokinesis in yeasts. In S. cerevisiae, five vegetatively expressed septins (Cdc3, Cdc10, Cdc11, Cdc12, and
Shs1/Sep7) are assembled into hetero-oliogomeric complexes, which polymerize end-to-end to form filaments. These
filaments are then organized into an hourglass-shaped structure at the mother-bud neck upon bud emergence (Kim et
al., 1991; Cid et al., 2001; Lippincott et al., 2001). The hourglass is maintained at the division site until mitotic exit,
when it is triggered by a cell-cycle signal or, more specifically, Cdk1 inactivation to split into a pair of cortical rings
(Cid et al., 2001; Lippincott et al., 2001; Meitinger et al.,
2010). The septin hourglass and the double ring are thought
to play distinct roles in cytokinesis. Before the onset of cytokinesis, the septin hourglass functions as a ‘scaffold’ for
AMR assembly, as disruption of the septin structure blocks
the localization of Myo1 (the sole myosin-II in S. cerevisiae)
and many other cytokinesis proteins to the division site, causing a failure to assemble an AMR (Bi et al., 1998; Lippincott
and Li, 1998; Gladfelter et al., 2001). The co-localization of
the septins and the AMR during this stage of the cell cycle
is similar to that in mammalian cells. After the onset of cytokinesis, the pair of septin rings sandwiches the AMR and has
been thought to act as diffusion barriers to restrict diffusible
cytokinesis factors to the division site (Dobbelaere and Barral, 2004). The clear contrasts in these regards between yeast
and mammalian cells raise the question of the common and
unique functions of the septins in cytokinesis in different
organisms.
In this study, we show that S. cerevisiae mutants that are
unable to assemble or maintain a double septin ring during
cytokinesis are nonetheless capable of dividing efficiently,
suggesting that a septin-based diffusion barrier is not
required for cytokinesis in this organism.
Results
Failure of cdc10D cells to form a double septin ring
In wild-type cells, the septin hourglass at the mother-bud
neck splits into a pair of rings late in the cell cycle (Figure
1A; Supplementary Video 1, left). Splitting is controlled by
the mitotic-exit network (MEN) (Cid et al., 2001; Lippincott
et al., 2001) and is closely correlated with the elongating
nucleus reaching the extreme ends of the mother-daughter
axis. We found that splitting was accompanied by a 31"6%
decrease in septin fluorescence intensity relative to 15 min
before splitting (Figure 1A), suggesting that there is a
cell-cycle-triggered disassembly of septin filaments that
accompanies splitting. In contrast, in cells lacking the septin
Cdc10, a core subunit of the octameric septin complex (Bertin et al., 2008), the remaining septins were able to assemble
into a single ring or hourglass (hereafter referred to as a
‘ring’), which resided at the daughter side of the mother-bud
neck in most cases (unpublished data) but failed to rearrange
into a double ring (Figure 1B; Supplementary Video 1, right)
(Castillon et al., 2003; Versele and Thorner, 2004). Instead,
it was quickly lost during mitotic exit in all cells observed
(an 84"6% decrease in septin fluorescence intensity), suggesting that Cdc10-less septin filaments (or rings) are hypersensitive to cell-cycle-triggered disassembly, and essentially
inert for double-ring formation. Similar results were obtained
with other tagged septins (Cdc11-GFP, Cdc12-GFP, and
Shs1-GFP) as markers (unpublished data). The rapid loss of
the septin ring in dividing cdc10D cells is consistent with
the cell-cycle-regulated changes in septin organization and
dynamics that occur during mitotic exit and perhaps even
earlier (Oh and Bi, 2011). Thus, it appears that Cdc10 plays
a critical role in the formation of the septin double ring.
Efficient AMR assembly and constriction in cdc10D
cells
The cdc10D defect in formation of the septin double ring
offers an excellent opportunity to determine the specific role
of the double ring in cytokinesis. In wild-type cells, Myo1
localizes to the division site in a septin-dependent manner
early in the cell cycle (Bi et al., 1998; Lippincott and Li,
1998; Fang et al., 2010), and actin-ring assembly and maturation occur from the onset of anaphase to the onset of
mitotic exit (Epp and Chant, 1997; Bi et al., 1998; Lippincott
Article in press - uncorrected proof
Role of septins during cytokinesis in budding yeast
815
Figure 1 cdc10D cells are defective in formation of the septin double ring.
(A) Change in septin (Cdc3-GFP) fluorescence intensity around the time of hourglass splitting in wild-type (WT) cells. Strain YEF6021
was grown to exponential phase in SC-Leu medium at 258C and imaged by dual-color spinning-disk confocal microscopy. Time ‘0’ is when
the elongating nucleus (marked by the nuclear-pore component Nup57-RFP) reaches the extreme ends of the mother-daughter axis. Total
septin fluorescence intensities were monitored for each of 15 cells for 15 min before and after this time. Mean intensities"standard deviations
are plotted. The images above the plot correspond to the time points on the X-axis. (B) Disappearance of the single septin ring without
splitting in cdc10D cells around mitotic exit. Conditions were the same as in (A) except that strain YEF6022 was used.
and Li, 1998; Fang et al., 2010). Thus, by the time the septin
hourglass splits to form the double ring, when the nucleus is
fully elongated (Figure 1A) at the onset of mitotic exit (Cid
et al., 2001; Lippincott et al., 2001), a normal-looking AMR
has been assembled (Figure 2A, left two panels; 92% of 61
such cells examined had a well-defined actin ring). Strikingly, 95% of 55 cdc10D cells examined also displayed a welldefined actin ring at this stage (Figure 2A, right four panels;
Supplementary Video 2). Thus, actin-ring assembly appears
to be normal in cdc10D cells.
As shown previously (Lippincott et al., 2001; Dobbelaere
and Barral, 2004; Fang et al., 2010), Myo1-GFP constricted
symmetrically between the two septin rings during cytokinesis in wild-type cells, at a rate of 0.09"0.03 mm/min in
diameter (Figure 2B, left; Supplementary Video 3, top).
Remarkably, Myo1-GFP also constricted symmetrically in
;50% of cdc10D cells (the remaining cells are discussed
below), at a rate of 0.17"0.05 mm/min (Figure 2B, right;
Supplementary Video 3, bottom). This increased constriction
rate may reflect the larger initial diameter at the division site
in cdc10D cells (1.97"0.37 mm vs. 1.0"0.11 mm for wildtype), consistent with the observation in animal cells that
large cells divide fast (Schroeder, 1972; Carvalho et al.,
2009). Taken together, our data indicate that AMR assembly
Article in press - uncorrected proof
816 C. Wloka et al.
Figure 2 AMR assembly and constriction occur efficiently in cdc10D cells.
(A) Normal actin-ring assembly in cdc10D cells. Wild-type (YEF6033) and cdc10D (YEF6034) cells expressing Nup57-GFP (to mark
nuclear position and indicate cell-cycle stage) were grown to exponential phase in YM-P medium at 258C and stained for actin. 3D reconstructions of the actin rings in representative cells were performed (Supplementary Video 2), and a single frame of each Z-stack is
shown. (B) Efficient Myo1-GFP ring constriction in cdc10D cells. Wild-type (XDY286) and cdc10D (YJL496A) cells expressing Myo1GFP and Cdc3-RFP were grown to exponential phase in SC-Leu medium at 258C and imaged by dual-color spinning-disk confocal
microscopy. Fluorescence intensities were quantified for 15 min before and after septin-hourglass splitting for WT cells or septin-ring
disappearance for cdc10D cells. Montage images of the RFP (magenta), GFP (green), and merged channels from representative time-lapse
data are shown here.
and constriction occur efficiently in cdc10D cells, apparently
in the absence of the septin double ring. These results confirm and extend a previous analysis of cytokinesis in cdc10D
cells (Frazier et al., 1998).
Efficient localization of membrane-trafficking
components to the division site in cdc10D cells
The PM and ECM remodeling that are central to cytokinesis
require the efficient localization to the division site of polysaccharide synthases, such as Chs2, and vesicle-trafficking
factors, such as the myosin-V Myo2 and the exocyst component Exo84 (see Introduction). To ask if the septin double
ring is required for such localization as proposed previously
(Dobbelaere and Barral, 2004), we examined the localizations of these proteins during cytokinesis in cdc10D cells by
live-cell imaging (Figure 3A). As expected, all three proteins
were targeted to the division site around the time of septinhourglass splitting in wild-type cells (Figure 3A, left; Supplementary Video 4, left). Subsequently, Myo2 and Exo84
displayed partial constriction between the septin rings and
remained concentrated at the division site for the duration of
cytokinesis and cell separation. In contrast, Chs2 constricted
much further than Myo2 or Exo84 and was then removed
from the division site, presumably by endocytosis (Chuang
and Schekman, 1996; Roh et al., 2002). Contrary to the pre-
dictions of the diffusion-barrier hypothesis, Myo2, Exo84,
and Chs2 were all targeted efficiently to the division site in
cdc10D cells at the time when the single septin ring began
to disappear or had already disappeared from the division
site (Figure 3A, right; Supplementary Video 4, right). Moreover, these proteins displayed durations for their localizations
and constriction that were comparable to those in wild-type
cells. In the ‘post-constriction phase’, Myo2 and Exo84 did
appear to de-localize from the division site more quickly in
cdc10D than in wild-type cells, perhaps reflecting a redundant role for the septin double ring in localizing these proteins to the division site when the AMR is disassembled or
abolished (see Figures 7 and 8, and Discussion). Importantly,
Myo1 and Chs2 were spatially coupled during cytokinesis in
cdc10D cells (Figure 3B, Supplementary Video 5), suggesting that the AMR may guide membrane deposition and PS
formation in the absence of the septin double ring.
Asymmetric cleavage furrow formation and
localization of cytokinesis proteins in cdc10D cells
About half (nine of 20) cdc10D cells displayed a seemingly
symmetric constriction of the AMR (Figure 2B, right) and
ingression of the cleavage furrow (as marked by Chs2; Figure 3A, bottom right), much as in wild-type cells (except for
the difference in organization of the associated septin struc-
Article in press - uncorrected proof
Role of septins during cytokinesis in budding yeast
817
Figure 3 Efficient localization of membrane-trafficking components to the division site and spatial coupling of Chs2 and Myo1 during
cytokinesis in cdc10D cells.
(A) Wild-type (YEF5986, YEF5862, and YEF5874) and cdc10D (YEF5987, YEF5873, and YEF5875) cells expressing labeled Myo2,
Exo84, or Chs2 were grown to exponential phase in SC-Leu medium at 258C and imaged by dual-color spinning-disk confocal microscopy.
Kymographs of a representative cell for each strain are shown. (B) Strain YO1511 was examined as in A using SC-Trp medium and 2-min
intervals for the time-lapse series.
ture). Other cdc10D cells displayed asymmetric constriction
of the AMR, furrow ingression, and localization of the associated membrane-trafficking components (Figure 4A; Supplementary Video 6; the fractions showing such asymmetry
are probably underestimated because of the difficulty of
identifying subtle asymmetries across the bud neck from
light-microscopy images). The single septin ring in cdc10D
cells was either symmetric or asymmetric before its disappearance, and every asymmetric septin ring (or collapsed
septin patch at one side of the bud neck) was accompanied
by asymmetric and correlated localizations of the other proteins examined (Figure 4A; Supplementary Video 6). These
data support the hypothesis that the septins function as a
scaffold for these other proteins during cytokinesis.
Successful cleavage furrow and septum formation in
cdc10D cells
To investigate whether the nearly normal behavior of cytokinesis proteins in cdc10D cells, as described above, is
accompanied by successful completion of cytokinesis and
septum formation, we examined cdc10D cells by electron
microscopy. As expected (Shaw et al., 1991), wild-type cells
formed a thin ingressing cleavage furrow with an electronlucent, chitinous PS, which ultimately traversed the motherbud neck and became sandwiched by SS to form a trilaminar
structure (Figure 4B, left panels). All these features were also
observed in cdc10D cells (Figure 4B, middle panels), indicating that normal cleavage furrow and septum formation
can occur in such cells. However, consistent with the lightmicroscopy analyses, asymmetric PS formation was also
observed in some cells (Figure 4B, upper right panel): the
frequencies of such asymmetric PS figures among cells with
incomplete PSs were 92% (ns25) and 5% (ns20) in cdc10D
and wild-type cells, respectively. (Note that there is probably
a bias towards detection of asymmetric PSs as their completion appears to require more time than does that of symmetric
PSs; compare Figure 2B, left and Figure 3A, bottom left, to
the corresponding panels in Figure 4A.) We also observed a
shift in the positions of PS (and thus full-septum) formation
towards the bud side of the neck in some cdc10D cells (Figure 4B, middle and bottom right). Thus, it appears that the
absence of Cdc10 allows other septins or their assembled
filaments to mislocalize not only circumferentially around
the division site but also longitudinally along the motherdaughter cell axis. Nevertheless, most cdc10D cells were successful in completing cytokinesis, suggesting that the
formation of the septin double ring is dispensable for the
entire suite of processes that lead to this result.
Failure of double-ring formation, but successful
cytokinesis, in bud4D cells
In the course of other experiments, we had noticed that a
nominally wild-type strain in the W303 genetic background
exhibited a defect in septin organization reminiscent of that
seen in cdc10D cells. Still-image analyses of Cdc3-GFPexpressing cells showed that all small- and medium-budded
cells formed seemingly normal septin hourglass structures.
However, among 400 large-budded cells examined, only six
displayed (faint) double rings, whereas 160 displayed persistent hourglass structures, 107 displayed no detectable septin structure, 102 displayed a single ring on the daughter side
of the neck, and 25 had grossly abnormal septin structures
Article in press - uncorrected proof
818 C. Wloka et al.
Figure 4 Asymmetric localization and constriction of the AMR and membrane-trafficking components during cytokinesis (A) and successful septum formation (B) in cdc10D cells.
(A) Kymographs are shown for representative cells of cdc10D CDC3-RFP strains expressing GFP-tagged Myo1 (YJL496A), Myo2
(YEF5987), Exo84 (YEF5873), or Chs2 (YEF5875). Growth and imaging conditions are as in Figures 2B and 3. (B) Strains XDY286
(CDC10) and YJL496A (cdc10D) were grown to exponential phase in SC medium at 248C and processed for electron microscopy. The
daughter side is shown in the top half of each panel. Bar: 0.5 mm.
(unpublished data). Time-lapse analyses of cells expressing
Cdc3-GFP or Cdc10-GFP revealed that in large-budded cells,
the mother-side half of the septin hourglass appeared to collapse, leaving a single septin ring on the daughter-cell side
(Figure 5A and C; Supplementary Video 7). Three-dimensional reconstructions confirmed that unlike strains in the
S288C genetic background (like all of the other strains used
in this study), which formed distinct double rings (Figure
5D, left; Supplementary Video 8, top row), the W303 strains
progressed from the hourglass to rather indistinct single
rings, which then persisted for some time (Figure 5D, middle
and right; Supplementary Video 8, middle and bottom rows).
W303-background strains are known to contain mutations
in several genes including BUD4 (Voth et al., 2005), which
encodes a septin-associated protein that together with Bud3,
Axl1, and Axl2 forms a spatial landmark that specifies the
next budding site in MATa and MATa cells (Chant and Herskowitz, 1991; Fujita et al., 1994; Chant et al., 1995; Halme
et al., 1996; Roemer et al., 1996; Sanders and Herskowitz,
1996; Park and Bi, 2007). Bud4 associates with the septin
hourglass at mitosis and remains associated with the split
septin rings into the next budding cycle (Sanders and Herskowitz, 1996). Bud4 has similarity in amino acid sequence
to the cytokinesis-related protein anillin (Figure S1), and it
has been shown that in the absence of anillin-like proteins,
septins are mislocalized in both animal (Field et al., 2005;
Maddox et al., 2005; Goldbach et al., 2010) and S. pombe
(Berlin et al., 2003; Tasto et al., 2003) cells. Thus, it was
not surprising that transformation of W303 with a BUD4
plasmid restored the transition from an hourglass to a double
ring (Figure 5B), as seen in S288C-derived wild-type strains
(see above). Moreover, when we intentionally deleted BUD4
in an S288C-background strain, the mutant strain showed a
mother-side specific collapse of the septin hourglass into a
single ring on the daughter side (Figure 6B), essentially as
seen in W303, and in sharp contrast to the well-defined double septin ring formed by the parent strain (Figure 6A). Interestingly, tagged Cdc10 frequently appeared to ‘ingress’,
suggesting an association of at least one septin with the
cleavage furrow membrane (Figure 5C) (tagged Cdc3 occasionally also displayed a weak association with the ingressing membrane; unpublished data); this behavior is
reminiscent of that seen for septins in an S. pombe anillin
mutant (Berlin et al., 2003). Taken together, the data indicate
that Bud4 plays a pivotal role in the organization of septin
structures at the time of mitotic exit in S. cerevisiae, as do
its homologues in other organisms (see further discussion in
Supplementary Material).
W303-background strains grow well, and previous studies
have suggested that cytokinesis proceeds normally in such
strains (Tolliday et al., 2003; Lister et al., 2006; Iwase et al.,
2007; Ko et al., 2007; Sanchez-Diaz et al., 2008). To explore
this issue in more detail, we examined AMR contraction in
a bud4D mutant and its wild-type parent in the S288C back-
Article in press - uncorrected proof
Role of septins during cytokinesis in budding yeast
Figure 5 Defective formation of septin double rings in Bud4-deficient cells of the W303 genetic background.
(A–C) Strains expressing Cdc3-GFP or Cdc10-GFP were grown to
exponential phase in SC-Leu medium and observed by spinningdisk confocal microscopy. Images represent 1 min intervals, starting
from an arbitrary time zero, for representative cells. The motherdaughter (M-D) cell axis is indicated. (A) Strain YEF6450; ns16.
(B) Strain YEF6457; ns11. (C) Strain MNY1031; ns36. (D)
Three-dimensional reconstructions of septin double rings in an
S288C-background wild-type strain (left; strain YEF6021) and of
the single rings in the W303-background strains YEF6450 (middle)
and MNY1031 (right). For strains YEF6450 and MNY1031, the
images correspond to the time points marked by asterisks in panels
A and C. Different angles of the 3D images were chosen to allow
clear visualization of the septin structures of interest.
819
ground; both strains also expressed Cdc3-CFP. In the wildtype strain, AMR contraction commenced at about the time
of septin-hourglass splitting and occurred within the zone
defined by the double septin ring (Figure 6C; Supplementary
Video 9, top row), as described above. In the bud4 mutant,
the timing and location of AMR contraction were similar to
those in wild-type cells, except that the constricting AMR
was flanked by a single septin ring at the daughter side (Figure 6D; Supplementary Video 9, bottom row). The time
required for AMR contraction was essentially the same in
wild-type (6.4"1.3 min; ns5) and bud4D (6.8"1.8 min;
ns13) cells (Figure 6C and D; Supplementary Video 9).
These data suggest strongly that the septin double ring and
any associated diffusion barrier are not required for proper
cytokinesis.
To ask if the cdc10D and bud4D phenotypes might be
connected, we examined the localization of Bud4-GFP in
wild-type and cdc10D cells. Bud4-GFP localized to the
mother-bud neck before, during, and after cytokinesis in
cdc10D cells, but its signal intensity was reduced by ;40%
in comparison to wild-type cells (Figure S2; Supplementary
Video 10). This result suggests that a reduction in Bud4
localization may contribute to the septin defects of cdc10D
cells during cytokinesis. It may also explain why cdc10
mutant cells are partially defective in axial budding (Flescher
et al., 1993). Interestingly, Bud4-GFP remained at the bud
neck even after septin disappearance in cdc10D cells, suggesting that Bud4 may have septin-independent mechanisms
mediating its membrane association. Indeed, Bud4 has a PH
domain (Figure S1; Yu et al., 2004) and its interacting proteins, Bud3 and Axl2, are known to be associated with the
plasma membrane through an amphipathic helix and a trans-
Figure 6 Absence of septin double rings but normal AMR contraction in bud4D cells in the S288C genetic background.
(A–B) Strains YEF473A (A; BUD4) and KNY117 (B; bud4D) were transformed with YCp111-CDC3-GFP, grown to exponential phase in
SC-Leu medium, and observed by time-lapse microscopy. Times are indicated in minutes starting at an arbitrary zero for each cell; cells
shown are representative of 23 (A) and 29 (B) cells observed. (C–D) Strains YEF1681 (C; wild type) and RNY2630 (D; bud4D) were
transformed with YCp111-CDC3-CFP and then grown and imaged as for panels A and B but using CFP and YFP filter sets. Kymographs
are shown with images at 1 min intervals. The daughter-mother (D-M) cell axis is indicated.
Article in press - uncorrected proof
820 C. Wloka et al.
membrane domain, respectively (Halme et al., 1996; Roemer
et al., 1996; Gao et al., 2007; Guo et al., 2011).
Redundant roles of the AMR and septin double ring
in localizing membrane-trafficking factors to the
division site
The spatial correlations and mutant phenotypes described
above, together with data presented previously (Fang et al.,
2010), suggest that the AMR, and specifically the Myo1 Cterminal ‘tail’ (i.e., non-motor) domain, may play the major
role in localizing membrane-trafficking and ECM-remodeling factors to the division site. If this is so, then the data
presented by Dobbelaere et al. (2004) in support of a diffusion barrier role for the septin double ring might be
explained if the AMR and double ring function redundantly
in this process. To test this hypothesis, we asked if myo1 and
cdc10 mutations, abolishing the AMR and the septin double
ring, respectively, have synergistic effects on cytokinesis and
the localization of the relevant proteins. Isogenic wild-type,
cdc10D, myo1D, and cdc10D myo1D strains carrying a URA3
MYO1 plasmid were spotted at different concentrations onto
plates that required maintenance of the plasmid (SC-Ura) and
plates on which only cells that had lost the plasmid could
grow (SCq5FOA). As shown in Figure 7A, in contrast to
the single mutants, the double mutant was essentially dead
in the absence of the plasmid, consistent with the hypothesis
that the AMR and septin double ring function redundantly
in a process essential for cytokinesis. In further support of
this hypothesis, the (presumed) overexpression of Myo1
from the plasmid was able to suppress the growth defect of
cdc10D cells (Figure 7A, second and fourth lines).
To explore the hypothesis further, we used the cdc10-1
temperature-sensitive mutation (Hartwell, 1971) to generate
a strain (myo1D cdc10-1) in which the AMR was abolished
and septin double ring function was compromised, but that
could still grow, albeit rather poorly, at the permissive temperature of 248C (Figure 7B). We then examined the behavior of the chitin synthase Chs2 in the single- and
double-mutant strains. As in wild-type cells (Roh et al.,
2002; VerPlank and Li, 2005; Fang et al., 2010), Chs2 was
delivered to the division site and then removed by endocytosis in myo1D (ns6) and cdc10-1 (ns4) single mutant cells
at 378C (Figure 7C, left and middle; Supplementary Video
11, top and middle rows). In myo1D cells, Chs2 occupied
the narrow space between the septin rings, and in cdc10-1
cells, it localized in a pattern consistent with co-localization
with the AMR during its entire duration of ;12 min. In
Figure 7 Synergistic effects between myo1 and septin mutations.
(A) Synthetic lethality between myo1D and cdc10D mutations and suppression of the cdc10D growth defect by a MYO1 plasmid. Strains
YEF6433 (wild type), YEF6437 (cdc10D), YEF2030 (myo1D), and YEF6442 (cdc10D myo1D) carrying the low-copy plasmid YCp50MYO1 were grown overnight in SC-Ura medium at 258C and then spotted onto SC-Ura and SCq5FOA plates using 10-fold serial dilutions
and a starting amount of ;105 cells in the spot. Plates were incubated at 258C for 3–4 days. (B) Temperature-sensitive viability of a myo1D
cdc10-1 double mutant. Strains RNY471 (myo1D), RNY2546 (cdc10-1), and RNY2537 (myo1D cdc10-1), all initially containing the URA3
MYO1 plasmid pRS316-MYO1, were pre-grown and spotted onto an SCq5FOA plate as described in A except that the initial spot contained
;2=105 cells. Plates were then incubated for 3 days at 248C or 308C. (C) Mislocaliztion of Chs2 in a strain defective in both the AMR
and the septin double ring. Strains YEF6454 (myo1D), YEF6453 (cdc10-1), and YEF6455 (myo1D cdc10-1), all expressing Cdc3-RFP and
Chs2-GFP, were grown to exponential phase in SC-Leu medium at 248C. Cells were then spotted onto pre-warmed agarose slabs containing
the same medium and imaged at 378C (myo1D and cdc10-1) or 348C (myo1D cdc10-1).
Article in press - uncorrected proof
Role of septins during cytokinesis in budding yeast
myo1D cdc10-1 cells incubated at 348C, the Chs2-GFP signal
spread dramatically over time and failed to disappear from
the division site during the entire imaging period of )30 min
(Figure 7C; Supplementary Video 11, bottom row; ns11).
Three-dimensional re-constructions indicated that the
Chs2-GFP signal was associated with the cell cortex, often
in the form of multiple puncta, during its entire localization
period (unpublished data). It also appeared that the asymmetric distribution of Chs2 (both around the neck and along
the mother-bud axis) in cdc10 mutants (Figure 4A, bottom
right; Figure 7C, middle) was lost in the absence of the AMR
(Figure 7C, right). Taken together, the results indicate that
the AMR and the septin double ring play redundant roles in
localizing cytokinesis factors to the division site, and that
both structures are also involved in the subsequent endocytic
removal of Chs2 from that site.
821
still formed functional diffusion barriers. However, these
double rings were fainter than in wild-type cells and distinctly asymmetric, with the septins concentrated on the daughter
side (McMurray et al., 2011); thus, these results are actually
similar to ours, except that in our study (as in the studies of
Castillon et al., 2003, and Versele et al., 2004), only rare
cells were observed with faint double rings, while nearly all
cells had detectable septin-GFP fluorescence only on the
daughter side of the neck and/or had lost it altogether by the
onset of cytokinesis. These differences probably reflect the
particulars of the strain and growth conditions used in the
several studies. In any case, because our time-lapse observations showed that the very same cells that had no double
rings still localized cytokinesis proteins, and carried out cytokinesis processes, with good efficiency, we think that our
conclusion – that scaffolding by septins and the AMR is
more important than the possible diffusion barrier – is likely
to be correct.
Discussion
Dispensability of the septin double ring, and hence of
any associated diffusion barrier, for cytokinesis in
S. cerevisiae
At the onset of cytokinesis, the septin hourglass structure at
the mother-bud neck rearranges and splits into a discrete pair
of cortical rings that sandwich the AMR and the zone to
which membrane-trafficking and ECM-remodeling factors
are localized (Kim et al., 1991; Cid et al., 2001; Lippincott
et al., 2001; Dobbelaere and Barral, 2004; Vrabioiu and Mitchison, 2006; Nishihama et al., 2009; Fang et al., 2010).
Dobbelaere and Barral (2004) presented evidence suggesting
that the double ring functions as a diffusion barrier to restrict
diffusible cytokinesis factors to the division site. In contrast,
our study provides strong evidence that the septin double
ring, and hence any associated diffusion barrier, is not
required for cytokinesis, at least under the conditions examined. In particular, in cells lacking the septin Cdc10, other
septins are organized into what appears to be a single ring
on the daughter side of the mother-bud neck, which then
disappears at or shortly before cytokinesis onset. Similarly,
in cells lacking the septin-associated, anillin-related protein
Bud4, the septin hourglass may split initially, but the ring on
the mother side is quickly lost, leaving what appears to be a
single ring on the daughter side of the neck. Nonetheless, in
both cdc10D and bud4D cells, all the major processes of
cytokinesis, including AMR assembly and constriction, the
localization of membrane-trafficking and ECM-remodeling
components, and the formation of both primary and secondary septa, occurred with reasonable efficiency.
Very recently, McMurray et al. (2011) reported that
cdc10D cells could form abnormal septin filaments that were
capable of assembling into nearly normal structures at the
mother-bud neck, including apparent double rings in at least
some cells, and carrying out many septin functions. Consistent with our results, McMurray and co-workers found that
their cdc10D cells could localize Chs2 and the exocyst-associated protein Sec3 to the division site, which they interpreted as indicating that the double rings they had observed
Possible cooperation/redundancy between the AMR
and the septin double ring in localizing cytokinesis
factors
It is also important to note that our results are not completely
discrepant with those of Dobbelaere and Barral (2004).
Using the temperature-sensitive cdc12-6 mutation, which
causes seemingly complete disassembly of septin structures
within minutes after a shift to a non-permissive temperature
of G358C (Haarer and Pringle, 1987; Kim et al., 1991), these
authors observed that once the AMR was assembled, it could
be maintained at the division site and undergo constriction
without the septin double ring (Dobbelaere and Barral,
2004), a result that seems fully consistent with our observations on cdc10D and bud4D cells. Dobbelaere and Barral
(2004) also observed that localization to the division site of
Chs2, Sec3, and the polarity protein Spa2 was disrupted
when the cdc12-6 mutant was shifted to 358C, findings that
constituted the major basis for their hypothesis that the septin
double ring functions as a diffusion barrier during cytokinesis. However, the delocalization of the marker proteins
does not appear to have been complete (see, for example,
their Table S5), and the loss of septin structures and delocalization of the marker proteins were not monitored simultaneously in the same cells, making it difficult to judge the
tightness of the correlation. Indeed, as AMR contraction was
observed, and this depends on the localized activity of Chs2
(Bi, 2001; Schmidt et al., 2002; VerPlank and Li, 2005; Nishihama et al., unpublished results), it seems that retention
of Chs2 at the division site must have been at least moderately efficient.
Nonetheless, it remains possible that a diffusion barrier
mediated by the septin double ring does become important
under the stress of growth at relatively high temperature
wsuch as the 358C used by Dobbelaere and Barral (2004) with
the cdc12-6 mutantx. Although there are other possible interpretations (in terms of disturbances to other essential roles
of the septins), this is one possible explanation for the consistent observation that cdc10D strains are viable at lower
temperatures but not at higher ones (Flescher et al., 1993;
Article in press - uncorrected proof
822 C. Wloka et al.
Fares et al., 1996; Versele et al., 2004). In addition, our
genetic experiments (Figure 7) provide good evidence that
the AMR and the double septin ring function cooperatively
(or redundantly) in cytokinesis and the localization of diffusible cytokinesis factors, with the former mechanism playing the primary role, at least at lower temperatures (Figure
8, right). Thus, full disruption of septin assembly (as with a
cdc12 mutation), which disrupts the assembly of both the
AMR and the septin double ring, is lethal, whereas loss of
either Myo1 (and thus of the AMR) or the double septin ring
(as in a cdc10D or bud4D strain) is not.
Scaffolding functions of the septins and the AMR
It has long been known that the septins, at least at the hourglass stage, provide a scaffold for the localization to the
mother-bud neck of many other proteins, including Myo1
and other constituents of the AMR (Chant et al., 1995;
DeMarini et al., 1997; Bi et al., 1998; Lippincott and Li,
1998; Longtine et al., 1998a; Gladfelter et al., 2001). We
have recently shown (Fang et al., 2010) that the localization
of Myo1 depends on two different regions in its C-terminal
(non-motor) domain and involves anchorage by the septinbinding protein Bni5 (Lee et al., 2002) through the early part
of the cell cycle and association with the myosin light chain
Mlc1 and the IQGAP Iqg1 from the onset of anaphase to the
completion of cytokinesis (Figure 8). The latter mechanism
presumably allows the AMR to remain associated with the
cell cortex even after the septin hourglass has split to form
the double ring, leaving a septin-free inner zone to which
the AMR is localized, although the precise mechanism of
AMR tethering remains unclear (Figure 8).
Fang et al. (2010) also provided evidence that the AMR,
through the Myo1 C-terminal domain, serves to localize the
factors needed for PM and ECM remodeling, and thus for
cleavage furrow ingression and PS formation. In the present
study, we provide further support for this hypothesis. Actin,
Myo2, Exo84, and Chs2 all co-localize with Myo1 at the
division plane and continue to do so even when the septins
are present only on the daughter-cell side of that plane or
have disappeared altogether. This appears to be true even
when the division plane is offset from the midpoint of the
mother-bud axis or when the AMR has collapsed to one side
of the neck (Figure 4). These last observations also support
the underlying role of early septin scaffolding in the assembly of these structures: even after an asymmetric septin structure has disappeared, the last position of this structure
accurately predicts the position of Myo1 as well as of the
Figure 8 A model for the spatial and functional relationships between septin structures and other cytokinesis factors.
(Left) From the onset of anaphase to the onset of telophase (before septin-hourglass splitting), Myo1 is tethered to the septin hourglass via
two pathways, the Bni5 pathway, which is fading at this time, and the Mlc1-Iqg1 pathway, which is strengthening. (Right) After the onset
of cytokinesis (after septin-hourglass splitting), the AMR is associated with the PM by an unknown mechanism. The AMR plays a major
role in localizing membrane-trafficking and ECM-remodeling components such as Myo2, Exo84, and Chs2 to the division site, while the
septin double ring appears to contribute, but less critically, to this process. Bud4 is involved in maintaining the septin ring at the mother
side. The septin double ring may also regulate SS formation and cell separation by controlling the localization, organization, and/or activation
of cell-wall remodeling proteins, such as glucan synthases and cell-wall hydrolases.
Article in press - uncorrected proof
Role of septins during cytokinesis in budding yeast
other associated proteins (Figure 4A). Strikingly, the localizations of the proteins as observed by light microscopy correlate well with the electron-microscopy observations
showing asymmetries of cleavage-furrow ingression and PS
formation along one or both of the relevant axes (Figure 4B).
It is also important to note that the scaffolding role of the
septins is almost certainly not completed when the septin
hourglass splits. First, in myo1D cells, Chs2 is still delivered
to the division site and maintained there, presumably by the
septin double ring (Figure 7C, left) (Schmidt et al., 2002;
Tolliday et al., 2003). Second, the two septin rings appear to
function as scaffolds for budding-landmark proteins, such as
Bud3 and Bud4, that mark the old division sites on both
mother and daughter cells (Chant et al., 1995; Sanders and
Herskowitz, 1996). Finally, the double ring is probably
important for post-cytokinesis processes, such as SS formation and cell separation (Figure 8), as cdc10D cells do tend
to form cell chains. Because bud4D cells separate efficiently
despite lacking discrete septin double rings, the ring(s) presumably functions as a scaffold rather than a diffusion barrier
in these processes.
Is there a common role for the septins in cytokinesis
in different organisms?
Although this question remains difficult to answer with confidence, there are some tantalizing clues. For example, in the
evolutionarily distant fission yeast S. pombe, the septin
assembly at the presumptive division site forms only after
assembly of the AMR, and the AMR itself appears to serve
as the landmark for targeting the septum-synthesizing
enzyme Cps1 (Liu et al., 2002), much as seen after septinhourglass splitting, or in a cdc10 or bud4 mutant, in S. cerevisiae. However, the septin double ring appears to serve as
a scaffold for holding the exocyst and other division factors
in place during cell separation (Berlin et al., 2003; MartinCuadrado et al., 2005). In mammalian cells, septins are colocalized with the AMR from furrow initiation to AMR
disassembly at the midbody stage (Estey et al., 2010), and
are then enriched in the intercellular bridge. Before the midbody stage, the septins appear to act as a scaffold to bring
myosin-II molecules and their activating kinases together for
AMR assembly and contraction (Joo et al., 2007). At the
midbody stage and after, the septins are involved in abscission, apparently at least in part by maintaining the exocyst
at the intercellular bridge. Taken together, these observations
suggest that the septins function primarily as scaffolds during
cytokinesis and cell separation in organisms ranging from
yeast to humans, although the precise components that are
targeted to them, and the relationship of scaffolding by the
septins relative to that by the AMR, may vary in different
cases.
Materials and methods
Strains and growth conditions
Yeast strains used in this study are listed in Table 1. Standard culture
media and genetic methods were used throughout this study (Guth-
823
rie and Fink, 1991). Where noted, cells were grown in YM-P, a rich,
buffered liquid medium (Lillie and Pringle, 1980). To select for the
loss of URA3-containing plasmids, 1 mg/ml 5-fluoroorotic acid
(5-FOA) (Research Products International, Prospect, IL, USA) was
added to media. Except where noted, targeted gene deletion or tagging was performed by a PCR-based method (Longtine et al.,
1998b).
Plasmids
All primers were purchased from Integrated DNA Technologies.
Plasmid YIp128-CDC3-GFP (integrative, LEU2) carries N-terminally GFP-tagged CDC3 under the control of its own promoter (Gao
et al., 2007). Plasmid YIp128-CDC3-mCherry is the same as
YIp128-CDC3-GFP except that the GFP ORF (open reading frame)
was replaced precisely by the mCherry ORF (Gao et al., 2007).
Plasmid YIp204-CDC3-mCherry (integrative, TRP1) was constructed by sub-cloning a 5.3-kb SalI-EcoRI fragment carrying mCherryCDC3 from YIp128-CDC3-mCherry into YIplac204 (Gietz and
Sugino, 1988). Plasmid YCp111-CHS2 was constructed by subcloning a 4.6-kb HindIII-XbaI CHS2 fragment from pEC2 (Ford et
al., 1996; kindly provided by Dr. Enrico Cabib, National Institutes
of Health, Bethesda) into HindIII/XbaI-digested YCplac111 (Gietz
and Sugino, 1988). Plasmid pRS305-CHS2-GFP (integrative,
LEU2) was constructed by first tagging CHS2 on YCp111-CHS2 at
its 39-end with GFP-KanMX6 using a standard PCR-based method
(Longtine et al., 1998b), and then sub-cloning the ;7.1-kb
HindIII-XbaI fragment carrying CHS2-GFP-KanMX6 from the
resulting plasmid (YCp111-CHS2-GFP-KanMX6) into pRS305
(Sikorski and Hieter, 1989). In the second step of construction, a
two-step ligation was performed due to the presence of a HindIII
site in KanMX6. Plasmid pRS314-MYO1-mCherry (CEN, TRP1)
was constructed by sub-cloning an ;8.0-kb SalI-ClaI fragment
from pRS316-MYO1-mCherry (Fang et al., 2010) into HindIII/ClaIdigested pRS314 (Sikorski and Hieter, 1989). Plasmid NRB884
(integrative, URA3) carries the 39-region of EXO84 with a GFP
inserted in-frame before its stop codon (kindly provided by Dr. Wei
Guo, University of Pennsylvania). Transformation with BglIIdigested NRB884 should result in the generation of a single copy
of C-terminally GFP-tagged EXO84 at its genomic locus. Plasmid
YCp111-CDC3-GFP (CEN, LEU2) and YCp111-CDC3-CFP carry
GFP- and CFP-tagged CDC3 under its own promoter control (Iwase
et al., 2006; Nishihama et al., 2009). Plasmid pSS17 (2 mm, URA3)
carries BUD4 under its own promoter control (Sanders and Herskowitz, 1996) (kindly provided by Dr. Hay-Oak Park, The Ohio
State University). Plasmids YCp50-MYO1 (kindly provided by Dr.
Susan Brown, University of Michigan) and pRS316-MYO1 (CEN,
URA3) (Ko et al., 2007) carry MYO1 under its own promoter
control.
Live-cell imaging and electron microscopy
For most live-cell imaging, cells were grown at 238C in synthetic
complete (SC)-dropout (a specific nutrient was omitted) media
selecting for the presence of a plasmid or, if no plasmid was present,
selecting for Cdc3-mCherry (Cdc3-RFP) (SC-Leu medium). Cells
were then concentrated by centrifugation and spotted on a slab of
SC media containing 2% agarose, which was sealed by nail polish.
Images were acquired at 238C on a spinning-disk confocal microscope equipped with a Yokogawa CSU 10 scan head combined with
an Olympus IX 71 microscope and an Olympus 100=objective (1.4
NA, Plan S-Apo oil immersion). Acquisition and hardware were
controlled by MetaMorph version 7.7 (Molecular Devices, Downingtown, PA, USA). A Hamamatsu ImagEM EMCCD camera
(Bi and Pringle, 1996)
(Bi and Pringle, 1996)
(Bi et al., 1998)
This studya
This studyb
This studyc
This studyc
This studyd
This studyd
This studye
This studye
This studyf
This studyf
This studyg
This studyg
This studyh
This studyh
This studyi
This studyi
This studyi
W303; This studyj
This studyk
This studyk
This studyk
W303; This studyl
This studye
This studye
This studym
(Fang et al., 2010)
This studyn
This studyn
This studya
W303; (Ko et al., 2007)
This studyo
This studyp
This studyq
W303; (Babour et al., 2010)
This studyr
a his3 leu2 lys2 trp1 ura3
a his3 leu2 lys2 trp1 ura3
As YEF473A except MYO1-GFP:kanMX6
As YEF473A except myo1D::His3MX6 wYCp50-MYO1x
As YEF473A except cdc10D::kanMX6
As YEF473A except cdc10D::kanMX6 CDC3-mCherry:LEU2
As YEF473A except CDC3-mCherry:LEU2
As YEF473A except CDC3-mCherry:LEU2 EXO84-GFP:URA3
As YEF473A except cdc10D::kanMX6 CDC3-mCherry:LEU2 EXO84-GFP:URA3
As YEF473A except CDC3-mCherry:LEU2 CHS2-GFP:His3MX6
As YEF473A except cdc10D::kanMX6 CDC3-mCherry:LEU2 CHS2-GFP:His3MX6
As YEF473A except CDC3-mCherry:LEU2 MYO2-ARG-GFP:His3MX6
As YEF473A except cdc10D::kanMX6 CDC3-mCherry:LEU2 MYO2-ARG-GFP:His3MX6
As YEF473A except CDC3-GFP:LEU2 NUP57-mCherry:His3MX6
As YEF473A except cdc10D::kanMX6 CDC3-GFP:LEU2 NUP57-mCherry:His3MX6
As YEF473A except NUP57-GFP:URA3
As YEF473A except cdc10D::kanMX6 NUP57-GFP:URA3
As YEF473B except wYCp50-MYO1x
As YEF473A except cdc10D::kanMX6 wYCp50-MYO1x
As YEF473A except cdc10D::kanMX6 myo1D::His3MX6 wYCp50-MYO1x
a ade2-1 his3-11,15 leu2-3,112 trp1-1 ura3-3 can1-100 CDC3-GFP:LEU2
As YEF473A except cdc10-1 CDC3-mCherry:LEU2 CHS2-GFP:His3MX6
As YEF473A except myo1D::kanMX6 CDC3-mCherry:LEU2 CHS2-GFP:His3MX6
As YEF473A except myo1D::kanMX6 cdc10-1 CDC3-mCherry:LEU2 CHS2-GFP:His3MX6
a ade2-1 his3-11,15 leu2-3,112 trp1-1 ura3-3 can1-100 CDC3-GFP:LEU2 wpSS17x
As YEF473A except CDC3-mCherry:LEU2 BUD4-GFP:TRP1
As YEF473A except cdc10D::kanMX6 CDC3-mCherry:LEU2 BUD4-GFP:TRP1
As YEF473A except MYO1-GFP CDC3-mCherry:LEU2 cdc10D::kanMX6
As YEF473A except MYO1-GFP CDC3-mCherry:LEU2
As YEF473A except bud4D::His3MX6
As YEF473A except BUD4-GFP:TRP1
As YEF473B except myo1D::kanMX6 wpRS316-MYO1x
a/a ade2-1/ade2-1 his3-11,15/his3-11,15 leu2-3,112/leu2-3,112 trp1-1/trp1-1 ura3-3/ura3-3 can1-100/can1-100
As YEF473A except cdc10-1 myo1D::kanMX6 wpRS316-MYO1x
As YEF473A except cdc10-1 wpRS316-MYO1x
As YEF473A except MYO1-GFP:kanMX6 bud4D::His3MX6
a ade2-1 his3-11,15 leu2-3,112 trp1-1 ura3-3 can1-100 bar1D::LEU2 CDC10-GFP:kanMX6
As YEF473A except cdc10D::kanMX6 CHS2-GFP:KanMX6:LEU2 wpRS314-Myo1-C-mCherryx
YEF473A
YEF473B
YEF1681
YEF2030
YEF5683
YEF5797
YEF5804
YEF5862
YEF5873
YEF5874
YEF5875
YEF5986
YEF5987
YEF6021
YEF6022
YEF6033
YEF6034
YEF6433
YEF6437
YEF6442
YEF6450
YEF6453
YEF6454
YEF6455
YEF6457
YEF6468
YEF6469
YJL496A
XDY286
KNY117
KNY312
RNY471
RNY501
RNY2537
RNY2546
RNY2630
MNY1031
YO1511
b
Segregants of YEF473-derived heterozygous diploid strains with myo1D::His3MX6 (or kanMX6) that had been transformed with the designated MYO1 plasmid.
Constructed by transforming PCR-amplified cdc10D::KanMX6 from a yeast strain (kindly provided by Andrew Dancis at the University of Pennsylvania) into YEF473A.
c
BglII-digested YIp128-CDC3-mCherry (integrative at CDC3 locus) was transformed into YEF473A (WT) and YEF5683 (cdc10D).
d
BglII-digested plasmid NRB884 was transformed into YEF5804 (WT) and YEF5797 (cdc10D) integrating it at the EXO84 locus.
a
Source
Genotype
Strain
Table 1 Yeast strains used in this study.
Article in press - uncorrected proof
824 C. Wloka et al.
CHS2-GFP:His3MX6 was transformed into YEF5804 (WT) and YEF5797 (cdc10D) by amplifying from the chromosomal DNA of YEF5762 using PCR with the primer set: CHS2-GFP-AMPforward: TTGTCGTTCAAGGTCCAGATGG and CHS2-GFP-AMP-reverse: CGCTCTCTACCCATAAGGATGAAG). Similarly, BUD4-GFP:TRP1 was PCR-amplified from KNY312 using a pair
of primers 257-bp upstream and 300-kb downstream of the BUD4 stop codon and transformed into YEF5804 and YEF5797, respectively, to generate strains YEF6468 and YEF6469.
f
MYO2-ARG-GFP:His3MX6 was transformed into YEF5804 (WT) and YEF5797 (cdc10D) by amplifying from the chromosomal DNA of YKT520 (K. Tanaka, Hokkaido University, Sapporo,
Japan) with PCR using the pair of primers (MYO2-GFP-AMP-forward: TTCACAATACCAGGTGGC and MYO2-GFP-AMP-reverse: CAGAAAGCAAATGTGGTGG).
g
NUP57-mCherry:His3MX6 was transformed into YEF5804 (WT) and YEF5797 (cdc10D) by amplifying from chromosomal DNA of YEF4529 as the template, which was constructed in the
YEF473A background using the standard PCR-based method (Longtine et al., 1998b), by PCR with the pair of primers NUP57-RFP-AMP-forward: AAAGAACGTGCTAAAAACATT and NUP57RFP-AMP-reverse: ATGTATCTCTTTATTCTTCCAG.
h
NUP57-GFP:URA3 was amplified by PCR using the chromosomal DNA from YEF5152, which was constructed using the standard PCR-based method (Longtine et al., 1998b), using the pair
of primers: NUP57-RFP-AMP-forward: AAAGAACGTGCTAAAAACATT and NUP57-RFP-AMP-reverse: ATGTATCTCTTTATTCTTCCAG) and transformed into YEF5804 (WT) and YEF5797
(cdc10D).
i
Segregants from YEF6411 (a/a cdc10D::kanMX6/CDC10 myo1D::His3MX6/MYO1 CDC3-mCherry:TRP1/CDC3 wYCp50-MYO1x). YEF6441 was constructed by transforming PCR-amplified
cdc10D::kanMX6 from YEF5683 into YEF1751 (Bi et al., 1998), followed by transformations of BglII-digested YIp204-CDC3-mCherry and then of YCp50-MYO1.
j
BglII-digested YIp128-CDC3-GFP was integrated at the CDC3 locus in W1588-4C (Ko et al., 2007).
k
BglII-digested YIp128-CDC3-GFP was transformed into RNY471 (myo1D), RNY2546 (cdc10-1), and RNY2537 (cdc10-1 myo1D) carrying the cover plasmid pRS316-MYO1. The resulting
strains were then transformed by CHS2-GFP:His3MX6, which was PCR-amplified using the chromosomal DNA of YEF5762 as the template and the primer set: CHS2-GFP-forward: CAAGAATGATTATTATAGAGAT and CHS2-GFP-reverse: GAGAACTTTAGCGTCACCA) (note: different primer set than in ‘e’). The resulting strains were grown under non-selective condition and
then selected for the loss of the cover plasmid on SC plates containing 5FOA to yield the desired strains.
l
pSS17 was introduced into YEF6450.
m
Constructed by transforming BglII-digested YIp128-CDC3-GFP into XDY41 (Fang et al., 2010) and transforming PCR-amplified cdc10D::KanMX6 from a yeast strain from the Research
Genetics deletion collection (kindly provided by Andrew Dancis at the University of Pennsylvania).
n
Segregant of the wild-type diploid strain YEF473 that had been transformed with a bud4D::His3MX6 or BUD4-GFP:TRP1 cassette, respectively.
o
Segregant of a cross between RNY471 and M-1620 (YEF473A with cdc10-1; kindly provided by Mark Longtine at Washington University in St. Louis).
p
pRS316-MYO1 was introduced into M-1620 (see footnote o).
q
Segregant of a cross between a bud4D::His3MX6 strain and a MYO1-GFP:kanMX6 strain.
r
Constructed by transforming AflII-digested plasmid pRS305-CHS2-GFP into YEF5683 and integrating it at the LEU2 locus, followed by transformation of the plasmid pRS314-MYO1-C-mCherry.
e
Table 1 (Continued)
Article in press - uncorrected proof
Role of septins during cytokinesis in budding yeast
825
Article in press - uncorrected proof
826 C. Wloka et al.
(model C9100-13, Bridgewater, NJ, USA) was used for capture.
Diode lasers for excitation (488 nm for GFP and 561 nm for mCherry/RFP) were housed in a launch constructed by Spectral
Applied Research (Richmond Hill, Ontario). Images were taken every 1 min with z-stacks ranging from 11=0.3 mm to 12=0.5 mm.
A maximum projection was created with NIH ImageJ (1.45b).
For imaging experiments involving temperature shifts (Figure
7C), cells of different strains were grown to exponential phase and
spotted on agarose slides as described above. The sealed slide was
then put in a 348C incubator for 25–50 min (except for the cdc10-1
myo1D cells; see legend for Figure 7C) and then immediately put
on the same spinning-disk confocal microscope now equipped with
a temperature control system (Pathology Devices ‘LiveCell’ Stage
Top Incubation System, P/N: 05110032 with a heated insert, P/N:
05110073) set at 378C for imaging.
For quantification of fluorescence intensities (Figures 1 and 2),
the integrated density at the bud neck region was calculated by
subtracting the fluorescence intensity in the cytosol from the total
intensity in an ImageJ-drawn polygon covering the neck region.
Quantification (mean"standard deviation) was performed with
GraphPad Prism Version 5.
Light microscopy for Figure 6 and electron microscopy for Figure
5B were performed as described previously (Nishihama et al.,
2009).
Actin staining
All strains were grown in SC media containing 2% dextrose at 238C
overnight. All samples were processed at 238C as well. Formaldehyde was added to the cultures at an OD600 of 0.6 to a final concentration of 3.7% and incubated for 1 h in a roller drum. After
washing three times with 1=PBS, cells were incubated for 15 min
in microcentrifuge tubes with 1=PBS containing 0.2% Triton
X-100. Cells were then washed two times with 1=PBS and incubated, while shaking in the dark for 30 min, with 100 ml of a mix
containing 0.1 U Alexa Fluor 568-phalloidin (Invitrogen, Eugene,
OR, USA), 1=PBS and 10 mg/ml BSA. After three times washing
with 1=PBSq10 mg/ml BSA, cells were resuspended in mounting
media (Vector Laboratories, Burlingame, CA, USA) and spotted on
an SC-agarose slide, which was then sealed with nail polish and
imaged. For acquisition and 3D reconstruction, the software
MetaMorph was used. 3D reconstruction videos were made using
MetaMorph or NIH ImageJ (1.45b) using the 3D projection
function.
Acknowledgments
We thank Eric Chen, Mark Longtine, Hay-Oak Park, Andrew Dancis, Susan Brown, Kenichi Nakashima, Enrco Cabib, Wei Guo,
Kazuma Tanaka, and Maho Niwa for yeast strains and plasmids,
Maho Niwa for sharing unpublished data, and the members of the
Bi and Pringle laboratories for discussions. This work was supported by grants GM87365 (to E.B.) and GM31006 (to J.R.P.) from
the National Institutes of Health.
References
Babour, A., Bicknell, A.A., Tourtellotte, J., and Niwa, M. (2010).
A surveillance pathway monitors the fitness of the endoplasmic
reticulum to control its inheritance. Cell 142, 256–269.
Balasubramanian, M.K., Bi, E., and Glotzer, M. (2004). Comparative analysis of cytokinesis in budding yeast, fission yeast and
animal cells. Curr. Biol. 14, R806–818.
Barr, F.A. and Gruneberg, U. (2007). Cytokinesis: placing and making the final cut. Cell 131, 847–860.
Berlin, A., Paoletti, A., and Chang, F. (2003). Mid2p stabilizes septin rings during cytokinesis in fission yeast. J. Cell Biol. 160,
1083–1092.
Bertin, A., McMurray, M.A., Grob, P., Park, S.S., Garcia, G., 3rd,
Patanwala, I., Ng, H.L., Alber, T., Thorner, J., and Nogales, E.
(2008). Saccharomyces cerevisiae septins: supramolecular organization of heterooligomers and the mechanism of filament assembly. Proc. Natl. Acad. Sci. USA 105, 8274–8279.
Bi, E. (2001). Cytokinesis in budding yeast: the relationship
between actomyosin ring function and septum formation. Cell
Struct. Funct. 26, 529–537.
Bi, E. and Pringle, J.R. (1996). ZDS1 and ZDS2, genes whose products may regulate Cdc42p in Saccharomyces cerevisiae. Mol.
Cell. Biol. 16, 5264–5275.
Bi, E., Maddox, P., Lew, D.J., Salmon, E.D., McMillan, J.N., Yeh,
E., and Pringle, J.R. (1998). Involvement of an actomyosin contractile ring in Saccharomyces cerevisiae cytokinesis. J. Cell
Biol. 142, 1301–1312.
Boyd, C., Hughes, T., Pypaert, M., and Novick, P. (2004). Vesicles
carry most exocyst subunits to exocytic sites marked by the
remaining two subunits, Sec3p and Exo70p. J. Cell Biol. 167,
889–901.
Carvalho, A., Desai, A., and Oegema, K. (2009). Structural memory
in the contractile ring makes the duration of cytokinesis independent of cell size. Cell 137, 926–937.
Castillon, G.A., Adames, N.R., Rosello, C.H., Seidel, H.S., Longtine, M.S., Cooper, J.A., and Heil-Chapdelaine, R.A. (2003).
Septins have a dual role in controlling mitotic exit in budding
yeast. Curr. Biol. 13, 654–658.
Chant, J. and Herskowitz, I. (1991). Genetic control of bud site
selection in yeast by a set of genes that constitute a morphogenetic pathway. Cell 65, 1203–1212.
Chant, J., Mischke, M., Mitchell, E., Herskowitz, I., and Pringle,
J.R. (1995). Role of Bud3p in producing the axial budding pattern of yeast. J. Cell Biol. 129, 767–778.
Chuang, J.S. and Schekman, R.W. (1996). Differential trafficking
and timed localization of two chitin synthase proteins, Chs2p
and Chs3p. J. Cell Biol. 135, 597–610.
Cid, V.J., Adamikova, L., Sanchez, M., Molina, M., and Nombela,
C. (2001). Cell cycle control of septin ring dynamics in the
budding yeast. Microbiology 147, 1437–1450.
DeMarini, D.J., Adams, A.E.M., Fares, H., De Virgilio, C., Valle,
G., Chuang, J.S., and Pringle, J.R. (1997). A septin-based hierarchy of proteins required for localized deposition of chitin in
the Saccharomyces cerevisiae cell wall. J. Cell Biol. 139, 75–93.
Dobbelaere, J. and Barral, Y. (2004). Spatial coordination of cytokinetic events by compartmentalization of the cell cortex. Science 305, 393–396.
Elia, N., Sougrat, R., Spurlin, T.A., Hurley, J.H., and LippincottSchwartz, J. (2011). Dynamics of endosomal sorting complex
required for transport (ESCRT) machinery during cytokinesis
and its role in abscission. Proc. Natl. Acad. Sci. USA 108,
4846–4851.
Epp, J.A. and Chant, J. (1997). An IQGAP-related protein controls
actin-ring formation and cytokinesis in yeast. Curr. Biol. 7,
921–929.
Estey, M.P., Di Ciano-Oliveira, C., Froese, C.D., Bejide, M.T., and
Trimble, W.S. (2010). Distinct roles of septins in cytokinesis:
SEPT9 mediates midbody abscission. J. Cell Biol. 191, 741–
749.
Fang, X., Luo, J., Nishihama, R., Wloka, C., Dravis, C., Travaglia,
M., Iwase, M., Vallen, E.A., and Bi, E. (2010). Biphasic target-
Article in press - uncorrected proof
Role of septins during cytokinesis in budding yeast
ing and cleavage furrow ingression directed by the tail of a myosin-II. J. Cell Biol. 191, 1333–1350.
Fares, H., Goetsch, L., and Pringle, J.R. (1996). Identification of a
developmentally regulated septin and involvement of the septins
in spore formation in Saccharomyces cerevisiae. J. Cell Biol.
132, 399–411.
Fares, H., Peifer, M., and Pringle, J.R. (1995). Localization and
possible functions of Drosophila septins. Mol. Biol. Cell 6,
1843–1859.
Field, C.M., Coughlin, M., Doberstein, S., Marty, T., and Sullivan,
W. (2005). Characterization of anillin mutants reveals essential
roles in septin localization and plasma membrane integrity.
Development 132, 2849–2860.
Flescher, E.G., Madden, K., and Snyder, M. (1993). Components
required for cytokinesis are important for bud site selection in
yeast. J. Cell Biol. 122, 373–386.
Ford, R.A., Shaw, J.A., and Cabib, E. (1996). Yeast chitin synthases
1 and 2 consist of a non-homologous and dispensable N-terminal
region and of a homologous moiety essential for function. Mol.
Gen. Genet. 252, 420–428.
Frazier, J.A., Wong, M.L., Longtine, M.S., Pringle, J.R., Mann, M.,
Mitchison, T.J., and Field, C. (1998). Polymerization of purified
yeast septins: evidence that organized filament arrays may not
be required for septin function. J. Cell Biol. 143, 737–749.
Fujita, A., Oka, C., Arikawa, Y., Katagai, T., Tonouchi, A., Kuhara,
S., and Misumi, Y. (1994). A yeast gene necessary for bud-site
selection encodes a protein similar to insulin-degrading
enzymes. Nature 372, 567–570.
Gao, X.D., Sperber, L.M., Kane, S.A., Tong, Z., Hin Yan Tong, A.,
Boone, C., and Bi, E. (2007). Sequential and distinct roles of
the cadherin domain-containing protein Axl2p in cell polarization in yeast cell cycle. Mol. Biol. Cell 18, 2542–2560.
Gietz, R.D. and Sugino, A. (1988). New yeast-Escherichia coli shuttle vectors constructed with in vitro mutagenized yeast genes
lacking six-base pair restriction sites. Gene 74, 527–534.
Gladfelter, A.S., Pringle, J.R., and Lew, D.J. (2001). The septin
cortex at the yeast mother-bud neck. Curr. Opin. Microbiol. 4,
681–689.
Goldbach, P., Wong, R., Beise, N., Sarpal, R., Trimble, W.S., and
Brill, J.A. (2010). Stabilization of the actomyosin ring enables
spermatocyte cytokinesis in Drosophila. Mol. Biol. Cell 21,
1482–1493.
Guizetti, J., Schermelleh, L., Mantler, J., Maar, S., Poser, I., Leonhardt, H., Muller-Reichert, T., and Gerlich, D.W. (2011). Cortical
constriction during abscission involves helices of ESCRT-IIIdependent filaments. Science 331, 1616–1620.
Guo, J., Gong, T., and Gao, X.D. (2011). Identification of an amphipathic helix important for the formation of ectopic septin spirals
and axial budding in yeast axial landmark protein Bud3p. PLoS
One 6, e16744.
Guo, W., Grant, A., and Novick, P. (1999). Exo84p is an exocyst
protein essential for secretion. J. Biol. Chem. 274, 23558–
23564.
Guthrie, C. and Fink, G.R. (1991). Guide to yeast genetics and
molecular biology. Methods Enzymol. Vol. 194, 933 pp.
Haarer, B.K. and Pringle, J.R. (1987). Immunofluorescence localization of the Saccharomyces cerevisiae CDC12 gene product to
the vicinity of the 10-nm filaments in the mother-bud neck. Mol.
Cell. Biol. 7, 3678–3687.
Hall, P.A., Russell, S.E.H., and Pringle, J.R. (2008). The Septins
(John Wiley & Sons, Ltd).
Halme, A., Michelitch, M., Mitchell, E.L., and Chant, J. (1996).
Bud10p directs axial cell polarization in budding yeast and
resembles a transmembrane receptor. Curr. Biol. 6, 570–579.
827
Hartwell, L.H. (1971). Genetic control of the cell division cycle in
yeast. IV. Genes controlling bud emergence and cytokinesis.
Exp. Cell Res. 69, 265–276.
Iwase, M., Luo, J., Bi, E., and Toh-e, A. (2007). Shs1 plays separable roles in septin organization and cytokinesis in Saccharomyces cerevisiae. Genetics 177, 215–229.
Iwase, M., Luo, J., Nagaraj, S., Longtine, M., Kim, H.B., Haarer,
B.K., Caruso, C., Tong, Z., Pringle, J.R., and Bi, E. (2006). Role
of a cdc42p effector pathway in recruitment of the yeast septins
to the presumptive bud site. Mol. Biol. Cell 17, 1110–1125.
Izumikawa, T., Kanagawa, N., Watamoto, Y., Okada, M., Saeki, M.,
Sakano, M., Sugahara, K., Sugihara, K., Asano, M., and Kitagawa, H. (2010). Impairment of embryonic cell division and
glycosaminoglycan biosynthesis in glucuronyltransferase-I-deficient mice. J. Biol. Chem. 285, 12190–12196.
Johnston, G.C., Prendergast, J.A., and Singer, R.A. (1991). The Saccharomyces cerevisiae MYO2 gene encodes an essential myosin
for vectorial transport of vesicles. J. Cell Biol. 113, 539–551.
Joo, E., Surka, M.C., and Trimble, W.S. (2007). Mammalian SEPT2
is required for scaffolding nonmuscle myosin II and its kinases.
Dev. Cell 13, 677–690.
Joo, E., Tsang, C.W., and Trimble, W.S. (2005). Septins: traffic control at the cytokinesis intersection. Traffic 6, 626–634.
Kim, H.B., Haarer, B.K., and Pringle, J.R. (1991). Cellular morphogenesis in the Saccharomyces cerevisiae cell cycle: localization of the CDC3 gene product and the timing of events at
the budding site. J. Cell Biol. 112, 535–544.
Kinoshita, M., Kumar, S., Mizoguchi, A., Ide, C., Kinoshita, A.,
Haraguchi, T., Hiraoka, Y., and Noda, M. (1997). Nedd5, a
mammalian septin, is a novel cytoskeletal component interacting
with actin-based structures. Genes Dev. 11, 1535–1547.
Ko, N., Nishihama, R., Tully, G.H., Ostapenko, D., Solomon, M.J.,
Morgan, D.O., and Pringle, J.R. (2007). Identification of yeast
IQGAP (Iqg1p) as an anaphase-promoting-complex substrate
and its role in actomyosin-ring-independent cytokinesis. Mol.
Biol. Cell 18, 5139–5153.
Lee, P.R., Song, S., Ro, H.S., Park, C.J., Lippincott, J., Li, R.,
Pringle, J.R., De Virgilio, C., Longtine, M.S., and Lee, K.S.
(2002). Bni5p, a septin-interacting protein, is required for normal
septin function and cytokinesis in Saccharomyces cerevisiae.
Mol. Cell. Biol. 22, 6906–6920.
Lesage, G. and Bussey, H. (2006). Cell wall assembly in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 70, 317–343.
Lillie, S.H. and Brown, S.S. (1994). Immunofluorescence localization of the unconventional myosin, Myo2p, and the putative
kinesin-related protein, Smy1p, to the same regions of polarized
growth in Saccharomyces cerevisiae. J. Cell Biol. 125, 825–842.
Lillie, S.H. and Pringle, J.R. (1980). Reserve carbohydrate metabolism in Saccharomyces cerevisiae: responses to nutrient limitation. J. Bacteriol. 143, 1384–1394.
Lippincott, J. and Li, R. (1998). Sequential assembly of myosin II,
an IQGAP-like protein, and filamentous actin to a ring structure
involved in budding yeast cytokinesis. J. Cell Biol. 140, 355–
366.
Lippincott, J., Shannon, K.B., Shou, W., Deshaies, R.J., and Li, R.
(2001). The Tem1 small GTPase controls actomyosin and septin
dynamics during cytokinesis. J. Cell Sci. 114, 1379–1386.
Lister, I.M., Tolliday, N.J., and Li, R. (2006). Characterization of
the minimum domain required for targeting budding yeast myosin II to the site of cell division. BMC Biol. 4, 19.
Liu, J., Tang, X., Wang, H., Oliferenko, S., and Balasubramanian,
M.K. (2002). The localization of the integral membrane protein
Cps1p to the cell division site is dependent on the actomyosin
Article in press - uncorrected proof
828 C. Wloka et al.
ring and the septation-inducing network in Schizosaccharomyces
pombe. Mol. Biol. Cell 13, 989–1000.
Longtine, M.S., DeMarini, D.J., Valencik, M.L., Al-Awar, O.S.,
Fares, H., De Virgilio, C., and Pringle, J.R. (1996). The septins:
roles in cytokinesis and other processes. Curr. Opin. Cell Biol.
8, 106–119.
Longtine, M.S., Fares, H., and Pringle, J.R. (1998a). Role of the
yeast Gin4p protein kinase in septin assembly and the relationship between septin assembly and septin function. J. Cell Biol.
143, 719–736.
Longtine, M.S., McKenzie, A., III, DeMarini, D.J., Shah, N.G.,
Wach, A., Brachat, A., Philippsen, P., and Pringle, J.R. (1998b).
Additional modules for versatile and economical PCR-based
gene deletion and modification in Saccharomyces cerevisiae.
Yeast 14, 953–961.
Maddox, A.S., Habermann, B., Desai, A., and Oegema, K. (2005).
Distinct roles for two C. elegans anillins in the gonad and early
embryo. Development 132, 2837–2848.
Martin-Cuadrado, A.B., Morrell, J.L., Konomi, M., An, H., Petit,
C., Osumi, M., Balasubramanian, M., Gould, K.L., Del Rey, F.,
and de Aldana, C.R. (2005). Role of septins and the exocyst
complex in the function of hydrolytic enzymes responsible for
fission yeast cell separation. Mol. Biol. Cell 16, 4867–4881.
McMurray, M.A., Bertin, A., Garcia, G., 3rd, Lam, L., Nogales, E.,
and Thorner, J. (2011). Septin filament formation is essential in
budding yeast. Dev. Cell 20, 540–549.
McMurray, M.A. and Thorner, J. (2009). Septins: molecular partitioning and the generation of cellular asymmetry. Cell Div. 4,
18.
Meitinger, F., Petrova, B., Lombardi, I.M., Bertazzi, D.T., Hub, B.,
Zentgraf, H., and Pereira, G. (2010). Targeted localization of
Inn1, Cyk3 and Chs2 by the mitotic-exit network regulates cytokinesis in budding yeast. J. Cell Sci. 123, 1851–1861.
Mizuguchi, S., Uyama, T., Kitagawa, H., Nomura, K.H., Dejima,
K., Gengyo-Ando, K., Mitani, S., Sugahara, K., and Nomura, K.
(2003). Chondroitin proteoglycans are involved in cell division
of Caenorhabditis elegans. Nature (London) 423, 443–448.
Mullins, J.M. and Biesele, J.J. (1973). Cytokinetic activities in a
human cell line: the midbody and the intercellular bridge. Tissue
Cell 5, 47–61.
Mullins, J.M. and Biesele, J.J. (1977). Terminal phase of cytokinesis
in D-985 cells. J. Cell Biol. 73, 672–684.
Mullins, J.M. and MacIntosh, J.R. (1982). Isolation and initial characterization of the mammalian midbody. J. Cell Biol. 94,
654–661.
Neufeld, T.P. and Rubin, G.M. (1994). The Drosophila peanut gene
is required for cytokinesis and encodes a protein similar to yeast
putative bud neck filament proteins. Cell 77, 371–379.
Nishihama, R., Schreiter, J.H., Onishi, M., Vallen, E.A., Hanna, J.,
Moravcevic, K., Lippincott, M.F., Han, H., Lemmon, M.A.,
Pringle, J.R., and Bi, E. (2009). Role of Inn1 and its interactions
with Hof1 and Cyk3 in promoting cleavage furrow and septum
formation in S. cerevisiae. J. Cell Biol. 185, 995–1012.
Oh, Y. and Bi, E. (2011). Septin structure and function in yeast and
beyond. Trends Cell Biol. 21, 141–148.
Park, H.O. and Bi, E. (2007). Central roles of small GTPases in the
development of cell polarity in yeast and beyond. Microbiol.
Mol. Biol. Rev. 71, 48–96.
Pollard, T.D. (2008). Progress towards understanding the mechanism of cytokinesis in fission yeast. Biochem. Soc. Trans. 36,
425–430.
Pollard, T.D. and Wu, J.Q. (2010). Understanding cytokinesis: lessons from fission yeast. Nat. Rev. Mol. Cell Biol. 11, 149–155.
Roemer, T., Madden, K., Chang, J., and Snyder, M. (1996). Selection of axial growth sites in yeast requires Axl2p, a novel plasma
membrane glycoprotein. Genes Dev. 10, 777–793.
Roh, D.H., Bowers, B., Schmidt, M., and Cabib, E. (2002). The
septation apparatus, an autonomous system in budding yeast.
Mol. Biol. Cell 13, 2747–2759.
Sanchez-Diaz, A., Marchesi, V., Murray, S., Jones, R., Pereira, G.,
Edmondson, R., Allen, T., and Labib, K. (2008). Inn1 couples
contraction of the actomyosin ring to membrane ingression during cytokinesis in budding yeast. Nat. Cell Biol. 10, 395–406.
Sanders, S.L. and Herskowitz, I. (1996). The Bud4 protein of yeast,
required for axial budding, is localized to the mother/bud neck
in a cell cycle-dependent manner. J. Cell Biol. 134, 413–427.
Sburlati, A. and Cabib, E. (1986). Chitin synthetase 2, a presumptive participant in septum formation in Saccharomyces cerevisiae. J. Biol. Chem. 261, 15147–15152.
Schmidt, M., Bowers, B., Varma, A., Roh, D.-H., and Cabib, E.
(2002). In budding yeast, contraction of the actomyosin ring and
formation of the primary septum at cytokinesis depend on each
other. J. Cell Sci. 115, 293–302.
Schroeder, T.E. (1972). The contractile ring II: determining its brief
existence, volumetric changes, and vital role in cleaving arbacia
eggs. J. Cell Biol. 53, 419–434.
Shaw, J.A., Mol, P.C., Bowers, B., Silverman, S.J., Valdivieso,
M.H., Duran, A., and Cabib, E. (1991). The function of chitin
synthases 2 and 3 in the Saccharomyces cerevisiae cell cycle. J.
Cell Biol. 114, 111–123.
Sikorski, R.S. and Hieter, P. (1989). A system of shuttle vectors and
yeast host strains designed for efficient manipulation of DNA in
Saccharomyces cerevisiae. Genetics 122, 19–27.
Strickland, L.I. and Burgess, D.R. (2004). Pathways for membrane
trafficking during cytokinesis. Trends Cell Biol. 14, 115–118.
Szafer-Glusman, E., Giansanti, M.G., Nishihama, R., Bolival, B.,
Pringle, J., Gatti, M., and Fuller, M.T. (2008). A role for verylong-chain fatty acids in furrow ingression during cytokinesis in
Drosophila spermatocytes. Curr. Biol. 18, 1426–1431.
Tasto, J.J., Morrell, J.L., and Gould, K.L. (2003). An anillin homologue, Mid2p, acts during fission yeast cytokinesis to organize
the septin ring and promote cell separation. J. Cell Biol. 160,
1093–1103.
Tolliday, N., Pitcher, M., and Li, R. (2003). Direct evidence for a
critical role of Myosin II in budding yeast cytokinesis and the
evolvability of new cytokinetic mechanisms in the absence of
Myosin II. Mol. Biol. Cell 14, 798–809.
VerPlank, L. and Li, R. (2005). Cell cycle-regulated trafficking of
Chs2 controls actomyosin ring stability during cytokinesis. Mol.
Biol. Cell 16, 2529–2543.
Versele, M., Gullbrand, B., Shulewitz, M.J., Cid, V.J., Bahmanyar,
S., Chen, R.E., Barth, P., Alber, T., and Thorner, J. (2004). Protein-protein interactions governing septin heteropentamer assembly and septin filament organization in Saccharomyces
cerevisiae. Mol. Biol. Cell 15, 4568–4583.
Versele, M. and Thorner, J. (2004). Septin collar formation in budding yeast requires GTP binding and direct phosphorylation by
the PAK, Cla4. J. Cell Biol. 164, 701–715.
Voth, W.P., Olsen, A.E., Sbia, M., Freedman, K.H., and Stillman,
D.J. (2005). ACE2, CBK1, and BUD4 in budding and cell separation. Eukaryot. Cell 4, 1018–1028.
Vrabioiu, A.M. and Mitchison, T.J. (2006). Structural insights into
yeast septin organization from polarized fluorescence microscopy. Nature 443, 466–469.
Weirich, C.S., Erzberger, J.P., and Barral, Y. (2008). The septin family of GTPases: architecture and dynamics. Nat. Rev. Mol. Cell
Biol. 9, 478–489.
Article in press - uncorrected proof
Role of septins during cytokinesis in budding yeast
Xu, X. and Vogel, B.E. (2011). A secreted protein promotes cleavage furrow maturation during cytokinesis. Curr. Biol. 21, 114–
119.
Yeong, F.M. (2005). Severing all ties between mother and daughter:
cell separation in budding yeast. Mol. Microbiol. 55, 1325–
1331.
Yu, J.W., Mendrola, J.M., Audhya, A., Singh, S., Keleti, D.,
DeWald, D.B., Murray, D., Emr, S.D., and Lemmon, M.A.
(2004). Genome-wide analysis of membrane targeting by
829
S. cerevisiae pleckstrin homology domains. Mol. Cell 13, 677–
688.
Zhang, G., Kashimshetty, R., Ng, K.E., Tan, H.B., and Yeong, F.M.
(2006). Exit from mitosis triggers Chs2p transport from the
endoplasmic reticulum to mother-daughter neck via the secretory
pathway in budding yeast. J. Cell Biol. 174, 207–220.
Received May 8, 2011; accepted June 22, 2011