Downloaded from http://gut.bmj.com/ on June 17, 2017 - Published by group.bmj.com
748
Gut 2001;48:748–752
Leading article
Detection of persistent measles virus infection in Crohn’s
disease: current status of experimental work
The aetiology of Crohn’s disease is unknown. Any hypothesis must take into account the continuing increase in incidence in some countries, including the UK. The increase
aVects the population from early teens, and specific
comprehensive epidemiological studies in children and
adolescents show a continuing rise in the rate of age and
sex standardised incidence in Scotland.1 This suggests an
environmental trigger, which may interact with underlying
genetic susceptibility. A number of such environmental
triggers have been proposed, including persistent infections, transient infections in a host with abnormal mucosal
immunity, particulate materials, or dietary changes.
Persistent infection with the measles virus after wild-type
virus infections or immunisation with live attenuated measles vaccine have been proposed as important environmental triggers based on epidemiological observations.2 3 Measles is a single stranded RNA virus which can induce
immune suppression. Measles infection is generally self
limited and results in long term immunity, but rarely, persistent infection may occur after wild-type virus infection.
The virus has special aYnity for epithelial cells of the respiratory tract and cells of the immune system, such as lymphocytes and macrophages.4 A number of chronic diseases
have been linked with persistent measles virus infection.
These include multiple sclerosis, Paget’s disease, a variety
of autoimmune diseases, and autism, although definite evidence is lacking in each. Inflammatory bowel disease
(IBD), especially Crohn’s disease, has been linked to
persistent measles virus infection. Ekbom et al proposed
perinatal exposure to wild-type measles virus may lead to
development of Crohn’s disease later in life.2 3 Such case
control epidemiological studies are of course prone to a
variety of confounding factors, especially selection and
recall biases. Epidemiologically robust data from a large
controlled prospective study showed absence of a link
between intrauterine exposure to measles and Crohn’s disease.5 However, epidemiological studies linking persistent
measles virus infection to Crohn’s disease generated a
hypothesis6 for confirmation or rejection by searching for
measles virus in Crohn’s aVected tissue.
Another line of epidemiological evidence linking
Crohn’s disease with measles implicated the vaccine strain,
and the safety of measles-mumps-rubella vaccination has
been a topic of lively debate both in the medical and lay
press. Vaccines against measles, mumps, and rubella
(MMR) are produced from live attenuated viruses which
have been propagated in a variety of cell substrates, such as
embryonated chicken eggs and/or human diploid cells. The
genomes of all three viruses consist of a single stranded
RNA molecule that has negative polarity for measles and
mumps and positive polarity for rubella. MMR vaccines
are eVective and safe. Reported side eVects include aseptic
meningitis and acute arthritis.7 Aseptic meningitis was
ascribed to the Urabe strain of mumps virus, which was
withdrawn in 1992. Arthritis has been related to rubella
vaccination but no significant association between chronic
arthropathy and rubella vaccination has been found in
women. Severe allergic reactions to MMR may be related
to egg allergy or allergy to gelatin.8 In 1995, the safety of
measles and MMR vaccination was brought into question
by the suggestion that live attenuated measles vaccine may
be a risk factor for the development of IBD, especially
Crohn’s disease.9 This link was postulated following epidemiological observations of the temporal link between an
increasing incidence of Crohn’s disease and introduction of
live attenuated measles vaccine in 1968 in the UK. The
MMR vaccine was introduced much later in 1988.
However, the increase in the incidence of Crohn’s disease
started earlier than 1968 and still continues.1 A case
control study of 140 IBD patients (83 Crohn’s disease)
born after 1968 and 280 controls matched for age, sex, and
general practitioner area provided no support for the
hypothesis that measles vaccination in childhood predisposed to the later development of either IBD overall or
Crohn’s disease in particular.10 In Finland, a countrywide
surveillance system to detect serious adverse events was set
up in 1982 after introduction of MMR vaccination. By the
end of 1996, 1.8 million individuals were immunised and
three million vaccine doses were consumed. The rate of
serious adverse events with possible or indeterminate
causal relationship with MMR vaccination was 5.3 per
100 000 vaccinees or 3.2 per 100 000 vaccine doses. The
majority of serious adverse events were neurological or
allergic. No association between IBD and MMR vaccination was reported. This is currently the best prospective
data on the safety of MMR vaccination.11
Considerable interest was then generated by the report
of the presence of measles virus nucleocapsid protein in
intestinal tissues aVected by Crohn’s disease.12 This article
reviews the current state of the evidence from the
experimental work regarding the question of persistent
measles virus in Crohn’s disease. The epidemiological evidence itself has generated a lively debate13–17 but this article
deals with the experimental work aiming to confirm or
reject the hypothesis formulated from the epidemiological
evidence.
Measles serology
The hypothesis that persistent measles virus infection may
result in Crohn’s disease prompted serological studies for
measles antibody. Sera from 14 aVected members of two
French families with a high incidence of Crohn’s disease
and from unaVected family members as well as healthy age
and sex matched controls were tested for measles IgG and
IgM antibodies.18 Commercially available indirect enzyme
immunoassay kits (Whittaker Bioproducts Inc., Walkersville, Maryland, USA) were used to detect measles IgM
and IgG antibodies. There were no diVerences in measles
Abbreviations used in this paper: IBD, inflammatory bowel
disease; PCR, polymerase chain reaction; RT, reverse transcriptase;
SSPE, subacute sclerosing panencephalitis; NIBSC, National
Institute for Biological Standards and Control; MMR,
measles-mumps-rubella vaccination; pfu, plaque forming units.
Leading articles express the views of the author and not those of the editor and the editorial board
www.gutjnl.com
Downloaded from http://gut.bmj.com/ on June 17, 2017 - Published by group.bmj.com
Persistent measles virus infection in Crohn’s disease
749
IgM or IgG antibody levels between patients and controls,
or between patients and unaVected family members. The
authors concluded that their data did not support the
hypothesis that persistent measles virus infection causes
Crohn’s disease. Fisher and colleagues19 reported that the
median measles virus IgG antibody titre in Crohn’s disease
patients determined by an inhouse complement fixation
test was actually lower than the median titre in controls.
There was also a trend towards lower median measles virus
IgM antibody titre determined by a commercial ELISA in
Crohn’s disease patients compared with controls. In a
study from the National Institute for Biological Standards
and Control (NIBSC), all patients with Crohn’s disease,
ulcerative colitis, and non-IBD controls had detectable
levels of serum neutralisation antibodies against measles
virus.20 The average antibody titre for all patients and controls (n=30) was 1:197,20 suggesting that all patients had
either been exposed to measles wild-type or vaccine strains
previously. The antibody titres of the non-IBD control
group were similar to the titres of the Crohn’s disease and
ulcerative colitis groups. A characteristic feature of
serological studies in subacute sclerosing panencephalitis
(SSPE) cases, where measles persistence is well established, is the significantly elevated concentrations of
measles specific antibodies both in serum and cerebrospinal fluid.21–23 Such an increase in antibody concentrations
has not been detected in serum samples from IBD patients
by any research group. On serological grounds therefore it
is unlikely that Crohn’s disease shares with SSPE the characteristics of measles virus infection in early life followed by
a latent illness with persistent measles virus particles in the
target organ.
Non-polymerase chain reaction (PCR) based
methods
The initial methods that demonstrated the presence of
measles virus in Crohn’s aVected tissues included immunocytochemistry, in situ hybridisation, and transmission
electron microscopy.12 24 The specificity and methodology
used in these studies are open to question. Non-specific
reactivity of measles antibody can be problematic and the
measles nucleocapsid-like particles may resemble normal
cellular structures. Positive detection of measles virus in
Crohn’s tissue by transmission electron microscopy,
immunogold staining, and in situ hybridisation may be
related to lack of specificity of immune staining because of
cross reactivity or non-specific adherence. Evidence for
such cross reaction has been provided recently.25 Colonic
mucosa from 20 Crohn’s disease, 20 ulcerative colitis, 11
“non-IBD” colitis, and nine non-inflamed control patients
were immunohistochemically stained with the antimeasles
monoclonal antibody 4F12. Measles related antigen was
present not only in colons aVected with Crohn’s disease
but also in colons aVected with ulcerative colitis and in
non-IBD colitis. It was reported by the authors that the
measles related antigen was not derived from measles virus
but was an as yet unidentified human protein.26 Confirmation of measles virus detection by non-PCR based methods
has eluded other teams. There is ambiguity in discriminating virus-like particles from normal cellular structures
which is relevant to reports of immunogold electron
microscopy detection of measles virus in intestine,27 28 and
paramyxovirus could not be detected by electron microscopy consistently.29 Immunocytochemistry for a panel of
bacterial and viral organisms failed to detect evidence of
measles antigen in Crohn’s aVected tissues.30 Intestines and
mesenteric lymph nodes of 21 patients from two French
families with a high frequency of Crohn’s disease and
patients from Connecticut were studied by Liu and
colleagues.30 Control tissues were from ulcerative colitis or
indeterminate colitis or a miscellaneous group of surgically
resected specimens. Primary antibodies were against the
measles virus nucleocapsid protein, polyclonal (from the
Royal Free Hospital group) and monoclonal (from
Karolinska Institute). Positive control tissues were from
virus infected HEP-2 cell from Bion Inc. (Park Ridge, Illinois, USA) and from SSPE brain. In all cases studied (16
patients with Crohn’s disease, eight patients with ulcerative
colitis, and 10 normal controls) by indirect and labelled
streptavidin-biotin-peroxidase immunocytochemical techniques, tissues were non-specifically labelled by the
polyclonal measles nucleocapsid protein antibody. The
immunolabelling occurred in the nuclei of macrophages,
fibroblasts, giant cells, smooth muscle cells, and nerves,
and the labelled cells were distributed in the lamina
propria, submucosa, muscle layers, subserosa, and granulomas (in Crohn’s aVected tissues). In contrast with the
results obtained with the polyclonal antibody, none of the
Crohn’s disease, ulcerative colitis, or control tissues were
labelled by monoclonal measles nucleocapsid protein antibody although highly specific staining with this antibody
was observed in SSPE control brain tissue and in cell cultures containing measles virus. The polyclonal measles
antibody was not aYnity purified and therefore it probably
cross reacted with normal cellular components.30 Other
studies have raised concerns about the specificity of
measles virus anti-M protein monoclonal antibody, which
labelled antigen in Crohn’s disease aVected tissues by
immunofluorescence staining.31 Overall, the immunohistochemical techniques do not provide confirmatory evidence
for persistent measles virus infection in Crohn’s disease
and are contradictory. Therefore, investigators have tried
to identify measles virus RNA in aVected tissues using
PCR amplification.
PCR based methods
Measles specific PCR enables amplification of measles
virus RNA to allow definitive molecular characterisation.
Several laboratories developed their own RNA based
reverse transcription (RT) PCR assays to detect measles
virus genomic RNA in tissues derived from Crohn’s disease
patients. Most groups used resected materials which
provide large amounts of tissues involving all layers of the
intestine but often represented end stage disease after
intensive medical therapy, including immunosuppressives.
The sensitivity limits of these RT-PCR assays varied
considerably between laboratories,20 32–35 but a N, F gene
specific RT-PCR nested PCR is reported to have an assay
sensitivity of a single genome copy.33
The NIBSC evaluated both a two step approach (RT
followed by PCR and nested PCR) and a single step
approach (both RT and primary PCR step combined using
EZ RTth RNA PCR kit).20 The latter was at least 100- to
1000-fold more sensitive than the two step approach. The
NIBSC assay was able to identify a measles virus genome
sequence in control samples that had measles virus corresponding to as little as 5.5×10−3 plaque forming units (pfu).
Measles N gene primers used in this study were highly
sensitive and could amplify target sequence from all known
strains of measles virus. Partially homogenised brain material from a patient with SSPE was examined as a positive
control, and measles specific nucleic acid was detected
from a sample equivalent to 18 cells. In contrast, no tissue
sample from IBD patients derived from endoscopic
biopsies was positive for measles specific nucleic acid.
Biopsies from all control patients were also negative. A
total of 93 colonoscopic biopsies were examined and both
steroid naïve and steroid treated patients were included.
About one million cells were examined per biopsy. All
www.gutjnl.com
Downloaded from http://gut.bmj.com/ on June 17, 2017 - Published by group.bmj.com
750
Table 1
Ghosh, Armitage, Wilson, et al
Summary of polymerase chain reaction (PCR) studies performed to identify measles virus in inflammatory bowel disease
Study group
Diagostic groups
Tissue source
Royal Free Hospital,
London, UK35
CD, UC, IC,
controls
NIBSC, UK20
CD, UC, IC,
controls
Experimental procedure
Measles virus
presence
Assay sensitivity
Positive control
Resected material + Hybrid capture + N, H
PBMC
gene specific RT-PCR
104 RNA molecules
SSPE (brain); vaccine
recipient + SSPE (PBMC)
−ve
Biopsies +
lymphocytes
N gene specific
RT-PCR nested PCR
5.5×10-3 pfu
SSPE (brain); wild-type
measles virus strain
(94/31825) in Vero cells
−ve
Hirosaki University, Japan33 CD, UC,
controls
Resected intestine
N, F gene specific
RT-PCR nested PCR
Single viral genomic RNA
SSPE (brain); Vero E6 cells −ve
infected with Toyoshima
strain of measles virus
Akita and Osaka
University, Japan32
CD, UC,
controls
Resected intestine
+ biopsies
N, M, F, H gene
specific RT-PCR
Not reported
Not reported
−ve
Tokyo Medical University,
Kitasato Institute Tokyo,
Japan; Royal Free
Hospital, London, UK37
CD, UC,
controls
PBMC
F, H gene specific
RT-PCR nested PCR
Not reported
SSPE (brain); SSPE
(PBMC), vaccine and wild
strains
+ve
NIBSC, UK34
CD (aVected,
unaVected,
lymph nodes)
Resection specimen N, M, H gene specific
(aVected and
RT-PCR nested PCR
unaVected intestine
lymph nodes)
N: 5.5×10−2– 5.5×10−3 pfu
SSPE (brain); wild-type
measles virus strain
(94/31825) in Vero cells
−ve
M: 5.5×10−3 pfu
H: 5.5 ×10−1–5.5 ×10−2 pfu
CD, Crohn’s disease; UC, ulcerative colitis; IC, indeterminate colitis; pfu, plaque forming unit; PBMC, peripheral blood mononuclear cells; N, nucleocapsid protein
gene; M, matrix protein gene; F, fusion protein gene; H, haemagglutinin protein gene.
patients had detectable neutralisation antibodies against
measles virus in serum and 5/30 patients had confirmed
measles vaccination.
Thirty one peripheral blood lymphocyte preparations
(20 patients with IBD, 11 non-IBD controls) were also
examined by the rTth RT-PCR nested PCR method, as
described above, at the NIBSC.20 None of the amplifications of the nucleic acids extracted from the lymphocyte
preparations produced DNA fragments of the size
expected for measles specific sequences.20
Colonoscopic biopsies are superficial and may miss virus
persistence in deeper layers within the granulomas. Hence
full thickness resection specimens of seven Crohn’s disease
patients taken from macroscopically inflamed and healthy
areas of the gut as well as mesenteric lymph nodes were
further investigated.34 Resected specimens had been snap
frozen in liquid nitrogen immediately after removal.
Despite using oligonucleotide primers corresponding to
three diVerent portions of the measles virus genome (N,
M, and H gene regions, full details of primer positions and
sequences reported elsewhere34), none of the surgically
resected specimens gave any positive signals that could
suggest the presence of measles virus RNA sequences in
Crohn’s tissue. The extraction mixtures derived from 3–4
slices of intestinal tissue had about 6–8 million cells, and
that derived from 2–3 slices of mesenteric lymph node tissue had 4–6 million cells. The assay sensitivity limits for the
wild-type strain of the N gene primer was 5.5×10−2 to
5.5×10−3 pfu , of the M gene primer was 5.5×10−3 pfu, and
of the H gene primer was 5.5×10-1 to 5.5×10−2 pfu. The
assay cut oV for SSPE brain material was 30 cells.34 As all
samples were examined with primers specific for three different genes of the measles virus genome, the possibility of
false negative results, in case one part of the virus genome
is less suitable for RT-PCR amplification, is minimised.
Other groups, including the Royal Free Hospital group,
failed to detect measles virus genome in Crohn’s tissue,
despite targeting multiple regions of the genome and
diVerent experimental approaches.35 36 Although it is
proposed that measles virus may persist in intestinal
endothelial cells causing intestinal vasculitis, the Munich
group36 found no evidence of persistence of measles virus
genome in 22 endothelial cell antibody positive IBD
patients using a PCR assay on formalin processed colonic
biopsies. The sensitivity of their PCR assay is unclear. A
summary of the assay characteristics used by diVerent
research groups has recently been reported and reviewed.7
Updated details of RT-PCR assays published by diVerent
groups are provided in table 1. The oligonucleotide primer
sequences of the nucleocapsid protein gene (N), matrix
protein gene (M), and haemagglutinin protein gene (H)
used in the NIBSC studies are provided in table 2.
Although all attempts to detect measles virus genome in
Crohn’s aVected tissue using RT-PCR have failed, a recent
study based on a Japanese-Royal Free Hospital group collaboration have claimed detection of the presence of wildtype and vaccine-type measles virus genome in peripheral
blood mononuclear cells from IBD patients (as well as
patients with autism).37 However, the NIBSC study also
attempted to detect measles virus genome in lymphocyte
preparations from IBD and control patients with paired
tissue specimens and all lymphocyte preparations were
negative. The experience with clinical specimens at NIBSC
has shown that even with the most meticulous technique,
cross contamination of specimens can occasionally occur.20
PCR contamination has also been reported by the Royal
Free Hospital group.35 A range of methods and considerable experience is needed to recognise non-specific
reactions which might be misinterpreted as positive if confirmatory techniques are not applied. The issue of cross
contamination during PCR based diagnosis is well
documented and reviewed recently in context with human
Table 2 Oligonucleotide primer sequences of three measles virus genes
used in the NIBSC study
Sequence (5' →3')
Gene Designation
Position
N
N
N
N
M
M
M
M
H
H
H
H
1198–1218 TTAGGGCAAGAGATGGTAAGG
1609–1630 GTTCTTCCGAGATTCCTGCCA
1248–1268 AGCATCTGAACTCGGTATCAC
1480–1500 AGCCCTCGCATCACTTGCTCT
3565–3584 GCGACAGGAAGGATGAATGC
3832–3851 GTTTGCGTTGAAAGACACTCC
3587–3603 TATGTACATGTTTCTGC
3811–3829 GTTGTTAGGACCTTTCTCC
8106–8125 CAGTCAGTAATGATCTCAGC
8676–8701 CTTGAATCTCGGTATCCACTCCAAT
8147–8171 GAGCTCAAACTCGCAGCCCTTTGTC
8457–8482 ATCCTTCAATGGTGCCCACTCGGGA
MV1/outer
MV2/outer
MV3/inner
MV4/inner
MV13/outer
MV14/outer
MV15/inner
MV16/inner
MV-M3/outer
MV-M6/outer
MV-H7/inner
MV-H4A/inner
The nucleotide positions are in relation to the sequence reported for the measles virus genome in the EMBL-Genbank data under accession number
K01711.
N, nucleocapsid protein gene; M, matrix protein gene; H, haemagglutinin protein gene.
www.gutjnl.com
Downloaded from http://gut.bmj.com/ on June 17, 2017 - Published by group.bmj.com
Persistent measles virus infection in Crohn’s disease
751
viral diagnosis.38 The exquisite sensitivity of the PCR reaction has led to applications in medical diagnostics, population genetics, and forensic analysis. Obviously, the fewer
the number of molecules we are trying to detect, the more
is the need to guard against false positives or mistyping, a
caveat well known to forensic molecular biologists.39 The
use of PCR for amplification of a few molecules of nucleic
acids requires rigorous adherence to a strict set of protocols
as the product of amplification serves as the substrate for
generation of more product. A single PCR cycle generates
very large numbers of amplifiable molecules that have the
potential to contaminate subsequent amplifications of the
same target sequence. To control contamination, one must
prevent the transfer of nucleic acid molecules between
amplified samples, and between positive and negative
experimental controls. A number of precautions are generally adopted to reduce false positive rates in laboratories,39
but false positives may still occur. Indeed, if there is any
reasonable doubt about a critical experimental result, it is
wisest to repeat the experiment. The negative controls may
eliminate reagent contamination but cannot guarantee
against sporadic contamination; it is however very unlikely
that a sporadic contamination event would occur twice in
exactly the same way. It is possible that the sequences
reported by Kawashima and colleagues37 have emerged as
a result of cross contamination of the samples with measles
virus controls or pre-existing DNA templates during
nested PCR amplification. This is supported by the fact
that the sequences derived from cases of IBD and autism
cannot be grouped eVectively in relation to their clinical
histories and established phylogenetic relationships of
wild-type and vaccine strains.40 In a recent correspondence, we have presented evidence that the results of
Kawashima et al are not internally consistent and not consistent with the findings of others.40 Based on the sequence
data provided by Kawashima et al, the sequence derived
from a Crohn’s disease patient diVered by only two nucleotides from the vaccine strain while the sequences derived
from cases of autism, which theoretically should be identical to the vaccine strains, diVered by 3–5 nucleotides.
There is also evidence to suggest the possibility that mixed
DNA fragments were present in the PCR products that are
usually produced by cross contamination with more than
one template.40
Molecular mimicry
As persistence of measles virus genomic sequences in
Crohn’s tissue has not been demonstrated by a number of
researchers using state of the art techniques, we now have
to re-examine the original immunohistochemical demonstration of signal for measles virus N protein using monoclonal antibody immunohistochemistry (Serelab, Crawley
Down, Sussex, UK). Iizuka et al have presented evidence
that this monoclonal antibody recognises a host antigen as
well as measles virus.25 The host antigen recognised by the
monoclonal antibody was unrelated to the measles virus.41
Serum neutralisation antibodies against measles virus is
ubiquitous, both in IBD patients and in non-IBD
controls.20 The measles related antigen has not been identified, as no homologous proteins have been found in the
protein databases. However, the nucleotide sequence of the
positive clone was 99% homologous with the human gene
AA449055 deposited in DNA databases. A Southern blot
analysis confirmed the human origin of the measles related
antigen.26 The functional role of the measles related
antigen is unclear but it may be associated with a subpopulation of macrophages. Molecular mimicry, the concept
that antigenic determinants of micro-organisms resemble
antigenic determinants of the host, is frequently cited as a
plausible mechanism to account for the association of
infection and autoimmune disease. Although an impressive
number of such mimicry have been reported, there are no
clear examples of a human disease caused by molecular
mimicry.42 Epitope homology of a viral and self determinant is not in itself adequate evidence for mimicry as a
pathogenetic mechanism.43 The mimicking determinant
must also be capable of inducing disease in the absence of
replicative virus, and there is no such evidence in Crohn’s
disease. Molecular mimicry at the T cell level may be
important in the development of systemic autoimmunity.44
Studies in multiple sclerosis found no evidence of a multiple sclerosis specific pattern of T cell responses to recombinant measles virus structural proteins45 but similar studies have not been performed in Crohn’s disease. Liu and
colleagues30 found that almost all immunolabelling by
polyclonal measles virus antibody occurs in the nucleus,
and measles virus phosphoprotein is known to have
immunological cross reactivity with an intermediate
filament protein of human cells, probably vimentin.46
Antimeasles monoclonal antibodies may also cross react
with mouse anterior pituitary, gastric mucosa, salivary
gland, and neurones in the brain.47 A comparison of the
temporal profile of the epidemiology of measles and
Crohn’s disease makes it unlikely that molecular mimicry
might be a plausible hypothesis to explain the onset of
Crohn’s disease after an outbreak of measles. The
widespread use of measles vaccine in children older than
one year in developed countries has greatly reduced the
incidence of measles in all age groups, including infants
under one year. Exposure to wild measles virus in infancy
when the infant is immunologically immature (as suggested by Van damme and colleagues48) in developed
countries (including Scotland) has therefore dramatically
reduced over a period in which the incidence of juvenile
onset Crohn’s disease has increased, especially in the
12–16 year old age group.1 Prior to measles immunisation,
30% of measles cases in urban Africa occurred in infants
under one year.49 This burden of wild measles infection
should have resulted in an epidemic of Crohn’s disease in
the survivors long ago.50
Summary
Epidemiological studies may generate a hypothesis regarding the aetiology of chronic diseases that may be tested
directly. In the case of persistent infections, demonstration
of a putative organism by a sensitive and specific test provides essential evidence in favour of such a hypothesis. The
measles virus hypothesis had generated considerable
excitement, attracted resources, and spurred Crohn’s
disease researchers to perform corroborative tests. It also
however had undesirable eVects on uptake of immunisation, a potential public health hazard.51 52 As a number of
well conducted studies to demonstrate measles virus
genome in Crohn’s disease tissues using state of the art
RT-PCR based assays have proved to be negative, it must
be concluded that the persistent measles virus infection
hypothesis in the aetiology of Crohn’s disease lacks
confirmatory evidence. There is now enough experimental
evidence to conclude that failure to detect measles virus
genome in IBD tissues is not due to the ineYciencies of the
PCR based detection systems but to the absence of measles
virus particles. The challenge facing the medical profession
is to convince the public that there is no evidence of measles virus persistence in the intestine of Crohn’s disease
patients.
S GHOSH
E ARMITAGE
Gastrointestinal Unit, Department of Medical Sciences,
University of Edinburgh, Western General Hospital,
Edinburgh EH4 2XU, UK
www.gutjnl.com
Downloaded from http://gut.bmj.com/ on June 17, 2017 - Published by group.bmj.com
752
Ghosh, Armitage, Wilson, et al
D WILSON
Paediatric Gastroenterology and Nutrition,
Royal Hospital for Sick Children, Edinburgh, UK
and Department of Child Life and Health,
University of Edinburgh, UK
P D MINOR
M A AFZAL
Division of Virology,
National Institute for Biological Standards and Control,
South Mimms, Potters Bar, Hertfordshire EN6 3QG, UK
Correspondence to: Dr S Ghosh, Western General Hospital, Edinburgh
EH4 2XU, UK. [email protected].
Supported in part by the Wellcome Trust.
1 Armitage E, Drummond H, Ghosh S, et al. Incidence of juvenile-onset
Crohn’s disease in Scotland. Lancet 1999;353:1496–7.
2 Ekbom A, Wakefield AJ, Zack M, et al. Perinatal measles infection and subsequent Crohn’s disease. Lancet 1994;344:508–10.
3 Ekbom A, Daszak P, Kraaz W, et al. Crohn’s disease after in-utero measles
virus exposure. Lancet 1996;348:515–17.
4 Casali P, Nakamura M, McChesney MB. Immunosuppression by measles
virus. In: Spector S, Bendinelli M, Friedman H, eds. Virus induced immunosuppression. New York: Plenum Press, 1989:345–73.
5 Jones P, Fine P, Piracha S. Crohn’s disease and measles. Lancet
1997;349:473.
6 Wakefield AJ, Ekbom A, Dhillon AP, et al. Crohn’s disease: Pathogenesis and
persistent measles virus infection. Gastroenterology 1995;108:911–16.
7 Afzal MA, Minor PD, Schild GC. Clinical safety issues of measles, mumps
and rubella vaccines. Bull World Health Organ 2000;78:199–204.
8 Patja A, Makinen-Kiljunen S, Davidkin I, et al. Allergic reactions to
measles-mumps-rubella vaccination. Pediatrics 2001;107:E27.
9 Thompson NP, Montgomery SM, Pounder RE, et al. Is measles vaccination
a risk factor for inflammatory bowel disease? Lancet 1995;345:1071–4.
10 Fenney M, Ciegg A, Winwood P, et al. A case-control study of measles vaccination and inflammatory bowel disease. The East Dorset Gastroenterology Group. Lancet 1997;350:764–6.
11 Patja A, Davidkin I, Kurki T, et al. Serious adverse events after
measles-mumps-rubella vaccination during a fourteen year prospective
follow-up. Pediatr Infect Dis J 2000;19:1127–34.
12 Wakefield AJ, Pittilo RM, Sim R, et al. Evidence of persistent measles virus
infection in Crohn’s disease. J Med Virol 1993;39:345–53.
13 Pardi DS, Tremaine WJ, Sandborn WJ, et al. Perinatal exposure to measles
virus is not associated with the development of inflammatory bowel disease.
Inflamm Bowel Dis 1999;5:104–6.
14 Montgomery SM, Morris DL, Pounder RE, et al. Paramyxovirus infections
in childhood and subsequent inflammatory bowel disease. Gastroenterology
1999;116:796–803.
15 Thompson NP, Montgomery SM, Wadsworth ME, et al. Early determinants
of inflammatory bowel disease: use of two nation longitudinal birth
cohorts. Eur J Gastroenterol Hepatol 2000;12:25–30.
16 Pardi DS, Tremaine WJ, Sandborn WJ, et al. Early measles virus infection is
associated with the development of inflammatory bowel disease. Am J Gastroenterol 2000;95:1480–5.
17 Morris DL, Montgomery SM, Thompson NP, et al. Measles vaccination and
inflammatory bowel disease: a national British Cohort Study. Am J Gastroenterol 2000;95:3507–12.
18 Van Kruiningen HJ, Mayo DR, Vanopdenbosch E, et al. Virus serology in
familial Crohn disease. Scand J Gastroenterol 2000;35:403–7.
19 Fisher NC, Yee L, Nightingale P, et al. Measles virus serology in Crohn’s
disease. Gut 1997;41:66–9.
20 Afzal MA, Armitage E, Begley J, et al. Absence of measles virus genome
sequence in inflammatory bowel disease tissues and peripheral blood lymphocytes. J Med Virol 1998;55:243–9.
21 Connolly JH, Allen IV, Hurwitz LJ, et al. Measles virus antibody and antigen
in subacute sclerosing panencephalitis. Lancet 1967;i:542–4.
22 Jabbour JT, Sever JL. Serum measles antibody titers in patients with
subacute sclerosing panencephalitis. J Pediatr 1968;73:905–7.
23 Rima BK. Paramyxoviruses and their role in disease. Semin Arthritis Rheum
1994;23:230–1.
24 Wakefield AJ, Sim R, Akbar AN, et al. In situ immune responses in Crohn’s
disease: A comparison with acute and persistent measles virus infection. J
Med Virol 1997;51:90–100.
25 Iizuka M, Chiba M, Yukawa M, et al. Immunohistochemical analysis of the
distribution of measles related antigen in the intestinal mucosa in
inflammatory bowel disease. Gut 2000;46:163–9.
26 Iizuka M, Masamune O. Measles vaccination and inflammatory bowel disease. Lancet 1997;350:1775.
27 Daszak P, Purcell M, Lewin J, et al. Detection and comparative analysis of
persistent measles virus infection in Crohn’s disease by immunogold electron microscopy. J Clin Pathol 1997;50:299–304.
28 Lewin J, Dhillon AP, Sim R, et al. Persistent measles virus infection of the
intestine: confirmation by immunogold electron microscopy. Gut 1995;36:
564–9.
29 Minor PD. Measles vaccination as a risk factor for inflammatory bowel disease. Lancet 1995;345:1362–3.
30 Liu Y, van Kruiningen HJ, West AB, et al. Immunocytochemical evidence of
Listeria, Escherichia coli, and Streptococcus antigens in Crohn’s disease. Gastroenterology 1995;108:1396–404.
31 Miyamoto H, Tanaka T, Kitamoto N, et al. Detection of immunoreactive
antigen, with a monoclonal antibody to measles virus, in tissue from a
patient with Crohn’s disease. J Gastroenterol 1995;30:28–33.
32 Iizuka M, Nakagomi O, Chiba M, et al. Absence of measles virus in Crohn’s
disease. Lancet 1995;345:199.
33 Haga Y, Funakoshi O, Kuroe K, et al. Absence of measles viral genomic
sequence in intestinal tissues from Crohn’s disease by nested polymerase
chain reaction. Gut 1996;38:211–15.
34 Afzal MA, Armitage E, Ghosh S, et al. Further evidence of the absence of
measles virus genome sequence in full thickness intestinal specimens from
patients with Crohn’s disease. J Med Virol 2000;62:377–82.
35 Chadwick N, Bruce IJ, Schepelmann S, et al. Measles virus RNA is not
detected in inflammatory bowel disease using hybrid capture and reverse
transcription followed by polymerase chain reaction. J Med Virol 1998;55:
305–11.
36 Folwaczny C, Loeschke K, Schhnettler D, et al. Endothelial cell
autoantibodies are a marker of disease susceptibility in inflammatory bowel
disease but apparently not linked to persistent measles infection. Clin
Immunol 2000;95:197–202.
37 Kawashima H, Mori T, Kashiwagi Y, et al. Detection and sequencing of
measles virus from peripheral mononuclear cells from patients with inflammatory bowel disease and autism. Dig Dis Sci 2000;45:723–9.
38 Clewley JP. The polymerase chain reaction (PCR) for human viral diagnosis.
London: CRC Press, 1995.
39 Kwok S, Higuchi R. Avoiding false positives with PCR. Nature
1989;339:237–8.
40 Afzal MA, Minor PD, Ghosh S, et al. Measles virus persistence in specimens
of inflammatory bowel disease and autism cases. Dig Dis Sci 2001;46:658–
60.
41 Iizuka M, Watanabe S, Chiba M. Immunohistochemical analysis of measles
related antigen in IBD. Gut 2001;48:136–7.
42 Rose NR, Mackay IR. Molecular mimicry: a critical look at exemplary
instances in human diseases. Cell Mol Life Sci 2000;57:542–51.
43 Lawson CM. Evidence for mimicry by viral antigens in animal models of
autoimmune disease including myocarditis. Cell Mol Life Sci 2000;57:552–
60.
44 Farris AD, Keech CL, Gordon TP, et al. Epitope mimics and determinant
spreading: pathways to autoimmunity. Cell Mol Life Sci 2000;57:569–78.
45 Pette M, Liebert UG, Gobel U, et al. Measles virus-directed responses of
CD4+ T lymphocytes in MS patients and healthy individuals. Neurology
1993;43:2019–25.
46 Fujinami RS, Oldstone MBA, Wroblewska Z, et al. Molecular mimicry in
virus infection: crossreaction of measles virus phosphoprotein or of herpes
simplex virus protein with human intermediate filaments. Proc Natl Acad
Sci USA 1983;80:2346–50.
47 Srinivasappa J, Saegusa J, Prabhakar BS, et al. Molecular mimicry:
frequency of reactivity of monoclonal antiviral antibodies with normal tissues. J Virol 1986;57:397–401.
48 Van damme W, Lynen L, Kegels G, et al. Measles vaccination and
inflammatory bowel disease. Lancet 1997;350:1174–5.
49 Taylor WR, Kalisa R, Ma-Disu M, et al. Measles control in urban Africa
complicated by high incidence of measles in the first year of life. Am J Epidemiol 1988;127:788–94.
50 Miller E, Goldblatt D, Cutts F. Measles vaccination and inflammatory bowel
disease. Lancet 1998;351:755–6.
51 MMR vaccine coverage falls after adverse publicity. Communicable Disease
Report Weekly 1998;8(5).
52 MMR vaccine coverage falls in the United Kingdom. Communicable Disease
Report Weekly 1999;9(5).
www.gutjnl.com
Downloaded from http://gut.bmj.com/ on June 17, 2017 - Published by group.bmj.com
Detection of persistent measles virus infection
in Crohn's disease: current status of
experimental work
S GHOSH, E ARMITAGE, D WILSON, P D MINOR and M A AFZAL
Gut 2001 48: 748-752
doi: 10.1136/gut.48.6.748
Updated information and services can be found at:
http://gut.bmj.com/content/48/6/748
These include:
References
Email alerting
service
Topic
Collections
This article cites 47 articles, 10 of which you can access for free at:
http://gut.bmj.com/content/48/6/748#BIBL
Receive free email alerts when new articles cite this article. Sign up in the
box at the top right corner of the online article.
Articles on similar topics can be found in the following collections
Crohn's disease (932)
Notes
To request permissions go to:
http://group.bmj.com/group/rights-licensing/permissions
To order reprints go to:
http://journals.bmj.com/cgi/reprintform
To subscribe to BMJ go to:
http://group.bmj.com/subscribe/