Canadian
International
Matriculation
Programme
Biology [SBI 4U] FINAL EXAMINATION
Date: November 28, 2012 (Wednesday)
Time: 8:30am – 10:30am
Length: 2 hours
Lecturer: Ms. Kimberley Gagnon
Student Name: ______________________________
Period: _______
Please read the following instructions carefully before you begin the examination:
1. This exam paper has 16 printed pages, including this cover page.
2. The examination is worth 30 percent of your final mark.
3. The examination consists of four parts: PART A, B, C and D.
PARTS
A
B
C
D
CONTENT
Knowledge and Understanding
Communication
Thinking and Investigation
Application
TOTAL
MARKS
25, allow 25 minutes
19, allow 25 minutes
40, allow 50 minutes
16, allow 20 minutes
100
4. Answer all sections on the exam paper.
5. Read all instructions carefully for each section.
6. Answers must be written in standard English format for an academic audience.
Dictionaries (electronic or paper) are not permitted.
7. All answers must be written in black or blue pen only.
For office use only:
Part A
Part B
Part C
Part D
Total
Page 2 of 12
Part A: Knowledge and Understanding (25 marks, allow 25 minutes)
Multiple Choice: Identify the letter of the choice that best completes the statement or answers the
question.
Page 3 of 12
Part B: Communication (19 marks, allow 25minutes)
Short Answer: Write the most appropriate answer in the space provided. All answers should be in POINT
FORM ONLY.
1. Two monosaccharides, glucose and fructose, combine chemically to form sucrose. Glucose and fructose
each have a molecular mass of 180 grams, but the molecular mass of sucrose is only 342 grams. Account
for this discrepancy and write/draw the complete equation. (4 marks)
2. During cellular respiration, the processes that follow glycolysis depend on whether or not oxygen is present.
Briefly explain why. (3 marks)
3. Briefly describe the reason for the formation of Okazaki fragments. (2 marks)
4. Distinguish between introns and exons in a genome. (2 marks)
Page 4 of 12
5. Given the following anti-sense strand of DNA transcribe and then translate this to determine the amino acid
sequence. Use the Genetic Code given on page 17. (4 marks)
Anti-Sense DNA SEQUENCE -
3’ TACCGGCGGTAGGCGCATTTTTCAGCAATT 5’
6. What is the wobble position? Why is this position so important in protein synthesis? (2 marks)
7. Suppose that a neuron was unable to use active transport to move sodium and potassium ions across the
neuronal membrane. Describe the effect on the resting potential of the neuron. (2 marks)
Page 5 of 12
Part C: Thinking and Investigation (40 marks, allow 50 minutes)
Graphics: For the following questions, use the graphics provided to review terms or skills. Add any
missing labels, draw any missing parts, or use the graphics to help you answer a question.
1. Explain the role of an allosteric inhibitor. Include a diagram in your explanation. (3 marks)
2. Fill in the missing labels on the following diagram that shows the roles of the mitochondria and chloroplasts
in cellular respiration and photosynthesis. (6 marks)
Page 6 of 12
3. Fill in the missing labels on the following light-dependent reactions. (8 marks)
4.
The following diagram shows the structural formula of ATP. Label the three phosphate groups, the highenergy bonds, adenine, ribose, and adenosine monophosphate. (4 marks)
Page 7 of 12
5. Label the following ladder diagram of DNA, using the letters S (for sugar), P (for phosphate), A (for
adenine), G (for glycine), T (for thymine) and C (for cytosine). (6 marks)
6.
The age structure diagrams in Figure 27-3 show how individuals are distributed at each age level for
different human populations. Describe the population types represented by the two graphs in Figure 27-3
that do not show rapidly expanding populations. (4 marks)
Page 8 of 12
7. Technology allows humans to increase the carrying capacity of their environment. Explain why. (3 marks)
8. Use the following information to answer the next question. (3 marks)
In research conducted on a population of red wolves, it was found that the growth rate of the
population was five wolves per year. The number of wolves rose from 257 to 499 over a
certain time period.
The time period for this growth of wolves is ______________.
9. Use the following information to answer the next question. (3 marks)
A population of swift foxes was under observation for two years. The per capita growth rate
of this population was 3.1% and the change in the size of the population at the end of the
study was 14.
The final number of foxes in the population is __________.
Page 9 of 12
Part D: Application (16 marks, allow 20 minutes)
Answer FOUR (4) of the following questions ONLY. If you attempt more than FOUR questions
CIRCLE the questions you want marked otherwise the first FOUR will be marked. For the following
questions, write the answer in the space provided. Use complete sentences in your answer.
1. “Some aerobic fitness classes should really be called anaerobic fitness classes because of the short, intense
workout they provide.” Comment on this statement, based on your knowledge of cellular respiration. (4
marks)
2. During an investigation of a crime scene, detectives find a hair sample that has a follicle attached. The
sample is taken to a forensic lab for analysis. State the technique, then list, in order, the steps the lab would
follow to amplify the sample for further analysis. (4 marks)
Page 10 of 12
3. a. Why are genetically engineered herbicide-resistant crops a concern, with respect to the environment? (2
marks)
b. Why are genetically engineered food organisms a concern, with respect to public health? (2 marks)
4. “Spontaneous contraction of the muscles (shivering) is one response of the body to decreasing body
temperature. It is reasonable to hypothesize that during shivering plasma levels of insulin are higher than
plasma levels of either glucagon or ADH.” Evaluate the validity of this comment. (4 marks)
Page 11 of 12
5. One of the few positive feedback systems in humans involves oxytocin. Oxytocin sustains the lactating
breast. Continued nursing by the offspring sends a signal to the hypothalamus of the mother to continue
releasing oxytocin. As well, oxytocin inhibits the release of LH and FSH from the posterior pituitary. What
is the selective advantage of this homeostatic system for humans? (4 marks)
6.
“Urbanization is the major cause of ecological problems throughout the world.” State your opinion and
defend with specific evidence. (4 marks)
Page 12 of 12
Genetic code