Published January 20, 2015
The effects of pure nucleotides on performance, humoral immunity,
gut structure and numbers of intestinal bacteria of newly weaned pigs1
N. Sauer,* M. Eklund,* E. Bauer,* M. G. Gänzle,† C. J. Field,† R. T. Zijlstra,† and R. Mosenthin*†2
*Institute of Animal Nutrition, University of Hohenheim, 70593 Stuttgart, Germany; and †Department of Agricultural, Food
and Nutritional Science, University of Alberta, Edmonton T6G 2P5, Canada
ABSTRACT: Weaning is often stressful for piglets and
accompanied by morphological, histological, microbial,
and immunological changes along the digestive tract.
Dietary nucleotides are bioactive compounds which have
the potential to diminish weaning-associated challenges.
The experiment was carried out with 5 litters each of 7 pigs
(mixed sex), weaned at 20 d of age. One baseline pig per
litter was slaughtered at d 0. The remaining 30 pigs were
housed individually and randomly allocated to 2 dietary
treatments: the control diet or the control diet supplemented
with a mixture of nucleotides. Measurements of growth
performance traits included ADFI, ADG, G:F, and BW. At
d 17, fresh fecal samples were taken to determine bacterial
numbers. On d 19 and 20, pigs were slaughtered and blood
samples were analyzed for plasma immunoglobulins and
intestinal samples were assessed for morphological traits.
Digesta from the jejunum and cecum were collected
for analysis of the microbiome. The ADFI was greater
in the nucleotide treatment compared with the control
treatment (P < 0.05), but ADG, G:F, and BW did not differ
between treatments. Plasma IgA concentrations increased
with age and were greater in the nucleotide (P < 0.05)
compared with the control group. There were no treatment
differences in plasma IgG and IgM, gut morphology,
or intestinal and fecal bacterial counts. Supplemental
nucleotides may increase ADFI but without having any
impact on growth performance of the pigs. Greater plasma
IgA concentrations indicate that adding nucleotides in the
weaning diet supported humoral immunity. However,
there was no effect of dietary nucleotide supplementation
on the composition of the bacterial community in parts of
the small and large intestine. Further research is warranted
before the use of nucleotide as a feed additive in pig diet
can be recommended.
Key words: bacteria, immunoglobulin, intestine, nucleotide, performance, pig
© 2012 American Society of Animal Science. All rights reserved.
INTRODUCTION
Weaning has been shown to be a stressful period,
with potential effects on the development of the
immune system (Johnson et al., 2006), the intestine,
and the intestinal microbiome (Pluske et al., 1997).
Many studies confirm that dietary composition is one
1 Analytical support in performing part of the histological analyses at the Institute of Animal Husbandry, University of Hohenheim
(Stuttgart, Germany) is highly appreciated. Appreciation is also extended to J. Yanez, P. Regmi, R. Jha, and K. Williams (Department
of Agricultural, Food and Nutritional Science, University of Alberta,
Edmonton, AB, Canada) for their assistance in animal experimentation and Y. Wang (Department of Agricultural, Food and Nutritional
Science, University of Alberta, Edmonton, AB, Canada) for her guidance in RT-PCR analyses.
2Corresponding author: [email protected]
Received June 28, 2011.
Accepted March 20, 2012.
J. Anim. Sci. 2012.90:3126–3134
doi:10.2527/jas2011-4417
factor that can change the intestinal morphology and,
therefore, may affect the gastrointestinal health of the
piglet (Boudry et al., 2004). Alternative feed ingredients
(e.g., probiotics or prebiotics) have been suggested to
support intestinal health (Lallès et al., 2007).
Dietary nucleotides represent one group of bioactive
agents, which contribute to the savory, umami taste of
food (Cairoli et al., 2008) and benefit gastrointestinal
morphology and functions, immune system, and
intestinal microbiota of monogastric species (Sauer et al.,
2011). Under certain conditions (rapid growth, limited
feed intake, stress, or immunological challenges), when
exogenous supply is not sufficient, nucleotides may
become essential nutrients (Cosgrove, 1998). There are
several reports in which the use of nucleotides in pig diets,
either supplied as live yeast or yeast extract, has been
described; however, results on the response of the pigs
are equivocal. The yeast culture products contain variable
3126
Pure nucleotides in pig nutrition
amounts of nucleotides in addition to viable cells and
cell wall components; therefore, it is difficult to attribute
the observed biological effects exclusively to specific
nucleotides present in these products (Sauer et al., 2011).
In piglets, no studies have been conducted to
evaluate biological effects and health benefits of feeding
known amounts of pure nucleotides (Sauer et al., 2011).
Therefore, the objective of the present study was to
determine the effect of a mixture of free nucleotides
supplemented to piglets post-weaning from d 20 to 39 or
40 on growth performance, immunological status, small
intestinal morphology, and bacterial numbers in digesta
of jejunum and cecum and in feces.
MATERIALS AND METHODS
Procedures involving animal handling and treatment
were approved by the University of Alberta Animal Care
and Use Committee for Livestock and followed principles
established by the Canadian Council on Animal Care (1993).
Experimental Design and Diets
The experiment was conducted at the Swine Research
Center at the University of Alberta. Thirty-five crossbred
(Duroc × Large White/Landrace) mixed-sex piglets with
an initial BW of 7.2 ± 0.5 kg were obtained from 5 litters,
with 7 pigs each (1 baseline, 3 control, and 3 control with
nucleotide inclusion), immediately after weaning at 20 ±
2 d of age. The piglets did not receive creep feed during the
suckling period. At weaning, 1 pig per litter that was close
to the average litter weight was slaughtered for baseline
measurements. The remaining 30 pigs were blocked by
BW, litter, and sex and allocated to the 2 experimental
groups according to a randomized complete block design.
Pigs were housed in floor pens (length, 1.22 m; width,
0.50 m; and height, 0.76 m) for 19 or 20 d. Each pen
was equipped with a stainless steel wet-dry self-feeder
attached to the front of the pen. The 4 pen sides were made
of solid plastic planks and at least 1 side with a window
that allowed nose-to-nose contact with the neighbor pig.
The pens were raised 0.80 m from the concrete floor of the
room. A single cup drinker was attached to the side wall
(0.09 m above the pen floor) of each pen.
Pigs were allowed 3 d to adapt to their new
environment and were housed in groups of 3 pigs. Pigs
were immediately fed with the control diet (Table 1) that
was low in nucleotide content (Mateo and Stein, 2004)
compared with sow milk at d 21 of lactation (Mateo
et al., 2004). The pigs had free access to water and
feed. After the adaptation period, pigs were housed
individually. Every morning at 0730 h, the nucleotide
treatment received a mixture of pure nucleotides (45.1
mg 5´-adenine-monophosphate, 22.4 mg 5´-cytosine-
3127
monophosphate, 65.8 mg 5´-guanosine-monophosphate,
9.5 mg 5´-inosine-monophosphate, and 1202.0 mg
5´-uridine-monophosphate) for a total of 1.34 g
nucleotides per pig and dissolved in 8 mL water. The
solution was infused by means of a 10-mL syringe placed
directly into the mouths of the pigs. Pure nucleotides
were obtained (Zhen-AO Group Co. Ltd., Dalian,
Liaoning, China) and had, according to the analysis
of the manufacturer, purities of >97%. The content of
individual nucleotides in the final solution was slightly
(10%) greater than that determined in sow milk (136.3
μmol· ∙ 100 mL−1) on d 21 of lactation (Mateo et al.,
2004), which corresponds to the time of weaning in this
study.
Pigs were weighed individually at the start (d 0) and
end (d 19 or 20) of the experiment. Fresh feed was provided
twice daily mixed with water (1:1; wt/vol), and individual
feed intake was recorded daily. At d 17, fresh feces were
collected by means of rectal stimulation and examined for
bacterial quantification. Fecal samples were immediately
kept on ice and transferred with a sterile spatula into plastic
tubes and were frozen within 10 min at −80°C.
Table 1. Composition of control diet, as-fed basis
Item
Basal diet
Ingredient, g/kg
Barley
685.7
Soy protein concentrate
205.0
Canola oil
61.0
L-LysHCl
3.9
DL-Met
1.1
L-Thr
1.3
L-Trp
0.2
Dicalcium phosphate
17.5
Calcium carbonate
9.3
Mineral premix1
3.0
Vitamin premix2
3.0
Salt
4.0
Titanium dioxide
5.0
Calculated energy and nutrient composition
ME, kcal/kg
3,271
CP, g/kg
192.0
Lys, g/kg
11.9
Met + Cys, g/kg
6.8
Thr, g/kg
7.4
Trp, g/kg
2.2
Arg, g/kg
11.4
Ca, g/kg
8.0
Available P, g/kg
4.0
Total nucleotides,3 mg/kg
4.25
1Provided per kilogram of diet: Zn, 104 mg as ZnSO ; Fe, 139 mg as FeSO ;
4
4
Cu, 39 mg as CuSO4; Mn, 38 mg as MnSO4; and Se, 0.4 mg as Na2SeO3.
2Provided per kilogram of diet: vitamin A, 2,250 IU; vitamin D , 450 IU;
3
vitamin E, 30 IU; niacin, 61 mg; D-pantothenic acid, 15 mg; riboflavin, 5 mg;
menadione, 5 mg; folic acid, 2 mg; thiamine, 5 mg; D-biotin, 0.3 mg; vitamin
B6, 5 mg; and vitamin B12, 0.01 mg.
3Calculated according to Mateo and Stein (2004).
3128
Sauer et al.
At the end of the experiment on d 19 and 20, 15
pigs from each treatment were anesthetized [Ketalean,
12 mg ketamine HCl/kg (Biomeda MTC, Cambridge,
ON, Canada); Rompun, 2 mg xylazine/kg (Bayer Cross,
Toronto, ON, Canada); and Stresnil, 8 mg/kg (Merial
Canada Inc., Baie D’Urfé, QC, Canada)] between 2 and
6 h postprandially. Before euthanization, blood samples
(2 × 6 mL) were collected in EDTA tubes by means
of cardiac puncture. Thereafter, pigs were euthanized
by intracardiac injection (Euthanyl Forte, 0.44 mg/kg;
MTC Pharmaceutical, Cambridge, ON, Canada) and
immediately exsanguinated. At the same time, hematocrit
value was measured and blood samples in EDTA tubes
were centrifuged (3,000 × g for 10 min at 4°C). After
centrifuging, plasma was immediately transferred into
micro centrifuge tubes and stored at −80°C.
After exsanguination, the abdominal cavity of each pig
was opened and the entire small and large intestines were
removed. The small intestine and the cecum were carefully
dissected from the mesentery. Duodenum, jejunum, ileum,
and cecum were classified and secured with ligatures to
avoid digesta flow into other parts of the gut. Length of
small intestine was measured using a measuring tape fixed
on a plate. Digesta from the duodenum, jejunum, ileum,
and cecum for bacterial quantification were aseptically
collected and placed in an ice-water bath until storage at
−80°C. As duodenal and ileal digesta were only collected
from less than 50% of the pigs, digesta from these parts
were excluded from bacterial quantification. For intestinal
morphology, measurements, including villus height, crypt
depth, and villus-to-crypt ratio, tissue samples (about
5 cm in length) were taken from the duodenum (10 cm
distal to the pylorus), the jejunum (middle of the small
intestine length), and the ileum (5% proximal to the end of
the small intestine). Tissue samples were rinsed with ice
cold saline and fixed in 10% formalin. The formalin was
replaced after 48 h, and the tissue samples were stored at
room temperature until fixation in wax blocks.
Analytical Methods
Hematocrit value was immediately measured
after collecting blood samples using capillary tubes
(Heparinized Micro-Hematocrit Capillary Tubes;
Fisher Scientific, Pittsburgh, PA) plugged with white
clay-like Critoseal and centrifuged at 12,000 × g for
4 min at 4°C (IEC Micro-MB Centrifuge; International
Equipment Company, Memphis, TN). Plasma samples
were thawed and analyzed for plasma IgA, IgM, and
IgG using commercially available ELISA kits (Benthyl
Laboratories, Montgomery, TX) according to the
manufacturer’s protocol for plasma analyses.
Tissues were removed from formalin, washed, and
embedded in paraffin wax using a tissue processor
(Fisher 166 MP Histomatic Tissue Processor; Fisher
Scientific, Pittsburgh, PA). Serial sections (5 μm) were
obtained using a microtome (AO-820 Rotary Microtome;
American Optical Corporation, Buffalo, NY). The
sections were placed on glass slides and stained with
hematoxylin and eosin. Three slides per segment sample
from each animal were prepared. Random intestinal villi
and crypts were measured (MetaMorph V. 7.0 software;
Molecular Devices, Downingtown, PA). Fifteen
recordings each were made for villi and crypts of each
animal and each segment analysis.
For bacterial quantification, digesta and fecal samples
were taken from 1 baseline, 1 control, and 1 nucleotide
pig (treatment pigs were chosen randomly) of each litter.
Before analyses, samples were thawed and DNA was
extracted (QIAmp DNA Stool mini Kit; QIAGEN, Hilden,
Germany) according to manufacturer’s protocol for stool
pathogen detection. For easy storage until DNA analysis,
isopropanol precipitation was used. For precipitation, 7.5
M NH4Ac and isopropanol 0.5:1 (vol/vol) were added. The
solution was incubated for 10 min at room temperature.
After incubation, the tubes were spun at 14,600 × g for 15
min at ambient temperature (Micromax RF; ThermoFisher
Scientific, Nepean, ON, Canada;), and the supernatant
was removed. The DNA was gently rinsed twice each
with 200 μL 70% ethanol and re-centrifuged (14,600
× g for 30 min at 4°C). The liquid was gently aspirated
and the pellet was air dried. For re-suspending the pellet,
200 μL of solution buffer (QIAmp DNA Stool mini Kit;
QIAGEN) was added and gently vortexed until the pellet
was dissolved. Quantity and quality of isolated DNA
were determined using a spectrophotometer (ND-1000
UV-Vis Spectrophotometer; NanoDrop Technologies,
San Francisco, CA). Standard curves were generated
using serial dilutions of the purified and quantified PCR
products generated by standard PCR using primers shown
in Table 2 and genomic DNA from pig digesta and feces
(Lee et al., 2006). The PCR products were checked by
agarose gel electrophoresis (1.8% agarose) to ensure
correct primer specific products. Quantitative PCR
was performed with slight modifications as described
by Metzler-Zebeli et al. (2009). For quantification of
Lactobacillus group, Bifidobacteria spp., Enterococcus
spp., Clostridium Cluster I, Clostridium Cluster XIVa,
Clostridium Cluster IV, Enterobacteriaceae, and total
eubacteria, the primer sequences presented in Table 2 were
used. All primers were obtained commercially (Eurofins
MWG Operon; Ebersberg, Germany). A detection system
(iCycler iQ5 Realtime Detection System; Bio-Rad
Laboratores, Munich, Germany) and a software (iCycler
Optical System Interface software, Version 2.0; BioRad Laboratories) was used for PCR amplification and
fluorescent data collection. The mastermix consisted of
a mix (12.5 μL of iQ SYBR Green Supermix; Bio-Rad
3129
Pure nucleotides in pig nutrition
Table 2. 16S ribosomal DNA real-time PCR primers used to detect bacterial numbers in digesta and feces of pigs on d
0 (baseline) and pigs consuming post weaning diets without (control) or with nucleotides (nucleotide)1
Phyla, or genera of interest
Total eubacteria
Primer sequence
F: CGGYCCAGACTCCTACGGG
R: TTACCGAGGCTGCTGGCAC
F: AGCAGTAGGGAATCTTCCA
Lactobacillus group
R: CACCGCTACACATGGAG
F: CCCTTATTGTTAGTTGCCATCATT
Enterococcus spp.
R: ACTCGTTGTACTTCCCATTGT
Enterobacteriaceae
F: CATTGACGTTACCCGCAGAAGAAGC
R: CTCTACGAGACTCAAGCTTGC
F: TCGCGTCYGGTGTGAAAG
Bifidobacterium spp.
R: CCACATCCAGCRTCCAC
F: AAATGACGGTACCTGACTAA
Clostridium Cluster XIVa
R: CTTTGAGTTTCATTCTTGCGAA
F: GCACAAGCAGTGGAGT
Clostridium Cluster IV
R: CTTCCTCCGTTTTGTCAA
F: TACCHRAGGAGGAAGCCAC
Clostridium Cluster I
R: GTTCTTCCTAATCTCTACGCAT
1AT = annealing temperature, °C; F = forward; and R = reverse.
Laboratories), 1 μL of each primer (1:10 diluted) and 9.5
μL water for SYBR Green assays. The thermal cycling
protocol was as follows: initial denaturation for 5 min,
followed by 40 cycles of denaturation at 95°C for 15 s,
primer annealing at their individual optimal temperatures
(Table 2) for 30 s, and an extension step at 72°C for 30 s.
The fluorescence signal was measured at the end of each
extension step at 72°C. After the amplification, a melting
curve analysis with a temperature gradient of 0.1°C per
second from 70 to 95°C was performed to confirm that
only specific products were amplified (Ririe et al., 1997).
AT
58
Reference
Lee et al., 1996
62
60
Walter et al., 2001
Heilig et al., 2002
Rinttilä et al., 2004
63
Bartosch et al., 2004
63
Rinttilä et al., 2004
50
Matsuki et al., 2002
50
Matsuki et al., 2004
63
Song et al., 2004
RESULTS
Growth Performance
Pigs stayed healthy throughout the experiment and
consumed the assay diets readily. Symptoms of intestinal
disorders were not observed. The average BW of the pigs
was 7.2 ± 0.5 kg at the beginning (d 0) and 12.6 ± 0.3 kg
at the end (d 19 or 20) of the study (Table 3). Inclusion
of nucleotides increased ADFI (P < 0.05), whereas ADG,
G:F, and final BW did not differ between treatments.
Hematocrit and Plasma Immunoglobulins
Statistical Analyses
Treatment effects were tested as a complete randomized
block design with 5 litters, again, each including 1 baseline,
3 control, and 3 nucleotide pigs. Data were examined for
normal distribution and homogeneity of variance before
analyzed using the MIXED procedure (SAS Inst. Inc.,
Cary, NC). The fixed effects included treatment, litter,
and treatment × litter for performance, plasma, and gut
morphology measurements, whereas pig within a litter
was assumed to be random. Additionally, for test of
bacterial numbers, a log transformation was implemented,
and additional terms, region, and treatment × region,
were included in the aforementioned model. To detect
any influential observation on the model, Cook’s distance
(Cook’s D) was used as a criterion. Any observation with
a Cook D greater than 0.5 was considered influential
and hence excluded from further analysis. Differences
between treatments were determined by PDIFF with P <
0.05 considered significant.
All pigs had an average hematocrit value of 32%
(Table 4), which is consistent with the average (33 ± 4%)
reported for healthy pigs. Plasma IgA increased with age
as the least concentration was observed at baseline. The
nucleotide group had a greater plasma concentration
of IgA than the control piglets (P < 0.05). Plasma
IgG concentrations decreased (P < 0.05) with age but
did not differ between dietary treatments. Plasma IgM
concentrations did not differ among groups.
Intestinal Morphology
Small intestine length increased (P < 0.001) with
age but did not differ between treatments (Table 5).
In the duodenum, both villus height and crypt depth
increased and villus-to-crypt ratio decreased when
comparing the treatments with the baseline (P < 0.05),
whereas no difference between the treatments existed.
There were no differences in jejunum villus height and
ileum villus height, as well as ileum crypt depth, among
groups. Similar to the results in the duodenum, the
3130
Sauer et al.
jejunum crypt depth, as well as the villus-to-crypt ratio,
and ileum villus-to-crypt ratio showed differences (P <
0.05) between baseline and treatments groups. However,
no differences were observed between treatments.
Bacterial Numbers
One baseline pig had no jejunum digesta at the time
of slaughter; therefore, mean values of bacterial numbers
in jejunum are based on observations from 4 pigs. Bacterial
numbers were influenced by region (P < 0.05; Table 6), with
fewest bacterial numbers occurring in the jejunum. In cecal
digesta, greater (P < 0.05) bacterial numbers of Enterococcus
spp. were observed for the nucleotide treatment compared
with the baseline, but no differences existed between
treatments. For bacterial numbers of Clostridium Cluster
I, differences with age were observed in jejunal and cecal
digesta (P < 0.05), but there were no differences between
treatments. No differences between baseline and dietary
treatments or among groups were observed in different
tested regions for numbers of total bacteria, Lactobacillus
group, Enterobacteriaceae, Bifidobacteria spp., Clostridium
Cluster XIV, and Clostridium Cluster IV.
DISCUSSION
In milk from various animals, including sows, very
high nucleotide concentrations are found, contributing
to as much as 20% of its non-protein fraction (Uauy,
1989). Thus, a special need for nucleotides in the nutrition
of suckling piglets has been suggested (Mateo et al.,
2004). According to those authors, sow milk supplies,
on average, 1,220 mg/kg of total nucleotides around the
time of weaning (i.e., on d 21 of lactation; Mateo et al.,
2004). However, feed ingredients used in diets for piglets
after weaning have considerably less concentrations
of nucleotides. For example, animal and plant proteins
contain nucleotides in varying concentrations (Mateo and
Stein, 2004) with greater amounts in feed ingredients of
animal origin (e.g., fish meal, 75 mg/kg) and decreased
contents in grains, casein, or soy protein concentrates (e.g.,
barley, 5 mg/kg; Mateo and Stein, 2004). In the present
study, the basal diet was designed to be as low as possible
Table 3. Effects on growth performance of pigs fed diets
without (control) or with nucleotides (nucleotide)1
Diet
Pooled
P-value,
SEM control vs. nucleotide
Item
Control Nucleotide
ADFI, kg
0.478
0.529
0.016
0.033
ADG, kg
0.298
0.332
0.020
0.242
G:F, kg/kg
0.620
0.621
0.028
0.977
Final BW, kg
12.64
12.61
0.34
0.559
1Values are expressed as least squares means with pooled SEM; n = 15 and
15 replicates for control and nucleotide, respectively.
in nucleotide content by selecting feed ingredients that
are known for their low content of nucleotides, such as
barley and soy protein concentrate containing 5 mg/kg
and 4 mg/kg of total nucleotides, respectively (Mateo and
Stein, 2004). Thus, this type of diet can be considered as
baseline of nucleotide content in weaning diets, whereas
the amount of pure nucleotides added to the basal diet
corresponded to contents present in sow milk.
In contrast, in the study of Shen et al. (2009), whey and
soybean meal containing considerably greater amounts
of total nucleotides (294 and 38 mg/kg, respectively;
Mateo and Stein, 2004) were used as dietary ingredients,
thereby increasing the initial amount of nucleotides
originating from the basal diet. In that way, it becomes
difficult to discriminate between potential effects of
nucleotides already present in the basal diet and those
supplemented as additive to the diet. According to N.
Sauer (unpublished data), such differences in both the
initial content of nucleotides in the basal diet and the total
content of nucleotides supplemented to the basal diet may
account, at least in part, for the differing results between
studies. Moreover, it is still speculative if the efficiency
of absorption of free nucleotides dissolved in water is
different from that of bound nucleotides in feed ingredients.
In the present study with weaned pigs, supplementation
of pure nucleotides dissolved in water did not improve
growth performance (ADG and G:F), which is in
general agreement with the results of other studies where
nucleotides were added as yeast products to the diet (e.g.,
Di Giancamillo et al., 2003; Domeneghini et al., 2004;
Andrés-Elias et al., 2007). However, in the present study,
the addition of pure nucleotides stimulated ADFI of piglets.
Since nucleotides have been shown to contribute to the
Table 4. Effects on hematocrit and plasma immunoglobulin concentrations of pigs slaughtered on d 0 (baseline) and
pigs fed diets without (control) or with nucleotides (nucleotide)1
Diet
P-value
Baseline
Baseline
Item
Baseline
Control
Nucleotide
vs. control
vs. nucleotide
Hematocrit, %
32 ± 2
32 ± 1
32 ± 1
0.913
0.906
IgA, mg/mL
0.17 ± 0.06
0.32 ± 0.03
0.45 ± 0.03
0.041
0.001
IgM, mg/mL
0.83 ± 0.50
1.76 ± 0.29
1.48 ± 0.29
0.127
0.279
IgG, mg/mL
10.43 ± 0.91
6.10 ± 0.53
5.73 ± 0.53
0.001
0.001
1Values are expressed as least squares means ± SEM; n = 5, 15, and 15 replicates for baseline, control, and nucleotide, respectively.
Control
vs. nucleotide
0.990
0.012
0.506
0.639
3131
Pure nucleotides in pig nutrition
savory, umami taste of food (Cairoli et al., 2008), they
may, when being supplemented to a weaner diet, promote
greater feed intake after weaning. It has been suggested
that an increased feed intake during weaning because of
nucleotide supplementation would diminish the risk of
diarrhea as piglets often reduce their feed intake soon
after removal from their sow. In that way, morphological
damages in the intestine could be minimized (MartinezPuig et al., 2007), contributing to better growth
performance and improved health status of the piglets.
However, as reviewed by Sauer et al. (2011), studies with
pigs in which pure nucleotides with known amounts were
added to the diet of the animals are still lacking. In humans,
the addition of pure nucleotides to infant formula, similar
to the results of the present study, had no effect on body
height and BW (Hawkes et al., 2006). On the other hand,
an increase in head circumference and BW was obtained
in infants after adding pure nucleotides to their formula
(Singhal et al., 2010). Thus, in both pigs and humans,
there are inconsistent results on the effect of nucleotide
supplementation on BW gain. It can be speculated whether
the observed differences between species are due to speciesdependent nucleotide requirements, which are reflected
in varying concentrations of nucleotides in milk between
species (Gil and Sanchez-Medina, 1982). However,
further aspects have to be considered when evaluating
the biological effects of supplemental nucleotides, apart
from species-specific effects. For example, the individual
immune status, or with regard to livestock, the hygienic
conditions, under which animals are kept, might influence
the response to supplemental dietary nucleotides.
Weaning is characterized by drastic changes in the
environment and diet of the piglet, concomitant with
the decline of maternal-derived immunoglobulins and
the withdrawal of other protective elements delivered
by milk (Salmon et al., 2009). Indeed, sow milk is
known to contain antibodies (mainly IgG in colostrum
and IgA in milk) conferring passive immune protection
to the newborn (Salmon et al., 2009). In the present
study, feeding nucleotides resulted in a greater plasma
IgA concentration, without affecting the concentration
of IgM or IgG. Consistent with this observation, Lee et
al. (2007) reported greater plasma IgA, but there were
no changes in IgG or IgM concentrations after dietary
supplementation with yeast nucleotides for 28 d to pigs. As
the immunoglobulins mediate humoral immunity and are
responsible for defending the body against extracellular
antigens in blood or other body fluids, an increase in
IgA may indicate a stimulating effect on piglet immunity
(Macpherson et al., 2008). According to Jyonouchi et al.
(1994), lymphocytes, as key components of the immune
system, depend on nucleotides synthesized de novo by
other organs, mainly the liver (Rudolph et al., 1990).
Moreover, according to those authors, dietary nucleotides
enhanced the Peyer’s patch lymphocyte production of
Type 1 and Type 2 cytokines that are involved in the
differentiation of intestinal B cells to plasma cells that
synthesize and secrete IgA. Consequently, under stressful
conditions, dietary nucleotides may have a substantial role
in maintaining optimal lymphocyte functions when the
requirements of the body for nucleotides surpass capacity
for de novo synthesis. Thus, it has been suggested that,
in a state of relative nucleotide deficiency as simulated
Table 5. Effect on small intestine length and small intestinal morphology of pigs slaughtered on d 0 (baseline) and
pigs fed diets without (control) or with nucleotides (nucleotide)1
Diet
Item
Small intestine
length, m
Duodenum
Villus, μm
Crypt, μm
V/C ratio2
Baseline
7.29 ± 0.48
Control
11.85 ± 0.28
577 ± 41
159 ± 10
755 ± 24
289 ± 6
Nucleotide
11.43 ± 0.28
755 ± 24
285 ± 6
Baseline
vs. control
<0.001
P-value
Baseline
vs. nucleotide
<0.001
0.001
<0.001
0.001
<0.001
3.6 ± 0.2
2.6 ± 0.1
2.7 ± 0.1
0.001
0.001
Jejunum
Villus, μm
643 ± 59
611 ± 34
630 ± 34
0.652
0.855
Crypt, μm
157 ± 16
246 ± 9
231 ± 9
< 0.001
0.001
4.2 ± 0.3
2.5 ± 0.2
2.8 ± 0.2
0.001
0.001
V/C ratio2
Ileum
Villus, μm
306 ± 233
321 ± 12
346 ± 12
0.565
0.147
Crypt, μm
210 ± 293
227 ± 15
246 ± 15
0.608
0.287
V/C ratio2
1.5 ± 0.53
2.0 ± 0.3
2.0 ± 0.3
<0.001
<0.011
1Values are expressed as least squares means ± SEM; n = 5, 15, and 15 replicates for baseline, control, and nucleotide, respectively.
2V/C ratio = villus-to-crypt ratio.
3n = 4, Cook’s D > 0.5.
Control
vs. nucleotide
0.291
0.997
0.596
0.377
0.704
0.242
0.369
0.170
0.388
0.903
3132
Sauer et al.
in the present basal diet, dietary nucleotides may be
rapidly incorporated into the tissue nucleotide pool,
thereby exerting important actions on the immune system
(Jyonouchi et al., 1994).
Moreover, according to Manzano et al. (2005),
dietary nucleotides increased the percentage of Peyer’s
patch lymphocytes expressing CD22 (a B cell marker)
and increased the percentage of lamina propria and
peritoneal lymphocytes expressing CD5 in mice. The
CD5 is expressed by B-1 cells that are precursors of IgAproducing intestinal plasma cells and IgA-producing
plasma cells in peripheral blood (Manzano et al., 2005),
indicating that greater IgA concentrations in the intestine,
as well as in the blood, is a possible explanation for
greater plasma IgA in the present study. Furthermore,
Vaerman et al. (1997) found relationships between gut
lymph and blood IgA in adult mini pigs. However, further
studies are warranted to examine potential relationships
between plasma IgA and intestinal secretory IgA content
because of dietary nucleotide supplementation.
For nucleotides, efficient and rapid absorption
from the small intestine has been shown (e.g., in vitro),
when using jejunal explants from suckling piglets (Gil
et al., 2007). Also, in the duodenum, more than 90% of
nucleotides and bases are transported into enterocytes
(Uauy, 1989). Since nucleotides are known to play many
key roles in biochemical processes, predominantly in
cellular functions (Cosgrove, 1998), an enhancement in
the absorption surface of mucosal structure, especially for
the upper gastrointestinal tract, can be expected because
of the supplementation of pure nucleotides to the basal
diet. However, in the present study, supplementation
of nucleotides in the diet of the piglets failed to affect
intestinal morphology on the basis of measurements of
small intestinal villus height, crypt depth, and villus-tocrypt ratio, which means that absence of nucleotides under
conditions tested in the present study would not induce
any growth depression of the piglets. Similarly, Van der
Peet-Schwering et al. (2007) obtained no difference in
jejunal morphology in terms of villus length and crypt
depth between pigs fed the control diet and those fed a diet
supplemented with yeast nucleotides. On the other hand,
there exist studies with pigs showing beneficial effects
of dietary yeast nucleotides on ileum gut morphology
as measured by increase in villus height and crypt depth
(Di Giancamillo et al., 2003; Domeneghini et al., 2004).
In comparison with the present study, yeast nucleotides,
which are known to contain different substances, were
used in the aforementioned studies. These substances,
such as oligosaccharides, may also promote small
intestine morphology (Sauer et al., 2011). Thus, it
needs to be clarified if the observed variation in gut
morphology in response to nucleotide supplementation
reflects differences between the administration of
free nucleotides or the components of yeast products.
Furthermore, it has been shown that, under certain
conditions (e.g., stress, disease, or periods of rapid
growth), nucleotides may become essential nutrients
(Cosgrove, 1998); the requirement for their exogenous
supply, however, may vary because of differences in health
status of the animals. This may account for the reported
differences between studies. Thus, a more pronounced
effect of nucleotides on intestinal morphology seems to
depend on immunological challenges such as diarrhea
(e.g., Bueno et al., 1994; Martinez-Puig et al., 2007).
For example, after recovery from diarrhea, rats fed a
nucleotide-enriched diet showed an intestinal histology
and ultrastructure close to those of normal uninfected
control animals (Bueno et al., 1994). Also, according to
Martinez-Puig et al. (2007), supplementation of yeast
nucleotides to the diet of pigs resulted in faster recovery
from diarrhea. However, in the present study, no signs
of diarrhea were observed, and future studies should
take into account potential effects of pure nucleotides on
alleviating intestinal disorders.
Bacterial numbers of the different compartments of
the intestine as determined in the present study generally
correspond to literature data for pigs (e.g., Metzler-Zebeli
Table 6. Effects on bacterial numbers (log10 16S ribosomal DNA gene copy/g fresh matter) of jejunum, cecum, and
feces of pigs slaughtered on d 0 (baseline) and pigs fed diets without (control) or with nucleotides (nucleotide)1
Jejunum
Cecum
Feces
P-value
Baseline Control Nucleotide Baseline Control Nucleotide Control Nucleotide Treatment Region Treatment × region
9.1 ± 0.1 9.3 ± 0.1 9.0 ± 0.2 10.8 ± 0.1 10.7 ± 0.1 10.9 ± 0.1 10.7 ± 0.1 10.8 ± 0.1
0.907 < 0.001
0.453
6.4 ± 0.2 6.6 ± 0.1 6.4 ± 0.2 6.6 ± 0.2a 6.9 ± 0.1ab 7.1 ± 0.1b 6.6 ± 0.1 7.0 ± 0.1
0.080
0.005
0.336
Enterococcus spp.
7.4 ± 0.2 7.8 ± 0.2 7.2 ± 0.3 8.4 ± 0.2 8.2 ± 0.2 8.6 ± 0.2 8.0 ± 0.2 8.1 ± 0.2
0.960
0.001
0.302
Lactobacillus group
Enterobacteriaceae
6.8 ± 0.3 7.3 ± 0.3 7.0 ± 0.3 8.6 ± 0.3 8.2 ± 0.3 8.3 ± 0.3 9.1 ± 0.3 9.2 ± 0.3
0.989 < 0.001
0.306
7.2 ± 0.2 7.5 ± 0.2 7.2 ± 0.2 8.1 ± 0.2 8.0 ± 0.2 8.2 ± 0.2 8.7 ± 0.2 8.7 ± 0.2
0.891 < 0.001
0.793
Bifidobacteria spp.
0.972 < 0.001
0.659
Clostridium Cluster XIV 6.0 ± 0.2 6.0 ± 0.2 5.7 ± 0.2 9.2 ± 0.2 9.3 ± 0.2 9.5 ± 0.2 9.1 ± 0.2 9.1 ± 0.2
7.4 ± 0.1 7.2 ± 0.1 7.2 ± 0.2 10.4 ± 0.1 10.2 ± 0.1 10.4 ± 0.1 10.4 ± 0.1 10.4 ± 0.1
0.367 < 0.001
0.910
Clostridium Cluster IV
7.5 ± 0.2a 7.0 ± 0.2b 6.8 ± 0.2b 7.6 ± 0.2a 8.1 ± 0.2b 8.2 ± 0.2b 8.0 ± 0.2 8.1 ± 0.2
0.988 < 0.001
0.012
Clostridium Cluster I
a,bMeans with different superscripts within a region and feces show differences (P < 0.05).
1Values are expressed as least squares means ± SEM; n = 5, 15, and 15 replicates for baseline, control, and nucleotide, respectively.
Phyla or
genera
Total Eubacteria
3133
Pure nucleotides in pig nutrition
et al., 2010; N. Sauer, unpublished data). In the present
study, no differences in intestinal bacterial numbers
because of dietary treatments were observed. However,
there were considerable changes with increasing age of
the animals. For example, there were greater numbers of
Enterococcus spp. in cecal digesta for the nucleotide group
in comparison with baseline, as well as greater numbers
of Clostridium Cluster I in cecal digesta for the treatments
in comparison with baseline. Contrary, bacterial numbers
of Clostridium Cluster I in jejunum digesta were lower
in the treatments when compared with the baseline. The
establishment of the intestinal microbiota of the pigs
during the period from birth to weaning is a complex
process characterized by different phases in bacterial
succession (Swords et al., 1993). Thus, differences in
bacterial numbers between baseline and treatments,
as observed in the present study, are due to the normal
succession in microbial composition, as influenced by
changes in age of the animals and dietary composition.
However, in the present study, it was expected that
dietary nucleotides would affect bacterial numbers in
the intestine. For example, in vitro studies indicate that
nucleotides enhance the growth of bifidobacteria (Tanaka
and Mutai, 1980; Uauy, 1989), and the response of different
E. coli strains to nucleotide additions to minimal culture
media is strain specific (Sauer et al., 2010). Additionally,
results from an in vivo study with human subjects indicate
that dietary nucleotides modify the composition of the
intestinal microbiota by promoting beneficial bacteria,
including bifidobacteria and lactobacilli (Gil et al., 1986).
However, in the present study, no difference between the
control and the nucleotide group was observed for any
of the bacterial groups tested. One reason could be that
dietary nucleotides are mainly absorbed in the proximal
intestinal tract (Bronk and Hastewell, 1987; Carver and
Walker, 1995), and, therefore, not be able to influence
bacterial growth or activity in the more distal regions
of the gastrointestinal tract. Furthermore, as it has been
suggested that lactic acid bacteria are not dependent
on exogenous supply with nucleotides (Terrade and
de Orduña, 2009), the observed increase in lactic acid
bacteria as shown in vitro (Gil et al., 1986) could be due
to other components present in the media. In addition,
the piglets in the present study were individually housed
under high hygienic standards, which could have affected
intestinal bacterial colonization differently from those
pigs that were exposed to environmental, nutritional,
or immunological stressors. Thus, further research is
warranted to determine the effect of dietary nucleotides
on intestinal bacterial numbers in piglets kept under
conditions similar to those in commercial pig production
systems. According to the conditions of the present study,
there is no evidence that dietary nucleotides may influence
the intestinal microbiota directly.
In summary, the current study demonstrated that
supplementing the diet of weaning piglets with pure
nucleotides resulted in an increase in plasma IgA
concentrations, without altering gut morphology, bacterial
numbers, and growth performance. Further studies
are warranted to determine if dietary supplementation
of nucleotides greater than physiological quantities,
especially, when pigs are challenged (e.g., with E. coli),
will improve their growth performance, immune status,
and intestinal microbial ecology.
LITERATURE CITED
Andrés-Elias, N., J. Pujols, I. Badiola, and D. Torrallardona. 2007. Effect
of nucleotides and carob pulp on gut health and performance of
weanling piglets. Livest. Sci. 108:280–283.
Bartosch, S., A. Fite, G. T. Macfarlane, and M. E. T. McMurdo. 2004.
Characterization of bacterial communities in feces from healthy
elderly volunteers and hospitalized elderly patients by using
Real-Time PCR and effects of antibiotic treatment on the fecal
microbiota. Appl. Environ. Microbiol. 70:3575–3581.
Boudry, G., V. Péron, I. Le Huërou-Luron, J. P. Lallès, and B. Sève. 2004.
Weaning induces both transient and long-lasting modifications of
absorptive, secretory, and barrier properties of piglet intestine. J.
Nutr. 134:2256–2262.
Bronk, J. R., and J. G. Hastewell. 1987. The transport of pyrimidines into
tissue rings cut from rat small intestine. J. Physiol. 382:475–488.
Bueno, J., M. Torres, A. Almendros, R. Carmona, M. C. Nuñez, A. Rios,
and A. Gil. 1994. Effect of dietary nucleotides on small intestinal
repair after diarrhoea. Histological and ultrastructural changes. Gut
35:926–933.
Cairoli, P., S. Pieraccini, M. Sironi, C. F. Morelli, G. Speranza, and
P. Manitto. 2008. Studies on umami taste. Synthesis of new
guanosine 5´-phosphate derivatives and their synergistic effect
with monosodium glutamate. J. Agric. Food Chem. 56:1043–1050.
Canadian Council on Animal Care. 1993. Guide to the Care and Use
of Experimental Animals. vol. 1. 2nd ed. Can. Counc. Anim. Care,
Ottawa, ON, Canada.
Carver, J. D., and W. A. Walker. 1995. The role of nucleotides in human
nutrition. J. Nutr. Biochem. 6:58–72.
Cosgrove, M. 1998. Nucleotides. Nutrition 14:748–751.
Di Giancamillo, A., C. Domeneghini, R. Paratte, V. Dell’Orto, and V.
Bontempo. 2003. Oral feeding with L-glutamine and nucleotides:
impact on some GALT (gut associated lymphoid tissue) parameters
and cell proliferation/death rates in weaning piglets. Ital. J. Anim.
Sci. 2(Suppl. 1):364–366.
Domeneghini, C., A. Di Giancamillo, G. Savoini, R. Paratte, V.
Bontempo, and V. Dell’Orto. 2004. Structural patterns of swine
ileal mucosa following L-glutamine and nucleotide administration
during the weaning period. An histochemical and histometrical
study. Histol. Histopathol. 19:49–58.
Gil, A., E. Corral, A. Martínez, and J. A. Molina. 1986. Effects of
the addition of nucleotides to an adapted milk formula on the
microbial pattern of faeces in at term newborn infants. J. Clin. Nutr.
Gastroenterol. 1:127–132.
Gil, A., C. Gomez-Leon, and R. Rueda. 2007. Exogenous nucleic
acids and nucleotides are efficiently hydrolysed and taken up as
nucleosides by intestinal explants from suckling piglets. Br. J. Nutr.
98:285–291.
Gil, A., and F. Sanchez-Medina. 1982. Acid-soluble nucleotides of
human milk at different stages of lactation. J. Dairy Res. 49:301–
307.
3134
Sauer et al.
Hawkes, J. S., R. A. Gibson, D. Roberton, and M. Makrides. 2006. Effect
of dietary nucleotide supplementation on growth and immune
function in term infants: A randomized controlled trial. Eur. J. Clin.
Nutr. 60:254–264.
Heilig, H. G. H. J., E. G. Zoetendal, E. E. Vaughan, P. Marteau, A.
D. L. Akkermans, and W. M. de Vos. 2002. Molecular diversity
of Lactobacillus spp. and other lactic acid bacteria in the human
intestine as determined by specific amplification of 16S ribosomal
DNA. Appl. Environ. Microbiol. 68:114–123.
Johnson, I. R., R. O. Ball, V. E. Baracos, and C. J. Field. 2006. Glutamine
supplementation influences immune development in the newly
weaned piglet. Dev. Comp. Immunol. 30:1191–1202.
Jyonouchi, H., L. Zhang-Shanbhag, Y. Tomita, and H. Yokoyama. 1994.
Nucleotide-free diet impairs T-helper cell functions in antibody
production in response to T-dependent antigens in normal C57B1/6
mice. J. Nutr. 124:475–484.
Lallès, J. - P., P. Bosi, H. Smidt, and C. R. Stokes. 2007. Weaning: a
challenge to gut physiologists. Livest. Sci. 108:82–93.
Lee, C., J. Kim, S. G. Shin, and S. Hwang. 2006. Absolute and relative
QPCR quantification of plasmid copy number in Escherichia coli.
J. Biotechnol. 123:273–280.
Lee, D. N., S. R. Liu, Y. T. Chen, R. C. Wang, S. Y. Lin, and C. F.
Weng. 2007. Effects of diets supplemented with organic acids
and nucleotides on growth, immune responses and digestive tract
development in weaned pigs. J. Anim. Pysiol. Anim. Nutr. (Berl.)
91:508–518.
Lee, D.- H., Y. - G. Zo, and S. - J. Kim. 1996. Nonradioactive method
to study genetic profiles of natural bacterial communities by
PCR-single-strand-conformation polymorphism. Appl. Environ.
Microbiol. 62:3112–3120.
Macpherson, A. J., K. D. McCoy, F. E. Johansen, and P. Brandtzaeg.
2008. The immune geography of IgA induction and function.
Mucosal Immunol. 1:11–22.
Manzano, M., A. Gil, and R. Rueda. 2005. New insights in the potential
mechanism of action of nucleotides to modulate immunity. Pages
172–173 in Early Nutrition and Its Later Consequences: New
opportunities. Perinatal Programming of Adult Health - EC
Supported Research. Advances in Experimental Medicine and
Biology. B. Koletzko, P. Dodds, H. Akerblom, and M. Ashwell, ed.
Springer Dordrecht, the Netherlands.
Martinez-Puig, D., E. G. Manzanilla, J. Morales, E. Borda, J. F. Pérez, C.
Piñeiro, and C. Chetrit. 2007. Dietary nucleotide supplementation
reduces occurrence of diarrhoea in early weaned pigs. Livest. Sci.
108:276–279.
Mateo, C. D., D. N. Peters, and H. H. Stein. 2004. Nucleotides in sow
colostrum and milk at different stages of lactation. J. Anim. Sci.
82:1339–1342.
Mateo, C. D., and H. H. Stein. 2004. Nucleotides and young animal
health: can we enhance intestinal tract development and immune
function? Pages 159–168 in Nutritional Biotechnology in the Feed
Industry. Proc. Alltech’s 20th Annual Symp. Department of Animal
and Range Sciences, South Dakota State University, Brookings,
SD.
Matsuki, T., K. Watanabe, J. Fujimoto, Y. Miyamoto, T. Takada, K.
Matsumoto, H. Oyaizu, and R. Tanaka. 2002. Development of
16S rRNA-Gene-Targeted group-specific primers for the detection
and identification of predominant bacteria in human feces. Appl.
Environ. Microbiol. 68:5445–5451.
Matsuki, T., K. Watanabe, J. Fujimoto, T. Takada, and R. Tanaka. 2004.
Use of 16S rRNA Gene-Targeted group-specific primers for RealTime PCR analysis of predominant bacteria in human feces. Appl.
Environ. Microbiol. 70:7220–7228.
Metzler-Zebeli, B. U., S. Hooda, R. Pieper, R. T. Zijlstra, A. G. van
Kessel, R. Mosenthin, and M. G. Gänzle. 2010. Nonstarch
polysaccharides modulate bacterial microbiota, pathways for
butyrate production, and abundance of pathogenic Escherichia
coli in the pig gastrointestinal tract. Appl. Environ. Microbiol.
76:3692–3701.
Metzler-Zebeli, B. U., A. Ratriyanto, D. Jezierny, N. Sauer, M. Eklund,
and R. Mosenthin. 2009. Effects of betaine, organic acids and inulin
as single feed additives or in combination on bacterial populations
in the gastrointestinal tract of weaned pigs. Arch. Anim. Nutr.
63:427–441.
Pluske, J. R., D. J. Hampson, and I. H. Williams. 1997. Factors
influencing the structure and function of the small intestine in the
weaned pig: a review. Livest. Prod. Sci. 51:215–236.
Rinttilä, T., A. Kassinen, E. Malinen, L. Krogius, and A. Palva. 2004.
Development of an extensive set of 16S rDNA-targeted primers
for quantification of pathogenic and indigenous bacteria in fecal
samples by real-time PCR. J. Appl. Microbiol. 97:1166–1177.
Ririe, K. M., R. P. Rasmussen, and C. T. Wittwer. 1997. Product
differentiation by analysis of DNA melting curves during the
polymerase chain reaction. Anal. Biochem. 245:154–160.
Rudolph, F. B., A. D. Kulkarni, W. C. Fanslow, R. P. Pizzini, S. Kumar,
and C. T. Van Buren. 1990. Role of RNA as a dietary source of
pyrimidines and purines in immune function. Nutrition 6:45–52.
Salmon, H., M. Berri, V. Gerdts, and F. Meurens. 2009. Humoral
and cellular factors of maternal immunity in swine. Dev. Comp.
Immunol. 33:384–393.
Sauer, N., E. Bauer, W. Vahjen, J. Zentek, and R. Mosenthin. 2010.
Nucleotides modify growth of selected intestinal bacteria in vitro.
Livest. Sci. 133:161–163.
Sauer, N., R. Mosenthin, and E. Bauer. 2011. The role of dietary
nucleotides in single-stomached animals. Nutr. Res. Rev. 25:46–59.
Shen, Y. B., X. S. Piao, S. W. Kim, L. Wang, P. Liu, I. Yoon, and Y. G.
Zhen. 2009. Effects of yeast culture supplementation on growth
performance, intestinal health, and immune response of nursery
pigs. J. Anim. Sci. 87:2614–2624.
Singhal, A., K. Kennedy, J. Lanigan, H. Clough, W. Jenkins, A. EliasJones, T. Stephenson, P. Dudek, and A. Lucas. 2010. Dietary
nucleotides and early growth in formula-fed infants: A randomized
controlled trial. Pediatrics 126:946–953.
Song, Y., C. Liu, and S. M. Finegold. 2004. Real-Time PCR quantitation
of Clostridia in feces of autistic children. Appl. Environ. Microbiol.
70:6459–6465.
Swords, W. E., C. - C. Wu, F. R. Champlin, and R. K. Buddington. 1993.
Postnatal changes in selected bacterial groups of the pig colonic
microflora. Biol. Neonate 63:191–200.
Tanaka, R., and M. Mutai. 1980. Improved medium for selective
isolation and enumeration of Bifidobacterium. Appl. Environ.
Microbiol. 40:866–869.
Terrade, N., and R. M. de Orduña. 2009. Determination of the essential
nutrient requirements of wine-related bacteria from the genera
Oenococcus and Lactobacillus. Int. J. Food Microbiol. 133:8–13.
Uauy, R. 1989. Dietary nucleotides and requirements in early life. Pages
265–280 in Textbook of Gastroenterology and Nutrition in Infancy.
2nd ed. E. Lebenthal, ed. Raven Press Ltd. New York, NY.
Vaerman, J. - P., A. Langendries, R. Pabst, and H. J. Rothkötter. 1997.
Contribution of serum IgA to intestinal lymph IgA, and vice versa,
in minipigs. Vet. Immunol. Immunopathol. 58:301–308.
Van der Peet-Schwering, C. M. C., A. J. M. Jansman, H. Smidt, and I.
Yoon. 2007. Effects of yeast culture on performance, gut integrity,
and blood cell composition of weanling pigs. J. Anim. Sci.
85:3099–3109.
Walter, J., C. Hertel, G. W. Tannock, C. M. Lis, K. Munro, and W.
P. Hammes. 2001. Detection of Lactobacillus, Pediococcus,
Leuconostoc, and Weissella species in human feces by using groupspecific PCR primers and denaturing gradient gel electrophoresis.
Appl. Environ. Microbiol. 67:2578–2585.