0022-3565/04/3113-1154 –1162$20.00 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS Copyright © 2004 by The American Society for Pharmacology and Experimental Therapeutics JPET 311:1154–1162, 2004 Vol. 311, No. 3 71415/1180356 Printed in U.S.A. Coexpression of Y1, Y2, and Y4 Receptors in Smooth Muscle Coupled to Distinct Signaling Pathways Sudhakar Misra, Karnam S. Murthy, Huiping Zhou, and John R. Grider Departments of Physiology and Medicine, Medical College of Virginia Campus, Virginia Commonwealth University, Richmond, Virginia Received May 14, 2004; accepted July 26, 2004 Five distinct mammalian NPY receptors have been cloned: Y1, Y2, Y4, Y5, and Y6 (Eva et al., 1990; Lundell et al., 1995; Rose et al., 1995; Berglund et al., 2003; Rodriguez et al., 2003). The abbreviated Y designation reflects the large number of tyrosine residues (Y in the single-letter amino acid code) present in their endogenous ligands, neuropeptide Y (NPY), and the hormonal peptides, peptide YY (PYY) and pancreatic polypeptide (PP) (Blomqvist and Herzog, 1997; This work was supported by Grant DK15564 from the National Institute of Diabetes, and Kidney and Digestive Diseases. Article, publication date, and citation information can be found at http://jpet.aspetjournals.org. doi:10.1124/jpet.104.071415. concentration-dependent contraction, inositol 1,4,5-trisphosphate (IP3) formation, and increase in cytosolic free Ca2⫹. Contraction induced by Y2 and Y4 agonists was not affected by 0 Ca2⫹, Ca2⫹ channel blockers, or pertussis toxin (PTx), but it was abolished by thapsigargin, U73122 [1-(6-(17-3-methoxyestra-1,3,5(10)-trien-17-yl)amino)hexyl)-1H-pyrrole-25dione], or the myosin light chain kinase inhibitor ML-9 [1-(5-chloronaphthalene-1-sulfonyl)homopiperazine, HCl]. Y2-mediated contraction was inhibited by the selective Y2 antagonist BIIE 0246. Insensitivity to PTx implied that the coupling to Gi did not initiate (Y1) or contribute (Y2 and Y4) to contraction. All Y receptor agonists inhibited cAMP formation in a PTxsensitive manner. The patterns of contraction and inhibition of cAMP by various Y receptors were corroborated by selective receptor protection. The study demonstrates coexpression of Y1, Y2, and Y4 receptors on smooth muscle negatively coupled to adenylyl cyclase via Gi2. Coupling of Y2 and Y4 receptors to Gq determines their ability to induce IP3-dependent Ca2⫹ release and initiate contraction. Berglund et al., 2003). A putative Y3 receptor has not been cloned and remains a pharmacological entity based on the existence in some models of widely divergent responses to NPY and PYY (Michel et al., 1998). Y4 binds preferentially PP, whereas Y1, Y2, and Y5 bind preferentially NPY and PYY (Berglund et al., 2003). The pharmacological profile of Y6 has not been accurately determined. The pharmacological profile of Y2 receptors is distinctive with high affinities for NPY, PYY, long C-terminal fragments of NPY or PYY (e.g., NPY13–36), and the selective, nonpeptide antagonist BIIE 0246 (Rose et al., 1995; Dumont et al., 2000). The pharmacological profiles of Y1 and Y5 receptors are similar with high affinities for NPY-, PYY-, and [Pro34]-substituted analogs of ABBREVIATIONS: NPY, neuropeptide Y; PYY, peptide YY; PP, pancreatic polypeptide; RT-PCR, reverse transcription-polymerase chain reaction; TTx, tetrodotoxin; PCR, polymerase chain reaction; NEM, N-ethylmaleimide; GTP␥S, guanosine 5⬘-O-(3-thio)triphosphate; PTx, pertussis toxin; [Ca2⫹]i, cyosolic free Ca2⫹; IP3, inositol 1,4,5-trsiphosphate; CCK-8, cholecystokinin octapeptide; D600, methoxyverapamil; MLCK, myosin light chain kinase; ML-9, 1-(5chloronaphthalene-1-sulfonyl)homopiperazine, HCl; Y27632, (R)-(⫹)trans-N(4pyridyl)-4-(1-aminoethyl)-cyclohexanecarboxamide, 2HCl; U73122, 1-(6-(17-3methoxyestra-1,3,5(10)-trien-17-yl)amino)hexyl)-1H-pyrrole-25-dione; BIIE 0246, (S)N2-[1-[2-[4-[(R,S)-5,11-dihydro-6(66H)-oxodibenz[b,e]azepin-11-yl]1piperazinyl]-2-oxoethyl]cyclopentyl]acetyl]-N-[2-[1,2-dihydro-35(4H)-dioxo-1,2-diphenyl-3H-1,2,4-triazol-4-yl]ethyl]-argininamide. 1154 Downloaded from jpet.aspetjournals.org at ASPET Journals on June 17, 2017 ABSTRACT Coexpression of Y1, Y2, and Y4 receptors on smooth muscle cells was determined by reverse transcription-polymerase chain reaction, and the receptors were characterized by radioligand binding, selective receptor protection, and functional analysis of signaling pathways. 125I-peptide YY (PYY) binding was completely inhibited by neuropeptide Y (NPY) and PYY, and partially inhibited by the Y1 agonist [Leu31, Pro34]NPY or the Y2 agonist NPY13–36. In cells where Y1 receptors were preserved by selective receptor protection, 125I-PYY binding was selectively inhibited by the Y1 agonist or antagonist BIBP 3226 [(R)-N2-(diphenylacetyl)-N-[(4-hydroxyphenyl)methyl]-Darginine-amide]. Conversely, in cells where Y2 receptors were preserved, 125I-PYY binding was selectively inhibited by the Y2 agonist or antagonist BIIE 0246 [(S)N2-[1-[2-[4-[(R,S)-5,11dihydro-6(66H)-oxodibenz[b,e]azepin-11-y]-1piperazinyl]-2oxoethyl]cyclopentyl]acetyl]-N-[2-[1,2-dihydro-35(4H)-dioxo1,2-diphenyl-3H-1,2,4-triazol-4-yl]ethyl]-argininamide]. All Y receptors activated preferentially Gi2, but only Y2 and Y4 receptors activated Gq. Consequently, Y2 agonists (NPY, PYY, and NPY13–36) and the Y4 agonist (pancreatic polypeptide) induced Y Receptor Signaling in Smooth Muscle Y2 receptors mediated contraction by NPY and PYY, and Gq-coupled Y4 receptors mediated contraction by PP. Materials and Methods Dispersion of Muscle Cells. Muscle cells were isolated from the circular muscle layer of the rabbit stomach by successive enzymatic digestion, filtration, and centrifugation as described previously (Murthy and Makhlouf, 1995, 1996, 1997). Briefly, slices of gastric muscle were incubated for 30 min at 31°C in 15 ml of HEPES medium containing 0.1% collagenase and 0.1% soybean trypsin inhibitor. The composition of the medium was 120 mM NaCl, 4 mM KCl, 2.6 mM KH2PO4, 0.6 mM MgCl2, 25 mM HEPES, 14 mM glucose, and 2.1% Eagle’s essential amino acid mixture. The partly digested tissue was washed with 100 ml of enzyme-free medium and reincubated for 30 min, during which the cells were allowed to disperse spontaneously. Suspensions of single muscle cells were harvested by filtration through 500-m Nitex mesh. The suspension was centrifuged twice for 10 min at 350g to eliminate cell debris and organelles. RT-PCR Analysis of Y Receptor Expression. Specific primers were designed based on homologous sequences in human, rat, and mouse cDNAs for Y1, Y2 and Y4. The sequences of the primers are listed in Table 1. Total RNA (5 g) isolated from cultured gastric smooth muscle cells was reversibly transcribed and amplified by PCR under standard conditions as described previously (Teng et al., 1998). The PCR products were separated by electrophoresis in 1.2% agarose gel in the presence of ethidium bromide, visualized by ultraviolet fluorescence, and recorded by a ChemiImager 4400 fluorescence system (Alpha Innotech, San Leandro, CA). The PCR products were purified and sequenced. Characterization of Y Receptors by Radioligand Binding. Muscle cells were suspended in HEPES medium containing 1% bovine serum albumin, amastatin (10 M), phospharamidon (1 M), and bacitracin (0.7 mM). Triplicate aliquots (0.3 ml) of cell suspension (106 cells/ml) were incubated for 15 min at 25°C with 125I-PYY (50 pM) alone or in the presence of unlabeled PYY, NPY, [Leu34, Pro31]NPY, NPY13–36, or PP. Bound and free radioligand were separated by rapid filtration through 5-m polycarbonate nucleopore filters followed by washing for three times with HEPES medium (Kuemmerle et al., 1995; Murthy and Makhlouf, 1997). Nonspecific binding was measured as the amount of radioactivity associated with the muscle cells in the presence of unlabeled PYY (10 M). Specific binding was calculated as the difference between total and nonspecific binding. Nonspecific binding was 26 ⫾ 4% of total binding. Characterization of Y1, Y2, and Y4 Receptors by Selective Receptor Protection. A technique for selective receptor protection previously used to determine the coexpression and function of various G protein-coupled receptors was used to characterize the expression of Y receptors in smooth muscle (Kuemmerle et al., 1995; Murthy and Makhlouf, 1997, 1998). The technique involves protection of one receptor type with the selective Y1 agonist [Leu31, Pro34]NPY, the selective Y2 agonist NPY13–36, or the Y4 agonist PP followed by inactivation of all unprotected receptors with a low concentration of N-ethylmaleimide (NEM; 5 M). Freshly dispersed muscle cells were TABLE 1 Sequences of PCR primers for Y receptors Receptor Subtype Sequence Base Pairs Y1 Forward 5⬘ TCCTTCTCAGACTTGCT 3⬘ Reverse 5⬘ TTGTCCATCATGTTGTTTCTCC3⬘ *Forward 5⬘ GASAGCAAGATCTCCAAGC 3⬘ Reverse 5⬘ TGTACTCCTTCAGGTCCAG 3⬘ *Forward 5⬘CCTTCTCYGACTTCCTCATGTG3⬘ *Reverse 5⬘CTTGAAGTTGYTGTTGAGAAAGCC 3⬘ 493 Y2 Y4 442 740 * Degenerate oligonucleotides from human, rat, and mouse sequence. S ⫽ C ⫹ G; Y ⫽ C ⫹ T. Downloaded from jpet.aspetjournals.org at ASPET Journals on June 17, 2017 NPY or PYY (e.g., [Leu31, Pro34]NPY), but they can be distinguished by the selective, nonpeptide Y1 antagonist BIBP 3226 (Krause et al., 1992; Doods et al., 1995; Wieland et al., 1995; Weinberg et al., 1996; Rodriguez et al., 2003). Before the advent of selective antagonists, C-terminal fragments of NPY/PYY were used effectively as preferential agonists of Y2 receptors, and [Pro34]-substituted analogs as preferential agonists of Y1 and Y5 receptors (or Y1 in the absence of expressed Y5 receptors); PP was used as a preferential agonist of Y4 receptors (Lundell et al., 1995). Y receptors are widely distributed in the central and peripheral nervous systems (Sundler et al., 1993; Lomax and Furness, 2000). Although typical responses have been ascribed to specific receptors, variability is common. Thus, inhibition of neurotransmitter release, a prototypical response mediated by Y2 receptors in some tissues, (e.g., vas deferens) is mediated by Y1 receptors in the enteric nervous system (Wahlestedt et al., 1986; Grider and Langdon, 2003). Expression of Y receptors in non-neural tissues has usually been surmised from pharmacological profiles and only rarely by precise receptor mapping. In gastrointestinal tissues, for example, the response to NPY, PYY, or PP is often a compound of nerve-mediated and direct effects that involve more than one receptor type, leading to divergent results and interpretations (Feletou et al., 1998; Pheng et al., 1999; Ferrier et al., 2000, 2002). Recent studies have attempted to facilitate the interpretation of pharmacological studies by measurement of Y receptor expression (Goumain et al., 1998). Analysis of receptor expression by RT-PCR in heterogeneous tissues can be useful in identifying which receptor types are not expressed, but it has obvious limitations in assigning expressed receptors to specific tissues or cell types. This is illustrated by several recent studies of Y receptor expression in rat colon, where there was complete agreement on expression of Y4 receptors, and clear differences on expression of Y1, Y2, and Y5 receptors. Feletou et al. (1998) demonstrated expression of Y2 and Y4 receptors and showed contraction of colonic muscle by NPY and PYY that was insensitive to the axonal blocker tetrodotoxin (TTx) and contraction by PP that was abolished by TTx and strongly inhibited by atropine, suggesting direct muscle contraction via Y2 receptors and nerve-mediated contraction via Y4 receptors. It is worth noting, however, that insensitivity to TTx does not preclude a nerve-mediated response via presynaptic release of an excitatory neurotransmitter from nerve terminals. Ferrier et al. (2000, 2002) demonstrated expression of Y1 and Y4 receptors and also showed nerve-mediated contraction by PP; contraction by PYY was partly inhibited by TTx and by a neurokinin1 receptor antagonist, but it was not affected by the Y1 antagonist BIBP 3226; consequently, contraction by PYY was attributed to a yet undefined Y receptor type. In the present study, we have examined the expression of Y receptors in cultured and freshly dispersed smooth muscle cells and identified the G protein-dependent signaling pathways initiated by these receptors. Y1, Y2, and Y4 receptors were demonstrated by RT-PCR. A combination of techniques involving radioligand binding, selective receptor protection, and functional analysis of signaling pathways confirmed the coexpression of Y1, Y2, and Y4 receptors. The Y receptors exhibited distinctive patterns of coupling to G proteins, but all three receptors were negatively coupled to adenylyl cyclase via one or more isoform of Gi (mainly Gi2). Gq-coupled 1155 1156 Misra et al. (Murthy and Makhlouf, 1995, 1996, 1997). Aliquots (0.5 ml) containing 106 cells/ml were incubated with isobutyl methyl xanthine (10 M) and forskolin (10 M) for 5 min followed by addition of various Y receptor agonists for 60 s. The reaction was terminated with 6% trichloroacetic acid. The mixture was centrifuged at 2000g for 15 min at 4°C. The supernatant was extracted three times with 2 ml of diethyl ether and 500 l of 50 mM sodium acetate (pH 6.2) and acetylated with triethylamine-acetic anhydride [3:1 (v/v)] for 30 min. cAMP was measured in duplicate and expressed as picomoles per 106 cells. Drugs and Chemicals. NPY, PYY, PP, [Leu31, Pro34]NPY, NPY13–36 were obtained from Peninsula Laboratories (Belmont, CA); [35S]GTP␥S and 125I-PYY were from PerkinElmer Life and Analytical Sciences (Boston, MA); U73122 and ML-9 were from Calbiochem (San Diego, CA); and polyclonal antibodies to G␣i1, G␣i2, G␣i3, and G␣q were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). BIBP 3226 was from Bachem California (Torrance, CA), and BIIE 0246 was a gift from Boehringer Ingelheim Pharma (Biberach, Germany). All other chemicals were from Sigma-Aldrich (St. Louis, MO). Data Analysis. Significant differences were determined relative to control using Student’s t test for paired or unpaired values. Results Coexpression of Y1, Y2, and Y4 Receptors on Smooth Muscle Cells. Y1, Y2, and Y4 receptors were detected by RT-PCR on RNA extracted from cultured rabbit gastric muscle cells in first passage using primers based on conserved sequences of human, rat, and mouse cDNAs (Table 1). PCR products of the expected size were obtained (Fig. 1). The primary amino acid sequences based on the partial DNA sequences of rabbit Y1, Y2, and Y4 receptors were similar to those of human, rat, and mouse (Y1: 95% similarity to human, rat, and mouse; Y2: 96% similarity to human, 94% to rat and 93% to mouse; and Y4: 86% similarity to human, and 76% to rat and mouse) (Fig. 1). The partial sequences for Y1, Y2, and Y4 receptors in rabbit smooth muscle have been deposited in GenBank (accession nos. AY587058 for Y1, AY587059 for Y2, and AY587060 for Y4). As shown previously (Teng et al., 1998), the use of confluent cultures of smooth muscle in Fig. 1. Expression of Y receptors in cultured gastric smooth muscle cells. Total RNA was isolated from cultured (first passage) rabbit gastric muscle cells was reverse transcribed, and cDNA was amplified with specific Y1, Y2, and Y4 primers (see Table 1). Experiments were done in the presence or absence of reverse transcriptase (RT). PCR products were obtained with Y1, Y2, and Y4, but not Y5 primers. Partial sequences of rabbit Y1, Y2, and Y4 receptors have been deposited in GenBank (accession nos. AY587058 for Y1, AY587059 for Y2, and AY587060 for Y4). Downloaded from jpet.aspetjournals.org at ASPET Journals on June 17, 2017 incubated at 31°C for 2 min with 0.1 M [Leu31, Pro34] NPY, NPY13– 36, or PP followed by addition of NEM for 20 min. The cells were centrifuged twice at 150g for 10 min and resuspended in control HEPES medium for 60 min. Control cells and cells in which one receptor type was preserved were used for measurement of radioligand binding and muscle contraction (see below). As shown previously (Kuemmerle et al., 1995; Murthy and Makhlouf, 1997, 1998), muscle cells incubated with NEM without protective agent did not contract in response to receptor-linked agonists, but they responded fully to ionomycin and KCl. Identification of G Proteins Coupled to Y1, Y2, and Y4 Receptors. Activation of specific G proteins was determined from agonist-induced increase in G␣ binding to GTP␥S as described previously (Okamoto et al., 1992; Murthy et al., 1996; Murthy and Makhlouf, 1996, 1997, 1998) Cells were homogenized in 20 mM HEPES (pH 7.4) containing 2 mM MgCl2, 1 mM EDTA, and 2 mM 1,4-dithiothreitol. The homogenate was centrifuged at 30,000g for 30 min at 4°C, and the membranes were solubilized at 4°C in 20 mM HEPES (pH 7.4) buffer. The solubilized membranes were incubated for 20 min at 37°C with 100 nM [35S]GTP␥S in 10 mM HEPES (pH 7.4) in the presence or absence of agonist. The reaction was stopped with 10 volumes of 100 mM Tris HCl (pH 8.0) containing 10 mM MgCl2, 100 mM NaCl, and 20 M GTP, and the membranes were incubated for 2 h on ice in wells precoated with specific antibodies to G␣i1, G␣i2, G␣i3, and G␣q. After washing with phosphate buffer, the radioactivity from each well was counted by liquid scintillation. Measurement of Cytosolic Free Ca2ⴙ ([Ca2ⴙ]i) in Dispersed Muscle Cells. Cytosolic free Ca2⫹ [Ca2⫹]i was measured in muscle cells by using Ca2⫹ fluorescent dye fura-2 as described previously (Murthy and Makhlouf, 1995, 1998). Muscle cells were suspended in a medium containing 10 mM HEPES, 125 mM NaCl, 5 mM KCl, 1 mM CaCl2, 0.5 mM MgSO4, 5 mM glucose, 20 mM taurine, 5 mM creatine, and 45 mM Na pyruvate. Cells were loaded with fura-2 by incubation with 2 M fura-2/acetoxymethyl ester for 20 min followed by centrifugation and resuspension in fura-2/acetoxymethyl esterfree medium for immediate measurement of [Ca2⫹]i. Two milliliters of cell suspension (106/cells) was used for measurement of fluorescence, which was monitored at 510 nm by using a Deltascan-1 fluorometer (Photon Technologies, Brunswick, NJ) with excitation wavelengths alternating between 340 and 380 nm. Autofluorescence of unloaded cells was determined in each suspension and subtracted from fluorescence of fura-2-loaded cells. Ca2⫹ levels were calculated under basal conditions and upon addition of test agents from the ratios of observed, minimal, and maximal fluorescence (Murthy and Makhlouf, 1995, 1998). Inositol 1,4,5-Trisphosphate (IP3) Radioreceptor Assay. IP3 was measured in dispersed muscle cells by a radioreceptor assay, which uses 3H-labeled D-myo-IP3 and bovine brain microsomes as described previously (Murthy and Makhlouf, 1995, 1996, 1998). Agonists were added for 30 s to 1 ml of muscle cell suspension (106 cells/ml), and the reaction terminated with an equal volume of icecold 10% perchloric acid. The supernatant was extracted and IP3 content in the aqueous phase was measured. The results were expressed as picomoles of IP3/106 cells. Measurement of Contraction. Muscle cell contraction was measured in freshly dispersed muscle cells by scanning micrometry as described previously (Murthy and Makhlouf, 1995, 1996, 1998). A cell aliquot containing 104 muscle cells/ml was added to 0.1 ml of medium containing agonist and the reaction terminated with 1% acrolein. Time course measurements were done at intervals ranging from 15 s to 5 min. The initial peak contraction was measured at 30 s, and the response was used to construct concentration-response curves. The lengths of muscle cells treated with agonist were compared with the lengths of untreated cells, and contraction was expressed as the decrease in mean cell length from control (range of control cell length in various experiments, 75 ⫾ 3 to 84 ⫾ 2 m). Cyclic AMP Radioimmunoassay. Cyclic AMP was measured in dispersed muscle cells by radioimmunoassay as described previously Y Receptor Signaling in Smooth Muscle 1157 first passage ensured the absence of neural, endothelial, or interstitial cell contaminants. Characterization of Y Receptors by Radioligand Binding and Receptor Protection. PYY and NPY inhibited specific binding of 125I-PYY with equally high affinity (IC50 of 5 nM). The Y1 agonist [Leu31, Pro34]NPY and Y2 agonist NPY13–36 only partially inhibited 125I-PYY binding, whereas PP had little or no effect (Fig. 2). The pattern implied that PYY and NPY bound to Y1 and Y2 receptors and that PP bound to a distinct receptor, presumably Y4, which is expressed in these cells and for which PP has high affinity. The pattern of binding was confirmed by selective receptor protection. In cells where only Y1 receptors were preserved, control 125I-PYY binding was decreased by 52 ⫾ 4%, and the residual binding was selectively inhibited by the Y1 agonist [Leu31, Pro34]NPY or antagonist BIBP 3226, but not by the Y2 agonist NPY13–36 or PP (Fig. 3). In cells where only Y2 receptors were preserved, control 125I-PYY binding was decreased by 61 ⫾ 3%, and the residual binding was selectively inhibited by the Y2 agonist NPY13–36 and antagonist (BIIE 0246), but not by the Y1 agonist or by PP (Fig. 3). Activation of G Proteins by Y Receptors. The Y2 agonist NPY13–36 (1 M) activated Gq and Gi2, in a time-dependent manner (maximal at 15 min), causing a significant increase in the binding of [35S]GTP␥S to G␣q (259 ⫾ 34%) and G␣i2 (308 ⫾ 26%) but not to G␣i1 (2%) or G␣i3 (6%) in solubilized membranes derived from freshly dispersed smooth muscle cells (Fig. 4). The Y1 agonist [Leu31, Pro34]NPY (1 M) activated both Gi1 (47 ⫾ 4%) and Gi2 (307 ⫾ 30%) but not Gq (8%) (Fig. 4). PP (1 M) activated Gq (61 ⫾ 10%) and Gi2 (193 ⫾ 15%), but its ability to activate Gq was significantly lower (p ⬍ 0.01) than that of the Y2 agonist NPY13–36, whereas its ability to activate Gi2 was significantly lower (p ⬍ 0.05) than that of Y2 and Y1 agonists (Fig. 4). Fig. 3. 125I-PYY binding to dispersed muscle cells in which either Y1 or Y2 receptors were preserved. Y1 and Y2 receptors were preserved by selective receptor protection with 0.1 M [Leu31, Pro34]NPY (A) or 0.1 M NPY13–36 (B), respectively, followed by inactivation of untreated receptors as described under Materials and Methods. 125I-PYY binding to control untreated muscle cells is shown in the solid column. Binding decreased in cells in which only one receptor type was preserved (open columns; residual 125I-PYY binding). [Leu31Pro34]NPY and the Y1 antagonist BIBP 3226 selectively inhibited residual binding in cells in which Y1 receptors were preserved. NPY13–36 and the Y2 antagonist BIIE 0246 selectively inhibited residual binding in cells in which Y2 receptors were preserved. All concentrations of unlabeled peptide were 1 M, except for BIBP 3226 and BIIE 0246 (0.1 M). Values are means ⫾ S.E.M. of four experiments. Muscle Cell Contraction Mediated by Y Receptors. PYY, NPY, the selective Y2 agonist NPY13–36, and PP caused contraction that attained a rapid peak within 30 s before declining to lower levels. The time course was similar to that observed with various agonists in these cells (Murthy et al., 2003). The selective Y1 agonist [Leu31, Pro34]NPY had no effect. Peak contraction was concentration-dependent: PYY, NPY, and the Y2 agonist were equipotent and exhibited full efficacy (half-maximal response at 1 nM; maximal response at 1 M: 26 ⫾ 1% decrease in cell length versus 25 ⫾ 1% for CCK-8) (Fig. 5). PP behaved as a partial agonist with a maximal response at 1 M that was ⬃35% lower than the response to NPY or PYY. The contractile response to NPY and NPY13–36, but not the response to PP, was abolished by the Y2 antagonist BIIE 0246 (0.1 M); the Y1 antagonist Downloaded from jpet.aspetjournals.org at ASPET Journals on June 17, 2017 Fig. 2. Competitive inhibition of 125I-PYY binding to dispersed gastric muscle cells by Y receptor agonists. Specific 125I-PYY binding was completely inhibited by NPY and PYY and partially inhibited by [Leu31, Pro34]NPY and NPY13–36. The extent of inhibition by [Leu31, Pro34]NPY and NPY13–36 reflected the component of 125I-PYY binding to Y1 and Y2 receptors, respectively. Values are means ⫾ S.E.M. of four experiments. 1158 Misra et al. Downloaded from jpet.aspetjournals.org at ASPET Journals on June 17, 2017 Fig. 4. Activation of G proteins by Y1, Y2, and Y4 receptor agonists. A, time course of Gq and Gi2 activation by NPY13–36. Membranes isolated from freshly dispersed smooth muscle cells were incubated with NPY13–36 (1 M) for different times in wells coated with G␣q or G␣i2 antibodies. B, membranes incubated with Y1 agonist [Leu31, Pro34]NPY (1 M), Y2 agonist NPY13–36 (1 M), or Y4 agonist PP (1 M) for 20 min in wells coated with specific G␣i1, G␣i2, G␣i3, or G␣q antibodies. Results are expressed as the agonist-induced increase in [35S]GTP␥S binding to G␣ subunits. Values are means ⫾ S.E.M. of four experiments. BIBP 3226 (0.1 M) had no effect on contraction (Fig. 5). The results implied that contraction by NPY was mediated by the Y2 receptor, and contraction by PP was mediated by a distinct receptor. Contraction measured after selective receptor protection confirmed that NPY and PYY induced contraction via Y2 receptors and that PP induced contraction via a distinct receptor, presumably Y4. In freshly dispersed muscle cells where the Y2 agonist was used to protect Y2 receptors only, the responses to NPY, PYY, and the Y2 agonist were fully preserved, whereas the response to PP was suppressed (Fig. 6). Conversely, in cells where PP was used as protective agent, the response to PP only was preserved, whereas the responses to NPY, PYY, and the Y2 agonist were suppressed (Fig. 6). In cells where the Y1 agonist was used to protect Y1 receptors, all contractile responses to NPY, PYY, the Y2 agonist, and PP were suppressed (data not shown), providing further evidence that Y1 receptors do not mediate contraction. With Y1 agonist as protective agent, only contraction induced by KCl (20 mM), which bypasses receptors, was retained (data not shown). Treatment of the cells with 400 ng/ml pertussis toxin for 1 h Fig. 5. Contractile response of dispersed gastric muscle cells to Y receptor agonists. A, concentration-dependent contraction of muscle cells in response to NPY, PYY, NPY13–36, and PP; the Y1-selective agonist [Leu31, Pro34]NPY did not cause contraction. B, blockade of contraction induced by 1 M NPY and 1 M NPY13–36 by the selective Y2 antagonist BIIE 0246 (0.1 M), but not by the Y1-selective antagonist BIBP 3226 (0.1 M). BIBP 3226 and BIIE 0246 had no effect on PP-induced contraction. Contraction was measured by scanning micrometry and expressed as percentage of decrease in cell length from control (mean control cell length: 81 ⫾ 3 M). Values are means ⫾ S.E.M. of four to six experiments. had no effect on contraction induced by all Y receptor agonists (data not shown), unlike its effect on inhibition of cAMP formation (see below), implying that contraction was exclusively mediated via Gq, which induces PI hydrolysis and IP3-dependent Ca2⫹ release and contraction in circular gastric and intestinal smooth muscle by activating PLC-1. In this respect, Y receptor Y Receptor Signaling in Smooth Muscle agonists differed from other Gi-coupled receptor agonists, which can induce contraction by activating a distinct PLC- isoform, PLC-3 (Murthy and Makhlouf, 1995; Murthy et al., 1996, 1996, 1998). Thus, activation of Gi2 by Y2 or Y4 receptors did not contribute to the contractile response. Similarly, activation of both Gi2 and Gi1 by Y1 receptors did not initiate contraction. Stimulation of IP3 Formation and Ca2ⴙ Mobilization by Y2 and Y4 Receptors. At a concentration (1 M) that induced maximal contraction, NPY, PYY, the Y2 agonist NPY13–36, and PP caused significant increases in IP3 and [Ca2⫹]i levels (Table 2). The Y1 agonist did not stimulate IP3 formation or cause an increase in [Ca2⫹]i. The IP3 and [Ca2⫹]i responses to NPY, PYY, and NPY13–36 were not significantly different from those of a maximally effective concentration of cholecystokinin octapeptide (CCK-8; 1 nM). [Ca2⫹]i in response to PP was significantly lower (p ⬍ 0.05) than the response to NPY or CCK-8; the IP3 response to PP TABLE 2 Increase in IP3 formation and 关Ca2⫹兴i induced by Y1, Y2, and Y4 agonists and CCK-8 in dispersed muscle cells The agonists were used at maximally effective concentrations (1 M for Y receptor agonists and 1 nM for CCK-8). IP3 was measured by radioreceptor assay and expressed as picomoles per 106 cell above basal levels (3.3 ⫾ 1.3 pmol/106 cells). 关Ca2⫹兴i was measured by fura-2 fluorescence and expressed as nanomoles per liter above basal level (40 ⫾ 3 nM). Values are mean ⫾ S.E. of three to six experiments. ⌬ 关Ca2⫹兴i NPY PYY NPY13–36 关Leu31,Pro34兴NPY PP CCK-8 ⌬ IP3 nM pmol/106 cells 437 ⫾ 77** 393 ⫾ 108** 411 ⫾ 92** 2 ⫾ 6 (N.S.) 242 ⫾ 62** 439 ⫾ 47** 2.2 ⫾ 0.0.4** 2.2 ⫾ 0.4** 1.8 ⫾ 0.7* 0.1 ⫾ 0.6 (N.S.) 1.9 ⫾ 0.6* 2.8 ⫾ 0.1** Significant increase above basal level, **p ⬍ 0.01; *p ⬍ 0.05. was only marginally lower than the response to NPY, PYY, or NPY13–36. Contraction by NPY, PYY, NPY13–36, and PP was not affected by withdrawal of Ca2⫹ from the extracellular medium or by addition of the Ca2⫹ channel blocker methoxyverapamil (D600), but it was abolished after sarcoplasmic Ca2⫹ stores were depleted by pretreatment of the cells for 20 min with thapsigargin (2 M) (Table 3). The results confirmed that the increase in [Ca2⫹]i was dependent on release of Ca2⫹ from intracellular stores. A control response to KCl, which is mediated by opening of voltage-gated Ca2⫹ channels, was abolished in Ca2⫹-free medium and in the presence of D600, but it was retained after treatment with thapsigargin. Signaling Pathway Mediating Contraction by Y2 and Y4 Receptors. As shown above, Y2 and Y4 receptors activated Gq and stimulated IP3 formation and IP3-dependent Ca2⫹ release and muscle contraction. Accordingly, the initial peak contraction induced by NPY, PYY, and NPY13–36 acting via Y2 receptors, and PP acting via Y4 receptors was abolished after suppression of PI hydrolysis with U73122 (1 M) or inhibition of myosin light chain kinase (MLCK) activity with ML-9 (1 M) (Table 3). Neither the protein kinase C inhibitor bisindolylmaleimide (1 M) nor the Rho kinase inhibitor Y27632 (1 M) had any effect on contraction (data not shown), further confirming that initial contraction is mediated by MLCK-dependent phosphorylation of MLC20 (Murthy et al., 2003). Inhibition of cAMP Formation Y1, Y2, and Y4 Receptors. As expected from their coupling to Gi1 and/or Gi2, all Y receptor agonists (1 M) inhibited cAMP formation induced by 1 M forskolin in freshly dispersed muscle cells; the inhibition, which ranged from 90 to 95%, was completely reversed by pretreatment of the muscle cells for 1 h with pertussis toxin (400 ng/ml) (Fig. 7). In cells where the selective Y2 agonist was used to protect Y2 receptors only, cAMP inhibition by NPY, PYY, and the Y2 agonist was preserved, whereas cAMP inhibition by the Y1 agonist and PP was suppressed (Fig. 8). In cells where the selective Y1 agonist was used to protect Y1 receptors, cAMP inhibition by NPY, PYY, and the Y1 agonist was preserved, whereas cAMP inhibition by the Y2 agonist and PP was suppressed (Fig. 8). In cells where PP was used to protect Y4 receptors, cAMP inhibition by PP only was preserved (Fig. 8). The pattern implied that NPY and PYY interacted with both Y1 and Y2 receptors. The results also confirmed the selectivity of the Y1 and Y2 agonists and the interaction of PP with its specific receptor. Discussion This study demonstrates the coexpression of three Y receptor types, Y1, Y2, and Y4, on smooth muscle cells and identifies the unique signaling pathways initiated by each. Decisive evidence for the expression of these receptors was obtained by RT-PCR in cultured gastric smooth muscle cells in first passage. The use of cells in first passage ensured the absence of other cell contaminants; previous studies using specific markers for other cell types (interstitial cells of Cajal, endothelial cells, and neurons) showed that only smooth muscle cells are retained after first passage (Teng et al., 1998). Expression of the three Y receptor types was corroborated by radioligand binding studies and pharmacological mea- Downloaded from jpet.aspetjournals.org at ASPET Journals on June 17, 2017 Fig. 6. Contractile response in dispersed gastric muscle cells in which either Y2 or Y4 receptors were preserved. Y2 and Y4 receptors were preserved by selective receptor protection with 0.1 M NPY13–36 or 0.1 M PP, respectively, followed by inactivation of untreated receptors as described under Materials and Methods. Contraction in response to 1 M NPY, PYY, NPY13–36, or PP in untreated cells (solid columns) and cells in which Y2 receptors (open columns) or Y4 receptors (hatched columns) were preserved was measured by scanning micrometry and expressed as percentage of decrease in cell length from control (mean control cell length, 78 ⫾ 4 m). Values are means ⫾ S.E.M. of four experiments. 1159 1160 Misra et al. TABLE 3 Contraction induced by Y1, Y2, and Y4 agonists in dispersed muscle cells Cell contraction in response to maximally effective concentrations of Y receptor agonists (1 M) was measured by scanning micrometry and expressed as percentage of decrease in cell length from control (mean control cell length, 81 ⫾ 3 m). Muscle cells were pretreated for 10 min with inhibitors of PI hydrolysis (U73122; 1 M), MLCK (ML-9; 10 M), or voltage-gated Ca2⫹ channels (D600; 1 M). The cells were pretreated for 30 min with thapsigargin (TG; 2 M) to deplete Ca2⫹ stores. Values are means ⫾ S.E. of four to five experiments. NPY PYY NPY13–36 关Leu31Pro34兴NPY PP Control D600 0 Ca2⫹/EGTA TG U73122 ML-9 28 ⫾ 2 26 ⫾ 3 25 ⫾ 2 3⫾3 19 ⫾ 2 27 ⫾ 2 25 ⫾ 3 25 ⫾ 1 NT 20 ⫾ 3 26 ⫾ 2 28 ⫾ 3 27 ⫾ 2 NT 22 ⫾ 2 2 ⫾ 3** 6 ⫾ 4** 4 ⫾ 3** NT 3 ⫾ 3** 4 ⫾ 2** 3 ⫾ 1** 4 ⫾ 1** NT 1 ⫾ 2** 2 ⫾ 2** 2 ⫾ 1** 3 ⫾ 1** NT 1 ⫾ 2** NT, not treated. Significant inhibition of contraction, **p ⬍ 0.01. surements using selective agonists and antagonists. The pharmacological measurements were supplemented by analysis of G protein coupling, IP3 formation, Ca2⫹ release, and inhibition of cAMP formation for each receptor type. The analysis yielded distinctive signaling profiles for Y1, Y2, and Y4 receptors in smooth muscle cells. Contraction was mediated exclusively by Y2 and Y4 receptors consistent with their coupling to Gq, whereas inhibition of cAMP formation was mediated by all three Y receptors, consistent with their coupling preferentially to Gi2. The Y2 receptor was significantly more effective than the Y4 receptor in activating G proteins and in mediating IP3 formation, Ca2⫹ release, and muscle contraction. Consequently, the selective Y4 ligand PP behaved as a partial contractile agonist. As shown for other contractile agonists in these cells, the initial contraction was mediated by Ca2⫹/calmodulin-dependent activation of MLCK and phosphorylation of MLC20 (Murthy et al., 2003). The signaling pathways that mediate Rho kinase/protein kinase C-dependent sustained contraction were not examined in this study (Murthy et al., 2003). The signaling pathways initiated by Y1, Y2, and Y4 receptors are depicted in Fig. 9. Studies in cell lines expressing one Y receptor type have shown that [Leu31, Pro34]NPY inhibited 125I-PYY (or 125INPY) binding in cells expressing Y1 receptors, whereas Downloaded from jpet.aspetjournals.org at ASPET Journals on June 17, 2017 Fig. 7. Inhibition of cAMP formation by Y receptor agonists. Dispersed muscle cells were treated with forskolin (1 M) for 10 min and then with different Y receptor agonist (all at 1 M) for 1 min. In some experiments, cells were pretreated with 400 ng/ml pertussis toxin (PTx) for 1 h. Cyclic AMP formation was expressed as picomoles per 106 cells. All Y receptor agonists inhibited forskolin-stimulated cAMP formation, and the inhibition was reversed by PTx. Values are means ⫾ S.E.M. of four experiments. NPY13–36 inhibited binding in cells expressing Y2 receptors (Weinberg et al., 1996). In smooth muscle cells, 125I-PYY binding was completely inhibited by NPY and PYY and partially inhibited by [Leu31, Pro34]NPY or NPY13–36, but it was not inhibited by PP, consistent with the presence of Y1 and Y2 receptors. Consequently, when only Y2 receptors were preserved by selective receptor protection, 125I-PYY binding was selectively inhibited by Y2 agonists and antagonists, whereas when only Y1 receptors were preserved 125I-PYY binding was selectively inhibited by Y1 agonists and antagonists. The technique of receptor protection has been repeatedly validated in these cells for a variety of receptors (Kuemmerle et al., 1995; Murthy and Makhlouf, 1997). Similar results were obtained by analyzing contractile response in naive cells and cells in which only one receptor type was preserved. NPY, PYY, and NPY13–36 elicited equipotent contraction, whereas [Leu31, Pro34]NPY had no effect, implying that NPY and PYY elicited contraction by activating Gq-coupled Y2 receptors. Selective protection of Y2 receptors preserved the contractile response to NPY, PYY, and NPY13–36, whereas selective protection of Y1 receptors suppressed the contractile response to all Y receptor agonists. PP elicited only a submaximal contraction that was preserved only when PP was used as protective agent, implying that PP interacted with its own Gq-coupled Y4 receptor. All Y receptor ligands used in this study inhibited cAMP formation in a PTx-sensitive manner, consistent with coupling of Y1, Y2, and Y4 receptors preferentially to Gi2. Previous studies by Voisin et al. (1996) in a renal proximal tubule cell line using an antisense approach had also noted preferential coupling of Y1 receptors to Gi2. Selective protection of Y2 receptors preserved the response (i.e., cAMP inhibition) to NPY, PYY, and NPY13–36, whereas selective protection of Y1 receptors preserved the response to NPY, PYY, and [Leu31, Pro34]NPY. The pattern implied that NPY and PYY interact with both Y1 and Y2 receptors, as was evident in the pattern of radioligand binding. Selective protection of Y4 receptors with PP preserved the response to PP only. The results of pharmacological measurements (contraction and inhibition of cAMP) confirmed the presence of three receptor types. This study provides decisive evidence that Y2 and Y4 receptors couple to Gq and stimulate IP3 formation and intracellular Ca2⫹ mobilization. To our knowledge, coupling of either receptor to Gq has not been reported previously. The increase in [Ca2⫹]i reflected IP3-dependent Ca2⫹ release, since it was not affected by withdrawal of extracellular Ca2⫹ or blockade of voltage-gated Ca2⫹ channels, but it was abolished by depletion of sarcoplasmic stores with thapsigargin. A study of porcine aortic smooth muscle cells by Shigeri et al. Y Receptor Signaling in Smooth Muscle 1161 Fig. 8. Inhibition of cAMP formation in dispersed gastric muscle cells in which one Y receptor type was preserved. Y2, Y1, and Y4 receptors were preserved by selective receptor protection with (A) 0.1 M NPY13–36, (B) 0.1 M [Leu31, Pro34]NPY or (C) 0.1 M PP as described under Materials and Methods. The cells were treated with forskolin (1 M) for 10 min and then with different Y receptor agonists (all at 1 M). Results are expressed as percent inhibition of forskolin-stimulated cAMP formation (1.82 pmol/106 cells). Values are means ⫾ S.E.M. of three experiments. (1995) had previously shown that NPY stimulated an increase in [Ca2⫹]i, even though it caused an insignificant change in IP3 formation; the increase in [Ca2⫹]i was sensitive to PTx and U73122, an inhibitor of PI hydrolysis. In the present study, however, the Y1 receptor agonist, which activated Gi1 and Gi2, did not induce IP3 formation, Ca2⫹ release, or muscle contraction. Furthermore, PTx had no effect on contraction by Y2 or Y4 receptor agonists, implying that activation of Gi did not contribute to contraction. In this re- spect, Y1, Y2, and Y4 receptors differ from other Gi-coupled receptors (somatostatin receptor 3, opioids , ␦, and , and adenosine A1), which mediate Ca2⫹ release and muscle contraction in these cells via G␥i-dependent activation of PLC-3 (Murthy and Makhlouf, 1995; Murthy et al., 1996; 1996) The difference is most evident for P2Y2 receptors, which couple to both Gq and Gi3 and activate PLC-1 via G␣q and PLC-3 via G␥i3: PI hydrolysis, Ca2⫹ mobilization, and muscle contraction mediated by these receptors is partly PTx-sensitive, implying participation of both Gq and Gi in the contractile response (Murthy and Makhlouf, 1998). PYY and PP are released from endocrine cells of the intestine and pancreas, respectively (Kimmel et al., 1984; Greeley et al., 1987), and can influence smooth muscle activity either directly via Y2 and Y4 receptors as shown in this study, or by interacting with receptors located on excitatory or inhibitory enteric neurons as shown in studies of innervated smooth muscle (Holzer et al., 1987; Krantis et al., 1988; Grider and Langdon; 2003). NPY is present exclusively in neurons and is usually colocalized with vasoactive intestinal peptide and nitric oxide synthase in the stomach and intestine (Nichols et al., 1994; Schicho et al., 2003). It can act directly on smooth muscle to cause contraction via Gq and inhibit relaxation via Gi. It can also act presynaptically to stimulate, or more usually, to inhibit neurotransmitter release via Y1 or Y2 receptors. A recent study by Grider and Langdon (2003) has shown that NPY acts presynaptically to inhibit the release of excitatory motor neurotransmitters during the ascending phase of the peristaltic reflex. In summary, this study provides a molecular and pharmacological profile of three Y receptors, Y1, Y2, and Y4, expressed on smooth muscle cells: Y1 is coupled exclusively to Gi and does not mediate contraction, whereas Y2 and Y4 receptors are coupled to both Gq and Gi, and initiate contraction via Gq-dependent activation of PLC- and stimulation of IP3-dependent Ca2⫹ release. All three receptors are coupled to inhibition of adenylyl cyclase. Downloaded from jpet.aspetjournals.org at ASPET Journals on June 17, 2017 Fig. 9. Signaling pathways initiated by Y1, Y2, and Y4 receptors. Pathways that mediate initial Ca2⫹-dependent contraction only are depicted. Although Y2 and Y4 receptors are coupled to the same pathways, Y4 receptors stimulate Gq, IP3, [Ca2⫹]i, and contraction significantly less than Y2 receptors. The selective Y4 ligand acts as a partial agonist of muscle contraction. 1162 Misra et al. References phospholipase C-beta 3 in intestinal muscle: dual requirement for alpha and beta gamma subunits of Gi3. Mol Pharmacol 47:1172–1179. Murthy KS and Makhlouf GM (1996) Opioid mu, delta and kappa receptor-induced activation of phospholipase C-beta 3 and inhibition of adenylyl cyclase is mediated by Gi2 and G(o) in smooth muscle. Mol Pharmacol 50:870 – 877. Murthy KS and Makhlouf GM (1997) Differential coupling of muscarinic m2 and m3 receptors to adenylyl cyclase V/VI in smooth muscle: concurrent m2-mediated inhibition via G␣ i3 and m3-mediated stimulation via G␥q. J Biol Chem 272: 21317–21324. Murthy KS and Makhlouf GM (1998) Coexpression of ligand-gated P2X and G protein-coupled P2Y receptors in smooth muscle. Preferential activation of P2Y receptors coupled to phospholipase C (PLC)- 1 via G␣q/11 and to PLC- 3 via G␥i3. J Biol Chem 273:4695– 4704. Murthy KS, Zhou H, Grider JR, Brautigan DL, Eto M, and Makhlouf GM (2003) Differential signaling by muscarinic receptors in smooth muscle: m2-mediated inactivation of MLCK via Gi3, Cdc42/Rac1, and PAK1 and m3-mediated MLC20 phosphorylation via Rho kinase/MYPT1 and PKC/CPI-17 pathways. Biochem J 374:145–155. Nichols K, Staines W, and Krantis A (1994) Neural sites of the human colon colocalize nitric oxide synthase-related NADPH diaphorase activity and neuropeptide Y. Gastroenterology 107:968 –975. Okamoto T, Ikezu T, Murayama Y, Ogata E, and Nishimoto I (1992) Measurement of GTP␥ S binding to specific G proteins in membranes using G protein antibodies. FEBS Lett 305:125–128. Pheng LH, Perron A, Quirion R, Cadieux A, Fauchere JL, Dumont Y, and Regoli D (1999) Neuropeptide Y-induced contraction is mediated by neuropeptide Y Y2 and Y4 receptors in the rat colon. Eur J Pharmacol 374:85–91. Rodriguez M, Audinot V, Dromant S, Macia C, Lamamy V, Beauverger P, Rique H, Imbert J, Nicolas JP, Boutin JA, et al. (2003) Molecular identification of the long isoform of the human neuropeptide Y Y5 receptor and pharmacological comparison with the short Y5 receptor isoform. Biochem J 369:667– 673. Rose PM, Fernandes P, Lynch JS, Frazier ST, Fisher SM, Kodukula K, Kienzle B, and Seethala R (1995) Cloning and functional expression of cDNA encoding a human type 2 neuropeptide Y receptor. J Biol Chem 270:22661–22664. Schicho R, Schemann M, Pabst MA, Holzer P, and Lippe IT (2003) Capsaicinsensitive extrinsic afferents are involved in acid-induced activation of distinct myenteric neurons in the rat stomach. Neurogastroenterol Motil 15:33– 44. Shigeri Y, Nakajima S, and Fujimoto M (1995) Neuropeptide YY1 receptorsmediated increase in intracellular Ca⫹2 contraction via phospholipase Cdependent pathway in porcine aortic smooth muscle cells. J Biochem 118:515–520. Sundler F, Bottcher G, Ekblad E, and Hakanson R (1993) PP, PYY and NPY: occurrence and distribution in the periphery, in The Biology of Neuropeptide Y and Related Peptides (Colmers WF and Wahlestedt C eds) pp 157–196, Human Press, Totowa, NJ. Teng B, Murthy Ks, Kuemmerle JF, Grider JR, Sase K, Michel T, and Makhlouf GM (1998) Expression of endothelial nitric oxide synthase in human and rabbit gastrointestinal smooth muscle cells. Am J Physiol 275:G342–G351. Voisin T, Lorinet AM, Maoret JJ, Couvineau A, and Laburthe M (1996) G␣i RNA antisense expression demonstrates the exclusive coupling of peptide YY receptors to Gi2 proteins in renal proximal tubule cells. J Biol Chem 271:574 –580. Wahlestedt C, Yanaihara N, and Hakanson R (1986) Evidence for different pre-and post-junctional receptors for neuropeptide Y and related peptides. Regul Pept 3– 4:307–318. Weinberg DH, Sirinathsinghji DJS, Tan CP, Shiao LL, Morin N, Rigby MR, Heavens RH, Rapoport DR, Bayne ML, Cascieri MA, et al. (1996) Cloning and expression of a novel neuropeptide Y receptor. J Biol Chem 271:16435–16438. Wieland HA, Willim KD, Entzeroth M, Wienen W, Rudolf K, Eberlein W, Engel W, and Doods HN (1995) Subtype selectively and antagonistic profile of the nonpeptide Y1 receptor antagonist BIBP 3226. J Pharamcol Exp Ther 275:143–149. Address correspondence to: Dr. John R. Grider, P.O. Box 908711, Medical College of Virginia Campus, Virginia Commonwealth University, Richmond, VI 23298. E-mail: [email protected] Downloaded from jpet.aspetjournals.org at ASPET Journals on June 17, 2017 Blomqvist AG and Herzog H (1997) Y-receptor subtypes – how many more? Trends Neurosci 20:294 –298. Berglund MM, Hipskind PA, and Gehlert DR (2003) Recent developments in our understanding of the physiological role of PP-fold peptide receptor subtypes. Exp Biol Med 228:217–244. Doods HN, Wienen W, Entzeroth M, Rudolf K, Eberlein W, Engel W, and Wieland HA (1995) Pharmacological characterization of the selective nonpeptide neuropeptide Y Y1 receptor antagonist BIBP 3226. J Pharmacol Exp Ther 275:136 –142. Dumont Y, Cadieux A, Doods H, Pheng LH, Abounader R, Hamel E, Jacques D, Regoli D, and Quirion R (2000) BIIE0246, a potent and highly selective nonpeptide neuropeptide Y Y(2) receptor antagonist. Br J Pharmacol 129:1075–1088. Eva C, Keinanen K, Monyer H, Seeburg P, and Sprengel R (1990) Molecular cloning of a novel G protein-coupled receptor that may belong to the neuropeptide receptor family. FEBS Lett 271:81– 84. Feletou M, Rodriguez M, Beauverger P, Germain M, Imbert J, Dromaint S, Macia C, Bourrienne A, Henlin JM, Nicolas JP, et al. (1998) NPY receptor subtypes involved in the contraction of the proximal colon of the rat. Regul Pept 75–76:221–229. Ferrier L, Segain JP, Pacaud P, Cherbut C, Loirand G, Galmiche JP, and Blottiere HM (2000) Pathways and receptors involved in peptide YY induced contraction of rat proximal colonic muscle in vitro. Gut 46:370 –375. Ferrier L, Segain JP, Bonnet C, Cherbut C, Lehur PA, Jarry A, Galmiche JP, and Blottiere HM (2002) Functional mapping of NPY/PYY receptors in rat and human gastro-intestinal tract. Peptides 23:1765–1771. Goumain M, Voisin T, Lorinet AM, and Laburthe M (1998) Identification and distribution of mRNA encoding the Y1, Y2, Y4 and Y5 receptors for peptides of the PP-fold family in the rat intestine and colon. Biochem Biophys Res Commun 247:52–56. Greeley GH Jr, Hill FL, Spannagel A, and Thompson JC (1987) Distribution of peptide YY in the gastrointestinal tract of the rat, dog and monkey. Regul Pept 5– 6:365–372. Grider JR and Langdon L (2003) Physiological role of neuropeptide Y in the regulation of the ascending phase of the peristaltic reflex. Am J Physiol 285:G1139 – G1146. Holzer P, Lippe ITH, Bartho L, and Saria A (1987) Neuropeptide Y inhibits excitatory enteric neurons supplying the circular muscle of the guinea pig small intestine. Gastroenterology 92:1944 –1950. Kimmel JR, Pollock HG, Chance RE, Johnson MG, Reeve JR Jr, Taylor IL, Miller C, and Shively JE (1984) Pancreatic polypeptide from rat pancreas. Endocrinology 114:1725–1731. Krantis A, Potvin W, and Harding RK (1988) Peptide YY (PYY) stimulates intrinsic enteric motor neurones in the rat small intestine. Naunyn-Schmiedeberg’s Arch Pharmacol 338:287–292. Krause J, Eva C, Seeburg PH, and Sprengel R (1992) Neuropeptide Y1 subtype pharmacology of recombinantly expressed neuropeptide receptor. Mol Pharmacol 41:817– 821. Kuemmerle JF, Murthy KS, Grider JR, Martin DC, and Makhlouf GM (1995) Coexpression of 5-HT2A and 5-HT4 receptors coupled to distinct signaling pathways in human intestinal muscle cell. Gastroenteology 109:1791–1800. Lomax AE and Furness JB (2000) Neurochemical classification of enteric neurons in the guinea-pig distal colon. Cell Tissue Res 302:59 –72. Lundell I, Blomqvist AG, Berglund MM, Schober DA, Johnson D, Statnick MA, Gadski RA, Gehlert DR, and Larhammar D (1995) Cloning of human receptor of the NPY receptor family with high affinity for pancreatic polypeptide and peptide YY. J Biol Chem 270:29123–29128. Michel MC, Beck-Sickinger A, Cox H, Doods HN, Herzog H, Larhammar D, Quirion R, Schwartz T, and Westfall T (1998) XVI. International union of pharmacology recommendations for the nomenclature of neuropeptide Y, peptide YY and pancreatic polypeptide receptors. Pharmacol Rev 50:143–150. Murthy KS, Coy DH, and Makhlouf GM (1996) Somatostatin receptor –mediated signaling in smooth muscle. Activation of phospholipase C-3 by G␥ and inhibition of adenylyl cyclase by G␣1 and G␣o. J Biol Chem 271:23458 –23463. Murthy KS and Makhlouf GM (1995) Adenosine A1 receptor-mediated activation of
© Copyright 2026 Paperzz