Ó 2003 The American Genetic Association
Journal of Heredity 2003:94(5):416–420
DOI: 10.1093/jhered/esg088
Genetic and Molecular Markers of the
Queensland Fruit Fly, Bactrocera tryoni
J. T. ZHAO, M. FROMMER, J. A. SVED,
AND
C. B. GILLIES
From the Fruit Fly Research Centre, School of Biological Sciences, A12, University of Sydney, NSW 2006, Australia.
Address correspondence to Dr. Gillies at the address above, or e-mail: [email protected].
Twenty-six microsatellite markers, along with two restriction
fragment length polymorphism (RFLP) markers and three
morphological markers, have been mapped to five linkage
groups, corresponding to the five autosomes of the
Queensland fruit fly, Bactrocera tryoni. All these molecular
and genetic markers were genotyped in three-generation
pedigrees. Eight molecular markers were also localized to
the salivary gland polytene chromosomes by in situ
hybridization. This provides a substantial starting point for
an integrated genetic and physical map of B. tryoni.
16 microsatellite markers were isolated and shown to be
polymorphic in five widely separated population samples
(Kinnear et al. 1998). Among these markers, six highly
polymorphic loci were used in a study to reveal the
population structure of B. tryoni in Australia (Yu et al. 2001).
In this paper, we report the establishment of five linkage
groups of B. tryoni, including 26 microsatellite markers, three
visible markers, and two RFLP markers. All the linkage
groups have been assigned to the polytene chromosomes by
in situ hybridization of selected microsatellite sequences and
cloned genes.
The Queensland fruit fly, Bactrocera tryoni (Diptera, Tephritidae), is a significant pest of Australia’s east coast orchards,
infesting almost every commercial fruit crop except
pineapple and strawberry (Drew 1989). The general
approach of biological control through the sterile insect
technique (SIT) has been applied to minimize the use of
chemical insecticides. It has been shown that release of sterile
male flies in place of sterile mixed broods can improve the
SIT program considerably (McInnis et al. 1994). In the
Mediterranean fruit fly, Ceratitis capitata, Y-autosome translocations with recessive markers have been used to construct
genetic sex-separation strains (e.g., Franz et al. 1996;
Robinson and Heemert 1982). Similar Y-autosome translocations have also been constructed in B. tryoni (Meats et al.
2002). This work will be facilitated by the establishment of
a combined genetic and physical map.
In the last decade, new classes of genetic markers, such as
microsatellites and restriction fragment length polymorphisms (RFLPs), were found to be ideal for linkage analysis
and boosted the generation of genetic maps in insect species.
In the malaria mosquito, Anopheles gambiae, a detailed microsatellite genetic map has been constructed (Zheng et al. 1996)
and used to identify and localize two genetic loci that are
involved in refractoriness of A. gambiae to Plasmodium (Zheng
1997). A good recombination map, based on RFLP analysis,
has been established for the yellow fever mosquito, Aedes
aegypti (Severson et al. 1993), and has greatly facilitated the
analysis of complex traits such as refractoriness to filarial and
plasmodial parasites (Severson et al. 1994, 1995). In B. tryoni,
Materials and Methods
416
Fly Stocks
The wild-type laboratory stock of B. tryoni originated from
the Post-Harvest Laboratory in Gosford, New South Wales,
Australia, where it had been the domestic stock for almost
20 years. In the Post-Harvest Laboratory, occasional wild
flies collected from the surrounding orchards had been
introduced into the stock, under uncontrolled conditions,
without any forced mating. It is unclear how many, if any,
fresh wild characters were present in the stock. Therefore, it
was taken to represent a laboratory-adapted stock with wildtype phenotype. The stock was introduced to the Fruit Fly
Research Centre in 1991 and has been maintained since then
for at least 50 generations. During 1996–1997, in order to
provide the laboratory stock with more fresh wild character,
wild flies collected from the Sydney area were occasionally
introduced into the stock by forced mating. Flies were reared
at 258C with 70% relative humidity and a 14 h light/10 h dark
cycle. Adults were fed on a mixture of sucrose and yeast
(Bateman 1967). To provide larval polytene-chromosome
materials for in situ hybridization, larvae were grown at 258C
in uncrowded, well-yeasted carrot medium (Bateman 1967)
containing 4.8% protein and 11.7% dry carrot powder (H. J.
Landgon & Company P/L).
Three recessive markers, orange eyes (oe), white marks (wm),
and bent wings (bw) (Meats et al. 2002) were used in the
mapping experiment. Each of these markers was identified
initially through inbreeding from the Gosford and other
Brief Communications
Figure 1. Three-generation pedigrees, showing numbers of progeny and informative markers. Each row indicates a pedigree,
including information on the mutant stock used. Each column indicates a marker, with 3 showing a segregating cross. The order
of markers is as shown in Figure 2, with unmapped markers shown in parentheses. An asterisk (*) indicates markers separately
mapped by in situ hybridization. A dagger (y) indicates that, because of incomplete penetrance of the bw mutation at the
temperatures studied, only markers definitely scored as having the bent wings phenotype, about half the number shown, were used
for linkage calculations involving bw.
wild-type stocks. Penetrance is incomplete at low temperatures for the bw mutation. Recombination frequencies for
this marker were therefore restricted to progeny scored as
mutant rather than wild type.
Genetic Crosses
Homozygous lines have not been established for any of the
microsatellite markers. The variety of different markers
would make this an extremely difficult task. However, the
high variability of the microsatellites allowed us to set up
informative crosses that could be scored, in retrospect, for
segregation of all markers.
Crosses were made involving the three genetically
marked stocks, oe, wm, and bw. In each case a single female
was crossed to a single male from the wild-type stock. Then
a single F1 male or a single F1 female was backcrossed to
a single fly from the same genetically marked stock. This
procedure assures segregation for the visible marker, and
optimizes the chance of producing a segregating backcross
for microsatellite markers. Because of the expected absence
of male recombination, crosses involving F1 males serve to
assign markers to chromosomes, while those involving F1
females provide mapping data. Figure 1 shows the actual
crosses and markers.
Most of the information on markers from the two most
densely marked chromosomes comes from crosses involving
three or more linked markers. Ordering was facilitated in
such crosses by testing the distribution of crossovers implied
for all possible marker orders on the chromosome. For
example, for the case of cross wm-3 chromosome 2,
a computer program was written to test each of the 2,520
(¼ 7!/2) possible orders of markers. For each order, the
distribution of crossover points required to explain each
progeny was calculated, and the ten marker orders having the
lowest total number of crossovers were printed out. We then
chose the order that implies the most realistic crossover
distribution. In the case of cross wm-3 for markers on
chromosome 2, the chosen order is consistent with
a maximum of three crossovers over the chromosome.
Molecular Markers
Microsatellites were identified from screenings of two partial
genomic libraries, as described in Kinnear et al. (1998) and
Wang et al. (2003). Nine microsatellites were chosen from
417
Journal of Heredity 2003:94(5)
Figure 2. Schematic current chromosome map of B. tryoni. Chromosome maps are drawn only approximately to scale, and
chromosome lengths are not representative. Markers listed beside the chromosome represent loci included in the linkage group for
which there are no data on genetic order. Ambiguities of order of markers are indicated by dotted outlines for the markers.
Positions of centromeres are defined from the polytene map (Zhao et al. 1998). Because centromeres are undetected in the
mapping experiments, there are several cases in which it is not known on which side of the centromere the marker lies. Map
distances are shown referring to crosses described in Figure 1.
the first B. tryoni genomic library screening, based on the
initial estimates of polymorphism of the markers (Kinnear
et al. 1998, Table 1) and the insert size of the clones. Among
these nine microsatellites, six were described in Table 1 of Yu
et al. (2001), and the other three were loci 9.4.8, 12.8.1A, and
1.7.7 in Table 1 of Kinnear et al. (1998), redesignated as Bt5,
Bt4, and Bt6, respectively. Nineteen microsatellites were
chosen from the second library screening. The microsatellite
418
structures, primers, and alleles are described in Table 1 of
Wang et al. (2003).
Microsatellites Bt14 and Bt4 were recovered from the
same clone 12.8.1, and microsatellites 2.6A and 2.6B were
also recovered from a single clone. PCR on genomic DNA
using primers that spanned both microsatellites in each clone
excluded the possibility that the recovery of the two markers
from the same clone was an artifact of the cloning
Brief Communications
procedures. In total, therefore, the 28 microsatellite markers
correspond to 26 loci.
In B. tryoni, restriction assays of genomic PCR products
within exons 4–6 of the B. tryoni white eye-color gene (Bennett
and Frommer 1997) revealed polymorphism at RsaI restriction sites within intron 5. This RFLP marker is
designated as Rwhite. Also, PCR and subsequent restriction
digestion on another B. tryoni eye-color gene, scarlet (Zhao
et al., 2003), revealed one BclI polymorphic site within exon
5, and this RFLP marker is designated as Rscarlet.
PCR primers for Rwhite, 59-39, are: GAGGACGAGAATGGATTTACA and TGGTATGATAACAGGTGGGC;
PCR primers for Rscarlet, 59-39, are: AGACGGGTGACTATCCCTTC and GCATATAACATCCATGACAG.
Genotype Analysis
Microsatellite typing was performed as detailed by Yu et al.
(2001).
The specific oligonucleotide primers for RFLP typing of
the Rwhite and Rscarlet markers were synthesised by Geneworks. The 25 ll PCR reactions included 13 Tth plus buffer,
1.5 mM MgCl2, 0.2 mM dNTPs, 0.6 lM each primer, 0.66 U
Tth plus DNA polymerase (Biotech International), and 3 ll
of a Chelex DNA supernatant. Cycle program: 948C for 3
min; 30 cycles of 948C for 1 min, 608C for 1 min, and 728C
for 1 min; and 1 cycle of 728C for 5 min. The PCR product
(10 ll) was digested with restriction enzymes and size
separated by 2% agarose gel electrophoresis.
Polytene Chromosome In Situ Hybridization
Genomic clones containing microsatellite repeats (Kinnear
et al. 1998, Table 1), labeled with biotin-16-dUTP (Roche)
using the random priming method, were used as probes in
polytene chromosome in situ hybridization experiments, as
described by Zhao et al. (1998).
Results and Discussion
In total, 13 three-generation pedigrees, each marked with the
mutation oe, wm, or bw, were generated in the experiment and
have been used to map the morphological and molecular
markers (Figure 1). Genotyping of molecular markers was
performed on the mapping panel, composed of each threegeneration family of B. tryoni: a pair of G0, a pair of F1, and
various numbers of F2 progeny (12–113 from each of the
families, Figure 1). A total of 26 microsatellite markers and
two RFLP markers were genotyped in 13 backcross families
that included 619 progeny. (Complete data are available on
request.) Alleles were identified on the basis of their electrophoretic mobility. The PCR products appeared as single
(homozygote) or double (heterozygote) bands. All alleles
behaved as autosomal codominant Mendelian factors. No
evidence of mutations occurring during the crosses was seen.
Using the in situ hybridization technique, the 1.1-kb
microsatellite fragment Bt32 maps to a unique site on
chromosome 2, section 4B. The hybridization signal was
located on a puff; thus it showed a characteristic dispersed
granular appearance. The purified 806-bp insert of microsatellite clone 12.8.1 (microsatellite markers Bt4 and Bt14)
hybridized to section 5C on chromosome 2. The microsatellite clones Bt5 and Bt17 were definitively located on
chromosome 3, section 23B and chromosome 4, section
59B, respectively. The microsatellite clones Bt15 and Bt10
were both mapped to section 99B of chromosome 6 on two
bands next to each other. Because the B. tryoni white gene has
been located on chromosome 5, section 71B, by polytene
chromosome in situ hybridization (Zhao et al. 1998), the
linkage group containing the RFLP marker Rwhite has been
assigned to chromosome 5. The B. tryoni scarlet gene has been
located on chromosome 6, section 82A (Zhao et al. 1998);
the scarlet RFLP marker is located at that position. No
recombination was found between the oe phenotype and the
Rscarlet marker in the oe-4 family, indicating that the oe locus
and the scarlet gene are very closely linked, estimated within
one map unit.
Based on the above data, five linkage groups were
unambiguously defined, corresponding to the five autosomes
previously identified cytologically (Zhao et al. 1998). No
markers were found corresponding to the largely heterochromatic X and Y chromosomes. The most likely genetic
map is shown in Figure 2.
In the B. tryoni genotyping process, no genetic recombination between the syntenic loci was found in F1 males. This
result conforms to the general rule that crossing over is rare or
absent in males of higher Diptera (e.g., Cladera 1981; Foster
and Whitten 1974; Morgan 1914). The absence of crossing
over in B. tryoni males allows linkage to be demonstrated from
a male backcross with a small number of progeny, which
overcomes the difficulty in obtaining large numbers of
progeny in single-pair crosses, and also makes the construction of genetic maps in B. tryoni easier and faster. Nevertheless,
crossing over in males has been found with a low frequency in
several species of higher Diptera (Foster et al. 1980; Rössler
1982a,b) and cannot be excluded entirely in B. tryoni.
In situ hybridization of unique sequences of microsatellite
markers to polytene chromosomes allows the genetic and
polytene maps to be aligned with respect to each other. Some
of the microsatellites included in this linkage analysis are also
variable in other species of the genus Bactrocera (Shearman
DCA, personal communication). Thus, they can provide
a cross reference to establish linkage groups in pest species
for which few markers are available.
Acknowledgments
This work was supported by grants from Woolworths Supermarkets and the
Horticultural Research & Development Corporation.
References
Bateman MA, 1967. Adaptations to temperature in geographic races of the
Queensland fruit fly, Dacus (Strumeta) tryoni. Aust J Zool 15:1141–1161.
Bennett CL and Frommer M, 1997. The white gene of the tephritid fly
Bactrocera tryoni is characterized by a long untranslated 59 leader and a 12 kb
first intron. Insect Mol Biol 6:343–356.
419
Journal of Heredity 2003:94(5)
Cladera JL, 1981. Absence of recombination in the male of Ceratitis capitata.
Experientia 37:342–343.
Drew RAI, 1989. The tropical fruit flies (Diptera: Tephritidae:
Dacinae) of the Australasian and Oceanian regions. Mem Qld Mus 26:
1–521.
Foster GG, Maddern RH, and Mills AT, 1980. Genetic instability in massrearing colonies of a sex-linked translocation strain of Lucilia cuprina
(Wiedemann) (Diptera: Calliphoridae) during a field trial of genetic control.
Theor Appl Genet 58:169–175.
Rössler Y, 1982b. Recombination in males and females of the Mediterranean fruit fly (Diptera: Tephritidae) with and without chromosomal
aberrations. Ann Entomol Soc Am 75:619–622.
Severson DW, Mori A, Zhang Y, and Christensen BM, 1993. Linkage map
for Aedes aegypti using restriction fragment length polymorphisms. J Hered
84:241–247.
Severson DW, Mori A, Zhang Y, and Christensen BM, 1994. Chromosomal
mapping of two loci affecting filarial worm susceptibility in Aedes aegypti.
Insect Mol Biol 3:67–72.
Foster GG and Whitten MJ, 1974. The development of genetic methods of
controlling the Australian sheep blowfly, Lucilia cuprina. In: The use of
genetics in insect control, (Pal R and Whitten MJ, eds). Amsterdam:
Elsevier; 19–43.
Severson DW, Tahathy V, Mori A, Zhang Y, and Christensen BM, 1995.
Restriction fragment length polymorphism mapping of quantitative trait
loci for malaria parasite susceptibility in the mosquito Aedes aegypti. Genetics
139:1711–1717.
Franz G, Kerremans P, Rendon P, and Hendrichs J, 1996. Development
and application of genetic sexing systems for the Mediterranean fruit fly
based on a temperature sensitive lethal. In: Fruit fly pests, a world
assessment of their biology and management (McPheron BA and Steck G,
eds). Delray Beach, Florida: St. Lucie Press; 185–191.
Wang Y, Yu H, Raphael K, and Gilchrist AS, 2003. Genetic delineation of
sibling species of the pest fruit fly Bactrocera (Diptera: Tephritidae) in
Australia using microsatellites. Bull Entomol Res 93:351–360.
Kinnear MW, Bariana HS, Sved JA, and Frommer M, 1998. Polymorphic
microsatellite markers for population analysis of a tephritid pest species,
Bactrocera tryoni. Mol Ecol 7:1489–1495.
McInnis DO, Tam SYT, Grace C, and Miyashita D, 1994. Population
suppression and sterility rates induced by variable sex ratio, sterile insect
releases of Ceratitis capitata (Diptera: Tepheritidae) in Hawaii. Ann Entomol
Soc Am 87:231–240.
Meats A, Maheswaran P, Frommer M, and Sved J, 2002. Towards a maleonly release system for SIT with the Queensland fruit fly Bactrocera tryoni,
using a genetic sexing strain with a temperature-sensitive lethal mutation.
Genetica 116:97–106.
Morgan TH, 1914. Crossing over in males of Drosophila genus in the second
and third pairs of chromosomes. Biol Bull 26:195–204.
Robinson AS and Van Heemert C, 1982. Ceratitis capitata—a suitable case
for genetic sexing. Genetica 58:229–237.
Rössler Y, 1982a. Genetic recombination in males of the Mediterranean
fruit fly, and its relation to automated sexing methods. Ann Entomol Soc
Am 75:28–31.
420
Yu H, Frommer M, Robson MK, Meats AW, Shearman DCA, and Sved JA,
2001. Microsatellite analysis of the Queensland fruit fly Bactrocera tryoni
(Diptera: Tephritidae) indicates spatial structuring: implications for
population control. Bull Entomol Res 91:139–147.
Zhao JT, Bennett CL, Stewart GJ, Frommer M, and Raphael KA, 2003. The
scarlet eye colour gene of the tephritid fruit fly Bactrocera tryoni and the nature
of two eye colour mutations. Insect Mol Biol 12:263–269.
Zhao JT, Frommer M, Sved JA, and Zacharopoulou A, 1998. Mitotic and
polytene chromosome analyses in the Queensland fruit fly, Bactrocera tryoni
(Diptera: Tephritidae). Genome 41:510–526.
Zheng LB, 1997. Molecular approaches to mosquito parasite interactions.
Arch Insect Biochem Physio 34:1–18.
Zheng L, Benedict MQ, Cornel AJ, Collins FH, and Kafatos FC, 1996. An
integrated genetic map of the African human malaria vector mosquito,
Anopheles gambiae. Genetics 143:941–952.
Received January 10, 2003
Accepted May 30, 2003
Corresponding Editor: R. C. Woodruff