Parasite-mediated selection in an island endemic,
the Seychelles warbler (Acrocephalus sechellensis)
A thesis submitted to the School of Biological Sciences of the University of
East Anglia in partial fulfilment of the requirements for the Degree of
Doctor of Philosophy
By Kimberly Hutchings
June 2009
© This copy of the thesis has been supplied on condition that anyone who consults it is
understood to recognise that its copyright rests with the author and that no quotation
from the thesis, nor any information derived therefrom, may be published without the
authors prior, written consent.
Thesis abstract
The aim of this thesis was to investigate parasite mediated selection in the Seychelles
warbler (Acrocephalus sechellensis), a passerine found on four islands in the Seychelles
archipelago. The MHC class II was used as a model to look for evidence of parasite
mediated selection maintaining polymorphism. Twelve alleles were found, ten of which
appeared functional. Evidence of past balancing selection was seen in dN/dS substitution
rates, and in the trans-species polymorphism of alleles within the Sylviidae family.
However no difference in MHC class II alleles were found between individuals of
Seychelles warbler. Thorough screening found no gastrointestinal parasites and only
one strain of malaria in the populations. No factors tested were found to affect presence
of malaria, and no survival effects were found. Malaria prevalence decreased with age
until 8 years, when it increased, and infected adults were less likely to have been
infected as a juvenile than uninfected adults, indicating acquired immunity followed by
immunosenescence. The depauperate parasite diversity found in the warbler system may
have occurred during the recent population bottleneck that this species suffered, if the
population fell below the threshold required to maintain a parasite community.
Alternatively, it may be due to enemy release, with parasites being lost during historical
colonisations. This theory was investigated by focusing on the three populations that
have been established by conservation driven translocations from the single remaining
population on Cousin Island. Evidence of enemy release, as the absence of any malaria,
was seen in two of the populations, but a third translocated population still contained
malaria. On the most recently colonised island, 40% of the original founding birds had
malaria. Subsequently, malaria prevalence decreased over a three year period and no
birds born on the island contracted malaria. Therefore it is most likely that the lack of
malaria transmission on these new islands has lead to enemy release. These results
support a hypothesis of previous enemy release in the Seychelles warbler, leading to
loss of parasite diversity.
ii
Table of Contents
Abstract ..................................................................................................................... ii
List of tables.............................................................................................................. v
List of figures ............................................................................................................ vii
Acknowledgements ................................................................................................... ix
1.General introduction .............................................................................................. 1
1.1 Parasite-mediated selection..................................................................... 2
1.2 Parasite models for investigating parasite-mediated selection:
Avian malaria and gastrointestinal parasites........................................... 4
1.3 Parasites and the maintenance of polymorphisms:
The Major Histocompatibility Complex (MHC) ...................................... 7
1.4 Mechanisms of balancing selection at the MHC..................................... 10
1.5 Parasites, MHC and conservation ........................................................... 13
1.6 Enemy release hypothesis ....................................................................... 14
1.7 Study species: The Seychelles warbler ................................................... 15
1.8 Thesis outline .......................................................................................... 19
2.Characterisation of the MHC class II in the Seychelles warbler ........................... 21
2.1 Abstract ................................................................................................... 22
2.2 Introduction ............................................................................................ 23
2.3 Methods................................................................................................... 27
2.4 Results ..................................................................................................... 35
2.5 Discussion .............................................................................................. 45
3.Assessment of gastrointestinal parasite diversity in the Seychelles warbler ......... 51
3.1 Abstract ................................................................................................... 52
3.2 Introduction ............................................................................................. 53
3.3 Methods................................................................................................... 55
3.4 Results ..................................................................................................... 58
3.5 Discussion ............................................................................................... 64
4.Causes and consequences of malaria in the Seychelles warbler ............................ 71
4.1 Abstract ................................................................................................... 72
4.2 Introduction ............................................................................................. 73
4.3 Methods................................................................................................... 76
4.4 Results ..................................................................................................... 81
iii
4.5 Discussion ............................................................................................... 93
5.Conservation translocation and the enemy release hypothesis: Evidence from an
endemic island population...................................................................................... 103
5.1 Abstract ................................................................................................... 104
5.2 Introduction ............................................................................................. 105
5.3 Methods................................................................................................... 107
5.4 Results ..................................................................................................... 109
5.5 Discussion ............................................................................................... 112
6.General Discussion................................................................................................. 120
References ................................................................................................................. 127
iv
List of tables
Table 2.1. Primer sequences....................................................................................... 30
Table 2.2. Forward and reverse primer combinations used for
each FLR .................................................................................................... 32
Table 2.3.Annealing temperatures for each primer set used in
SSCP analysis............................................................................................. 34
Table 2.4 MHC class II sequences found in three individual
Seychelles warblers, X represents where an allele was
found .......................................................................................................... 37
Table 2.5. Synonymous (dS) and non-synonymous (dN)
substitution rates in the protein binding region (PBR)
and non-PBR in the Seychelles and great reed warbler ............................. 39
Table 2.6. Number of nucleotide differences, number of amino
acid (AA) differences, and AA p-distance in the PBR
for both Seychelles and great reed warblers .............................................. 39
Table 2.7 Results of RSCA and SSCP screening ........................................................ 43
Table 3.1. Number of faecal samples from Seychelles warblers
screened for gastrointestinal parasites, showing island,
age and sex of individuals .......................................................................... 59
Table 3.2 Gastrointestinal parasites found in other bird species on
the islands of Cousin, Cousine and Aride. EPG/OPG =
eggs/ coccidian oocysts per gram of faeces. Min-max
EP = minimum to maximum estimated prevalence ................................... 63
Table 4.1 Results of generalized linear mixed effects model with
adult malaria prevalence as the dependent variable, and
year as explanatory..................................................................................... 82
Table 4.2 Results of generalized linear mixed effects model with
juvenile malaria prevalence as the dependent variable,
and year as explanatory.............................................................................. 82
v
Table 4.3 Results of generalized linear mixed effects model with
malaria prevalence as dependent variable and age
category as explanatory variable................................................................ 84
Table 4.4 Minimum adequate model of generalized linear mixed
effects model a range of variables on adult malaria
presence/absence. All those ages with n<10 were
removed...................................................................................................... 87
Table 4.5 Results of generalized linear mixed effects model, with
year and individual as random factors, of the effects of
year of age on malaria prevalence in birds that survived
until five years old...................................................................................... 88
Table 4.6 Results of a Cox proportional hazards survival analysis............................. 92
Table 5.1 Number of samples screened for malaria and percentage
of the total island population this represents in brackets ........................... 110
vi
List of figures
Figure 1.1 Diagram showing simplified life cycle of typical
malaria parasite. Adapted from Atkinson and van Riper
1991............................................................................................................... 5
Figure 1.2 Map showing location of Cousin, Cousine, Aride and
Denis islands within the Seychelles archipelago .......................................... 16
Figure 1.3 Annual fluctuations of population density of Seychelles
warblers on Cousin, Cousine, Aride and Denis. Arrows
with sample size indicate introduction of birds to each
island. From Brouwer (2007)........................................................................ 17
Figure 1.4 Seychelles warbler (photo by J. van de
Crommenacker)............................................................................................. 18
Figure. 2.1 Schematic diagram of the organisation of MHC class
II gene, with location of primers ................................................................. 29
Figure 2.2 Twelve different MHC class II exon 2 sequences found
in the Seychelles warbler. ............................................................................. 36
Figure 2.3 Phylogenetic tree comparing MHC class II exon 2
sequences from the Seychelles warbler......................................................... 37
Figure 2.4. Total number of new alleles found in relation to the
number of clones screened in three Seychelles warbler
individuals ..................................................................................................... 38
Figure.2.5 Phylogenetic tree comparing Seychelles warbler MHC
class II exon 2 alleles to those observed in other
passerine species ........................................................................................... 41
Figure.2.6 RSCA trace showing individuals A, B and C run with
the FLR GRW248-5 .................................................................................... 44
Figure 2.7. SSCP trace showing 3 individuals A, B and C,
alongside a Liz 500 size marker.................................................................... 44
Figure 3.1. Number of faecal samples obtained by hour of day .................................... 60
vii
Figure 3.2. Number of faecal samples for parasite analysis
obtained during each month of the year ...................................................... 60
Figure 3.3 Ribosomal small subunit (SSU) sequence of coccidia
oocyst found in one Seychelles warbler, aligned with
SSU of Adelina bambarooniae ..................................................................... 61
Figure 3.4 Adelina sp. oocyst found in Seychelles warbler faecal
sample ........................................................................................................... 62
Figure 4.1 Malaria prevalence and annual survival probabilities in
a) adult and b) juvenile Seychelles warblers from 1994
until 2003 ..................................................................................................... 83
Figure 4.2 Mean malaria prevalence in different age categories. .................................. 85
Figure 4.3 Minimum age of dominant and subordinate adult birds ............................... 86
Figure 4.4 Malaria prevalence in Seychelles warbler at ages 1-10
years, with ages with n<10 removed............................................................. 87
Figure 4.5 Malaria prevalence of birds that survived until at least
five years old at each age from 0-5 years...................................................... 89
Figure 4.6 Patterns of infection in Seychelles warblers as juveniles
and subsequently in adults ............................................................................ 90
Figure 4.7 Percentage of Seychelles warblers sampled three times
that have never been infected, infected then cleared
infection or latent, infected in all three samples, or
reinfected after clearing infection/latent infection ........................................ 91
Figure 4.8 Survival curve for juveniles with malaria, without
malaria and an unknown group ..................................................................... 92
Figure 5.1 Mean malaria prevalence in Cousin, Aride, Denis
(translocated and born on Denis) and Cousine Island
populations, from 1994 until 2007 ................................................................ 111
viii
Acknowledgments
I’d like to thank my supervisors, David Richardson and Jan Komdeur, for their support,
advice and endless enthusiasm for this project, even when occasionally mine was
waning. Iain Barr provided help in many areas of this thesis, including parasite
identification (especially difficult when you can’t find any), and statistical advice,
which was always done with cheerfulness and patience. Many members of the warbler
research group were involved in fieldwork and useful meetings, although special thanks
has to go to Lyanne Brouwer, Cas Eikenaar and Janske van de Crommenacker for
chasing warblers, and helping to explain to everyone why every bird I caught had to go
in a box. The Seychelles Department of Environment and Seychelles Bureau of
Standards gave permission for fieldwork and sampling. I am also grateful to Nature
Seychelles for allowing us to stay and work on Cousin, and especially to Rachel Bristol
for help which very often went above and beyond the call of duty. I’d also like to thank
the wardens on Cousin for providing brilliant company, wonderful food and a space on
the boat when supplies and civilisation were required. I am grateful to the management
of Cousine who allowed us to work and stay on the island, and to the Island
Conservation Society, Seychelles for allowing us to work on Aride. I carried out much
of the MHC work at the NERC-funded Biomolecular Analysis Facility in Sheffield.
While I cannot mention here all the people from Sheffield who provided useful advice,
Helena Westerdahl was indispensable and taught me an enormous amount about
molecular methods and how important it is to be kind to your cells if you want your
cloning to work. I am also grateful for the advice provided by Terry Burke while at the
facility. Lorna Kennedy was immensely helpful in developing the RSCA technique
during my visits to the University of Manchester. Thanks to my sister Laura Hutchings
for proof reading, Peter Selhurst for help during all forms of technology meltdown, and
both for copious amounts of light relief. My mum and dad have provided an enormous
amount of support, not least feeding and watering me during the writing up period, and
never doubting my ability to finish this thesis; little did they know when they left me as
a first year undergraduate that I wouldn’t feel the need to rejoin the ‘real’ world for
another nine years. Last, but certainly not least, I’d like to thank Sid Harold, who has
helped in so many ways its impossible to mention them all, but most importantly for
allowing me to test his patience on a regular basis, and for making the tea when it all got
a bit much.
ix
Chapter 1
General Introduction
-1-
1. General Introduction
1.1 Parasite mediated selection
A parasite can be defined as an organism that lives in or on a host, deriving food and
other necessities, while causing reduced fitness in the host (Kim, 1985, Watt et al.,
1995, Clayton and Moore, 1997). Parasites are an almost ubiquitous feature of life and
occur in nearly all ecosystems (Smyth and Wakelin, 1994, Roberts and Janovy, 1996).
Organisms from a wide range of taxa are parasitic, for example protozoa, helminths,
arthropods, plants, bacteria and fungi. Parasites can have wide range of effects on their
hosts. The ultimate detrimental effect parasites can have on fitness is to cause mortality.
For example, in humans, parasites such as malaria can cause high levels of mortality in
endemic areas (Breman, 2001). Effects of parasites on survival have been found in a
wide variety of host-parasite systems (Gulland, 1992, Hudson et al., 1992, Brown et al.,
1995, Sorci and Moller, 1997, Hudson et al., 1998, Merino et al., 2000, Sol et al.,
2003). Within populations, mortality caused by parasites has been shown to affect
demographic structure and drive population cycles (Hudson, 1986, Albon et al., 2002,
Tompkins et al., 2002, Redpath et al., 2006, Deter et al., 2008). Parasites may also have
far reaching consequences on factors other than the survival of the individual. For
example, parasites may affect reproductive success (Norris et al., 1994, Richner et al.,
1995, Merino et al., 2000, Hurd, 2001, Albon et al., 2002), secondary sexual features
(Brawner et al., 2000, McGraw and Hill, 2000, Horak et al., 2004), and behavioural
traits (Scott, 1985, Dobson, 1988, Fox and Hudson, 2001).
The considerable impact parasites can have on host fitness means that they can act
as a very significant selection pressure within host populations (Pauling et al., 1949,
Allison, 1954, Coltman et al., 1999, Aidoo et al., 2002, Wegner et al., 2003). Parasites
have been implicated as playing a significant selective role in a variety of areas of
evolutionary biology, for example in the evolution of sexual reproduction, sexual
selection, and maintenance of genetic diversity. For example, why sex is so widespread
has been the subject of debate, and is one of the big puzzles of evolutionary biology
(Hamilton et al., 1990, Barton and Charlesworth, 1998, Butlin, 2002, Otto and
Lenormand, 2002). The benefit of recombination is widely suggested to explain why
sexual reproduction might have arisen and been maintained. Recombination can provide
increased diversity, and therefore allow for adaptation. In asexual populations,
-2-
deleterious mutations can accumulate through the absence of recombinations (Futuyma,
1998). Sexual reproduction also allows individuals to incorporate beneficial mutations
from other individuals, whereas in asexual populations combinations of beneficial
alleles are difficult to attain (Strickberger, 2005). However, sexual reproduction is not
without its detriments. The most obvious is known as the two-fold cost of sex; unless a
sexually reproducing couple can produce twice as many offspring as a single asexual
individual, then sexual individuals have a lower reproductive output (Maynard Smith,
1971). Also, recombination can break up favourable sets of genes (review in Butlin,
2002, Otto and Lenormand, 2002). Therefore the benefits of increased fitness gained
through sexual reproduction must outweigh the significant costs endured. Hamilton
(1980) suggested a model in which parasitism was the driving factor behind the
evolution of sexual reproduction. This hypothesis states that as parasites are short lived,
and therefore have a fast rate of evolution, host anti-parasite adaptations are quickly
combated by counter-adaptations in the parasites. However, recombination during
sexual reproduction rapidly generates different gene combinations that may increase
resistance and allow host evolution to keep up in this host-parasite arms race.
Hamilton’s parasitism hypothesis is not the only explanation of the evolution and
maintenance of sexual reproduction (review in Barton and Charlesworth, 1998, Otto and
Lenormand, 2002). However, it does illustrate the potential of parasites to have
significant effects on the evolution of species.
Parasites have also been implicated in sexual selection, which may in turn provide
additional benefits from sexual reproduction, in terms of allowing individuals to
maximise offspring parasite resistance. The Hamilton-Zuk hypothesis (Hamilton and
Zuk, 1982) is one of the most widely cited hypothesis of parasite-mediated sexual
selection. The handicap model of sexual selection is based on the notion that secondary
sexual traits are costly, and therefore only the best quality males will be able to have
them (Zahavi, 1975). However, a problem with this hypotheses is that if females prefer
high quality, showy males, directional selection means variation within these traits will
decrease, and low quality males eliminated (Kirkpatrick and Ryan, 1991). The
Hamilton-Zuk hypothesis provides an answer to this problem; it suggests that secondary
sexual traits are honest indicators of parasite resistance. In this model, continuous
coevolution between parasite and host leads to frequency dependent selection, where
there are cyclical changes in fitness of genotypes. These cyclical changes lead to
-3-
balancing selection, therefore variation in the trait is maintained. Evidence of such
associations between parasites and sexually selected traits have been found in a number
of studies (Johnsen and Zuk, 1998, Buchanan et al., 1999, Brawner et al., 2000, Worden
et al., 2000, Ditchkoff et al., 2001, Piersma et al., 2001, Hill et al., 2005a, Spencer et
al., 2005, Ezenwa and Jolles, 2008).
There are many studies which have investigated the effects and consequences of
parasites on their hosts, considering, for example, the effect of parasites on fitness (e.g.
Brown et al., 1995, Dale et al., 1996, Siikamaki et al., 1997, Coltman et al., 1999,
Dawson and Bortolotti, 2000, Merino et al., 2000, Fox and Hudson, 2001, Hughes et al.,
2009), host specificity (e.g. Bensch et al., 2000, Sehgal et al., 2001), sexual selection
(e.g. McLennan and Brooks, 1991, Brawner et al., 2000, Freeman-Gallant et al., 2001,
Buchholz et al., 2004, Ezenwa and Jolles, 2008), and other forms of selection, for
example maintaining genetic diversity (e.g. Potts et al., 1997, Coltman et al., 1999,
Meyer-Lucht and Sommer, 2005, Westerdahl et al., 2005). These studies use a range of
parasite systems, from ectoparasites such as feather mites (Richner et al., 1993,
Salvador et al., 1995, Dowling et al., 2001b), to endoparasites such as gastrointestinal
(Hudson, 1986, Smith et al., 1999, Hill et al., 2005a) or blood parasites (Hill et al.,
1997, Fallon et al., 2003a, Westerdahl et al., 2005).
1.2. Parasite models for investigating parasite-mediated selection: Avian malaria
and gastrointestinal parasites
Malaria is a disease caused by haemosporidian parasites of the genus Plasmodium or
Haemoproteus found in many mammals, reptiles and birds (Atkinson and van Riper,
1991). These parasites are indirectly transmitted by blood sucking insects (of the order
Diptera), such as mosquitoes, and have a complex life cycle with stages of development
in both tissues and circulating blood cells (see figure 1.1). In humans, malaria is an
important disease, responsible for between 700,000 and 2.7 million deaths a year
(Breman, 2001). Amongst birds, malaria is widespread, and has been found in 68% of
species examined, and is likely to be present in the majority of species (Atkinson and
van Riper, 1991, Clayton and Moore, 1997). Avian malaria, caused by either
Haemoproteus or Plasmodium, follows a course similar to malaria in other vertebrates,
consisting of a number of stages; a pre-patent stage shortly after transmission, where
parasites develop in host tissues; the acute phase where parasites are found in the blood
-4-
and parasitaemia increases; the crisis phase where parasitaemia peaks; and finally a
latent, or chronic, phase, where parasitaemia falls. This latent phase may last many
years, possibly life, and relapses may occur (Atkinson and van Riper, 1991).
Figure 1.1 Diagram showing simplified life cycle of typical malaria parasite. Adapted from Atkinson and
van Riper (1991)
Due to its ubiquity, and because it is now easily detected by molecular methods
(Feldman et al., 1995, Bensch et al., 2000, Fallon et al., 2003b, Hellgren et al., 2004,
Waldenstrom et al., 2004), avian malaria has become a commonly used model for
investigating parasite-mediated selection. The use of modern molecular analysis, which
has only risen to the fore over the last decade, has also shown that many malaria species
previously identified by morphology are comprised of a significant number of cryptic
species or lineages (Bensch and Akesson, 2003, Bensch et al., 2004, Fallon et al., 2005,
Ricklefs et al., 2005, Beadell et al., 2006). This more accurate identification of
-5-
species/lineages has facilitated a better understanding of the relationships between
specific parasites and their hosts (e.g Bensch et al., 2000, Ricklefs and Fallon, 2002,
Bonneaud et al., 2006, Ishtiaq et al., 2008). There is some evidence that avian malaria
has effects on various aspects of fitness, such as survival (Sorci and Moller, 1997,
Dawson and Bortolotti, 2000, Sol et al., 2003, Marzal et al., 2008) and reproductive
success (Korpimaki et al., 1995, Merino et al., 2000), however many other studies have
found no evidence of this (Bennett et al., 1988, Davidar and Morton, 1993, Dale et al.,
1996, Siikamaki et al., 1997, Schrader et al., 2003). Identifying fitness effects may be
problematic due to the difficulty of sampling individuals at the acute stage, where
pathogenic effects are most likely to be found, due to the immobile nature of acutely
infected birds (Valkiunas, 2005). Nevertheless, laboratory studies have shown
pathogenic effects of avian malaria (Atkinson et al., 1988, Atkinson and van Riper,
1991, Earle et al., 1993), indicating their potential as a selective pressure in the wild.
A number of features make avian malaria an ideal model in which to study the
selective effects of parasites. It is widespread (Atkinson and van Riper, 1991, Clayton
and Moore, 1997) and bird hosts are exceptionally well studied and characterised as
model systems in which to answer evolutionary questions. As stated above, there is
evidence of fitness effects (Warner, 1968, Sorci and Moller, 1997, Merino et al., 2000)
and therefore the potential to cause selection. Finally, avian malaria is quickly and
easily detectable using molecular analysis of blood samples (Bensch et al., 2000,
Richard et al., 2002, Fallon et al., 2003b, Hellgren et al., 2004). Consequently, avian
malaria has become a popular system for investigating the selective effects of parasites.
In addition to avian malaria, parasites of the gastrointestinal (GI) tract have been the
focus of studies investigating the selective effects of parasites. It is widely accepted that
most, if not all, wild vertebrate populations are host to GI parasites (Janovy, 1997). In
humans, more than 2000 million people are affected by parasitic helminth infection
(Montresor et al., 2002) and parasites are a major cause of disease amongst livestock
(e.g. Innes and Vermeulen, 2006, Zajac and Conboy, 2006), causing huge economic
losses (Perry and Randolph, 1999). Gastrointestinal parasites can have wide ranging
negative effects, including on body mass or condition (Bosch et al., 2000, Irvine et al.,
2006, Hughes et al., 2009), on sexually selected traits (Brawner et al., 2000, Horak et
al., 2004, Ezenwa and Jolles, 2008), on reproductive success (Hudson, 1986, Albon et
-6-
al., 2002, Vandegrift et al., 2008), and on survival (Gulland, 1992, Hudson et al., 1998,
Coltman et al., 1999). Parasites inhabiting the GI tract include helminth worms, such as
nematodes
(roundworms),
cestodes
(tapeworms),
trematodes
(flukes)
and
acanthocephalans (thorny-headed worms) (Roberts and Janovy, 1996). It is also a
habitat for protozoan parasites, most notably coccidia, which are found in a wide range
of hosts (Levine, 1963, Tenter et al., 2002). The typical life cycle of a coccidian parasite
consists of several asexual generations, followed by a sexual generation, ending in
development of an oocyst which is passed in the faeces. This oocyst can then be
ingested by another host (Levine, 1963, Roberts and Janovy, 1996, Janovy, 1997). This
life cycle is usually direct, requiring only one host. Helminth worms, however, may
have more complex life cycles, requiring one, two or even three hosts to complete the
life cycle (Smyth and Wakelin, 1994, Roberts and Janovy, 1996). These intermediate
hosts vary by parasite genera; trematodes often have molluscs or arthropods as
intermediate hosts, cestodes require fish, insects or crustaceans (Janovy, 1997).
GI parasites provide a useful model to investigate the effects of parasites and
parasite-mediated selection in wild populations. They are incredibly widespread
amongst vertebrates (Janovy, 1997), and parasitaemia can be easily and non-invasively
determined using microscopic examination of faecal samples for eggs and oocysts
(Thienpont et al., 1979), although this method does not always allow identification of
the parasite to species level. Recently, molecular methods have been developed that
allow identification of parasites to the species level (McManus and Bowles, 1996, Hung
et al., 1999, Zhao et al., 2001, McGlade et al., 2003, Foldvari et al., 2005, Jex et al.,
2008) and this has led to a number of cryptic species being identified (Jousson et al.,
2000, Blouin, 2002, Criscione et al., 2005, Steinauer et al., 2007). The combination of
traditional and molecular parasite identification and analysis means that associations
between specific parasites and their hosts can be identified and investigated, and their
possible impact on selection assessed.
1.3 Parasites and the maintenance
Histocompatibility Complex (MHC)
of
polymorphisms:
The
Major
The Major Histocompatibility Complex (MHC) is a gene complex that codes for
molecules involved in the vertebrate acquired immune response. MHC molecules can be
classified as class I or class II. Class I molecules consist of a transmembrane chain, and
-7-
three extracellular domains (α1, α2, α3), each of which are encoded by a different exon
in one gene (Jeffery and Bangham, 2000, Hess and Edwards, 2002, Garrigan and
Hedrick, 2003). Class I molecules are found on nearly all cells, and are thought to be
most important in defence against intracellular pathogens, such as viruses (Bernatchez
and Landry, 2003). In contrast, class II molecules consist of two transmembrane chains,
the α and β chains, which are encoded by separate genes. Class II molecules are only
found on specialist immune cells, such as B cells and macrophages, and are considered
to be important in defence against extracellular pathogens, such as bacteria. In both
class I and II molecules, the peptide binding region (PBR) binds and presents peptides
to T cells, which leads to an immune response. The MHC is highly polymorphic. In
humans, 243, 499 and 321 different sequences have been discovered for the genes
HLA-A, -B and DRB respectively, making it the most polymorphic of known functional
genes in humans (Garrigan and Hedrick, 2003). MHC polymorphism has also shown to
be high in other mammals, for example in ruminants (Mikko et al., 1999, FeichtlbauerHuber et al., 2000) and rodents (Harf and Sommer, 2005, Klein et al., 2007).
The MHC of mammals has been well characterised (e.g. Klein, 1979, Ploegh et al.,
1981, Hughes et al., 1997, Hoelzel et al., 1999, Feichtlbauer-Huber et al., 2000, e.g.
Aguilar et al., 2004, Amillis et al., 2004, Musolf et al., 2004, Babik et al., 2005, Bryja
et al., 2005, Harf and Sommer, 2005, Bowen et al., 2006, Pratt et al., 2006, Mainguy et
al., 2007, Ezenwa and Jolles, 2008). Furthermore, because of its commercial
importance, the structure and function of the chicken (Gallus gallus) MHC has also
been well studied and reported (Briles et al., 1977, Guillemot et al., 1988, Kaufman et
al., 1999). For example; the chicken MHC, or B complex as it’s also known, has been
termed a “minimal essential MHC” due to it being much smaller and denser than
mammalian MHC. With only 19 genes packed into 92kb of DNA it is equivalent to just
1/20th the size of the human MHC (Kaufman et al., 1999, Hess and Edwards, 2002).
Indeed, perhaps the best example of association between MHC and disease are seen in
the chicken and resistance to Marek’s disease (Briles et al., 1977). However, outside the
chicken, our understanding of the avian MHC is very limited and has only recently
started to expand with work focusing on other avian groups. Recent work has found
evidence that passerines do not appear to have a minimum essential MHC (red-winged
blackbird, Agelaius phoeniceus, Edwards et al., 2000b, willow warbler, Phylloscopus
trochilus, and great reed warbler, Acrocephalus arundinaceus, Westerdahl et al., 2000,
-8-
savannah sparrow, Passerculus sandwichensis, Freeman-Gallant et al., 2002). Other
components of the chicken MHC, such as an Rfp-Y group of MHC-like genes have not
been found in passerines (Westerdahl et al., 2000) indicating that the features of chicken
MHC are not universal to all birds. The pattern of MHC polymorphism of passerines is
not seen in all non-chicken avian groups; great snipe (Gallinago media) has an MHC
intermediate in size and complexity of chickens and passerines (Ekblom et al., 2003).
Therefore there appears to be variation in size and structure of the MHC amongst birds.
While much early work focussed on the chicken as a model species, the development of
DNA sequencing and conserved primers that will amplify MHC across a range of
passerine species (Edwards et al., 1995b, Wittzell et al., 1999) has allowed a
proliferation of studies investigating not just the structure and variation present in
passerine MHC, but also investigating the causes and consequences of this variation
(Edwards et al., 1998, Edwards et al., 2000a, Westerdahl et al., 2000, Richardson and
Westerdahl, 2003, Bonneaud et al., 2004, Jarvi et al., 2004, Miller and Lambert, 2004a,
Westerdahl et al., 2004b, Aguilar et al., 2006).
In order to understand how variation at the MHC has been maintained, we need to
identify if it has been under selection in the past. If a species’ MHC has been under
selection, we can find evidence of this in its DNA sequence. The most widely-used
method for detecting past selection in the MHC is to look at the nucleotide sequence
within alleles from MHC genes and compare rates of synonymous (which cause no
amino acid change, dS) and non-synonymous (amino acid changing, dN) substitutions
per synonymous and non-synonymous sites. According to neutral theory, most nonsynonymous substitutions are harmful, and therefore should be eliminated by purifying
selection (Kimura, 1983). However, under selection, the rates of dN are expected to be
higher than that of dS (Hughes and Nei, 1988, Hughes et al., 1997). In the MHC, the
protein binding region (PBR) is the area most likely to be under selection, as it is this
region that recognises foreign antigens. New variants of the PBR may be able to
recognise new antigens; therefore if the PBR region has undergone selection, we expect
a higher rate of dN than dS in this area in comparison to non-PBR sites of the MHC
sequence. Hughes and Nei (1989) found that in the majority of cases, dN was
significantly greater than dS in the PBR of both human and mouse MHC. In contrast, in
non-PBR areas the opposite was true. This finding is common to many studies that look
for evidence of past selection on the MHC through dn/ds ratios in a range of species (e.g.
-9-
Mikko and Andersson, 1995, Edwards et al., 1998, Paterson, 1998, Westerdahl et al.,
2000, Richardson and Westerdahl, 2003, Bonneaud et al., 2004, Jarvi et al., 2004,
Musolf et al., 2004, Harf and Sommer, 2005, Schad et al., 2005). A meta-analysis by
Bernatchez and Landry (2003) found all but one study showed dN/dS >1, indicating
balancing selection was widespread in the MHC of a range of species.
A second method for detecting past selection on the MHC is to look for evidence of
trans-species polymorphism, the long-term persistence of MHC alleles beyond
speciation events (Klein, 1987, Figueroa et al., 1988). While over time genetic
differences accumulate between taxa, either stochastically or by selection, when alleles
are under balancing selection they may be maintained across speciation events. In transspecies polymorphism, alleles across taxa may be more similar than alleles within a
species, and allele phylogenies may not be representative of species phylogenies. A
study of a MHC class II allele in humans, chimpanzees (Pan troglodytes) and rhesus
macaques (Macaca mulatta) suggest persistence for over 30 million years (Geluk et al.,
1993). There is even support for persistence of MHC class II alleles since the
divergence of marsupial and placental mammals (Slade et al., 1994) over 100 million
years ago (Novacek, 1992, Edwards et al., 1995b). Other examples include within the
Muridae (Musolf et al., 2004) Hawaiian honeycreepers (Jarvi et al., 2004), salmon
(Miller and Withler, 1997), Acrocephalus warblers (Richardson and Westerdahl, 2003),
and between different passerine families (Freeman-Gallant et al., 2002),
1.4 Mechanisms of balancing selection at the MHC
The analyses described above show that balancing selection is likely to have occurred in
the MHC of a wide range of species and that this has helped to generate the high levels
of variation seen in the MHC. However the causes of such selection are still debatable
and several hypotheses have been proposed. Due to its important role in the immune
system, the selection pressure exerted by pathogens has been suggested to account for
the maintenance of MHC diversity via balancing selection (Clayton and Moore, 1997,
Jeffery and Bangham, 2000, Hedrick, 2002). Doherty and Zinkernagel (1975) suggested
that selection would favour individuals that are heterozygous at MHC loci.
Heterozygotes carrying two alleles are able to recognise more antigens than
homozygotes (carrying only one allele), and will therefore be better able to defend
themselves against pathogens and consequently have a higher fitness than homozygotes
- 10 -
(overdominance effect, Hedrick, 1999, Jeffery and Bangham, 2000.). High MHC
diversity or heterozygosity has been found to be associated with increased resistance to
parasites in a number of studies across a number of taxa (Froeschke and Sommer,
Thursz et al., 1997, Carrington et al., 1999, Arkush et al., 2002, Penn et al., 2002, Harf
and Sommer, 2005, Oliver et al., 2009). However, the distinction between
overdominant resistance/heterozygote advantage, and simply effects of a dominant
allele are often difficult to identify when investigating heterozygote advantage. Some
studies have shown that the apparent benefit of being a heterozygote is due to dominant
rather than overdominant resistance (Penn et al., 2002, McClelland et al., 2003). When
a heterozygote (AB) is fitter than the average of both homozygotes (AA and BB), but
no fitter than the fittest homozygote (AA), then it is the dominant allele (A) that is
causing
the
fitness
increase,
not
heterozygote
advantage.
True
overdominance/heterozygote advantage is when the fitness of the heterozygote (AB) is
significantly greater than both homozygotes (AA and BB).
Frequency dependent parasite mediated selection could also act to maintain diversity
within populations through a mechanism termed ‘rare allele advantage’. Common
parasites evolve resistance to common host genotypes; therefore genotypes with rare
alleles have a selective advantage. This theory predicts that parasite and host genotypes
would constantly evolve in cycles in relation to each other, thus retaining
polymorphisms (Hedrick, 1999, Jeffery and Bangham, 2000, and references therein). It
also predicts associations between specific MHC alleles/haplotypes and resistance or
susceptibility to pathogens. Such associations have now been found in a variety of
domestic and wild species (Froeschke and Sommer, Buitkamp et al., 1996, Paterson et
al., 1998, Langefors et al., 2001, Kurtz et al., 2004, Harf and Sommer, 2005, Bonneaud
et al., 2006). In humans infected with HIV, particular HLA (human MHC) class I
alleles are associated with rapid progression to AIDS (Carrington et al., 1999). In this
study, high heterozygosity at HLA loci also delayed progression to AIDS, indicating
that overdominance and frequency dependent selection may not be mutually exclusive.
The rare allele model also predicts temporal and geographic changes in MHC allele
frequencies as the relative abundance of parasite variants fluctuates. Such temporal
fluctuations in MHC allele frequencies have been observed in the great reed warbler
(Acrocephalus arundinaceus, Westerdahl et al., 2004a). Geographic differences in
MHC allele frequencies have also been found. For example, differentiation in MHC
- 11 -
allele frequencies have been found between populations of Atlantic salmon, (Salmo
salar, Landry and Bernatchez, 2001). However, as similar levels of variation were also
evident in neutral microsatellites, these populations are likely to have diverged via drift
rather than selection. However, geographic differentiation in MHC allele frequencies
have also been shown in great snipe (Ekblom et al., 2007) and the house sparrow
(Passer domesticus, Loiseau et al., 2009) that are considered to be due to differential
selection rather than stochastic mechanisms such as drift.
While heterozygote advantage and frequency dependent selection are thought to be
important in the maintenance of diversity in the MHC, and have therefore received
much attention, another mechanism may also play a role. The fluctuating selection
hypothesis (Hedrick et al., 1987, Hedrick, 1999) suggests that spatio-temporal variation
in the selection pressure exerted by pathogens may also contribute to increased MHC
diversity. Geographical and temporal variation in pathogen type and prevalence within
populations can cause differences in selection in space and time. These fluctuations may
then drive MHC diversity (Hill et al., 1991, Hedrick and Kim, 2000, Meyer and
Thomson, 2001, Hedrick, 2002). While this hypothesis has theoretical support
(Hedrick, 2002) and as mentioned above, MHC allele frequencies can differ over time
and space (Landry and Bernatchez, 2001, Ekblom et al., 2007, Loiseau et al., 2009),
little empirical work identifying balancing selection via fluctuating selection pressures
has been done (Meyer and Thomson, 2001, Charbonnel and Pemberton, 2005).
It is important to note that the hypotheses explaining MHC polymorphism outlined
above are not mutually exclusive, and a combination of mechanisms may contribute
towards maintaining MHC variation (Meyer and Thomson, 2001). Furthermore, another
process, sexual selection, may act on top of these processes, both responding to, and
helping to maintain, MHC variation. The MHC could provide a mechanism by which
females could gain genetic benefits through mate choice (Penn and Potts, 1999,
Tregenza and Wedell, 2000). MHC based mating preferences, based either on the direct
assessment of an individual’s MHC or via condition dependent traits, may provide
genetic benefits by increasing offspring disease resistance (and therefore fitness).
Offspring fitness could be increased by mating with males with advantageous MHC
alleles or by avoiding those with deleterious alleles. Females could also increase
offspring fitness by mating with a male with MHC alleles compatible with her own,
- 12 -
thus maximising (or optimising) offspring MHC diversity (Penn and Potts, 1999,
Tregenza and Wedell, 2000, Malinski, 2003). Evidence of MHC based mate choice has
been observed in a number of species (Wedekind et al., 1995, but see Hedrick and
Loeschcke, 1996, von Schantz et al., 1997, Penn and Potts, 1999 and references
therein).
1.5 Parasites, MHC and conservation
As discussed above, parasites can severely affect host fitness, and in extreme cases may
pose a threat to a population or even an entire species (Wilcove et al., 1998, McCallum
and Dobson, 2002). However, much of the evidence linking parasites and extinction is
anecdotal, and there are few definite empirical examples where parasites have been the
sole cause of extinction (de Castro and Bolker, 2005, Smith et al., 2006). However, it is
accepted that parasites may pose a significant threat in some cases, for example in
populations that have already declined or become fragmented as a result of habitat loss
(Smith et al., 2009), or in endemic species exposed to introduced, exotic disease
(O'Brian and Evermann, 1988, Cunningham, 1996).
There are some factors, such size of population or level of endemism, that may make
some populations more vulnerable to the effect of parasites. The loss of genetic
diversity that can occur in small or bottlenecked populations (Frankham, 1995) is one
such factor. It has been suggested that loss of genetic diversity in these populations may
leave them vulnerable to disease (O'Brian and Evermann, 1988, Spielman et al., 2004)
as alleles important in immune defence may be lost. Loss of MHC diversity in particular
could have important consequences for small, vulnerable populations, leaving them
prone to parasites and diseases (O'Brian and Evermann, 1988). Low MHC variability
has been shown in a number of species that have experienced genetic bottlenecks, for
example in the Eurasian beaver (Castor fiber, Babik et al., 2005) the Chatham Island
black robin (Petroica traversi, Miller and Lambert, 2004b), cheetah (Acinonyx jubatus,
Drake et al., 2004), Galapagos penguin (Spheniscus mendiculus, Bollmer et al., 2007),
Spanish ibex (Capra pyrenaica, Amillis et al., 2004) and crested ibis (Nipponia nippon,
Zhang et al., 2006). However, there is evidence that some small populations that have
endured a genetic bottleneck have maintained diversity at the MHC (Hughes, 1991).
The maintenance of MHC variation in such cases has been explained through the
continued effects of balancing selection during the bottleneck indicating that selection
- 13 -
by pathogens is strong enough to maintain MHC diversity in at least some bottlenecked
populations. Nevertheless, it has been suggested that maintenance of MHC diversity
should be an important aim when designing conservation strategies for endangered or
small populations (Richardson and Westerdahl, 2003, Aguilar et al., 2004, Jarvi et al.,
2004)
1.6 Enemy release hypothesis
The examples above show that parasites can have important consequences in shaping
and maintaining genetic diversity. However the maintenance of parasites is often not
considered in developing conservation plans for species or habitats. Parasites
themselves may be unique evolutionary units or species which, if the aim is to maintain
overall biodiversity, should also be conserved (Windsor, 1995). While introduced
parasites can have devastating consequences in naïve populations (the best example
being the introduction of malaria to Hawaiian birds, Warner, 1968, van Riper et al.,
1986), endemic parasites may play a significant role in maintaining genetic diversity.
Specifically, if MHC diversity is maintained by parasite mediated selection, then any
loss of a population’s parasites could have important consequences on the long-term
genetic viability of that population. Populations translocated for conservation reasons
are normally small and often already suffer from reduced genetic variability
(Frankham, 1995). If further variation is lost at loci such as the MHC, this may leave
them vulnerable to disease in the long run (O'Brian and Evermann, 1988). Consequently
the maintenance of parasite diversity in such populations may be valuable to protect
against further loss of genetic diversity.
The enemy release hypothesis (ERH) seeks to explain why invasive species are so
successful. It states that when a species is introduced into a new area it is able to escape
its natural enemies, such as herbivores or parasites, allowing the population to increase
and thrive as a result of decreased regulation by its enemies (Keane and Crawley, 2002).
The ERH has been applied primarily to invasive species, especially plants (Keane and
Crawley, 2002, Mitchell and Power, 2003, Torchin et al., 2003). There are three
mechanisms which may cause enemy release; 1) the initial population size of founding
individuals may be few, and so more likely to be parasite free , 2) Small founding
populations may be unable to support a parasite population; and 3), Pathogens with
- 14 -
indirect life cycles require the presence of an intermediate host, which may not be
available in the new range (Clay, 2003).
Translocations, here defined as the movement of living organisms from one area
with free release in another (IUCN, 1987), have proved important in the conservation of
a variety of species (Griffith et al., 1989, Abbot, 2000, Fischer and Lindenmayer, 2000,
Wolf et al., 2002). Like invasive species, translocated populations often involve small
founding populations. Furthermore preferential movement of uninfected animals is also
sometimes a feature of translocations (Mathews et al., 2006) and it is often unknown if
intermediate vectors for endemic parasites are present in the new range. All these
factors lead to the reasonable conclusion that translocated populations may also
experience enemy release. Consequently, it may be worthwhile to look for evidence of
this in such translocated populations. However, to my knowledge no work has been
done considering the role of ERH in species translocated as part of a conservation
programme.
1.7 Study species: The Seychelles warbler
The Seychelles warbler (Acrocephalus sechellensis) is a small, insectivorous, passerine
bird, endemic to the islands of the Seychelles in the Indian Ocean. Historical records of
the species’ historical range are unclear, however it probably lived on several islands
within the archipelago (Komdeur, 1991). By the middle of last century, loss of habitat
due to planting of coconut (Cocos nucifera) and introduction of rats and cats, lead to the
decline of the species, until only 26-29 individuals survived, limited to the 25 hectare
island of Cousin (Vesey-Fitzgerald, 1940, Crook, 1960, Loustau-Lalanne, 1968). In
1968, Cousin was bought by the International Council for Bird Protection (now Birdlife
International), and a programme of habitat restoration was begun. The species showed a
rapid recovery, with Cousin reaching carrying capacity of 320 individuals by 1982
(Brouwer, 2007). Since then, the population has fluctuated around this carrying
capacity, between 300-350 individuals (Komdeur, 1992). Due to the small nature of the
remaining population, translocations to three islands have been carried out to allow
population expansion. In 1988 and 1990, 29 birds were translocated from Cousin to
each of Aride (72 ha) and Cousine (26ha, see figure 1.2 for location of islands)
respectively (Komdeur, 1994a). More recently in 2004, 58 birds were translocated to
Denis Island (Richardson et al., 2006). These translocations have successfully increased
- 15 -
the population size to approximately 3000 individuals by the end of 2008 (Brouwer et
al., 2006, D.S. Richardson, pers.comm, figure 1.3).
Figure 1.2 Map showing location of Cousin, Cousine, Aride and Denis Islands within the Seychelles
archipelago.
- 16 -
Figure 1.3 Annual fluctuations of population density of Seychelles warblers on Cousin, Cousine, Aride
and Denis. Arrows with sample size indicate introduction of birds to each island. From Brouwer (2007)
The Seychelles warbler has a complex cooperative breeding system. Primary
(breeding) birds form long term pair bonds, and defend a territory year-round
(Komdeur, 1992). Due to lack of breeding opportunities, offspring from previous years
often forgo breeding to stay in their natal territory as subordinates (Komdeur, 1992) and
some of these subordinates act as helpers-at-the-nest by feeding and incubating.
However, molecular parentage analysis has shown that joint nesting occurs, with an
average of 44% of female subordinates gaining maternity each year (Richardson et al.,
2001). There are also high levels of extra pair paternity, with up to 40% offspring being
fathered by a male other than the pair male, normally a dominant male from another
territory (Richardson et al., 2001). Another recently discovered feature of this system is
that ‘grandparent helpers’ occur; 13.7% of dominant females are, at some point,
deposed from their primary breeding position, and of these 68% remain as subordinate
helpers within the territory (Richardson et al., 2007). The main breeding season for the
Seychelles warbler is between June – September, however some individuals also breed
during a smaller breeding season from December to February (Komdeur and Daan,
2005).
During each breeding season, each territory has typically one clutch each
breeding season, normally consisting of one egg, although clutches of 2 or 3 eggs also
occur, especially in cases of joint nesting (Richardson et al., 2001).
- 17 -
Figure 1.4 Seychelles warbler (photo by J. van de Crommenacker).
Microsatellite analysis has shown the Seychelles warbler to have low genetic
diversity, probably due to the bottleneck it experienced during the last century
(Richardson et al., 2001). However, there is evidence that the MHC class I of this
species has historically been under balancing selection, and has maintained some of its
diversity despite the bottleneck (Richardson and Westerdahl, 2003, Hansson and
Richardson, 2005). There is also evidence of MHC class I dependent extra-pair
fertilisation; females were more likely to gain an extra-pair fertilisation when their
social mate had low MHC class I diversity, and the MHC diversity of the extra pair
mate was significantly higher than that of her social mate (Richardson et al., 2005).
Therefore it appears that Seychelles warbler females may be using extra-pair paternity
to gain higher MHC diversity for their offspring when limited breeding opportunities
restrict social mate choice.
Since 1985, the Cousin Island population has been subject to intensive monitoring.
Birds have been ringed with a unique identifier of three U.V resistant colour rings, and
one metal British Trust for Ornithology (BTO) ring. This effort has resulted in over
97% of the population being ringed since 1997, thus allowing individuals to be
- 18 -
monitored throughout their lifetime. During each main breeding season, surveys of the
population and territories are carried out, nesting attempts are recorded to establish
reproductive success, and nests are observed to identify which subordinates help within
groups (incubating, feeding or nest guarding; Komdeur et al., 1997). As there is almost
no migration between islands (Komdeur et al., 2004a), if an individual is not seen over
two consecutive seasons it can safely be assumed dead. The intensive long term
monitoring of this closed system means that this is an ideal model system with which to
answer important evolutionary questions. This system has been used to study the
evolution of cooperative breeding (Komdeur, 1991, Komdeur, 1992, Richardson et al.,
2002) mate choice (Richardson et al., 2005), inbreeding (Richardson et al., 2004), and
adaptive egg sex modification (Komdeur, 1996a, Komdeur, 1998, Komdeur, 2003), as
well as many other evolutionary subjects (e.g. Komdeur, 1992, Komdeur and Kats,
1999, Richardson and Westerdahl, 2003, Komdeur et al., 2004a, Komdeur et al., 2004b,
Brouwer, 2007, Richardson et al., 2007, Eikenaar, 2008).
1.8 Thesis outline
The main focus of this thesis is to investigate the causes and consequences of pathogenmediated selection in a wild vertebrate organism. While it is generally accepted that
parasites have a significant selective effect, the fitness effects of parasites can vary
between host and parasite species, and in many cases the pathogenicity of parasites,
such as avian malaria, is unclear. Therefore, there is a need for studies that investigate
the effects of parasites on fitness components in order to assess the selective pressures
they create. It is also important to investigate the consequences of that parasite mediated
selection pressure, specifically the idea that such selection helps maintain genetic
variation within populations. The MHC is often used as a model in which to look for
evidence of parasite-mediated balancing selection in the wild; however in most species
investigated so far, only one class of MHC has been characterised. Characterisation and
analysis of both classes of MHC will provide a fuller picture of how hosts and their
parasites interact and how MHC polymorphism is maintained. Finally, parasites are
often viewed as a negative feature in endangered species, however endemic parasites
may play an important role in maintaining important genetic variation in the face of the
genetic bottlenecks that these species often undergo. Studies are required that
investigate how small or endangered populations may lose their endemic parasites, and
what likely impact this will have on future viability of the population.
- 19 -
The Seychelles warbler appears to be an excellent model system in which to answer
these questions. The long-term monitoring of the small, closed populations means
survival and other fitness parameters can be accurately determined. The MHC class I
has already been characterised (Richardson and Westerdahl, 2003). Neutral genetic
diversity has been shown to be low compared to congeneric species (Richardson et al.,
2000). It is known to have experienced at least one severe population bottleneck, and as
an island species has probably experienced numerous bottlenecks. In addition, island
species often have low parasite diversity (Dobson, 1988, Dobson et al., 1992, Font and
Tate, 1994, Fromont et al., 2001) and therefore we may expect a simple parasite
community in the Seychelles warbler. The simplified system provided by the Seychelles
warbler should make statistical analysis of associations between MHC, fitness and
parasites more tractable than in other, more polymorphic species, therefore facilitating
the investigation of the concepts and questions introduced above and outlined below.
Previous study has shown the MHC class I to be under balancing selection in the
Seychelles warbler. However, in order to get the full picture of how selection may have
shaped the MHC, both class I and class II need to be examined. Chapter 2 explains the
methods I used to screen for MHC class II variation in the Seychelles warbler, and how
the results were then used to investigate evidence of past selection. In chapter 3, I
survey the extent of gastrointestinal parasite infection within the entire population of the
Seychelles warbler so that the impact of infection, and its MHC diversity in particular,
can be investigated. In chapter 4, I investigate the causes and consequences of malaria
infection in the Seychelles warblers, and again link this to the patterns of variation seen
in the MHC. Finally, chapter 5 focuses on the enemy release hypothesis, and whether a
combination of historical colonisation of isolated oceanic islands, and contemporary
conservation driven translocations, may have caused a loss of parasite diversity in the
Seychelles warbler. I then discuss how such a loss may impact on the long term genetic
variation within a population and its viability. As this thesis has been written in the style
of a series of manuscripts for publication, there is some repetition, e.g. in methodology,
between chapters.
- 20 -
Chapter 2
Characterisation of the MHC class II in the
Seychelles warbler
- 21 -
2.1 Abstract
The endemic Seychelles warbler, Acrocephalus sechellensis, has low levels of neutral
genetic diversity, however diversity of the major histocompatibility complex (MHC)
class I appears to have been maintained by balancing selection. Here variation in its
counterpart, the MHC class II, was examined in the Seychelles warbler using cloning
and DNA sequencing, reference strand mediated conformation analysis (RSCA) and
single stranded conformation polymorphism (SSCP). Twelve alleles were identified,
two of which were considered to be non-functional. A higher ratio of synonymous to
non synonymous changes in the PBR (protein binding region) in comparison to the nonPBR, and the high allelic divergence at the PBR, suggest that the MHC class II genes
have previously been under balancing selection. Comparison of the alleles with other
published passerine sequences showed evidence of trans-species persistence of alleles
within the Sylviidae, but that trans-species persistence does not occur above the family
level across passerines. Both RSCA and SSCP screening showed that while there was
evidence of at least 10 functional alleles, there was little difference in MHC class II
alleles found between individuals. A previous bottleneck and reduced selection pressure
may be responsible for this between individual MHC class II similarity, however the
large number of loci found may mean individual Seychelles warblers may able to
combat a wide range of pathogens.
- 22 -
2.2 Introduction
How and why genetic diversity is maintained in natural populations is central to our
understanding of evolutionary biology (Futuyma, 1998). Consequently, the role of
processes such as selection and drift in shaping genetic diversity has been much studied
and debated (Hey, 1999). The exceptionally high levels of diversity observed within
certain genes (e.g. those of the major histocompatibility complex; MHC); make such
genes good models with which to explore the effects of selection on polymorphisms.
These genes are thought to be under balancing selection, a process which maintains
polymorphisms within a population over a long time period (Futuyma, 1998).
The MHC is a highly polymorphic gene complex that codes for molecules involved
in the acquired immune response of vertebrates. MHC molecules bind peptide
fragments and present these on the cell surface. Presentation of foreign (non-self)
peptides results in activation of T cells, initiating the immune response (Edwards and
Hedrick, 1998, Jeffery and Bangham, 2000). Evidence that the MHC is under balancing
selection comes from its high allelic diversity (Klein, 1986), the persistence of alleles
across species over long evolutionary time periods or speciation events (Klein, 1987,
Figueroa et al., 1988), and the increased levels of non-synonymous to synonymous
substitutions in the protein binding region (PBR; the area most likely to be under
selection). Many studies across a wide range of species have now provided support for
the idea that the MHC is strongly influenced by balancing selection, for example
salmon, Salmo salar (Langefors et al., 2001), red winged blackbirds, Agelaius
phoeniceus (Edwards et al., 1995a), tuco-tucos (Ctenomys spp.) (Cutrera and Lacey,
2007) Soay sheep, Ovis aries (Paterson, 1998), lesser kestrel, Falco naumanni (Alcaide
et al., 2008), and red wolves, Canis rufus (Hedrick et al., 2002) amongst many others
(Piertney and Oliver, 2006).
What causes the balancing selection that appears to be acting upon the MHC has
been the focus of much research. Due to the intrinsic role of the MHC in immune
defence, parasite mediated balancing selection has been widely suggested as important
in maintaining MHC diversity in natural populations. There have been several
mechanisms suggested to explain how this occurs; (i) heterozygote selection, (ii)
frequency dependent selection, (iii) fluctuating selection, and (iv) sexual selection.
- 23 -
Doherty and Zinkernagel (1975) suggested selection would favour individuals that are
heterozygous at MHC loci, as heterozygotes carrying two different alleles are able to
recognise a greater range of antigens than homozygotes carrying only one allele, and
therefore have a higher fitness than homozygotes (Hedrick, 1999, Jeffery and Bangham,
2000) High MHC diversity or heterozygosity associated with increased resistance to
parasites has been found in a few species; for example sticklebacks, Gasterosteus
aculeatus, (Kurtz et al., 2004) and several species of gazelle (Cassinello et al., 2001).
Frequency dependent selection could also act to maintain diversity within populations
through a mechanism termed ‘rare allele advantage’. Common parasites evolve
resistance to common host genotypes; therefore genotypes with rare alleles have a
selective advantage. This theory predicts that parasite and host genotypes would
constantly evolve in cycles in relation to each other, thus retaining polymorphisms
(Hedrick, 1999, Jeffery and Bangham, 2000, and references therein). It also predicts the
occurrence of associations between specific MHC alleles/haplotypes and resistance or
susceptibility to pathogens. Such associations have been found in both domestic
(Buitkamp et al., 1996) and unmanaged populations of sheep (Paterson et al., 1998), and
hairy-footed gerbils, Gerbillurus paeba (Harf and Sommer, 2005). Fluctuating selection
exerted by pathogens may also contribute to increased MHC diversity. Geographical
and temporal variation in pathogen type and prevalence cause differences in selection in
space and time, which can drive MHC diversity (Hill et al., 1991, Meyer and Thomson,
2001, Hedrick, 2002). Another mechanism by which MHC diversity could be
maintained is by sexual selection. The MHC may provide a mechanism by which
females could gain indirect benefits through mate choice. Offspring fitness could be
increased by mating with males with advantageous MHC alleles or by avoiding those
with deleterious alleles. Females could also increase offspring fitness by mating with a
male with MHC alleles compatible with her own (Penn and Potts, 1999, Tregenza and
Wedell, 2000).
Selection on hosts by parasites may be strong enough to maintain diversity despite
the population experiencing low neutral diversity, for example, caused by a population
bottleneck. While some populations that have been genetically bottlenecked may also
have low MHC variation (Hedrick et al., 2000, Mainguy et al., 2007), various others
have been shown to have surprisingly high MHC diversity compared to neutral genetic
variation, for example, in San Nicolas Island foxes, Urocyon littoralis dickeyi (Aguilar
- 24 -
et al., 2004), guppies, Poecilia reticulata (Oosterhout et al., 2006), and Hawaiian
honeycreepers (Jarvi et al., 2004). The maintenance of MHC variation in such cases has
been explained through the continued effects of balancing selection during the
bottleneck (Sommer, 2005).
The maintenance of MHC variation may be of particular importance for these
bottlenecked or small population species that may be of conservation concern. Due to
the central role the MHC plays in disease resistance, low diversity may leave small
populations vulnerable to introduced parasites and diseases (O'Brian and Evermann,
1988). As mentioned above, the MHC may also play a role in mate choice and
particularly inbreeding avoidance (Penn and Potts, 1999), which may be of importance
in the recovery of small bottlenecked populations. These reasons mean it is important to
measure MHC variation in such populations, alongside more widespread measures of
genetic diversity such as microsatellites, in order to better inform the conservation of
these species.
The Seychelles warbler, Acrocephalus sechellensis, is a passerine endemic to the
islands of the Seychelles. The Seychelles warbler population underwent a severe
bottleneck, with the entire world population consisting of less than 29 individuals
confined to Cousin Island (26 ha) between at least 1940 to 1968 (Vesey-Fitzgerald,
1940, Crook, 1960, Loustau-Lalanne, 1968). Subsequent conservation efforts from 1968
onwards have resulted in a substantial population increase and, with the aid of
translocations, populations now exist on four islands (Komdeur, 1994a, Brouwer, 2007).
The Cousin Island population has been monitored since 1985, with >96% individuals
colour ringed since 1997 (Richardson et al., 2004). Microsatellite markers have been
used to genotype neutral variation within the populations and to assign parentage
(Richardson et al., 2000, Richardson et al., 2001). MHC class I diversity within the
population has also been determined and evidence that balancing selection has had a
role in maintaining MHC class I diversity in this species has been found (Richardson
and Westerdahl, 2003). Importantly levels of MHC class I variation were found to be
higher than expected given the low levels of neutral variation observed in this species
(Richardson and Westerdahl, 2003, Hansson and Richardson, 2005). Interestingly MHC
class I diversity appears to play a role in extra pair, but not social, mate patterns within
this species (Richardson et al., 2005). Females were more likely to obtain extra-pair
- 25 -
fertilisations when their social mate had low MHC diversity, and the extra pair male had
significantly higher MHC diversity than the social male.
Many studies, including the ones on the Seychelles warbler discussed above, have
focused on either class I or II MHC diversity. However, this approach may only explain
half the story when it comes to complex interactions between the MHC, fitness
measures such as survival and reproductive success, and mate choice. For example, an
individual’s choice of mate is likely to be based on a wide range of factors, of which
either class I, II or both classes of MHC may, or may not, be implicated. Selection on
the MHC may also depend on the type of pathogens present within the population. It is
thought class I MHC may be particularly important in resistance against intracellular
pathogens, such as viruses or blood parasites like malaria, whereas class II MHC may
be important for defence against extracellular pathogens like gastrointestinal parasites
(Hess and Edwards, 2002). The range of pathogens present in a population may exert
variable selection pressures on the two classes of MHC. Screening and investigating the
role of class II variation within the Seychelles warbler is, therefore, not just important in
its own right, but in combination with the information available for class I variation,
may also provide a fuller picture of selection on the MHC, and its consequences in this
species.
Screening MHC variation of either class I or II in passerines has, however, proved
difficult because of the high number of duplicated genes involved, high interlocus gene
similarity, and high numbers of non-functional genes. These features prevent the use of
single locus PCR techniques to identify individual MHC variation (Wittzell et al., 1999,
Edwards et al., 2000b). The screening of multiple similar loci amplified together also
poses problems as resolving between a large number of different sequences (variants
within or across the loci – for the sake of simplicity here termed alleles) within a single
individual can be difficult. Various different conformation based techniques have now
been used in an attempt to resolve this problem, with differing levels of success
(Arguello et al., 2002, Goto et al., 2002, Richardson and Westerdahl, 2003, Worley et
al., 2008).
The aims of the present study were to; 1) characterise MHC class II variation in the
Seychelles warbler and to assess the evidence that balancing selection has had an effect
- 26 -
on this variation; 2) to look for evidence of trans-species persistence of MHC class II
alleles by comparing alleles identified across a range of passerine birds; 3) to compare
levels of variation in the Seychelles warbler to that observed in a widespread congener
(the great reed warbler Acrocephalus arundinaceus) and finally; 4) to compare the
ability of two conformation based screening techniques, reference strand mediated
conformation analysis (RSCA) and single stranded conformation polymorphism (SSCP)
so that an efficient protocol for screening MHC class II diversity in the Seychelles
warbler can be developed.
2.3 Methods
2.3.1 Field methods
DNA from birds caught on Cousin Island in 1999 and 2005, and on Aride Island in
2002, were used to characterise the MHC class II. Birds were caught using mist nets.
Unringed birds were given a unique combination of three UV resistant colour rings, and
a metal British Trust for Ornithology (BTO) ring for identification. A small (ca 50µl)
blood sample was taken from each bird by brachial venipuncture, and stored in 800µl of
100% ethanol at room temperature in a 2ml microcentrifuge tube, for later analysis.
2.3.2 Sequencing of intron 1 and 2 in the Seychelles warbler and great reed
warbler
Variation at exon 2 of the MHC class II genes was screened as this exon contains the
protein binding region (PBR, Yeager and Hughes, 1999) and, consequently, is the
region most likely to be under selection (Bernatchez and Landry, 2003). In order to
amplify the entire sequence of exon 2 it was necessary to place primers in the introns
flanking this region. To do this these introns first had to be amplified and sequenced. A
cDNA library of all MHC class II exon sequences produced from the great reed warbler
by Westerdahl et al (2000) was used to design primers to amplify the intron 1 (cO30
and cO40, see table 2.1 for sequences) and intron 2 (cO31 and cO42) regions flanking
exon 2. These primers were then used to amplify sections from a small sample of three
Seychelles warblers in order to ascertain that the correct sequence was amplified, and
with which to develop a screening protocol which would allow a larger number of birds
to be screened. MHC class II exon 2 sequences were cloned from three birds, here
- 27 -
referred to as individuals A, B and C. Individual A was caught on Cousin Island in
1999, individual B on Aride Island in 2002, and individual C on Cousin Island in 2005.
All were unrelated to each other. DNA was extracted using a salt extraction technique
(Aljanabi and Martinez, 1997). The DNA fragment was amplified from each individual
separately. The polymerase chain reaction (PCR) mix contained ca. 100ng DNA
template, 1 x reaction buffer, 1mM MgCl2, 0.125 µM dNTPs, 0.5 µM of each of the
forward and reverse primers, and 0.2 µl Taq polymerase in a final reaction volume of
25µl. The thermal profile was as follows; 94 ˚C for 2min, followed by 35 cycles of 94
˚C for 30sec, 56 ˚C (cO30-40) or 60 ˚C (cO31-42) for 30sec, and 72 ˚C for 1min,
followed by extension at 72 ˚C for 10min. PCR products were visualised after
electrophoresis on a 1% agarose gel stained with ethidium bromide. Fragments were
excised from the gel and eluted using a gel extraction kit (Qiagen) using the
manufacturer’s protocol. The product was cloned into a pGEM-T vector, according to
the manufacturer’s protocol (Promega).
Colonies containing an inserted intron sequence were picked, mixed in 50 µl ddH2O
and then heated to 95 ˚C for 3 minutes. This was then used as the template for PCR
using the universal M13 primers. The reaction mixture contained 0.5 µM M13 forward
primer, 0.5 µM M13 reverse primer, 0.125mM dNTP, 1x reaction buffer, 1mM MgCl2,
and 0.05 µl Taq, with a thermal profile of 95 ˚C for 3min, 30 cycles of 95 ˚C, 55 ˚C, 72
˚C each for 1min, followed by 2min extension at 72 ˚C. The product was cleaned using
ExoSAP-IT (USB Corporation), and sequenced using the BigDye Terminator cycle
sequencing kit (Applied Biosystems). Following cycle sequencing, excess dye
terminators were removed by ethanol/EDTA/sodium acetate precipitation, and sequence
analysis performed on an ABI 3730 automated sequencer (Applied Biosystems).
2.3.3 Amplification and sequencing of exon 2
Six intron 1 sequences (five Seychelles warbler, one great reed warbler) and eight intron
2 sequences (six Seychelles warbler, two great reed warbler) were aligned and used to
design primers to amplify exon 2. Due to time constraints, intron 1 sequences were
obtained from fewer individuals than intron 2. Primers were designed in conserved
regions of the flanking introns; one in intron 1 (cO33) and one in intron 2 (cO43: see
table 2.1, figure 2.1). PCRs were performed on genomic DNA extracted from two
Seychelles warblers and two great reed warblers. PCR conditions were as above except
- 28 -
1.5mM MgCl2 was used, with an annealing temperature of 62˚C. Products were cloned
using either TOPO ZeroBlunt cloning kit (Invitrogen) or pGEM-T easy system
(Promega) following the manufacturers protocol, and sequenced using the method
above. The identity of the amplified sequences was then confirmed as being the exon 2
of the MHC class II by comparison of the cloned sequences with other passerine exon 2
sequences available on Genbank. Intensive cloning was then undertaken to identify all
exon 2 alleles present in three unrelated adult Seychelles warbler individuals, sampled
from the Cousin Island population, using the cO33 and cO43 primers. The PCR
conditions and the cloning and sequencing were performed as described above.
Figure. 2.1 Schematic diagram of the organisation of MHC class II gene, with location of primers
- 29 -
Primer
5’ to 3’ sequence
cO30
TGCGGGCGCGGAGCTCTC
cO31
TGAGGTTCGACAGCGAGTG
cO33
CACCNCCTGACCTGTGTCC
cO33B
GGGCACCNCCTGACCTGTGTCC
cO40
CCCACGTCGCTGTCGAAC
cO42
CCGGCCTGGGAGCTCGAG
cO43
CGAGGGGACAYGCTCTGCC
AsRv1
GCGCTGCACGSTGAAMGGGRCA
AsRv4
TGCCCCGTTCAGCGTGCA
AsFw2
CACGGAGAAGGTGAGGTAC
cO33B-G
GGGCACCGCCTGACCTGTGTCC
cO33B-T
GGGCACCTCCTGACCTGTGTCC
AsRv1-A
GCGCTGCACGGTGAAAGGGGCA
AsRv1-C
GCGCTGCACGGTGAACGGGGCA
Table 2.1. Primer sequences used in MHC class II analysis. Degenerate bases are
shown according to IUPAC codes, Y= C/T, M=A/C, S=G/C, R= A/G, N=any base
2.3.4 Confirmation based screening of exon 2 variation in individuals
New primers were designed to reduce degeneracy, which can cause problems with
conformational screening techniques, and also to attempt to prevent amplifying
pseudogenes. Using the sequence data obtained from cloning, a range of different
primers were designed that would amplify exon 2 (AsFw2, AsRv1, AsRv1-A, AsRv1C, and AsRv4; figure 2.1; table 2.1). These primers were located so that all, or a large
fragment, of exon 2 would be amplified and so that no variable sites would be lost. The
primers AsRv1 and cO33B were chosen to test for use in screening of individuals as
they amplified the whole of the region and consistently gave a clear, strong product. The
exon primer AsRv1 rather than the intron primer cO43 was used, as AsRv1 was
designed based on a larger number of independent sequences. Amplicons were
generated from six unrelated individuals (determined by genotyping) from the Cousin
Island Seychelles warbler population. The product size was 296bp. The reaction mixture
contained 12.5 µl of Extensor Hi-Fidelity PCR Master Mix (Abgene) in a 25µl reaction,
containing 0.35 mM each of dNTPs, 2.25 mM MgCl2, and 1.25 U of DNA polymerase.
- 30 -
To this mix 0.2 µM of each forward and reverse primer was added. The thermal profile
was as follows; 95 ˚C for 3min, 30 cycles of 95 ˚C , 75 ˚C , 72 ˚C each for 1min,
followed by 2min extension at 72 ˚C.
2.3.5 Reference strand mediated conformation analysis (RSCA)
RSCA is a method by which polymorphisms can be detected using DNA conformation.
It is influenced less by temperature or gel properties than other conformational
techniques such as denaturing gradient gel electrophoresis (DGGE), and has been
shown to be effective in resolving alleles that differ in only one nucleotide (Arguello et
al., 2002). RSCA relies on hybridisation of PCR products with fluorescently labelled
reference strands (FLRs). These FLRs are similar enough to the target sequences to
hybridise and form heteroduplexes, but mismatches cause loops and bulges to be
formed.
These
mismatches
affect
mobility
through
a
polyacrylamide
gel.
Heteroduplexes of different alleles and the FLR have different mobility, allowing allelic
variants to be identified using an automated DNA sequencer which detects the
fluorescent label.
Exon 2 sequences, obtained from three great reed warblers by cloning and
sequencing (see above) were used as templates to generate FLRs for use in the RSCA.
However it was important to ensure that FLR’s were made up of just a single identical
sequence. Degenerate primers, which would lead to small differences in the sequence of
amplified fragments, had to be avoided. Consequently, primers cO33B and AsRv1 were
revised to remove the degenerate sites and replaced with a single relevant nucleotide,
depending on the great reed warbler sequence to be amplified (table 2.2). The different
combinations of these primers required for each great reed warbler sequence used as an
FLR, are shown in table 3. 2. The new primers were as follows; cO33B-G, cO33B-T,
AsRv1C, AsRv1A (table 2.1). The primers cO33B-G and cO33B-T were labelled using
FAM at 5’ end. Four sequences were selected as potential FLRs; GRW248-7,
GRW309-5, GRW246-2, GRW248-5.
- 31 -
Forward primer Reverse primer
FLR
GRW248-7 cO33B-G
AsRv1C
GRW309-5 cO33B-G
AsRv1C
GRW248-2 cO33B-T
AsRv1A
GRW248-5 cO33B-G
AsRv1A
Table 2.2. Forward and reverse primer combinations used for each FLR
Minipreps of GRW248-7, GRW309-5, GRW246-2, and GRW248-5 were diluted
3000x before PCR. A six-fold excess of FAM labelled forward primer was used in the
reaction mix, to ensure more fluorescently labelled single strands would be generated
than non-labelled complementary strands. The PCR mix contained 25µl of Extensor HiFidelity PCR Master Mix (Abgene) which contained 0.7 mM of each dNTP, 1 µM of
Fam labelled forward primer, and 0.15 µM of reverse primer, 4.5 mM MgCl2, and 2.5 U
DNA polymerase, in a 50 µl reaction. The thermal cycle was 94 ˚C 2 min, followed by
30 cycles of 94 ˚C for 30 sec, 62 ˚C for 30 sec, and 72 ˚C for 1 min, followed by
extension at 72 ˚C for 10min.
2.3.6 RSCA runs
The RSCA protocol was first run using cloned alleles isolated from the Seychelles
warbler, in conjunction with each of the four FLRs. This allowed the identification of
individual allele peaks, so that the peaks observed in the RSCA profiles generated for
individuals could be assigned to specific alleles. The samples were hybridised with an
FLR that had been diluted with ddH20. Two different dilutions of FLR were tested; 1 µl
FLR to 5 µl ddH20, and 1 µl FLR to 10 µl ddH20. The 1:10 dilution gave the clearest
trace and was used for all further tests. Four different ratios of FLR to sample were also
tested; 1:2, 2:2, 1:3, and 2:3. All except the 2:3 ratio gave a peak profile. The 2:2 ratio
gave the clearest peaks and so was used for all further tests; 2 µl of sample being added
to 2 µl FLR. The thermal cycle was 95 ˚C for 10 min, ramp 1˚C/sec to 55 ˚C, 55 ˚C for
10 min, then 4 ˚C for 5 min. The hybridisation mix was diluted with 3 µl ddH20, and 2
µl placed into wells of a 384 well plate. 0.3 µl Rox-500 standards (ABI) and 7.7 µl
- 32 -
ddH20 were added to each well. The samples were run on an ABI 3100 DNA Analyser
(Applied Biosystems, Warrington, UK) using 50 cm capillaries and 4% Genescan nondenaturing polymer (ABI). Conditions were as follows; injection voltage 15 kV,
injection time 15 sec, run voltage 15 kV, and run temperature 30 ˚C. Each of the four
FLRS was used in separate tests. After running allele clones, samples from 6-24
Seychelles warbler individuals were run using the same conditions
2.3.7 Single Stranded Conformation Polymorphism (SSCP)
In SSCP analysis the sample is amplified by PCR and denatured into single strands
which fold on themselves, forming secondary structures unique to their nucleotide
sequence. This secondary structure affects their mobility when electrophoresed through
a non-denaturing gel (Orita et al., 1989). This technique was used to screen Seychelles
warbler MHC class II exon 2. To rule out that a given primer set may preferentially
amplify a certain restricted subset of alleles, several different primer sets were used
(table 2.3). At least one of the primers in each set was labelled with Fam or Hex at the
5’ end. The thermal cycle was 94 ˚C 2 min, followed by 28 cycles of 94 ˚C for 30 sec,
30 sec of the appropriate annealing temperature (shown in table 2.3) and 72 ˚C for 1
min, followed by extension at 72 for 10 min. More samples were tested using primer
sets 3 and 5 than the other primer sets. This is because set 3 gave the clearest peak trace,
and the primers in set 5 were in the most conserved area of the sequence and therefore
expected to amplify the majority of alleles. The amplicon was diluted 1:20 with ddH20,
and 1 µl of this was added to 9 µl HiDi Formamide (Applied Biosystems), and 0.2 µl
Rox-500 size standard. The samples were then denatured at 95˚C for five minutes, then
snap cooled on ice. The samples were run at a temperature of 18 ˚C, and tested with
injection times of 10 seconds and 30 seconds. Both gave clear traces, so the injection
time was kept at 10sec for the remainder of the runs.
- 33 -
Primer sets used in SSCP
Annealing
temperature ˚C
1. 5’ Hex AsFw2 and 5’ Fam AsRv4
64
2. Nested PCR
External primers;
cO33 and cO43,
62
Internal primers;
5’Hex AsFw2 and 5’ Fam AsRv4
64
3. cO33 and 5’ Fam AsRv4
63
4. 5’ Hex AsFw2 and cO43
63
5. 5’Fam cO33 and cO43
62
Table 2.3. Annealing temperatures for each primer set used in SSCP analysis
2.3.8 Analyses
According to neutral theory, at any given loci the number of synonymous nucleotide
substitutions (dS) per synonynous site is expected to be greater than the number of non
synonymous substitutions (dN) at non-synonymous sites as these are likely to be
deleterious and will be removed by purifying selection (Hughes and Nei, 1988).
Advantageous changes will be retained by positive selection, in which case dN will be
greater than dS. The PBR is the region of the MHC most likely to be under positive
selection; as such we expect there to be a higher dN than dS in this region. The non-PBR
region codes for the more conserved aspects of the MHC molecule not involved in
peptide binding, and therefore we expect a greater dN/dS ratio in the PBR compared to
the non-PBR (Hughes and Nei, 1988, Bernatchez and Landry, 2003).
Cloned sequences were aligned using MEGA v4 and dN/dS ratios and phylogenetic
trees were calculated using MEGA 4.0. Values of dN and dS were calculated using the
Nei and Gojobori method (Nei and Gojobori, 1986). RSCA and SSCP traces were
analysed using GeneMarker v1.5 (SoftGenetics). Cloning and sequencing of MHC loci
is notoriously difficult due to its tendency for recombination and other artefacts during
PCR and cloning (Longeri and Zanotti, 2002). To ensure only real alleles were
identified, their identification was defined using the criteria outlined in Kennedy et al
(2002); there must be three identical clones, identified from two separate PCRs from the
same individual, or from PCRs from at least two individuals.
- 34 -
MHC class II exon 2 sequences from various passerine species were obtained from
Genbank. As the studies all utilised different primers, all sequences were cut to a 135bp
fragment that was present in all sequences and aligned with the Seychelles warbler
alleles, to look for evidence of trans-species allelism in the Seychelles warbler MHC
class II exon 2 sequences.
2.4 Results
2.4.1 MHC class II sequences
A total of 280 clones were derived from the three Seychelles warbler individuals. Of
these, 145 were confirmed as real MHC class II exon 2 sequences, while the remaining
clones were considered either recombinants or artefacts. A total of twelve exon 2 alleles
were identified. Of these Ase-DAB*2 contained a stop codon, and Ase-DAB*3 had a
two base pair deletion, indicating these are probably non-functional sequences. All other
alleles had the correct reading frame, and no stop codons, and are believed to be
functional. The alleles (excluding pseudogenes) found in each individual can be seen in
table 2.4, which reveals that many of the alleles detected were the same in each
individual.
Figure 2.4 shows the total number of new alleles found as a greater number of
cloned sequences were analysed. New alleles were being detected in individuals even
after 40 clones were examined. It is likely that in individual A, in which the fewest
clones (33) were screened, more alleles may be found with greater screening. However,
high numbers of cloning recombinations or artefacts, cost, and time available made
further cloning unfeasible.
- 35 -
- 36 -
Figure 2.2 Twelve different MHC class II exon 2 sequences found in the Seychelles warbler. Gaps are indicated with - , and missing information with ~.
Ase-DAB*7
100
Ase-DAB*8
Ase-DAB*6
Ase-DAB*5
54
Ase-DAB*10
Ase-DAB*4
Ase-DAB*9
100
Ase-DAB*11
Ase-DAB*2
58
Ase-DAB*12
Ase-DAB*3
Ase-DAB*1
G. gallus White Leghorn
0.05
Figure 2.3 Phylogenetic tree comparing MHC class II exon 2 sequences from the Seychelles warbler. A
chicken Gallus gallus sequence was used as an outgroup. The evolutionary distances were estimated
using the Kimura-2 parameter method. The tree was constructed using the Neighbour-Joining method.
Probabilities of the branches are bootstrap values; only bootstrap values >50 are shown (500 replications).
The scale bar shows genetic distance as nucleotide substitutions per site
Individual
Allele
Ase-DAB*1
Ase-DAB*2
Ase-DAB*3
Ase-DAB*4
Ase-DAB*5
Ase-DAB*6
Ase-DAB*7
Ase-DAB*8
Ase-DAB*9
Ase-DAB*10
Ase-DAB*11
Ase-DAB*12
Total sequences
examined
A
B
C
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
X
33
70
42
Table 2.4 MHC class II sequences found in three individual Seychelles warblers. X represents where an
allele was found.
- 37 -
Figure 2.4. Total number of new alleles found in relation to the number of clones screened in three
Seychelles warbler individuals. The y axis shows total number of alleles, not the specific allele found.
2.4.2 Synonymous vs. non synonymous substitutions
The dN/dS ratio observed across Seychelles warbler alleles was compared with that
found in MHC class II cDNA sequences in the great reed warbler from Westerdahl et al
(2000). Codons representing the PBR were identified by aligning with those in the
great reed warbler, which in turn had been superimposed from human HLA sequences
(Brown et al., 1993). In Westerdahl et al (2000), one sequence was omitted from
analysis due to missing 14 codons at the beginning of the sequence. Here it has been
included, and all Seychelles and great reed warbler sequences cut to the same length,
giving a 218bp fragment for analysis. Sequences considered to be non-functional were
left out of the analysis. The results can be seen in table 2.5. There is a higher ratio of
dN/dS in the MHC class II exon 2 PBR than non-PBR in the Seychelles warbler. The
dN/dS ratio in the PBR is also >1, indicating balancing selection, although this difference
was not significant. However, the difficulties comparing dN/dS across loci mean it is
uncommon to find these differences statistically significant (see discussion for more on
this point). The dN/dS is similar to that found in the great reed warbler.
- 38 -
Species
Overall
N
PBR
Non-PBR
dN
dS
dN/dS
dN
dS
dN/dS
dN
dS
dN/dS
Seychelles
warbler
11
0.21
±0.03
0.22
±0.03
0.95
T=0.33
0.33
±0.05
0.29
±0.05
1.14
T=0.71
0.16
±0.03
0.19
±0.03
0.84
T=0.75
Great Reed
warbler
6
0.16
±0.02
0.09
±0.02
1.78*
T=2.3
0.30
±0.06
0.15
±0.05
2.00*
T=2.14
0.11
±0.02
0.07
±0.02
1.57
T=1.0
Table 2.5. Synonymous (dS) and non-synonymous (dN) substitution rates in the protein binding region (PBR) and
non-PBR in the Seychelles and great reed warbler. Difference between dN/dS was tested using a one sample t-test
with infinite degrees of freedom (Nei and Kumar 2000) * indicates P <0.05
2.4.3 Allelic divergence
The average amino acid variation per site, measured as p-distance, is significantly
higher in the PBR than non-PBR in the Seychelles warbler. It is similar to that seen in
the great reed warbler (see table 2.6), indicating that there is an equally high level of
divergence between MHC class II alleles between the species.
Species
N
Number of
nucleotide
differences
Number of AA
differences
PBR, AA
p-distance
Non PBR, AA
p-distance
t-test, PBR
vs Non
PBR
Seychelles
warbler
12
46.53 ± 3.64
24.30 ±2.92
0.51 ±0.07
0.25 ±0.04
P<0.05
Great reed
warbler
7
37.05 ± 3.36
23.11 ± 2.79
0.52 ± 0.07
0.20 ± 0.04
P<0.05
Table 2.6. Number of nucleotide differences, number of amino acid (AA) differences, and AA p-distance
in the PBR for both Seychelles and great reed warblers.
- 39 -
2.4.4 Tran-species persistence of alleles
MHC class II exon 2 sequences from various passerine species (house sparrow Passer
domesticus , Chatham Island black robin Petroica traverse, South Island robin Petroica
australis australis, little greenbul Andropadus virens, savannah sparrow Passerculus
sandwichensis, and four species of
Hawaiian honeycreepers, Hemignathus virens,
Vestiaria coccinea, Himatione saguinea, and Loxiodes bailleui) were obtained from
Genbank. As the studies all utilised different primers, all sequences were cut to a 135bp
fragment that was present in all sequences and aligned with the Seychelles warbler
alleles (see figure 3.5). Seychelles warbler, great reed warbler and little greenbul
sequences were interspersed, while all other sequences grouped according to species.
The three species are all members of the family Sylviidae, whereas other sequences
come from a variety of different families.
- 40 -
Figure.2.5 Phylogenetic tree comparing Seychelles warbler (Ase-DAB) MHC class II exon 2 alleles to
those observed in other passerine species. Sequences were obtained from Genbank for little greenbul,
(Andropadus virens Aguilar et al., 2006), house sparrow, (Passer domesticus, Bonneaud et al., 2004),
savannah sparrow, (Passerculus sandwichensis, Freeman-Gallant et al., 2002), Hawaiian honeycreepers
(Jarvi et al., 2004), and New Zealand robins (Chatham Island black robin Petroica traverse, South Island
robin Petroica australis australis, Miller and Lambert, 2004b). A chicken B-LB sequence (Gallus gallus
X07447, Bourlet et al., 1988) was used as an outgroup. The evolutionary distance was computed with the
Kimura 2-parameter model, and the tree constructed using the neighbour joining method. The probability
of the branches are bootstrap values for 1000 replications (bootstrap values >50 are shown in the tree, the
scale bar indicates genetic distance in units of nucleotide substitutions per site). Genbank accession
numbers or allele name is shown where the alleles do not group together in a single clade.
- 41 -
2.4.5 RSCA and SSCP screening
The individual alleles amplified from clones were run using the RSCA method.
Alleles Ase-DAB*5, Ase-DAB*7, Ase-DAB*8, Ase-DAB*9 and Ase-DAB*10 all gave
a single clear peak (alongside the FLR homoduplex), with mobilities between 472- 524
when run alongside a Rox 500 size standard. Six independent, unrelated (determined by
genotyping) Seychelles warblers, chosen at random, were then run using primers cO33B
and AsRv1. Each FLR gave a different pattern of peaks. However, within each FLR, the
pattern of peaks was the same across all the individuals tested (see figure 2.6). While
the peaks were in the same region of the trace as for the individual sequences, it was not
possible to assign alleles, as there were more peaks than those identified by the 5 allele
clones, and the peaks were often at low intensity.
Between 6 and 24 individuals spread over each primer set were run using SSCP.
Each primer set gave a different peak profile, with multiple peaks. However, in all cases
the traces were identical between individuals (and within primer sets). More samples
(see sample sizes in table 2.7) were tested using primer sets 3 and 5 than the other
primer sets. This is because set 3 gave the clearest peak trace, and set 5 was the primer
set in the most conserved area, so expected to amplify the majority of alleles.
- 42 -
Number of
Number of peaks
individuals
tested
FAM
HEX
label
label
RSCA
FLR - GRW248-7
6
12
-
-GRW309-5
6
10 *
-
-GRW246-2
6
12*
-
-GRW248-5
6
13*
-
Primer set- 1
6
6
5
2
8
3
3
3
24
11
-
4
8
-
7
5
18
12
-
SSCP
Table 2.7 Results of RSCA and SSCP screening. For the RSCA four different FLRs were used, and for
the SSCP four different primer sets were used. In all cases the traces were identical across the tested
individuals within a treatment.
* These traces showed many very low intensity peaks, making peak identification difficult.
- 43 -
Figure.2.6 RSCA trace showing individuals A, B and C run with the FLR GRW248-5. The homoduplex
is where the FLR hybridised with itself.
Individual A
Individual B
Individual C
Figure 2.7. SSCP trace showing 3 individuals A, B and C, alongside a Liz 500 size marker
- 44 -
2.5 Discussion
A total of twelve different MHC class II sequences (here termed alleles) were detected
in the Seychelles warbler; two of these were judged to be non functional. Alignment to
expressed exon 2 sequences obtained from a number of other bird species (Edwards et
al., 1995a) confirmed that MHC class II exon 2 sequences were amplified. Analysis of
the sequences dN/dS ratio, and amino acid p-distance, provided evidence that balancing
selection has occurred at the MHC class II in the Seychelles warbler. Comparison with
other published passerine sequences showed evidence of trans-species persistence of
alleles within the Sylviidae family in which the Seychelles warbler belongs, but that
trans-species persistence does not occur above the family level across passerines. Both
the cloning of unrelated Seychelles warblers and the screening of larger samples of
individuals using SSCP and RSCA techniques showed that there was little or no
difference in MHC class II alleles found between individuals within the Cousin Island
population of this species.
The higher ratio of non synonymous to synonymous substitutions per nonsynonymous and synonynous site in the PBR in comparison to the non-PBR region, and
the high allelic divergence at the PBR, suggest that the MHC class II genes have been
under balancing selection. However, the difference in dN/dS between the PBR and nonPBR was not as great as that seen in the widespread great reed warbler, for which
evidence for balancing selection at the MHC has already been shown (Westerdahl et al.,
2000). These findings could indicate less selection has occurred at the MHC class II in
the Seychelles warbler than in the great reed warbler. However, care must be taken
when comparing dN/dS ratios across loci, as the number of synonymous changes are
expected to be higher than comparisons within a locus, which can lead to
underestimates of dN/dS (Hughes and Nei, 1989, Westerdahl et al., 1999). Therefore
selection at the MHC class II in the Seychelles warbler may be greater than predicted by
these dN/dS ratios. Alternatively this could be due to a stochastic loss of alleles/ variation
during the last bottleneck
Phylogenetic analysis of Seychelles warbler and great reed warbler sequences show
that they are found mixed within clades. This could indicate these sequences pre-date
the split between the great reed warbler and Seychelles warbler or its ancestors.
- 45 -
Alignment with other passerine birds provided evidence for incomplete lineage sorting
(where the phylogenetic relationships between MHC alleles do not coincide with
taxonomic relationship between species) and suggests that trans-species persistence of
alleles has occurred across these species. Trans-species evolution of MHC alleles is the
long term persistence of MHC alleles beyond speciation events (Klein, 1987, Figueroa
et al., 1988) and is often cited as an indication that balancing selection has occurred in
the evolutionary history of a species. Trans-species evolution has been supported by
many studies in a wide range of taxa (review in Hedrick, 2001, and Piertney and Oliver,
2006). For example, Garrigan and Hedrick (2001) found alleles in Chinook salmon that
predated speciation, around 8mya, while Cuteran and Lacey (2007) found species of
tuco-tucos shared identical MHC alleles. Similar support for the prolonged maintenance
of alleles has also been found for the MHC class I of the Seychelles warbler
(Richardson and Westerdahl, 2003). These previous results, alongside the results from
this study, indicate that long term balancing selection has played a role in both classes
of MHC within the Seychelles warbler.
Interestingly, the phylogeny based on the class II MHC sequences derived from a
number of passerines showed that the MHC allele lineages of the Seychelles warbler
and great reed warbler species were interspersed with those from the little greenbul, but
not with those from other passerine species (figure 2.5). The sequences from these three
species, all members of the family Sylviidae, clustered independently from the
sequences from other passerine species. There is evidence of trans-species persistence
of MHC class II alleles amongst more distantly related passerines, for example in
Savannah sparrows and red winged blackbirds which belong to different families
(Freeman-Gallant et al., 2002). There are also a number of studies that show evidence
of trans-species allelism in mammals over long time periods. A study of an MHC class
II allele in humans, chimpanzees (Pan troglodytes) and rhesus macaques (Macaca
mulatta) suggest persistence for over 30 million years (Geluk et al., 1993), and there is
even support for persistence of MHC class II alleles since the divergence of marsupial
and placental mammals (Slade et al., 1994), over 100 million years (Novacek, 1992,
Edwards et al., 1995b). Clearly, the evidence of limited trans-species polymorphism in
the sequences analysed here suggest persistence may be much lower than this in
passerines. There is evidence that the evolution of the MHC differs between mammals
and birds. Gene conversion and concerted evolution appear to be more important in
- 46 -
avian MHC evolution (Hess and Edwards, 2002). Edwards et al (1995b) found that,
unlike mammals, there was a lack of orthology of MHC class II genes between different
songbird species. This indicates there could be a different evolutionary history for
different regions of the MHC class II in songbirds. Edwards et al (1995b) suggest that
the evolution of songbird MHC is shaped by concerted evolution, or descent from more
recent ancestral MHC genes. This may explain why the present study found evidence of
trans-species polymorphism amongst closely related species but not among more
distantly related passerines. In support of this no evidence of orthology was found
between MHC class II genes between the Chatham island black robin, South Island
robin, great reed warbler and Bengalese finch (Lonchura striata domestica, Miller and
Lambert, 2004a). Furthermore, Edwards et al (1995b) showed that while exon 2
sequences often did not cluster by species, the non-polymorphic exon 3 did. In the
present study, sequences from the Seychelles warbler and other passerines were aligned
using only a section of exon 2. This may, therefore, give an incomplete picture of the
extent of trans-species persistence of alleles. Another factor that may confuse these
results is the frequent recombination and gene conversion that occurs in the MHC
(Longeri and Zanotti, 2002). These attributes may cause problems interpreting
phylogenies of MHC alleles as it could cause alleles to appear older than they are
(Martinsohn et al., 1999). The results from this study appear to agree with that of
Edwards et al (1995b); a more extensive analysis over a greater number of species of
both passerine and other bird groups would allow us to fully characterise the nature of
evolution of MHC alleles within passerines.
Of the three individuals that were cloned, two had 90% and one had 70% of all
alleles found, excluding those thought to be pseudogenes. The individual with the least
number of alleles also had the least number of sequences examined. It appears likely
that with further cloning all alleles would be found in each of the individuals, as with
each round of cloning, more alleles were found within each of the three individuals,
even after 40 clones had been screened. However, the difficulties in cloning across
multiple loci mean this process is disproportionately expensive and time consuming.
MHC alleles often show high homology with each other, which makes new variants
difficult to identify. Cloning difficulties makes determining new alleles (rather than
artefacts) difficult as each new variant has to be found at least twice (in separate PCRs),
and the high number of clones required to do this in a species which has at least 12
- 47 -
alleles makes this extremely difficult. Recombination during PCR and cloning has been
a problem that is common to many MHC studies. Jarvi et al (2004) used a PCR+1
protocol (Borriello and Krauter, 1990, L'Abbe et al., 1992) when investigating MHC of
Hawaiian honeycreepers, to avoid the problems of recombination during PCR and
cloning of MHC alleles. PCR+1 uses an asymmetric PCR with an excess of one primer
for a number of cycles. A third primer is added with a new restriction site at the 5’ end
for one cycle. This final cycle ensures only homoduplexes carry the new restriction site.
This serves as a marker by which clones can be screened for heteroduplex artefacts.
Retrospectively, the use of a PCR+1 protocol in this study may have decreased the
number of recombinant clones screened and reduced the number of clones that needed
to be screened to find the twelve alleles identified.
The RSCA runs suggested that all the individuals tested had identical (or very
similar) MHC class II profiles; while each of the four FLRs had its own peak profile,
within FLRs all individual traces were the same. Tests on individual cloned alleles
showed that the RSCA method worked and that clear peaks could be observed for the
majority of alleles, though a couple of FLR allele combinations showed no peaks
(which is expected when using RSCA). The RSCA technique has already been used to
screen for MHC class I variation in the Seychelles warbler (unpublished data), and also
MHC in the jungle fowl (Worley et al., 2008). Both were successful in identifying
differences in alleles between individuals. The SSCP screening, which used five
different combinations of primer sets, showed similar results; each primer set showed a
different peak profile but within primer sets all individuals had identical traces. This
held true even for primer sets 3 and 5 where 24 and 18 individuals were tested
respectively, all of which gave identical traces. Overall, the high similarity observed
between the three individuals for which cloning was undertaken, and the results from
RSCA and SSCP screening all appear to indicate that there is a high number of class II
loci in the Seychelles warbler, but that levels of variation at these loci between
individuals was very low or non existent.
One possibility is that MHC-like genes were identified that are non variable. In the
chicken, pheasant (Phasianus colchicus), and black grouse (Tetrao tetrix) the Rfp-Y
group consists of MHC-like genes which assort independently of the B complex (which
contains MHC class I and II gene(s), Miller et al., 1994, Wittzell et al., 1995, Strand et
- 48 -
al., 2007) There is some evidence that Rfp-Y genes are less polymorphic than those of
the B system (Zoorob et al., 1993, Pharr et al., 1996). As yet the Rfy-P system is
thought to be unique to fowl, no evidence has been found for its existence in other bird
groups, including passerines (e.g, Westerdahl et al., 2000). Furthermore, alignment of
Seychelles warbler sequences found to other published passerine exon 2 sequences
show high similarity. Therefore these sequences can be confirmed as MHC class II exon
2 sequences, and not part of a related non-variable region.
The Seychelles warbler population went through a bottleneck during the middle of
the last century, and microsatellite analysis has shown that the population has very low
levels of neutral variation (Richardson et al., 2000). Such a bottleneck could also have
caused MHC class II variation to be lost, especially if no balancing selection was
simultaneously acting to maintain variation. Other studies have detected low MHC
variability and suggested this to be the result of population bottlenecks; for example in
the Eurasian beaver, Castor fiber (Babik et al., 2005), the Chatham Island black robin,
(Miller and Lambert, 2004b), cheetah, Acinonyx jubatus (Drake et al., 2004).,
Galapagos penguin Spheniscus mendiculus (Bollmer et al., 2007), Spanish ibex Capra
pyrenaica (Amillis et al., 2004) and crested ibis Nipponia nippon (Zhang et al., 2006).
However, other bottlenecked species have shown that MHC variation can be maintained
despite low neutral diversity. The San Nicolas Island fox is the most genetically
monomorphic sexually reproducing animal population reported, however it has retained
substantial variation at the MHC class II (Aguilar et al., 2004). Similar maintenance of
MHC polymorphism is seen in Hawaiian honeycreepers which show low diversity at
neutral markers (Jarvi et al., 2004). Within the Seychelles warbler, substantial diversity
has been maintained at the MHC class I despite the bottleneck (Richardson and
Westerdahl, 2003). In these examples, the MHC shows evidence of being maintained by
balancing selection.
However, despite low between-individual difference in MHC class II, the
Seychelles warbler has at least six loci; up to 12 if all individuals are fixed at these loci
as the data suggests. Even if there is no between individual variability, this may not
matter to the individual – each individual may be able to express multiple alleles and
therefore be able to combat a wide range of pathogens. This raises an interesting point
on how MHC diversity within populations is interpreted. While a population may
- 49 -
appear to have low diversity due to a lack of difference between individuals, effective
diversity may be maintained within the individual if many expressed loci are present.
Overall, evidence of balancing selection and persistence of alleles suggest that the
MHC class II in the Seychelles warbler has historically been under selection, however
in contrast to previous studies of MHC class I in this species, there is little or no
difference in MHC class II alleles found between individuals of the Seychelles warbler.
Despite this, the high number of loci found within individuals indicates that this
similarity may not have compromised the individual Seychelles warbler’s ability to
recognise a large number of pathogens, raising an interesting question with regards to
the interpretation of low MHC diversity in small populations.
- 50 -
Chapter 3
Assessment of gastrointestinal parasite diversity
in the Seychelles warbler
- 51 -
3.1 Abstract
It is generally accepted that gastrointestinal (GI) parasites are widespread, and can have
significant detrimental effects on hosts; therefore they have the potential to be potent
agents of selection. Island species often have lower parasite diversity than their
mainland counterparts, possibly as a result of escape from natural enemies. The enemy
release hypothesis states that when a species is introduced into a new area it is able to
escape its natural enemies, such as pathogens and disease. Here, a comprehensive
assessment of the type and prevalence of GI parasites found in the Seychelles warbler,
Acrocephalus sechellensis, an island endemic that has experienced a severe bottleneck,
was carried out to allow further investigation into the effects of GI parasites on fitness
in this species. A total of 166 faecal samples from 159 individuals were screened from
all four populations of Seychelles warbler on the islands of Cousin (n=46), Cousine
(n=63), Aride (n=20) and Denis (n=37). Faecal samples were checked for parasite
eggs/oocysts microscopically. Samples were obtained from both breeding and non
breeding seasons, across ages and sexes, and at different times of day, to control for
factors that may affect prevalence. When eggs/oocysts were found, they were identified
by PCR and sequencing. One parasite species found in 4 individuals was identified as a
coccidian of the genus Adelina, which is normally a parasite of invertebrates and
therefore is likely a pseudoparasite. No other eggs or oocysts were found, therefore the
Seychelles warbler appears to be free of GI parasites. This is in contrast to other avian
species found on the islands, the Seychelles fody (Foudia sechellarum), lesser noddy
(Anous tenuirostris) and Seychelles turtle dove (Streptopelia picturata), and
Madagascar fody (Foudia madagascarensis) which are host to GI parasites. The lack of
parasites in the Seychelles warbler may have been a result of enemy release. Movement
to new islands and small founding populations during the colonisation process may
have allowed the Seychelles warbler to escape their parasites, or the small population
size following the bottleneck may have been too small to sustain a parasite population.
It is difficult to pinpoint when this might have occurred, however the present day
population’s lack of GI parasites has important implications for the conservation of this
species.
- 52 -
3.2 Introduction
Almost all vertebrates are subject to parasitic infection, with many harbouring complex
parasitic fauna (Roberts and Janovy, 1996, Clayton and Moore, 1997). These parasites
can have detrimental effects on host fitness, e.g. affecting survival (Brown et al., 1995,
Coltman et al., 1999), reproductive success (Richner et al., 1993, Merino et al., 2000),
territorial behaviour (Fox and Hudson, 2001) and sexually selected traits (Hamilton and
Zuk, 1982, Horak et al., 2004). Consequently, parasites have been implicated as a major
selective force on host populations, important in the evolution and maintenance of
genetic diversity, secondary sexual traits (Hamilton and Zuk, 1982), and even sexual
reproduction (see Clayton and Moore, 1997, Milinski, 2003 for review).
It is generally accepted that most, if not all, wild vertebrate populations are host to
gastrointestinal (GI) parasites (Janovy, 1997). Therefore GI parasites have the potential
to have considerable and widespread effects on evolution in wild populations. Selection
within host-GI parasite systems is considered to generate notable effects on a number of
traits, such as the evolution of body size or mass (Clayton and Moore, 1997), sexually
selected characters (Hill et al., 2005a, Mougeot et al., 2005), behavioural defences
(Hart, 1997), and the major histocompatibility complex (MHC, Buitkamp et al., 1996,
Paterson et al., 1998, Harf and Sommer, 2005, Meyer-Lucht and Sommer, 2005).
Studies have also shown GI parasites can play an important role in population
demographics (Gulland, 1992, Hudson et al., 1992).
Previous studies have shown a tendency for a lower parasite diversity within island
species compared to mainland populations (Dobson, 1988, Dobson et al., 1992, Font
and Tate, 1994, Fromont et al., 2001). One theory for this is that host species escape
some natural predators, including parasites, known as the enemy release hypothesis
(ERH). The ERH suggests that as species colonise new areas, they leave their parasite
species behind. This can be due to a lack of intermediate host species, or the founding
population being too small to sustain a population of parasites, causing local extinction
of the parasite. Therefore, we expect island species to have escaped their parasites
during the colonisation process, and while they may gain new parasites in their new
range, they may always show lower parasite diversity than their more widespread
congeners.
- 53 -
Gastrointestinal parasites can have life cycles of varying complexity. Protozoan
parasites such Eimeria are ingested via the faeces of another infected host. These
parasites have a simple, direct life cycle. The parasite goes through asexual then sexual
reproductive phases which result in a spore phase, known as oocysts, being expelled
from the intestine (Roberts and Janovy, 1996). However other parasites such as some
helminths (worms) have more complex indirect life cycles that require intermediate
hosts before transmission to the definitive host. One such example is that of the poultry
nematode Capillaria caudinflata, transmission of which is entirely dependent on
earthworms as an intermediate host (Saif et al., 2003). Many surveys and studies of GI
parasite load and fitness use the morphology of the eggs or oocysts expelled in the
faeces to identify parasite infection and determine individual parasite load. This kind of
non invasive sampling, based on the microscopic examination of faeces from live
organisms is an established and useful technique for screening populations for GI
parasites. More invasive techniques, such as examination of the gut of dead hosts, may
allow better isolation and identification of helminth parasites such as nematodes;
however this is clearly not a reasonable option when dealing with endangered species. It
is also time consuming, and often doesn’t allow identification to species level for many
parasites. Recently, advances have been made in the molecular identification of
gastrointestinal parasites, using PCR techniques (McManus and Bowles, 1996, Hung et
al., 1999, Zhao et al., 2001, McGlade et al., 2003, Foldvari et al., 2005). This has
resulted in a number of cryptic species being identified (Jousson et al., 2000, Blouin,
2002, Criscione et al., 2005). Molecular identification based on DNA extracted from
eggs or oocysts isolated from faecal samples now provides a useful tool that allows both
the precise identification and quantification of GI parasite loads even in endangered
species. Furthermore, the ability to characterise species or strains of a parasite allows
for more precise investigations of, for example, the interactions between GI parasites
and fitness traits, sexual selection and the MHC.
The Seychelles warbler is small passerine endemic to the islands of the Seychelles
in the western Indian Ocean. The species has undergone a severe population bottleneck,
with the entire world population consisting of 25-29 individuals confined to Cousin
Island during the middle of the last century (Vesey-Fitzgerald, 1940, Crook, 1960,
Loustau-Lalanne, 1968). Subsequent conservation efforts have resulted in a substantial
population increase and, with the aid of translocations, populations now exist on four
- 54 -
islands (Komdeur, 1994a, Eikenaar et al., 2007). The Cousin Island population has been
monitored since 1985, with, since 1997, over 97% of individuals colour ringed. The
population is intensively monitored throughout the main breeding season (June to
September) so life history, breeding status, and reproductive success can be measured.
There is almost no migration between islands (Komdeur et al., 2004a), therefore birds
that are no longer observed in a population can be presumed dead. The collection of all
this information means that fitness and survival parameters can be estimated for nearly
all birds in the population. This and the existence of four replicated closed populations
now provides a unique opportunity to investigate the role of GI parasites in selection in
the Seychelles warbler. No studies have previously looked at GI parasites in the
Seychelles warbler, however the islands are home to other passerine and seabird
species, often at very high density, which may provide ample opportunity for parasite
transmission and host switching. Previous surveys of gastrointestinal parasites in
Acrocephalus species, such as the great reed warbler (Acrocephalus arundinaceus) have
shown these warblers to be host to a wide variety of parasites (Cork, 1999, Kruszewicz
and Dyrcz, 2000). A study of parasite communities over 26 taxa found an average 16
species in native host populations (Torchin et al., 2003). However we expect to find less
in an island endemic such as the Seychelles warbler.
In this study, I have used both traditional microscopy techniques and novel
molecular techniques to identify and quantify GI parasite load within and across the
Seychelles warbler populations. This comprehensive assessment of the type and
prevalence of GI parasites found in the Seychelles warbler, will allow further
investigation into the effects of these parasites on aspects of fitness, such as survival and
reproductive success.
3.3 Methods
3.3.1 Sample collection
Seychelles warblers were caught on the islands of Cousin, Cousine, Aride and Denis
between June-September 2005 and 2006, and November - December 2005. Cousin
Island (29ha) was the last known population of the Seychelles warbler during the
bottleneck, before translocations to other islands increased the population range. Cousin
has been at carrying capacity since 1982, with the population stable at ca. 340
- 55 -
individuals (Brouwer, 2007). Birds were translocated to Aride Island (68ha, 9km from
Cousin) in 1988, Cousine Island (26ha, 2.1 km) in 1990, and Denis Island (144ha,
35km) in 2004 (Komdeur, 1994a, Richardson et al., 2006). The population on Aride
was estimated at >1600 birds in 1997 (Betts, 1998) and Cousine was estimated at 200
birds in 2007 (D.Richardson pers. comm.). The population on Denis was estimated at 82
individuals in 2006 (Brouwer, 2007).
Birds were caught using mist nets. Unringed birds were ringed using a unique
combination of three UV resistant colour rings, and a metal British Trust for
Ornithology (BTO) ring for identification. A small (ca 25 µl) blood sample was taken
from each bird by brachial venipuncture and stored in 800 µl of 100% ethanol at room
temperature in a 2 ml microcentrifuge tube for later molecular genotyping and sexing.
Molecular sexing using a PCR technique (Griffiths et al., 1998) was used to verify the
sex of individuals. Age was determined either from resighting data from previous years,
or by eye colour: juveniles (< 8 months) have grey eyes, subadults (< 14months) have
light brown eyes while adults (15 months and older) have chestnut brown eyes
(Komdeur, 1991). Many birds were ringed as nestlings, so exact age is known for these
birds.
Faecal samples were collected if birds defecated voluntarily during handling,
otherwise each bird was kept in a small, ventilated box, lined with foil paper and
containing a perch, for 1-3 hours or overnight if caught after 5pm, until enough faecal
matter was collected for analysis. Samples were stored in 2 % potassium dichromate
and kept refrigerated at 4˚C. Catching was done at different times of the day over the
field period, so as to be able to detect any diurnal variation and to maximise the chances
of detecting parasites within the populations. GI parasite load may also vary according
to season (Altitzer et al., 2003), so samples were collected both in breeding (JuneSeptember) and non-breeding seasons to compare parasite load throughout the breeding
cycle. Faecal samples from nine individuals were collected twice, with samples taken
between two weeks and a year apart. Repeat samples from seven individuals were
obtained from Cousine (five months apart n = 1, seven months apart n = 4, ten months
apart n = 2), and two from Cousin (two weeks apart n = 1, one year apart n = 1).
- 56 -
3.3.2 Other Seychelles avifauna
Faecal samples were also taken from other bird species inhabiting the islands to
measure the type and levels of parasites in the coexisting avifauna. No samples were
collected from other bird species on Denis. Samples were collected from the Seychelles
fody (Foudia sechellarum), lesser noddy (Anous tenuirostris) and Seychelles turtle dove
(Streptopelia picturata) from Cousin Cousine and Aride; from the Madagascar fody
(Foudia madagascarensis) on Cousine and Aride (none on Cousin); and the barred
ground dove (Geopelia striata) from Cousin. These birds were chosen are they are
common on many of the islands and so represent key bird fauna in the community
(Skerrett and Bullock, 2001). Samples were collected where species were present;
however not all species were present on all islands.
For non-warbler species, samples from 3-5 individuals of the same species and same
island were pooled randomly (dependent on the number of samples available) to reduce
screening time. Although this will not provide exact prevalence data, it will give an idea
of minimum and maximum prevalence estimates in these species. A parasite detected as
being present in a pooled sample of five individuals can be interpreted as having a
minimum prevalence estimate of 20 % (only one of 5 infected) or a maximum of 100 %
(all individuals infected). Where groups of samples from the same species and island
consisted of an uneven number of samples (e.g. samples from nine individuals being
split into one group of 5 individuals, and one group of four individuals) an average of
estimates of minimum and maximum prevalence was used.
3.3.3 Analyses of faecal samples
Samples were analysed using a salt flotation technique (Thienpont et al., 1979). The
entire faecal sample was homogenised by vortexing, and half was taken for microscope
analysis. The other half was kept for later molecular analysis. The sample was
centrifuged for ten minutes at 1500 rpm, and the supernatant discarded. The sample was
weighed, and 5 ml of saturated NaCl and ZnCl2 solution added (320 g ZnCl2, 280 g in
800 ml distilled water) and gently mixed. Two McMaster slides were then filled with
solution, taking from under the meniscus, and examined at x100 magnification. The
number of parasite eggs, or coccidian oocysts, per gram was calculated as:
- 57 -
Eggs per gram (EPG) = Total eggs/oocysts in 2 McMaster slides x volume of salt solution
Volume of McMaster slide x mass
3.3.4 PCR identification
PCR identification of coccidia oocysts found in samples of Seychelles warbler or
Seychelles fodys was used to attempt to characterise the parasite to species level. Faecal
samples were centrifuged at 3000 rpm and the supernatant was removed. Ten ml of
ddH2O was added and the sample was centrifuged again at 3000 rpm. This step
removed the potassium dichromate in the sample. Five ml of a saturated ZnCl2 solution
was added to the pellet, and centrifuged at 1000 rpm for 5min. The top 1.5 ml of the
solution was then removed and placed in a clean centrifuge tube. This was diluted by 10
times with distilled water and centrifuged for a further 15 min at 3000 rpm. The
supernatant was removed and the pellet was re-suspended in 100 µl buffer and
transferred to a 1.5 ml eppendorf to which 3 or 4 glass beads were added. The samples
were shaken using an automated shaker at 3000 rpm for 8 minutes before adding 100 µl
of cetrimonium bromide (CTAB buffer) and 20 µl of proteinase k. This solution was
incubated at 65˚C for 1 hour. DNA was extracted from this using a standard
phenol:chloroform:isoamyl alcohol (25:24:1) extraction procedure. DNA was stored in
low Tris-EDTA buffer (TE) prior to further analysis (as in Zhao et al., 2001). A
polymerase chain reaction (PCR) was run using primers that amplified the ribosomal
small subunit (SSU) genes from the parasite egg or oocyst. Amplified fragments were
then sequenced using Big Dye terminator kit v3.1 (Applied Biosystems). The
sequencing reaction was as follows; 1 µl Big Dye, 1.5 µl sequencing buffer, 0.5 µl
WW2-F primer (10 µM), 5 µl H2O, and 2 µl template, thermal profile was 25 cycles of
96˚C for 10 sec, 50˚C for 5 sec, and 60˚C for 4 min. Sequences were analysed on
ABI3730 sequencer (Applied Biosystems).
3.4 Results
A total of 166 faecal samples were examined. No GI parasites of any type were found in
any of the Seychelles warbler samples from Cousin, Aride or Denis Islands, despite
being sampled at a range of times of day, month, sex and age (table 3.1, figures 3.1 and
3.2). On Cousine Island, a coccidian parasite of the genus Adelina, identified by both
morphology and molecular methods, was found in four individuals with an intensity of
- 58 -
770.08 (±375.19) eggs per gram (EPG). A BLAST search of two SSU sequences
obtained from coccidian from one Seychelles warbler showed Adelina bambarooniae
was the best match (Genbank accession no. AF494059, 97% match, P<0.01, figure 3.3
for sequence). However, a close match of the highly conserved middle region of the
sequence (approximately base pairs 330-620) was found with other sequences,
including Hepatazoon sp.(P<0.01, 99% match over conserved region, 52% match over
whole 820bp sequence) and Theileria annulata P<0.01, 99% match over conserved
region, 52% match over whole 820bp sequence) indicating this section may be a highly
conserved region in many protozoan parasites, which causes concerns as to the ability of
this region to distinguish between Adelina and other coccidian parasites. However,
Adelina was the closest match over the whole 820bp sequence fragment, and
morphological identification (I. Barr pers. comm..) indicates the parasite found in the
Seychelles warbler is most likely to be of the Adelina genus. An example of the Adelina
oocyst can be seen in Figure 3.4. Repeat samples from three of the four individuals in
which Adelina were observed were taken seven months later; no Adelina was found in
any of these repeat samples.
Island
Cousin Cousine Aride Denis
Total samples examined 46
63
20
37
Male
Female
30
16
41
22
14
6
20
17
Adults
Sub adult
Fledglings (< 8months)
31
4
11
49
9
5
16
0
4
11
18
8
Table 3.1. Number of faecal samples from Seychelles warblers screened for GI parasites,
showing island, age and sex of individuals.
- 59 -
Figure 3.1. Number of faecal samples obtained by hour of day. Where birds were kept in boxes to get a
larger sample, the time mid way through the boxed period was used.
Figure 3.2. Number of samples obtained during each month of the year. Breeding seasons are shown
above.
- 60 -
- 61 -
Figure 3.3 Two ribosomal small subunit (SSU) sequences obtained from coccidian found in one Seychelles warbler, aligned
with Adelina bambarooniae (Accession number AF494059)
Figure 3.4. Adelina sp. oocyst found in Seychelles warbler faecal sample
Table 3.2 shows gastrointestinal (GI) parasites found in other birds on the islands of
Cousin, Cousine and Aride.
- 62 -
Species
Island
Pooled
Group
N
Coccidia OPG
Cestode EPG
Cousin
1
5
53157.89
0
2
3
4
5
6
5
5
5
5
5
0
0
0
0
0
Cousine
1
2
3
4
5
5
5
3
Aride
1
5
10866.67
455.13
6805.28
7810.95
2417.51
=20-100%
611.62
18838.38
39266.05
11130.95
=23.3-100%
35.56
= 20-100%
Seychelles fody
(Foudia
sechellarum)
EPmin-max
EPmin-max
EPmin-max
Madagascar fody
(Foudia
madagascariensis)
Cousine
1
6
173.889
0
0
0
0
0
0
EPmin-max =16.7-100%
Lesser noddy
(Anous
tenuirostris)
Cousin
Cousine
1
5
30.86
61.73
2
5
48607.59
EPmin-max =20-100%
1
2
3
5
5
3
31.65
EPmin-max =41.5- 100%
0
0
0
1
4
EPmin-max
Aride
277.78
444.44
=24.4-100%
5782.31
0
EPmin-max = 25-100%
Turtle Dove
(Streptopelia
picturata)
Barred ground
dove
(Geopelia striata)
Cousin
1
5
6.67
0
2
4
0
Aride
1
4
4325
EPmin-max =22.5-100%
0
0
Cousine
1
5
0
0
Cousin
1
5
0
0
2
3
0
0
Table 3.2 Gastrointestinal parasites found in other bird species on the islands of Cousin, Cousine and
Aride. EPG/OPG = eggs/ coccidian oocysts per gram of faeces. EPmin-max = minimum to maximum
estimated prevalence
- 63 -
The results show that all other species sampled on the islands inhabited by Seychelles
warblers have some type of GI parasites. All species tested except the barred ground
dove had coccidia; however this is likely due to low sample size in this species. The
lesser noddy on Cousin also had a cestode species. Molecular analysis of coccidia
oocysts found in the Seychelles fody indicated that they show 90% identity with a
species of atoxoplasma found in tree sparrows (Passer montanus) from the UK (I. Barr
pers comms). The Adelina sp. observed in the Seychelles warbler was also found in one
Seychelles fody on Cousine.
3.5 Discussion
Despite intensive sampling, no GI parasites were found in any of the Seychelles
warblers sampled from the Cousin, Aride and Denis Island populations. Natural
variations in parasite load were controlled for by testing at different times of day
(Wrosch, 1995, Brawner and Hill, 1999), across ages (Simberloff and Moore, 1997),
across the sexes (Poulin, 1996), and time of year (Altitzer et al., 2003).
The Adelina genus parasite found at one point in time in a very limited number of
Seychelles warblers on Cousine (n=4) is most probably a pseudoparasite; this genus
(identified here by molecular methods as being closely related to Adelina
bambarooniae) is described as being a parasite of invertebrates (Sokolova et al., 1999).
Its presence in vertebrates, including one bird species (sandhill crane Grus canadensis,
Parker and Duszynski, 1986) has been attributed to the sampled organism having an
insectivorous diet and those eggs present in the prey persisting in the avian gut until
detection during this study. Adelina spp are considered to be non-pathogenic in birds
(Parker and Duszynski, 1986, Duszynski et al., 2000, Teixeira et al., 2003). The present
study now shows that Adelina can also be observed as a pseudoparasite in insectivorous
passerine birds, and although few individuals on only one island were found to harbour
it, the same result was not repeated when individuals were tested again for a second
time. These results suggest that Adelina was present in these individuals merely as a
consequence of them ingesting infected insect prey. A garden area on Cousine contains
a variety of non-native plants, some of which could be host to insects not normally
found in other Seychelles warbler habitats. The method to confirm the hypothesis of
Adelina as a pseudoparasite would involve insect prey sampling and subsequent testing
- 64 -
for Adelina or other parasites, although this would be time consuming and unlikely to
yield a satisfactory result, and so this hypothesis represents out best interpretation of the
available data. Overall these results strongly suggest that all populations of the
Seychelles warbler are free of GI parasite infection.
There is a vast body of literature on birds as hosts of helminth and coccidian
parasites, and it has been suggested that all bird populations are host to GI parasites
(Clayton and Moore, 1997 and references within). However, there have been relatively
few comprehensive surveys of GI parasites in wild avian species (Svobodova, 1994,
Cork, 1999, Kruszewicz and Dyrcz, 2000, Masello et al., 2006) and even fewer in
passerine birds. Those studies where large numbers of birds were examined invariably
detected the presence of GI parasites. In the few cases where these parasites were not
detected e.g. Cork (1999), this can most likely be attributable to low host sample sizes.
Certainly, few studies have examined a large proportion of the world population of a
species, across age, sex, season, reproductive cycle, populations and time of day, as has
been done for the Seychelles warbler in this study. It is likely then that this study is the
first to convincingly show a complete absence of GI parasites within a wild bird species.
It is possible that a publication bias may exist within the field of GI parasite studies,
whereby studies that failed to find any parasites are not reported. A lot of effort is
required to verify null results and, perhaps too often, little merit is given to the
publication of such results. However, the general ubiquity of such parasites in wild
populations (Clayton and Moore, 1997) suggests that the absence of parasites in wild
bird populations is not normal. Instead it seems more likely that some factor(s) specific
to the Seychelles warbler has resulted in the absence of GI parasites in this species.
Studies have shown that Acrocephalus warblers in Europe are host to a wide range
of GI parasites; surveys of the closely related but more widespread great reed warbler
have found nematodes (including Ascaris sp, Capillaria sp, Ornithostrongylus sp, and
Porraceum sp) and coccidia (Isospora sp.), and a wide variety in most warbler species
tested (Svobodova, 1994, Cork, 1999, Kruszewicz and Dyrcz, 2000). Consequently,
there are no phylogenetic reasons as to why Seychelles warbler should lack such
parasites, and we would expect both nematodes and coccidia to be common in these
- 65 -
populations. The absence of GI parasites in the Seychelles warbler must, therefore, be
due to their specific evolutionary and demographic history.
Island species often have depauperate parasite communities (Dobson, 1988, Dobson
et al., 1992, Font and Tate, 1994, Fromont et al., 2001). For example, native freshwater
fish on the Hawaiian islands have a lower parasite species diversity than introduced
fish, probably due to colonising restraints (Font and Tate, 1994). Super and van Riper
(1995) found lower prevalence of haematozoan parasites in passerine species found on
an island off the coast of California in comparison to those of the mainland. It has been
suggested that it is the colonisation history of island species that is responsible for the
loss of parasites (Dobson, 1988 as cited in Dobson and May, 1986). This can be
explained in terms of the enemy release hypothesis (ERH), a theory that is also used to
explain how introduced species become invasive species (Keane and Crawley, 2002,
Clay, 2003, Mitchell and Power, 2003, Torchin et al., 2003). Colonisation of new
ranges is often initiated by only a few members of the original population, which may
not carry the full quota of ‘enemies’ (in this case GI parasites) found in the original
native population. Furthermore, small host population size during establishment in the
new range may prevent any accompanying parasite communities from surviving. Small
population sizes may not reach the population density threshold level needed to sustain
a parasite population, and the accompanying parasites may die off soon after host
colonisation. Another reason for the loss of parasites during colonisation events may be
that many parasites are heteroxenous, requiring more than one host to complete their life
cycle (Roberts and Janovy, 1996). One such example is malaria, which requires an
insect vector, such as the mosquito. If intermediate hosts or vectors are not present in
the new range, parasite reproduction and transmission will be prevented. A lack of
intermediate hosts has been suggested to have contributed to the loss of some parasite
species in European starlings, Sturnus vulgaris, introduced to North America (Torchin
et al., 2003).
The enemy release hypothesis has been supported by evidence from various studies
(Clay, 2003). The majority of the evidence comes from invasive plant species (see
Keane and Crawley, 2002, Liu and Stiling, 2006 for review). In a study of a wide
variety of hosts from a number of major groups (molluscs, crustaceans, fishes,
mammals, amphibians, birds, and reptiles), it was shown that introduced populations
- 66 -
were infected by half the number of parasite species as native populations, and
introduced species took, on average, only three parasite species with them during
colonisation (Torchin et al., 2003). Furthermore, an average of only four ‘native’
parasite species colonised the introduced hosts, indicating that host switching was rare.
Further evidence can be found among vertebrates, in the Puerto Rican tree frog
(Eleutherodactylus coqui, Marr et al., 2007), Barbary ground squirrels (Atlantoxerus
getalus,
Lopez-Darias et al., 2008), and island populations of common mynas
(Acridotheres tristis, Ishtiaq et al., 2006).
A second explanation for the absence of GI parasites in the Seychelles warbler may
be the effect of a recent bottleneck in the population. During the middle of the last
century, the species was reduced to just 26-29 individuals restricted to Cousin Island
(Crook, 1960) and this bottleneck is thought to have existed for 40-50 years. Parasites
require a threshold host density in order to sustain their own population, and this will
vary depending on the parasites life history (Clayton and Moore, 1997). The size of the
Seychelles warbler population may have been small enough to result in the extinction of
its GI parasite fauna. Seychelles warbler inter-island dispersal is extremely rare (<0.1%,
Komdeur et al., 2004a), so transmission of parasites between populations would
historically have been difficult. Interestingly the Seychelles warbler is still host to one
strain of malaria (chapter 4) so not all parasitic associations have been eliminated by the
bottleneck.
If loss of GI parasites in the Seychelles warbler was due to the population bottleneck
this species experienced we might expect similar losses in the other species in the
Seychelles that have undergone such bottlenecks. For example, the Seychelles fody,
which is found on all islands inhabited by the Seychelles warbler, also underwent a
reduction in range and number due to anthropogenic effects, although unfortunately, the
minimum population size reached is unknown (Rocamora, 1997). As populations
persisted on three islands, the Seychelles fody probably didn’t reach as low population
size as the warbler. However, emigration between islands is also rare in the Seychelles
fody (Vega, 2005), so the movement of parasites between islands would also have been
rare. The continued presence of GI parasites (coccidia) in the Seychelles fody may
provide evidence that, as generally thought, the Seychelles fody bottleneck was not as
extreme as that of the warbler (Rocamora, 1997, Vega, 2005).
- 67 -
The present study shows that almost all other bird species tested that are found on
the islands that the Seychelles warblers inhabit are host to GI parasites. The barred
ground dove did not have any parasites, however this is likely due to the very small
sample size tested (n=8). The Seychelles fody, the passerine species most similar to the
Seychelles warbler in its ecology and demographic history, was host to coccidia. These
results suggest that the lack of gut parasites is not a common trait within the avifauna of
the Seychelles, even on the smaller isolated islands. It also raises the question as to why
the Seychelles warbler has not been re-infected by parasites from the other avifauna.
GI parasites can differ considerably in host specificity, with both extremely host
specific and more generalist parasites found in the same community (Clayton and
Moore, 1997, Sehgal et al., 2001, Poulin and Mouillot, 2003). The likelihood that
different host species share parasite species depends on factors such as host phylogeny,
diet, and host specificity of the parasite (Freeland, 1983). Molecular analysis of coccidia
oocysts found in the Seychelles fody show they are similar to that found in a population
of tree sparrows in the UK at one locus. This indicates that this coccidian species is
potentially a generalist parasite capable of infecting a range of host species. So how has
the Seychelles warbler avoided infection by this parasite? The tree sparrow and
Seychelles fody are both from the family Passeridae, and are more closely related to
each other than to the warbler (family Sylviidae). That this coccidia species has not been
found in the warbler, despite very high densities of both bird species sharing the same
environment, and often the same food and water sources, suggests that this coccidian
may be a family-specific parasite.
This study raises interesting questions about the host specificity of the parasites
found in bird species on these (or any) islands. Opportunities for host switching of GI
parasites to the Seychelles warbler from other species must be common, due to the
density of birds found on the islands, especially seabirds such as the lesser noddy.
Examining the species or strain of coccidia found in the other avian species on the
island would give us some insight into the chances of host switching of this parasite. If
the same strain as that found in the Seychelles fody is found in other species then this
would suggest it is a generalist parasite capable of infecting the Seychelles warbler. In
order to definitively determine the likelihood of host switching to the Seychelles
warbler, experimental infections would be required. This could tell us if any other GI
- 68 -
parasite present in Seychelles avifauna was able to infect the Seychelles warbler and
have an impact on fitness. While experimental infection studies are common in captive
or non-endangered species (e.g Horak et al., 2004, Hill et al., 2005b), clearly there are
conservation implications of doing such an experiment in a rare species . Experimental
infections of a malaria parasite were carried out on endangered Hawaiian honeycreepers
(Atkinson et al., 1995, Atkinson et al., 2001), however these experiments could be
justified as the parasite poses a large threat to the continuation of the species. As there is
no evidence the Seychelles warbler is threatened by host switching of parasites from
other Seychelles birds, such an experiment would be unwise and unjustified.
Determining at what point the Seychelles warbler lost its’ GI parasite species, or
whether it has ever been host to gut parasites, is difficult. We might expect that the
parasite fauna would have a chance to increase over time as the opportunity for parasite
acquisition increases (Guegan and Kennedy, 1993), making a more recent loss more
likely, as over time we may expect a number of opportunities for host switching to arise.
Furthermore, although there are no other native Sylviidae species in the Seychelles,
vagrant species such as the sedge warbler (Acrocephalus schoenobaenus) do occur in
the Seychelles (Skerrett and Bullock, 2001). Therefore, it is theoretically possible that
such parasites could be (re)introduced to the population via these means. This also
points to a recent loss of gastrointestinal parasites, as over a long period of time the
Seychelles warbler would be exposed to a greater number of potentially infective
parasites by this route.
These findings have implications for the conservation of the Seychelles warbler.
Parasites continually evolve better mechanisms to infect hosts, and hosts respond by
evolving more effective ways to defend against the new threat (May and Anderson,
1979, Toft and Karter, 1990). This coevolution means that when a parasite is introduced
to a new, ‘naïve’ host population, it can be highly pathogenic as the new host has little
defence against it (O'Brian and Evermann, 1988). Introduced parasites have been shown
to have catastrophic effects on native species previously free of such parasites. For
example, the well documented introduction of malaria to Hawaii has had devastating
effects on endemic bird populations (Warner, 1968, Atkinson et al., 2001). The fact that
native island species may have little immunity to introduced generalist parasites should
be taken into consideration when planning conservation efforts such as translocations.
- 69 -
Translocations to new islands may expose them to new pathogens, as may
translocations of other avian species to islands already inhabited by the Seychelles
warbler. Previous translocations of the endemic South Island Saddleback (Philesturnus
carunculatus carunculatus) in New Zealand are likely to have been threatened by
disease outbreaks, with a substantial population decline with signs of disease in the
population (though the lack of sampling before and during the outbreak means the cause
is inconclusive). Although the translocated population recovered, outbreaks of avian
pox and malaria in other saddleback populations show how vulnerable small,
susceptible host populations can be to disease (Hale, 2008).
In conclusion, both the enemy release and bottleneck hypotheses suggest plausible
reasons as to how the Seychelles warblers ‘escaped’ their parasites at some point in their
history. It is difficult to pinpoint when this might have occurred, however the present
day population’s lack of GI parasites has important implications for conservation in this
species.
- 70 -
Chapter 4
Causes and consequences of malaria in the
Seychelles warbler
- 71 -
4.1 Abstract
Parasites can have detrimental effects on their hosts, with the potential to affect survival
and reproductive success. As a result they can be potent agents of selection. To realise
the evolutionary impact of parasites such as avian malaria, we need to understand the
patterns and consequences of their interactions with their hosts. However, for many
parasites the patterns of infection, factors affecting susceptibility in individuals, and the
consequences of infection, are unknown or poorly understood. Here, a combination of
detailed life history, survival and malarial infection data collected from an isolated
population of an island endemic, the Seychelles warbler (Acrocephalus sechellensis)
over a period of 10 years was used to investigate these questions. Only one strain of
malaria, GRW1, was found within the population. Malaria prevalence fluctuated
between years, with between 15-53% of adults and 30-100% of juveniles infected in
any one year. There was no relationship between overall yearly prevalence and annual
rainfall or annual survival probabilities. Malaria prevalence was significantly higher in
juveniles (75%) than in adults (37%). However no effect of breeding status, territory
quality, annual rainfall, body mass, group size, or location of territory (coastal or
inland), was found on the presence of malaria in adult or juvenile birds. Among adult
birds, prevalence decreased with age, even after controlling for possible mortality of
infected hosts, however prevalence increased again in very old birds (>8 years).
Uninfected adults were more likely to have had the infection as a juvenile than infected
adults, indicating that birds which had previous exposure to malaria as juveniles may
have gained some immunity to further infection. Increase in prevalence amongst very
old birds is likely due to immunosenescence. No effect was found of malaria on
survival; however this analysis was probably confounded by an inability to catch and
sample birds during the initial acute stage of malarial infection. These findings suggest
that GRW1 is not highly pathogenic to the Seychelles warbler, and while some selective
mortality cannot be ruled out, many individuals do appear to gain acquired immunity.
- 72 -
4.2 Introduction
Parasites, by definition, can have detrimental effects on their hosts, with the potential to
affect survival (Gulland, 1992, Hudson et al., 1992, Brown et al., 1995, Sorci and
Moller, 1997, Hudson et al., 1998, Coltman et al., 1999, Merino et al., 2000, Sol et al.,
2003) and reproductive success (Norris et al., 1994, Richner et al., 1995, Merino et al.,
2000, Hurd, 2001, Albon et al., 2002). They have the potential, therefore, to be a potent
selection pressure in wild populations, and are considered to be an important driving
force in the evolution and maintenance of various evolutionarily important traits,
including genetic diversity, secondary sexual signals (Hamilton and Zuk, 1982), and
even sexual reproduction (see Clayton and Moore, 1997, Milinski, 2003 for review).
Therefore it is important that we understand the causes and consequences of parasite
infection in order to understand how they might affect selection.
Malaria is a vector borne disease, caused by protozoan parasites of the genera
Plasmodium or Haemoproteus (Atkinson and van Riper, 1991), found in many
mammals, reptiles and birds. It is indirectly transmitted, requiring blood sucking insects
(of the Diptera order) such as mosquitoes as their intermediate host. Their life cycle is
complex, with stages of development in both tissues and circulating blood cells. In
humans, malaria is an important disease, responsible for between 700,000 and 2.7
million deaths a year (Breman, 2001), and malaria parasites are found in a range of bird,
mammal and lizard hosts (Perez-Tris et al., 2005). In birds, malaria is a common
parasite that has been recorded in the majority of species examined (Atkinson and van
Riper, 1991, Clayton and Moore, 1997) and has been shown to impact on fitness in
some systems (Warner, 1968, Sorci and Moller, 1997, Merino et al., 2000, Sol et al.,
2003, Bensch et al., 2007, but see Weatherhead, 1990, Weatherhead and Bennett, 1991,
Davidar and Morton, 1993, Siikamaki 1997). Avian malaria is commonly used as a
model for examining the evolutionary impact of parasitism, for example in studies of
sexual selection (e.g Hamilton and Zuk, 1982), host life history (Allander, 1997, Moller,
1997), and the maintenance of MHC polymorphism (Westerdahl et al., 2005, Bonneaud
et al., 2006). Its usefulness as a model comes from its ubiquity amongst birds, and its
ease of detection using molecular methods (Feldman et al., 1995, Bensch et al., 2000,
Fallon et al., 2003a, Hellgren et al., 2004, Waldenstrom et al., 2004).
- 73 -
To realise the evolutionary impact of parasites such as avian malaria, we need to
understand the patterns and consequences of their interactions with their hosts.
However, for many species or lineages of parasites the patterns of infection, factors
affecting susceptibility in individuals, and the consequences of infection, are unknown
or poorly understood. The advent of molecular screening of malaria (Feldman et al.,
1995, Bensch et al., 2000, Fallon et al., 2003a, Hellgren et al., 2004, Waldenstrom et al.,
2004) also allows much more sensitive analysis (Richard et al., 2002). It also allows
accurate identification of parasite lineages using DNA sequence information, and
application of this technique has shown that a great diversity of cryptic lineages exist
within those avian malarial parasites previously identified by morphology (Bensch and
Akesson, 2003, Bensch et al., 2004, Fallon et al., 2005, Ricklefs et al., 2005, Beadell et
al., 2006), and it appears some of these lineages are distinct species (Bensch et al.,
2004). With this more detailed molecular information, the taxonomic relationships
between malarial lineages can be determined, and ultimately the intimate relationships
between specific parasites and their hosts can be better understood.
In order for avian malaria parasites to be an important selection pressure, they must,
at some point, have had a detrimental effect on their host. Some studies have provided
evidence of the detrimental effects of avian malaria parasites on their hosts; laboratory
studies have shown pathogenic effects (Atkinson et al., 1988, Atkinson and van Riper,
1991, Earle et al., 1993) while in wild populations, malaria has been shown to
negatively affect reproductive success (Korpimaki et al., 1995, Merino et al., 2000), and
survival (Sorci and Moller, 1997, Dawson and Bortolotti, 2000, Sol et al., 2003, Marzal
et al., 2008). However, many other studies of wild populations have found no detectable
effects (Bennett et al., 1988, Davidar and Morton, 1993, Dale et al., 1996, Siikamaki et
al., 1997, Schrader et al., 2003) and the pathogenicity of different malaria lineages in
the wild is unclear. Selection also requires that there is individual variation in host
resistance or susceptibility to malaria. Therefore understanding the factors that lead to
some individuals becoming infected while others do not, or why some succumb to the
infection, while others do not, are important.
Many factors may influence an individuals’ susceptibility to malaria, including its
genetic composition. The major histocompatibility complex (MHC) has been the focus
of a range of studies investigating associations of genetic factors and malaria resistance.
- 74 -
Associations between specific MHC alleles (Westerdahl et al., 2005, Bonneaud et al.,
2006) and MHC heterozygosity (Westerdahl et al., 2005) with avian malaria have been
shown, indicating a genetic effect on resistance to malaria. Other intrinsic factors that
have been highlighted as important in susceptibility to malaria, include the age and sex
of the host. Differences may be due to the effects of sex hormones such as testosterone
and oestrogen on immunity (Grossman, 1985, Schuurs and Verheul, 1990), differential
exposure to vectors, or differences in physiological stress between the sexes due to
mating systems (Zuk, 1990, Zuk and McKean, 1996, McCurdy et al., 1998). Agerelated prevalence is also a common finding of studies of malaria in birds (Allander and
Bennett, 1994, Sol et al., 2000). Prevalence may initially increase with age as infections
accumulate, then decrease as a result of host mortality or acquired immunity (Hudson
and Dobson, 1997, Wilson et al., 2002). Other factors which may affect a hosts’
susceptibility to malaria, include breeding activity (Gustafsson et al., 1994, Richner et
al., 1995, Merino et al., 2000, Norris et al., 1994) and habitat factors that may affect
vector abundance and distribution (van Riper et al., 1986, Wood et al., 2007). To fully
understand malaria as an agent of selection, we must understand how all these features
interact to affect an individual’s susceptibility or resistance to malaria.
The Seychelles warbler (Acrocephalus sechellensis) is a small passerine endemic to
the islands of the Seychelles in the western Indian Ocean. The Cousin Island population
of this species has been intensively monitored since 1985, with over 97% of individuals
colour ringed since 1997. Importantly, blood samples are taken from all individuals
caught each year. Furthermore, the population is intensively monitored so life history
and breeding status can be accurately measured. As there is virtually no migration
between islands (Komdeur et al., 2004a), birds that are no longer observed in a
population can accurately be presumed dead. Therefore accurate and complete data on
individual survival and fitness are also known for almost all individuals. Many other
studies that have attempted to investigate the effects of avian malaria upon individual
survival have been limited to analysis of return rates (Weatherhead and Bennett, 1991,
Davidar and Morton, 1993, Siikamaki et al., 1997, Bensch et al., 2007), which may be
confused by dispersal, or analysis over short time frames (Schrader et al., 2003, Sol et
al., 2003). However this is not the case for the Seychelles warbler. As such the longterm data set collated on this species provides an excellent opportunity to investigate
- 75 -
how different factors affect susceptibility to avian malaria in a wild bird population,
with a minimum of confounding factors.
In this study, molecular techniques (Feldman et al., 1995, Bensch et al., 2000,
Fallon et al., 2003a, Hellgren et al., 2004, Waldenstrom et al., 2004) were used to
determine patterns of avian malaria infection in individuals from the Cousin Island
Seychelles warbler population over a ten-year period. By combining these data with life
history and survival data, the aim is to identify which malaria lineages are present in the
population, to analyse changes in malaria prevalence across the ten-year period, and to
investigate the factors that affect malaria presence in individuals. Finally, the effect of
malaria infection on survival will be determined, and test whether individuals gain
acquired immunity to malaria infection.
4.3 Methods
4.3.1 Sampling
Seychelles warblers were caught on the island of Cousin over a period of 10 years
(1994-2003). Seychelles warblers have one major breeding season from JuneSeptember, and another smaller breeding period during December-February (Komdeur
and Daan, 2005). The breeding periods were defined as follows: breeding (major) from
1st June to 30th September, breeding (minor) from 1st January to 28th February, and nonbreeding any time outside these periods. Birds were monitored intensively during the
major breeding season in each year. Birds were also caught and monitored in the minor
breeding period during 1997-1999, and in the non-breeding period in 1995, 1998 and
1999. The status of all birds was based upon field observations from the given field
season combined with the detailed long-term demographic data available. The
‘dominant’ male and female were defined as the primary, pair-bonded male and female
in a territory, while ‘subordinates’ included all other birds (> 8 months old) resident in
the territory. When the exact age was unknown, birds were aged using eye colour;
juveniles (>8 months old), have grey/light brown eyes, while adults have chestnut
brown eyes (Komdeur, 1991).
- 76 -
Birds were caught using mist nets. Unringed birds were given a unique combination
of three UV resistant colour rings, and a metal British Trust for Ornithology (BTO) ring
for identification. A 50µl blood sample was taken from each bird by brachial
venipuncture, and stored in 800µl of 100% ethanol at room temperature in a 2ml
microcentrifuge tube, for later analysis. Birds were weighed to 0.1g using a pesola
balance.
4.3.2 Molecular Analysis
Molecular techniques have been shown to be more accurate than traditional blood
smears (Perkins et al., 2002, Richard et al., 2002), and allows identification of the
species or lineage by sequence information (Bensch and Akesson, 2003, Fallon et al.,
2005, Ricklefs et al., 2005, Beadell et al., 2006). Therefore the population was screened
for malaria using a PCR technique (Hellgren et al., 2004). Total genomic DNA was
extracted from blood using a salt extraction technique (Aljanabi and Martinez, 1997). A
small sample of blood was taken and 300 µl of TEN lysis buffer/2% SDS added. To this
10 µl of Proteinase K was added, and incubated at 55 ˚C for 2-3 hours until blood had
dissolved. Next, 100 µl of 5M NaCl was added, and centrifuged for 5 min at 14000rpm.
DNA was precipitated by adding 800 µl ice cold 100% ethanol. Excess ethanol was
removed, and tubes blotted dry. DNA was washed with 500 µl 70% ethanol, and
centrifuged for 3 min at 13000 rpm. Excess ethanol was removed, and DNA left to dry.
The DNA was then resuspended in 200 µl of sterile dH20. Molecular sexing using a
PCR technique (Griffiths et al., 1998) was used to confirm the gender of all birds, and
as a positive check that DNA was of PCR quality, as malaria screening using PCR
shows presence or absence and therefore there is no positive control. The samples were
then screened for malaria using the nested polymerase chain reaction (PCR) method
described in Hellgren (2004). This method consists of 20 cycles using the primers
HeamNF1 and HeamNR3, followed by a final amplification of 35 cycles using the
primers HeamF and HeamR2, which target a 479bp section of the cytochrome b gene of
Heamoproteus and Plasmodium. All conditions were as in Hellgren et al (2004).
Positive samples from over 40 individuals were sequenced using Big Dye terminator
kit v3.1 (Applied Biosystems) to determine the genetic lineage of malaria present. The
sequencing reaction was as follows; 1 µl Big Dye, 1.5 µl sequencing buffer, 0.5 µl
HeamF or HeamR2 primer (10 µM), 5 µl H2O, and 2 µl template. The thermal profile
- 77 -
was 25 cycles of 96 ˚C for 10 sec, 50˚C for 5 sec, and 60 ˚C for 4 min. Sequences were
analysed on ABI3730 sequencer (Applied Biosystems). Sequences were aligned using
MEGA (Tamura et al., 2007) and then using BLAST (Basic Local Alignment Search
Tool) the sequences were compared with those in the National Centre for
Biotechnology (NCBI) gene bank database. The sequence analysis was carried out in
two different laboratories at UEA in the UK and in the department of Ecology at Lund
University, Sweden.
4.3.3 Statistical analysis
All analyses were carried out using the programme “R” (R development Core Team
2006). All generalized linear mixed effects models were carried out using the package
lme4 (Bates, 2007). Models were fitted using a backwards stepwise procedure, in which
the least significant variables were removed one by one, starting with the interactions,
until only significant variables were present in the model (minimal adequate model).
i) Malaria prevalence across years
Prevalence of malaria per year was assessed in adults and juveniles separately.
Generalized linear mixed effects models were fitted, with malaria (presence or absence)
as the response variable, year as the explanatory variable, and individual as a random
factor to control for multiple measurements on the same individual over the 10 years.
The models were fitted with a binomial error distribution, with a logit link function.
Rainfall may affect the abundance of biting insects such as mosquitoes (Hu et al., 2006,
VanderWerf et al., 2006), therefore the relationship between annual malaria prevalence
and mean annual rainfall (mm) was investigated using a general linear model with a
binomial error structure and logit link function. Rainfall data was obtained from the
Seychelles Meteorological Service on Praslin Island, 2km south of Cousin. Temperature
was not tested, as mean temperatures stay relatively constant, varying between a mean
monthly temperature of 26 - 27.5 ˚C on the nearby island of Praslin (Seychelles
Meteorological Service)
Annual malaria prevalence were also examined in relation to annual survival
probabilities from a previous analysis by Brouwer et al. (2006). These estimates were
maximum likelihood probabilities derived from a capture-recapture model. Adults and
juveniles were analysed separately. Generalized linear mixed effects models were fitted
- 78 -
with a poisson error structure, with survival as the dependent variable, malaria
prevalence as the explanatory variable and year as a random factor.
ii) Malaria and age
A generalized linear mixed effects model was used to investigate differences in malaria
prevalence between age categories. The categories were defined as follows; Adult (>1
year), juvenile (<1 year, fledged), and chick (still in the nest). Year and individual were
included as random factors, and the model used a binomial error structure with logit link
function. When exact age was unknown, birds were aged using eye colour. Juveniles
have grey to light brown eyes, whereas adults have chestnut brown eyes (Komdeur,
1991).
iii) Factors affecting malaria presence
Factors affecting malaria presence were investigated in adults and juveniles separately,
as preliminary analysis indicated a large difference in prevalence between these age
categories. Both analyses used a generalized linear mixed effects model, with binomial
error structure and logit link function, and year and individual included as random
factors. In both analyses, the following variables were included: territory quality, annual
rainfall, sex, coastal/inland territory, body mass, tarsus and a body mass x tarsus
interaction. In juveniles, number of individuals in group was also included. In adults,
minimum age was included, which was calculated using the last known sighting of the
individual as the likely year of death. To test for non-linearity in the response of
infection to minimum age, a quadratic term was included for this variable. Measures of
territory quality were based on the natal territory for juveniles, as they remain on their
natal territory for at least six months after fledging (Komdeur, 1996a). Therefore it is
highly likely that the majority of juveniles catch malaria while still in their natal
territory. The effect of natal territory quality on malaria presence was analysed during
the breeding season. Territory quality in adults was based on the territory occupied in
that year. As Seychelles warblers are insectivorous, taking 98% of their insect food
from leaves (Komdeur, 1991), territory quality was measured as an index of insect prey
available, following Komdeur (1994b). Territory quality was not available for all
territories in all years; where it was not available the territory quality for either the year
before or after was used, as territories vary relatively little in quality in the breeding
season between years (Komdeur, 1996b). This technique has been used in previous
- 79 -
analysis (Brouwer et al., 2006, Richardson et al., 2007). Territory quality measures were
still only available for a limited number of individuals and years (89 juvenile measures,
299 adult measures); once the removal of this variable was shown to have no significant
effect on the model, the sample size was increased to 194 for juveniles and 559 in adults
to test all other variables. Increased salinity of the environment has been shown to
affect malaria prevalence (Figuerola, 1999), and coastal areas on Cousin have been
shown to be exposed to greater salt spray (Dowling et al., 2001a). Therefore, whether an
individual’s territory was coastal or inland was included as a factor in the analysis. A
coastal territory was defined as being on the perimeter of the island. All other territories
not directly on the coast were defined as inland.
iv) Do infected individuals gain acquired immunity?
Age was an explanatory variable in a generalized mixed effects model of malaria
prevalence which included only those individuals that reached five years of age to
determine if the decrease in prevalence seen with age was due to selective mortality or
the acquiring of resistance. Year and individual were included as random factors. A
binomial error structure and logit link function were used.
v) Survival analysis
The effect of malaria on survival of adults to the following year after screening, and
juvenile survival during the first year of life, was tested using a generalised linear mixed
effects model, with year as a random factor. A further survival analysis was used to
look at long-term survival effects of malaria. Previous survival analysis using captureresighting models has shown resighting probability is high (0.92 ± 0.03) for adult birds
(Brouwer et al., 2006). This resighting probability was considered high enough to use a
Cox proportional hazards survival model, using the analysis package ‘survival’
(Therneau) in “R”. Only individuals of known age (ringed as chick or young juvenile)
were included in the analysis. Kaplan-Meier survivorship curves were created to display
relative survival of the different groups. Three groups were included; those individuals
that tested positive for malaria as a juvenile, those that tested negative for malaria as a
juvenile; and an unknown group, which included individuals sampled as a chick but not
as a juvenile. Only individuals where age was known to within a few months were
included in the analysis. The prepatent period (where parasites cannot be found in
circulating blood) of malaria parasites is between 11 days and 3 weeks (Atkinson and
- 80 -
van Riper, 1991, Valkiunas, 2005, Cosgrove et al., 2006). Seychelles warbler chicks are
in the nest for 18-20 days (Komdeur, 1991). Therefore, even if a chick was infected on
the day of hatching, even with a short prepatent period, it is likely that infection will not
be able to be detected until after fledging. Malaria is not transmitted vertically
(Valkiunas, 2005) therefore these chicks are unlikely to test positive for malaria.
4.4 Results
4.4.1 Sequence analysis
Sequence analysis of the PCR product from 40 infected individuals showed that all
individuals were infected with a single malaria lineage; the GRW1 lineage of the
morphospecies Haemoproteus payevskyi (Accession number AY099040, Bensch et al.,
2004).
4.4.2 Malaria prevalence across years
Malaria prevalence amongst the adult population fluctuated between 15% and 53%
between years, with a mean of 33% (figure 4.1). Both the years 2000 and 2002 had
significantly lower malaria prevalence during the breeding season, however prevalence
during all other years were not significantly different. The variation in prevalence
between years was not related to annual rainfall (P > 0.05, Z=-1.34, n = 512). There was
no overall effect of malaria prevalence on the survival of adult birds (P >0.05, Z=1.34,
n = 10).
Malaria prevalence amongst the juvenile population fluctuated between 30 - 100%
between years, with a mean of 76% (figure 4.2). However, the difference between years
was not significant. There was no effect of mean annual rainfall on juvenile malaria
prevalence (P >0.05, Z=0.12, n = 193). No effect of malaria prevalence on the annual
survival probabilities of juvenile birds was detected (P >0.05, Z= 0.001, n = 10).
- 81 -
Estimate
SE
z value
P
Intercept
-0.32
0.25
-1.24
0.21
1995
0.23
0.35
0.67
0.50
1996
0.45
0.48
0.95
0.34
1997
-0.48
0.36
-1.35
0.18
1998
-0.84
0.44
-1.9
0.06
1999
-0.63
0.77
-0.83
0.42
2000
-1.80
0.86
-2.09
0.04
2001
-0.18
0.99
-0.18
0.85
2002
-0.77
0.36
-2.12
0.03
2003
-0.01
0.37
-0.01
0.99
Table 4.1 Results of generalized linear mixed effects model, with adult malaria prevalence as dependent
variable, and year as explanatory variable, n=512.
Estimate
SE
z value
P
Intercept
1.71
1.30
1.32
0.19
1995
0.54
1.79
0.30
0.76
1996
15.2
1756.35
0.09
0.99
1997
-0.12
1.40
-0.09
0.93
1998
-0.65
1.47
-0.44
0.66
1999
0.48
1.57
0.31
0.76
2000
-1.25
1.37
-0.92
0.36
2001
-2.72
1.5
-1.80
0.07
2002
-0.30
1.35
-0.22
0.82
2003
-0.06
1.44
-0.04
0.97
Table 4.2 Results of generalized linear mixed effects model, with juvenile malaria prevalence as
dependent variable, and year as explanatory variable, n=193
- 82 -
Figure 4.1 Malaria prevalence and annual survival probabilities in a) adult and b) juvenile Seychelles
warblers from 1994 until 2003. All years except 1999 and 2000 for adults, and 1998 for juveniles, are
major breeding season only, during these years prevalence is also shown for the minor breeding season
(shown on the figure by ‘mb’). Numbers next to points are the number of samples screened each year.
- 83 -
4.4.3 Differences in malaria prevalence between age categories
Average adult malaria prevalence (37%) was significantly lower than juvenile
prevalence (74%, table 4.3 , fig. 4.2). As expected, chicks had a very low malaria
prevalence of only 1.7% (only 2 cases from total of n=118, both found in old chicks
over 15 days old) and were therefore excluded from the remainder of the analysis.
Estimate
Intercept
-0.43
Age
Chick
Juvenile
Adult
S.E
Z
P
Estimate
0.21 -3.61 >0.001
-4.31
Chick
S.E
Z
P
0.79 -5.45 <0.001
Adult
-
-
-
-
-3.56
0.78 -4.57 <0.001
5.65
0.79
7.10
>0.001
2.08
0.21 9.785 <0.001
3.55
0.78
4.57
>0.001
-
-
-
-
Table 4.3 Results of generalized linear mixed effects model with malaria prevalence as dependent
variable, and age category as explantory variable. Year and individual were included as random factors,
n=851.
- 84 -
Figure 4.2 Mean malaria prevalence in different age categories. Age categories are adult (>1 year,
n=534), juvenile (<1 year, fledged, n = 199) and chick (still in the nest, n = 118). P values, coefficients
and standard deviations are shown above the bars (generalized linear mixed effects model, with year and
individual as random factors)
4.4.4 Factors determining malaria infection
i) Colinearity of age and status
The relationship between age and status was investigated, as these are likely to be nonindependent of each other, and may affect further analysis. For adult birds there was a
significant difference in age between dominant and subordinate birds (Wilcoxen signed
rank test; n = 248 W = 2957, P = 0.01). Dominant birds had a mean minimum age of
4.6 (± 0.18) years, while subordinate birds had a mean minimum age of 3.2 (± 0.38)
years (figure 4.3). Individuals of a set minimal age (either 2 years or 3 years of age)
were analysed to investigate the effects of breeding status without the confounding
effect of age. Both found no effect of breeding status on malaria presence or absence in
birds of 2 years old (generalized linear mixed effects model, individual and year as
random factor, n = 86, Z=0.88, P >0.05) or 3 years old (n =56, Z=-0.36, P >0.05). As
- 85 -
status was shown to have no effect, it was excluded from all further analyses due to its
colinearity with age.
Figure 4.3 Plot of minimum age of dominant and subordinate adult birds
ii) Factors affecting malaria presence
In adults, territory quality measures were only available for 299 cases; this variable was
shown to have no significant effect on malaria prevalence, and therefore removed,
allowing the sample size to increase to n = 551 to test for all other variables. No effect
of annual rainfall, sex, coastal/inland territory, body mass, tarsus, or body mass x tarsus
interaction was found, and were therefore excluded from the model. The minimum
adequate model (table 4.4) contained minimum age, and a quadratic relationship
between age and malaria; younger adult birds were more likely to have malaria than
older adults, and prevalence increased again in older aged adults.This may have been
due to low sample sizes (n<10) at older ages, therefore all those ages with n<10 were
removed, and the quadratic relationship remained, indicating it is a robust result (fig
4.4). Amongst juveniles, annual rainfall, sex, coastal/inland territory, body mass, group
- 86 -
size, tarsus and body mass x tarsus interaction showed no detectable effect on the
presence of malaria in juveniles (table 4.5 ).
Intercept
Age
Age 2
Coefficient
1.04
-0.93
0.07
SE
0.27
0.16
0.02
Z
P
<0.001
<0.001
<0.001
Table 4.4 Minimum adequate model of generalized linear mixed effects model of a range of variables on
adult malaria presence/absence. All those ages with n<10 were removed.
Intercept
Coefficient
1.19
SE
0.24
Z
4.90
P
<0.001
Table 4.5 Minimum adequate model of generalized linear mixed effects model of a range of variables on
juvenile malaria presence/absence.
Figure 4.4 Malaria prevalence in Seychelles warbler at ages 1-10, with ages with n<10
removed. Sample sizes for each age shown above each point.
- 87 -
4.4.5 Is the decrease in prevalence with age due to resistance or death?
Figure 4.5 shows malaria prevalence at ages 1 to 5 only in individuals that survived
until 5 years of age. This removes the effect of selective mortality when investigating
the effect of age on prevalence of malaria infection. Analysis of those birds that
survived until five years of age (generalized linear mixed effects model, n = 131, based
on 82 individuals) showed prevalence was significantly less in two year old, three year
old, and four year old birds compared to birds under one (table 4.6). There was no
difference between birds under one and those of one year or five years. Malaria
prevalence does peak again at five years, however as this is based on a very small
sample size (n = 4) this is likely to be an unrepresentative sample.
Intercept
Age
1 years
2 years
3 years
4 years
5 years
Estimate
1.34
S.E
0.52
-0.58
-1.58
-2.58
-3.91
-1.8
0.64
0.81
0.84
1.21
1.4
Z
2.60
P
<0.01
-0.91
-1.96
-3.08
-3.23
-1.28
0.36
0.05
0.002
0.001
0.20
0 years
Table 4.6 Results of generalized linear mixed effects model, with year and individual as random factors,
of the effects of year of age on malaria prevalence in birds that survived until five years old
- 88 -
Figure 4.5 Malaria prevalence of birds that survived until at least five years old at each age from 0-5
years. Sample sizes are shown above each point.
4.4.6 Within individual patterns of infection
A sub sample of 111 individuals was tested for malarial infection both as a juvenile and
as an adult (fig 4.7). Of the total 64 birds infected as juveniles, 21 (32%) of these
individuals were also infected as adults, and 43 (68%) were not. Of those birds that
were not infected when tested as juveniles, 19 (42%) had malaria when tested as an
adult, while 28 (58%) were not infected. Therefore, those birds that were not infected as
a juvenile were more likely to be infected as an adults (fig 4.6, McNemar’s Chi squared
= 9.29, P < 0.002, n=111).
- 89 -
McNemar Chi Sq 9.29
P<0.01
50
45
40
Frequency
35
30
25
20
15
10
5
0
Adult infected
Adult uninfected
Juveniles infected (n= 64)
Adult infected
Adult uninfected
Juveniles uninfected (n= 47)
Figure 4.6 Patterns of infection in Seychelles warblers as juveniles and subsequently in adults, with
results of a McNemar Chi squared test.
The pattern of infection was looked at in individuals which had been re-sampled at
least three times during their lifetime (n = 45). Of these, 15 (33%) never tested positive
for malaria, 24 (53%) tested positive and then later tested negative for the infection, and
5 (11%) tested positive in all three samples. Reinfection was rare; only one individual
was shown to test positive after previously clearing the infection (figure 4.7).
- 90 -
60
50
% of total
40
30
20
10
0
Never tested
positive for
malaria (n=15)
Initially positive Malaria all three
for malaria, later samples (n=5)
negative (n=24)
Reinfected with
malaria (n=1)
Figure 4.7 Percentage of Seychelles warblers sampled three times that have never been infected, infected
then cleared it (or latent), infected in all three samples, or reinfected after clearing infection/latent
infection.
4.4.7 Survival Analyses
In juveniles, malaria had no effect of survival in the first year of life (P >0.05, Z=1.63,
n = 165). There was no effect of malaria on survival to the following year in adults (P
>0.05, Z=-0.23, n = 326). A further, detailed survival analysis was carried out, looking
at the effect of juvenile malaria on lifetime survival. Three groups were included; those
individuals that had malaria when tested as a juvenile, those that did not have malaria as
a juvenile; and a group for which their infection status as a juvenile was unknown
(individuals sampled as a chick, before infection by malaria could occur, or become
established at high enough levels in the blood to be detected). The model showed no
significant difference in survival between juveniles with or without malaria (mean age
at death 3.15 years for those with malaria as a juvenile 3.6 years for those uninfected as
a juvenile; table 4.7). The hazard ratio is the effect of the group (malaria, no malaria or
unknown) on risk of death. Juveniles without malaria as a juvenile have a hazard ratio
of 0.97, a hazard ratio of 1 supports the null hypothesis that there is no effect on risk,
therefore there is no difference in likelihood of death between those with malaria as a
juvenile or not. The hazard ratio of the unknown group is 1.55, indicating that risk for
this group is 1.5 x that of the group with malaria as a juvenile. The survival curves for
each group can be seen in figure 4.8.
- 91 -
Coefficient Hazard ratio
SE
P
Mean age at death
Juvenile group
N
With malaria
123
Without malaria
42
-0.034
0.97
0.21
0.87
3.60
Unknown
116
0.439
1.55
0.15 0.003
2.38
Total
281
(years)
3.15
Table 4.7 Results of a Cox proportional hazards survival analysis. Hazard ratio represents the effect of
the juvenile group on risk of death.
Figure 4.8 Survival curve for juveniles with malaria, without malaria and the unknown group.
Censored individuals are shown by +
- 92 -
4.5 Discussion
Between 1994 – 2003, the Seychelles warbler was host to just a single genetic lineage
of avian malaria, GRW1 (Bensch et al., 2000). The prevalence of this infection within
the population was found to fluctuate widely between years amongst both adults and
juveniles. There was no correlation between levels of rainfall (and, consequently, the
abundance of biting insects, Freed et al., 2005, VanderWerf et al., 2006) and prevalence
of malaria in the population. Nor was there any apparent link between malaria
prevalence in the population in any year and levels of adult or juvenile survival in that
year. Of the variables predicted to affect the likelihood of malaria infection only age
was found to affect the presence of malaria; a quadratic relationship was found, with
prevalence decreasing with age until 8 years, after which prevalence increased.
Although the analysis used has been shown to cope well with small sample sizes
(Bolker et al., 2008), the relationship still remained, even when all those ages of sample
size <10 were removed. There was no detectable correlation between malarial infection
and either body mass or survival.
4.5.1 Fluctuating malaria prevalence between years
Malaria prevalence fluctuated between years on Cousin Island, between 15-53% in
adults and 30-100% in juveniles. Such fluctuations in prevalence have been shown in
other host-blood parasite systems. In both lizards (Schall and Marghoob, 1995) and
humans (Molineaux, 1988), temporal variation seems to follow a cyclical pattern, with a
periodicity of approximately ten years in both cases. Bensch (2007) found fluctuations
in prevalence of three malaria lineages in the great reed warbler (Acrocephalus
arundinaceous) with a periodicity of 3-4 years. However, this study found two of the
three most common lineages to be absent from the population during several years,
which never occurred in the related Seychelles warbler. Three theories have been put
forward to explain temporal fluctuations in prevalence. Firstly, competition between
strains or species of malaria may cause changes in the relative frequency of parasites
amongst the host population (Richie, 1988, Bensch and Akesson, 2003, Fallon et al.,
2003a). As there is only one malaria parasite in the Seychelles warbler system this
cannot be the case here. Secondly, climatic variations which affect vector abundance
could cause differences in prevalence. There was no relationship between annual
rainfall and malaria prevalence across the ten year period of the study. Temperature was
- 93 -
not tested, as mean temperatures stay relatively constant, varying between a mean
monthly temperature of 26 - 27.5 ˚C on the nearby island of Praslin (Seychelles
Meteorological Service). However, as the specific vector responsible for transmitting
GRW1 in this population is unknown, it is impossible to determine which specific
factors may affect its abundance. Finally, genetic changes in host resistance and parasite
virulence, caused by parasite-mediated selection, could occur. Previous analyses of the
Seychelles warbler population on Cousin have shown no association between the
immune genes of the MHC class I and malaria infection (Brouwer unpublished), and
that there is a lack of variation in the MHC class II genes (chapter 3). This does not rule
out the possibility that other areas of the genome may be coevolving in a cyclic arms
race with the malarial lineage however, investigating this possibility is not within the
scope of this present study. At this stage, the causes of the temporal variations in
malaria infection in the Cousin Island population of Seychelles warbler are unknown.
Further investigation would be aided by identification of the intermediate vector and its
ecology.
4.5.2 Malaria and acquired immunity
Malaria prevalence varied markedly with age in the Seychelles warbler. Adults had a
dramatically lower prevalence than juveniles (37% in adults compared to 74% in
juveniles). Amongst adults there appeared to be a quadratic relationship with age. A
decrease in parasite prevalence or intensity with age has been seen in other host-parasite
systems (Hudson and Dobson, 1997, Hudson et al., 2001, Wilson et al., 2002)
including, in regards to malarial infection, in great tits (Parus major, Allander and
Bennett, 1994), and feral pigeons (Columba livia, Sol et al., 2000). Other notable
examples of age-dependent parasitism include malaria and other diseases in humans
(Anderson and May, 1991), and wood mice (Apodemus sylvaticus) infected with a
gastrointestinal nematode (Gregory et al., 1992).
A number of mechanisms have been put forward to explain the decrease in infection
prevalence with age, including parasite induced host mortality, acquired immunity, and
age-related changes in predisposition and exposure (Gregory et al., 1992, Wilson et al.,
2002). In the Seychelles warbler there was no detectable effect of malaria on survival,
and amongst adults, malaria prevalence decreased with age until very old ages, even
after controlling for the possibility of age related mortality by testing only birds that
- 94 -
reached at least five years of age. Thus selective mortality cannot explain the pattern
seen. While it is possible that juvenile birds may have a predisposition to malaria,
perhaps due to behavioural differences increasing exposure, or the trade-off of immune
defence with growth in juveniles (Tschirren and Richner, 2006), adult birds were
significantly less likely to show infection if they have already been tested positive as
juveniles, and individuals sampled at least three times throughout their lives were highly
unlikely to show a re-infection after having previously cleared themselves of infection.
This indicates that it is more likely to be acquired immunity, rather than a behavioural
difference causing predisposition to malaria amongst juveniles.
Acquired immunity is the development of long term resistance to a pathogen, by
recognition of antigens during initial exposure by MHC receptors, which leads a
specific immune response (Frank, 2002). However, while acquired immunity seems to
play a role in age-related differences in parasitism in humans (Anderson and May,
1991) and laboratory animals (Anderson and Crombie, 1984, Wilson et al., 2002 and
references therein), there have been few examples of this in wild populations. These
examples include Quinnell (1992), who showed acquired immunity in a natural wood
mouse (Apodemus sylvaticus) population infected by gastrointestinal nematodes, and
Sol et al (2003) who found that while there was some parasite induced mortality in
juveniles, age-related decrease in intensity of malaria in feral pigeons (Columba livea)
was best explained by a mechanism of acquired immunity. Sol et al (2003) suggested
that although birds are continually exposed and reinfected with the parasite throughout
their lifetime, only juveniles show high intensity infection, because a degree of
immunity against further infection is gained after the exposure to malaria. A similar
scenario may be occurring in the Seychelles warbler system. Individuals are exposed to
reinfection throughout their lives, but after initially contracting malaria as a juvenile
they may gain a degree of immunity against further infection. This idea is supported by
the evidence malaria prevalence with age (even after controlling for mortality), that
adult birds were significantly less likely to show infection if they already tested positive
as juveniles, and reinfection was rare. Therefore the evidence here suggests that
acquired immunity, and not host mortality or the different behavioural predispositions
of younger birds, is the cause of the decrease in malaria prevalence with age in the
Seychelles warbler.
- 95 -
4.5.3 Immunosenescence
The decrease in prevalence with age in the Seychelles warbler was only seen until the
age of eight years, after which prevalence increased. While a gradual increase in
prevalence with age may represent the acquirement of infections over time (Wilson et
al., 2002), in this case where higher malaria prevalence is seen in very young and very
old birds - with a decrease between these ages - the pattern is most likely explained by
acquired immunity followed by immunosenescence. Immunosenescence is the decrease
in immune function with old age (Pawelec, 2008). There is evidence of decrease in
immunity with old age in birds (Moller and De Lope, 1999, Lozano and Lank, 2003,
Saino et al., 2003, Lavoie, 2006, Lavoie et al., 2006, Palacios et al., 2007) . An
evolutionary explanation for immunosenescence is that organisms adjust investment of
resources between self maintenance and other areas such as reproduction. As age
increases, the optimum is to spend fewer resources in self maintenance, which may
compromise immune function, and spend more on reproduction (Kirkwood, 1990). The
pattern of malaria prevalence in the Seychelles warbler appears best explained by young
birds acquiring immunity against malaria as they age, followed by a decrease in
immune function in old age which decreases immunity to new or latent malaria
infections.
It is worth noting that PCR methods used in the present study may miss low
intensity infections. Malaria only spends part of its life cycle in the circulating blood
(Atkinson and van Riper, 1991) and nested PCR methods have 64-84% accuracy in
detecting low parasitaemia typical of chronic or latent infections (Jarvi et al., 2002).
Therefore some apparently malaria free adults may be suffering from chronic malaria,
where immune responses have reduced parasitaemia to low levels. This acquired
immunity may be by clearance of infection, or maintenance of asymptomatic, low
parasitaemia, chronic infection. This means malaria infection within the population may
be underestimated, however as this is likely to be chronic, low level infection, which is
often asymptomatic, we may expect there to be few detrimental effects. However,
combining PCR with serological methods as suggested in Jarvi (2002) would allow
these low level infections to be detected.
- 96 -
4.5.4 Malaria infection in nestlings
Only 1.7% of chicks were infected, which corresponds to just two individuals out of the
118 screened. The nestlings that tested positive were both old nestlings (>15 days old)
close to fledging. The prepatent period of Haemoproteus infections varies between 11
days and 3 weeks and is, therefore longer than the nestling period for many species
(Valkiunas, 2005, Cosgrove et al., 2006). The infected chicks were likely to have been
infected very shortly after birth, therefore the acute phase, characterised by high
parasitaemia, had just begun at the time of sampling at the end of the nestling period.
The low number of infected chicks found in the present study suggests that the
prepatent period of GRW1 is generally longer than the nestling period of the Seychelles
warbler, which is approximately 18-20 days (Komdeur, 1991, Komdeur et al., 2004b),
as it is clear that nestlings are often bitten by biting insects (pers comm. D.S.
Richardson)
4.5.5 Sex differences in prevalence
Differences in parasitism between males and females have been found in a number of
studies (Zuk and McKean, 1996, McCurdy et al., 1998, Tschirren et al., 2003). Sexrelated differences in parasitism may be due to the effects of sex hormones such as
testosterone and oestrogen on immunity (Grossman, 1985, Schuurs and Verheul, 1990),
differential exposure to vectors (for example, differing amounts of time spent inactive
on the nest), or differences in physiological stress between the sexes due to mating
systems (Zuk, 1990, Zuk and McKean, 1996, McCurdy et al., 1998). In the Seychelles
warbler, females incubating eggs may be more susceptible to being bitten by vectors
than males (Atkinson and van Riper, 1991, Komdeur et al., 1997). On the other hand the
immune system of males may be suppressed by the male sex hormones. That there was
no overall difference between the sexes in infection rates for adults could suggest that
these various effects may balance each other out, however the more parsimonious
explanation is that neither effect occurs. In the juvenile Seychelles warbler there is no
known difference in behaviour that would lead to one sex having greater exposure to
vectors, nor would we expect these juveniles to be affected by sex hormones that may
decrease resistance to infection. Again there is no difference in malaria infection rates
between the sexes
- 97 -
4.5.6 Malaria and dominance status
Both reproduction and immune defence are costly (Williams, 1966, Sheldon and
Verhulst, 1996) and investment in reproduction may lead to a trade-off with defence
against parasites. There are a number of studies that show evidence for such a trade-off
in birds (Gustafsson et al., 1994, Norris et al., 1994, Richner et al., 1995, Merino et al.,
2000). Consequently, we may expect this trade-off between reproduction and immune
defence to lead to a difference in prevalence of malaria between breeding and nonbreeding adult birds. The Seychelles warbler provides an opportunity to investigate this
trade-off because it is a facultative cooperative breeder (Komdeur, 1992), in which
some individuals, normally females (Komdeur, 1996a, Richardson et al., 2001) act as
subordinates. Dominant birds engage in breeding activity, while subordinates may act as
helpers, but do not breed themselves. In this situation we may therefore predict that the
higher levels of investment in breeding activity by dominant Seychelles warblers may
make them more susceptible to infection than subordinates. However, there was no
difference in malaria prevalence between dominants or subordinates even after
controlling for age. This may be due to the fact that the division of breeding between
dominant and subordinate birds is not as clear cut as initially thought; up to 44% of
subordinate females joint nest (Richardson et al., 2001) and therefore may be investing
in breeding although only a subordinate. Furthermore it is not known whether acting as
a helper is costly in terms of resources allocated to immune defence. As the relative
levels of investments made by dominant and subordinate birds may not be
straightforward, the trade-off between reproduction and immune defence may differ
between individuals.
4.5.7 Seasonality of malaria prevalence
There are a number of examples of seasonality in avian blood parasites (Weatherhead
and Bennett, 1991, Weatherhead and Bennett, 1992, Allander and Sundberg, 1997,
Deviche et al., 2001, Schrader et al., 2003, Cosgrove et al., 2008) and several
mechanisms have been suggested to be the cause of this (reviewed in Altizer et al.,
2006). In vector-borne diseases such as malaria, seasonal variations in climatic
conditions such as temperature or rainfall can affect the abundance or activity of insect
vectors (Smith et al., 2004, Freed et al., 2005, VanderWerf et al., 2006). Malaria
seasonality may also be linked to host reproduction; short synchronised breeding
seasons mean a rapid increase in the number of susceptible juvenile hosts available, and
- 98 -
therefore an increase in parasite prevalence. As a result of this influx of new susceptible
hosts into the population, levels of ‘herd immunity’ - the proportion of individuals with
immunity within a population (John and Samuel, 2000) - could decline, leading to
greater chance of infection in susceptible adults. Seasonality in breeding can also lead to
‘spring relapse’, where an increase in intensity of malaria infection coincides with the
beginning of the breeding season (Applegate and Beaudoin, 1970, Applegate, 1971).
While the mechanism is unknown, there is evidence of a relationship with
corticosterone levels (Applegate and Beaudoin, 1970), and the timing of relapse
indicates a relationship with reproductive activity. Finally, trade-offs between
reproduction and immune defence, as suggested above, could also lead to differences in
parasitism in adults between the breeding and non-breeding seasons. Although the
Seychelles warbler does have relatively short set breeding seasons (Komdeur, 1996b)
with escalated levels of testosterone in breeding males (Brouwer, 2007), no seasonal
difference in malarial prevalence was found. So at least in the Seychelles warbler this
does not seem to be the case.
Vector distribution is an important determinant of geographical variation in malaria
prevalence in an area (Super and van Riper C, 1995, Sol et al., 2000). The territory
quality index used in the Seychelles warbler study is based on the density of prey
insects in the territory (Komdeur, 1994b). High quality territories have a high number of
prey items, but will also probably have a high density of malaria vectors.
Consequentially we may expect to find a correlation between territory quality and
malaria prevalence in the resident birds, but no such correlation was found. This finding
could be confounded, as better territories may be occupied by fitter, more resistant
individuals. However it is not currently possible to disentangle these effects.
Habitats with high salinity have also been shown to have lower prevalence of blood
parasites, perhaps due to the inability of vectors to survive such an environment
(Figuerola, 1999). Significantly lower feather mite loads have been found on Seychelles
warblers living in parts of Cousin Island with high salinity caused by the penetration of
wind blown salt spray into the island (Dowling et al., 2001a). Although the distribution
of the specific biting fly vector that transmits the GRW1 strain on Cousin is unknown,
we may predict that its prevalence, and therefore the prevalence of the malaria in the
Seychelles warbler, may be lower in the coastal areas affected by salt spray. However
- 99 -
no difference in malaria prevalence between coastal and inland territories was found.
This may be because the area affected by salt spray changes between the two seasons,
which are characterised by changes in wind direction.
4.5.8 Group size and parasite prevalence
Living in groups may increase the chances of parasitism (Alexander, 1974, Cote and
Poulin, 1995), as increased density of hosts increases the rate of parasite transmission
(Anderson and May, 1979). In birds, this is suggested to explain the increase in
parasitism with levels of coloniality seen in a number of studies (Brown and Brown,
1986, Rozsa et al., 1996, Tella, 2002). Similarly cooperatively breeding species, which
live and interact at higher local densities, may be subject to higher rates of parasitism
than pair breeding species. Indeed, there is some evidence that cooperatively breeding
birds may invest more in parasite defence than pair breeding birds (Spottiswoode, 2008)
and Whiteman and Parker (2004) found ectoparasite infection increased with group size
in cooperatively breeding Galapagos hawks (Buteo galapogoensis). In contrast, there
was no effect of group size on presence of malaria in the Seychelles warbler. Much of
the evidence for increased risk of parasitism in groups comes from directly transmitted
parasites; however malaria is indirectly transmitted through vectors, and the way in
which group size affects transmission will clearly differ as a result. In a vector
transmitted parasite, group size may affect infection risk in two ways: i) by an encounter
dilution effect, where living in large groups decreases the risk of any given individual
being bitten by an infected vector; or ii) by a heightened chance of being bitten, due to
the increased attractiveness of higher densities of birds to vectors, such as mosquitoes,
that rely on olfactory cues to find prey (e.g Allan et al., 2006). Some studies do suggest
a link between group size and indirectly transmitted parasites. For example malaria
prevalence increases with group size in primates (Davies et al., 1991, Nunn and
Heymann, 2005) and Tella (2002) showed blood parasite prevalence, as well as species
richness, was greater in colonial bird species than non-colonial species. However, there
are no studies I am aware of that have looked at prevalence of blood parasites in relation
to group size within a single bird species, and therefore it is unknown how this result
compares with malaria infection in other cooperatively breeding species.
- 100 -
4.5.9 Survival effects of malaria
Blood parasites have the potential to have detrimental effects on health and fitness, and
ultimately survival, of their host (Valkiunas, 2005). While laboratory studies have
shown significant pathological effects of Plasmodium, there are few reports of
pathogenic effects of Haemoproteus, perhaps due to the difficulty of transmitting the
parasites to hosts in experimental conditions (Atkinson and van Riper, 1991). In the
Seychelles warbler, body condition was measured as body mass relative to tarsus
length, but there was no correlation between this measure and malarial infection. This is
in agreement with other studies, which have also found no effect of blood parasite
infection on body mass in birds (Bennett et al., 1988, Dale et al., 1996, Allander and
Sundberg, 1997, Deviche et al., 2001).
There was also no relationship between malaria prevalence in a given year and the
overall survival rate for that year for either juveniles or adults. Nor did we detect an
effect of malaria on adult or juvenile survival in the Seychelles warbler. In the survival
analysis, which focused on juvenile infection and its impact on survival, the ‘unknown
group’ which consisted of birds ringed in the nest but never caught again, had lower
survival. This is in part due to the nature of the group; most of these birds are never
caught because they have died before the next field season. Although their death may be
due to various reasons, it is possible that they may have died of malaria. Furthermore,
during malaria infection, the initial acute period of infection (during which birds will be
inactive and difficult to catch, Valkiunas, 2005) is followed by a long tail of chronic or
latent infections characterised by low levels of parasitaemia (Atkinson and van Riper,
1991). Consequently, it is likely that any birds that show infection when sampled are
those birds that have already survived the acute phase of the infection and have
recovered to join the active population, albeit with a chronic infection. Therefore in the
Seychelles warbler, the infected sampled individuals may be those that have already
survived, while those without infection may be a mix of individuals that have cleared
the infection or individuals that have not yet been infected. If there is an impact of
malaria on survival in the Seychelles warbler, it is likely to be found in the unknown
group, where it will be difficult to separate from any of the other possible causes of
mortality. Controlled infection experiments are required to properly assess the impact of
this malaria infection on the Seychelles warbler, but obviously this is not an option in
this endangered species. The lack of a detectable effect of malaria on survival in the
- 101 -
Seychelles warbler is consistent with other studies of malaria in wild populations
(Weatherhead, 1990, Weatherhead and Bennett, 1992, Davidar and Morton, 1993,
Siikamaki et al., 1997, but see Sorci and Moller, 1997, Sol et al., 2003, Bensch et al.,
2007). While Dawson and Bortolitti (2000) found return rates lower in American
kestrels (Falco sparverius) with high intensity of malaria infections, they were unable to
separate a potential survival effect from increased dispersal. As in the Seychelles
warbler, many of the studies are based on birds diagnosed with chronic infection
(Valkiunas, 2005) and may therefore not capture the initial impact of malaria in acutely
infected individuals.
4.5.10 Conclusions
Overall the results of this study of malaria infection in the Seychelles warbler show that
this species is only infected by one strain of Heamoproteus malaria (GRW1) which does
not appear to be highly pathogenic (at least in that many individuals survive with a
chronic infection). Infection prevalence decreased with age; while an effect of selective
mortality cannot totally be ruled out, many individuals do appear to gain acquired
immunity. Very old individuals seem to suffer increased prevalence, probably due to
immunosenescence. More detailed analysis of infection intensity may give a further
level of detail needed to clarify the effects of malaria infection in this species.
- 102 -
Chapter 5
Conservation translocation and the enemy release
hypothesis: Evidence from an endemic island
population
- 103 -
5.1 Abstract
The enemy release hypothesis seeks to explain why some invasive species are so
successful in non-native habitats. It states that when a species is introduced into a new
area it is able to escape its natural enemies, such as herbivores or pathogens (parasites
and diseases), allowing its population to increase and thrive as a result of decreased
regulation by its enemies. Parasite-free founders, small founding populations, and lack
of appropriate vectors can all lead to enemy release. Most of the evidence for enemy
release comes from studies of introduced species, but no studies have looked for
evidence of enemy release as a result of conservation translocations. Three new
populations of Seychelles warbler (Acrocephalus sechellensis) were established by
translocation in 1988 (Aride Island), 1990 (Cousine Island) and 2004 (Denis Island) as
part of a conservation programme for this species. All populations were founded from
the last surviving population on Cousin Island in which a single lineage (GRW1) of the
blood parasite Haemoproteus, which causes malaria, was found. Between 2003 and
2007 all translocated populations were screened for malaria. The Cousine Island
population was found to have a similar prevalence of malaria (47%) as the Cousin
population (33%). However, no malaria was found on Aride and Denis Islands. Malaria
prevalence in the most recently established population on the island of Denis was
measured in the founding individuals prior to translocation, and in the following three
years (including birds born on Denis). This data allows the process of enemy release to
be followed, and determine the likely mechanisms which contributed to enemy release
in this population. On Denis, malaria decreased over a three year period until no longer
found, and no birds born on Denis became infected with malaria. Therefore it is most
likely the lack of transmission of malaria on the islands, probably due to lack of
intermediate vector, which lead to malaria extinction in this case. This finding may have
important conservation implications. Lack of previous exposure to malaria may leave
the populations vulnerable to introduced disease, and lack of parasite-mediated selection
may lead to the loss of genetic diversity. Alternatively, these malaria-free islands could
provide important ‘refuge’ populations in the event of the introduction of a new strain
of malaria. A final consideration is that the loss of a parasite species during and after
translocation can be interpreted as a loss of important biodiversity.
- 104 -
5.2 Introduction
Invasive species can have a significant impact on native ecosystems (Mack et al., 2000,
Sakai et al., 2001) and are believed to be an important cause of global biodiversity loss
(Vitousek et al., 1997). One possible explanation as to why some invasive species are so
successful in non-native habitats is the enemy release hypothesis. It states that when a
species is introduced into a new area it is able to escape its natural enemies, such as
herbivores or pathogens (parasites and diseases), allowing it’s population to increase
and thrive as a result of decreased regulation by its enemies (Keane and Crawley, 2002).
This release from pathogens may occur for several reasons; 1) the initial population size
of founding individuals may be few, and so more likely to be pathogen free (Clay,
2003), 2) small founding populations may be unable to support a pathogen population
(Hudson et al., 2001), thus resulting in the extinction of any pathogens brought with the
introduced population, and 3) pathogens with indirect life cycles require the presence of
an intermediate host, which may not be available in the new location (Clay, 2003).
Numerous studies have provided evidence to support the enemy release hypothesis
across a range of taxonomic groups (see review in Keane and Crawley, 2002, Liu and
Stiling, 2006), including introduced bird species (Dobson and May, 1986, but see
Colautti et al., 2005, Macleod et al., 2005, Ishtiaq et al., 2006). However, all of these
studies focus on exotic species introduced by man. Few studies have looked at those
species which have expanded their range naturally (Menendez et al., 2008), and to my
knowledge none have looked at those translocated for conservation reasons. Such
translocations are an important tool in conserving threatened species/populations
(Griffith et al., 1989, Fischer and Lindenmayer, 2000, Seddon et al., 2007) and have
helped in the recovery of a great number and variety of species (Griffith et al., 1989,
Lovegrove, 1996, Pierre, 1999, Shah and Parr, 1999, Abbot, 2000, Fischer and
Lindenmayer, 2000, Wolf et al., 2002, López-Sepulcre et al., 2008). Much work has,
quite rightly, focused on the impact of any novel pathogens that translocated species
may encounter in their new environment (Cunningham, 1996). This is an important part
of any pre-translocation assessment of the suitability of the new habitat (Mathews et al.,
2006). However, such conservation translocations also have the potential to result in
enemy release for the species translocated, a concept that has received almost no
attention.
- 105 -
The reasons that translocated species may escape their enemies are generally the
same as those discussed above for invasive species. However, when dealing with rare
species the numbers of individuals that can be translocated are, by definition, relatively
low, so the effects due to small population sizes are exacerbated. With such small
numbers of individuals there is a higher chance that any pathogen may not be
transferred with them (Fischer and Lindenmayer, 2000) and less chance of the founding
population being able to support any pathogens (Hudson et al., 2001). Furthermore,
some conservation practices, e.g. only transferring the healthiest, uninfected individuals
(Mathews et al., 2006) may actually facilitate enemy release. Finally, the recipient area
may have been chosen, at least in part, because it contains fewer pathogens to threaten
the translocated individuals. This may be because there are few intermediate vectors in
that area, which would, in turn, reduce the likelihood that the habitat contains the
intermediate vectors required to transmit the translocated pathogens.
To my knowledge there are no studies which assess whether wildlife translocations
result in loss of enemies. Loss of pathogens may initially appear advantageous in
ensuring the survival of endangered species, protecting against losses due to disease.
Enemy release may increase the likelihood of establishment of translocated populations,
as it is hypothesised to do in some invasive species (Keane and Crawley, 2002, but see
Drake, 2003, Mitchell and Power, 2003, Torchin et al., 2003). However, disease is
considered to be important in the maintenance of genetic diversity (Jeffery and
Bangham, 2000) which may be of critical importance to the long term survival of
species (review in Frankham, 2005). Furthermore, pathogens can also be important in
ecosystem functioning (Hudson et al., 2006) and loss of such species, which may be
unique to their host, is, in effect, a loss of biodiversity (Windsor, 1995).
The Seychelles warbler (Acrocephalus sechellensis) is a small passerine endemic to
the islands of the Seychelles in the western Indian Ocean. The species has undergone a
severe population bottleneck, with the entire world population consisting of 25-29
individuals confined to Cousin Island during the middle of the last century (VeseyFitzgerald, 1940, Crook, 1960, Loustau-Lalanne, 1968). Conservation management of
Cousin Island has since seen the population recover, and the island has been at carrying
capacity since 1982 (Komdeur, 1992), with the population stable at ca. 340 individuals
(Brouwer, 2007). In order to further safeguard the species and allow population
- 106 -
expansion, translocations have been carried out to three other islands; Aride Island in
1988, Cousine Island in 1990 (Komdeur, 1994a) and Denis Island in 2004 (Richardson
et al., 2006). These translocations have succeeded in increasing the size of the entire
population to ca. 3,000 individuals by the end of 2008 (D.S. Richardson pers. comm.).
Previous work has shown there is a very limited pathogen fauna in the Seychelles
warbler; it has no gastrointestinal parasites (chapter 2) and is host to just one strain of
malaria, the GRW1 strain of Haemoproteus payevskyi (chapter 4). This limited parasite
fauna is thought to be due to previous episodes of enemy release in the species, due to
historical host population bottlenecks (chapter 3).
The translocation of the Seychelles warbler to new islands now provides an
opportunity to investigate how conservation based translocations have affected the
already limited pathogen fauna of this species. Here prevalence of Haemoproteus (from
now on referred to as malaria) was measured in the three translocated populations of
Cousine, Aride and Denis Islands, and compared them to the founding Cousin Island
population, to assess any changes in malaria prevalence and to look for evidence of
enemy release in this species. Importantly, blood samples from a large proportion of the
individuals moved to Denis Island in 2004, and from the growing population over the
next three years, are available. These samples can be used to investigate levels of
malaria in both the translocated and the subsequently expanding population. This will
allow investigation of the factors that could play a role in any loss of pathogens in the
Seychelles warbler.
5.3 Methods
5.3.1 Translocations
Cousin Island (29ha) was the last known population of the Seychelles warbler during
the historical population bottleneck that nearly drove this species to extinction, before
translocations to other islands increased the population range. Twenty-nine birds were
translocated to Aride Island (68ha, 9km from Cousin) in 1988, a further 29 to Cousine
Island (26ha, 2.1 km) in 1990 (Richardson et al., 2006) and 58 birds were translocated
to Denis Island (144ha, 35km) in 2004 (Betts, 1998). The Denis translocation was
carried out by Nature Seychelles as part of their conservation program for this species.
There is almost no migration between the islands (0.1%). Only two cases have been
- 107 -
recorded, both between the relatively close islands of Cousin and Cousine (Komdeur et
al., 2004a). The population on Aride was estimated at >1600 birds in 1997 (Komdeur et
al., 1997) and Cousine was estimated at 200 birds in 2007, and the population on Denis
was estimated at between 120-140 individuals in 2007 (J. van de Crommenacker, pers.
comm.). All translocations used birds from the founder population on Cousin Island.
5.3.2 Catching
Birds were caught using mist nets. Unringed birds were ringed using a unique
combination of three UV resistant colour rings, and a metal British Trust for
Ornithology (BTO) ring for identification. Measurements of wing, tarsus and head-bill
were made. A small (ca. 50 µl) blood sample was taken from each bird by brachial
venipuncture and stored in 800 µl of 100% ethanol at room temperature in a 2 ml
microcentrifuge tube, for later molecular genotyping and sexing. Blood samples were
collected in 2003 (9 individuals) and 2005 (38 individuals) from Aride; from 2003 (11
individuals), 2005 (77 individuals) and 2006 (68 individuals) from Cousine; and from
2004-2007 from Denis. Twenty nine of the 58 translocated individuals were sampled
either one day prior or on the day of translocation. Where samples of birds had not been
taken directly prior to translocation, samples were screened from 2002 (nine samples)
and 2003 (12 samples). While these earlier samples may differ from infection status at
the time of translocation, as most individuals are infected as juveniles, and 53% of these
individuals later test negative for malaria (chapter 4) then this is likely to be a
conservative estimate of malaria prevalence within the founding Denis population at the
time of translocation. On Denis the population grew rapidly over the three year period,
therefore the percentage of the population screened and overall malaria prevalence was
calculated using the measured population size for that year. On Cousin, Aride and
Cousine it was calculated using average population size.
5.3.3 Malaria Analysis
DNA was extracted from blood using a salt extraction technique as in Richardson et al
(2001). Samples were screened for malaria using the nested polymerase chain reaction
(PCR) method described in Hellgren (2004). The PCR was run using 20 ng of DNA for
each sample. This method consists of an initial amplification over 20 cycles using the
primers HeamNF1 and HeamNR3, which amplified a 617bp fragment. The second
amplification used 2 µl of the first PCR reaction as a template and consisted of 35
- 108 -
cycles using the primers HeamF and HeamR2, which target a 479bp section of the
cytochrome b gene of Haemoproteus and Plasmodium. All conditions were as in
Hellgren et al (2004). Negative and positive controls were included in all runs. All
samples were run at least twice on separate plates
Previous analysis has shown the Cousin Island population to be host to only one
strain of malaria (chapter 4). Ten positive samples were sequenced to identify the
species or strain of malaria present in the translocated populations. Samples were
sequenced using Big Dye terminator kit v3.1 (Applied Biosystems). The sequencing
reaction was as follows; 1 µl Big Dye, 1,5 µl sequencing buffer, 0.5 µl HeamF or
HeamR2 primer (10 µM), 5 µl H2O, and 2 µl template, thermal profile was 25 cycles of
96˚C for 10 sec, 50˚C for 5 sec, and 60˚C for 4 min. Sequences were analysed on
ABI3730 sequencer (Applied Biosystems). Sequences found were BLAST searched
using the National Centre for Biotechnology (NCBI) gene bank database.
5.3.4 Statistical analysis
Generalized linear mixed effects model were fitted using R (R development Core Team
2006) and the package lme4 (Bates, 2007).
5.4 Results
5.4.1 Number of samples screened
Table 5.1 shows the total number of samples (not prevalence) screened for malaria, and
the percentage of the total population each year in all populations this represents.
- 109 -
Number sampled (% of total population)
Year
Cousine
Aride
Translocated Born on
to Denis
Denis
Cousin
1994 -
-
76 (24%)
1995 -
-
122 (38%)
1996 -
-
56 (18%)
1997 -
-
121 (38%)
1998 -
-
129(40%)
1999 -
-
125 (39%)
2000 -
-
44 (14%)
2001 -
-
21 (7%)
2002 -
-
147 (46%)
2003 11 (6%)
9 (0.6%)
81 (25%)
2004 -
-
50 (86%*)
3 (75% †)
2005 71 (35%)
38(2%)
6 (11% *)
31 (84% †)
2006 68 (35%)
-
5( 9% *)
49 (64% †)
94(29%)
-
28 (28% †)
136(43%)
2007 119 (60%) 2008 -
-
-
79 (25%)
Table 5.1 Number of samples screened for malaria and percentage of the total island population this
represents in brackets. On Denis the population grew rapidly over the three year period, therefore
the percentage of the population screened was calculated using the measured population size for that
year. On Cousin, Aride and Cousine it was calculated using average population size.
*%
of total birds translocated to Denis. † % of total birds born on Denis.
5.4.2 Malaria prevalence on all islands
Figure 5.1 shows the prevalence of malaria within each population over the years. The
prevalence of malaria in the adult Cousin population fluctuated between 15% and 53%
between years, with a mean of 33%. On the neighbouring island of Cousine the
prevalence of malaria was between 32-54% from 2003 until 2006, with a mean of 47%.
A generalized linear model (with individual and year as random factors) showed no
difference in prevalence between Cousin and Cousine during years where data was
available for both islands (2003, 2006 and 2007, n=280, Z=-0.26, P=0.79). In contrast,
no malaria was found in the Aride population in either 2003 or 2005. The founding
birds translocated to Denis in 2004 had a malaria prevalence of 40%; however the
prevalence in samples of the population taken each year declined rapidly thereafter until
- 110 -
no birds were found to be infected with malaria in both 2006 and 2007 (Figure 5.1). Of
the 91 sampled individuals that were born on Denis, none were infected with malaria.
Cousin
80
Cousine
Aride
70
Translocated to Denis
Born on Denis
Malaria prevalence %
60
50
40
30
20
10
0
1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008
Year
Figure 5.1 Mean malaria prevalence in Cousin, Aride, Denis (translocated and born on Denis) and
Cousine Island populations, from 1994 until 2007.
5.4.3 Malaria strain/species in the Cousine population
Ten positive samples from Cousine were sequenced to identify the strain of malaria in
this population Only one strain of malaria, the GRW1 strain of Haemoproteus
payevskyi, was found in the Cousine population, which is the same strain found in the
Cousin population (chapter 4). Therefore all infected birds translocated to Denis also
carried only this strain.
- 111 -
5.5 Discussion
All of the new Seychelles warbler populations were founded by individuals from
Cousin Island, in which a single strain of malaria is consistently found at a mean
prevalence of 33%. The Aride and Denis Island populations both appear to be no longer
infected with malaria, while the population on Cousine has the same strain of malaria as
on Cousin, and there is no significant difference in prevalence between the islands.
These results indicate that wildlife translocations can result in enemy release and that
this can result in populations of a species which are, apparently, free of major
pathogens. It cannot be determined why the malaria parasite is not present on Aride, as
it is unknown how many infected birds were translocated to this island (no samples
were taken from the originally translocated birds in 1988). However, the process of
enemy release can be seen in action during the establishment of the Denis Island
population, where the prevalence of malaria decreases over a three year period until the
pathogen is no longer found, and no malaria was found in birds subsequently born on
the island. In this case, it is the lack of transmission of the pathogen on the new islands,
probably as a result of the intermediate vector being absent, that leads to the pathogens
extinction, and not the lack of the pathogen in the translocated individuals.
5.5.1 Evidence for enemy release
The majority of evidence for enemy release comes from exotic plants escaping
specialised herbivores (Dobson and May, 1986, Kennedy and Bush, 1994, but see
Colautti et al., 2005, Macleod et al., 2005). However, there are also many good
examples of vertebrates escaping their pathogen enemies. For example, a greater species
richness of a wide range of parasites (gut, blood and ectoparasites) was found in the
Puerto Rican tree frog (Eleutherodactylus coqui) in their native range in comparison to
their introduced habitat in Hawaii (Marr et al., 2007). The same result was found in
Barbary ground squirrels (Atlantoxerus getalus) where the native Moroccan population
had less gut helminth species compared to the introduced island population (LopezDarias et al., 2008). Ishtiaq et al (2006) found evidence of release from blood parasites
in native versus introduced common mynas (Acridotheres tristis), although the
difference seemed to be driven mainly by low parasite prevalence on two oceanic
islands, and not among all introduced populations. The most compelling overall
evidence though comes from two studies that surveyed a wide range of plants and
- 112 -
animals species and found that, as predicted, species suffered less parasitism in their
introduced, compared to their native, ranges (Mitchell and Power, 2003, Torchin et al.,
2003).
All the studies mentioned above focus on introduced, exotic species. Very few
studies have looked at those species which have expanded their natural range, or island
species colonizing new islands, although Menendez et al (2008) showed evidence of
enemy release in the Brown Argus butterfly (Aricia agestis) that had increased their
range northwards due to climate change. The assessment of malaria prevalence in
translocated populations of the Seychelles warbler described in the present study is, to
my knowledge, the first to show enemy release occurring in an island species that has
been translocated to new areas as part of a conservation translocation.
As mentioned in the introduction, there are several different ways populations can
escape their pathogens. The first possibility is that the founders may not have carried the
pathogen with them to the new range (Clay, 2003). In 2004 the founders of the Denis
population had a malaria prevalence of 44% prior to being moved to Denis. Thereafter
prevalence in the establishing population declined rapidly until no malaria was found in
either 2006 or 2007. Therefore in the case of the Denis translocation, malaria was
moved with the translocated birds. It is unknown if the founders of the Aride population
carried malaria with them. However, both Aride and Cousine were founded with the
same number of birds (29) within a couple of years of each other, and the Cousine
population contains the same strain and prevalence of malaria as on Cousin. As there is
almost no migration of warblers between islands (Komdeur et al., 2004a) it seems
unlikely that the malaria strain reached Cousine after the translocation through the
natural dispersal of birds from Cousin. It is also theoretically possible that the dispersal
of infected vectors between islands could have brought malaria to Cousine (2 km from
Cousin) after the translocation. However, the most parsimonious explanation is that
malaria was translocated to Cousine (and Aride) in the founding population, as it was to
Denis, and that it has since died out on Aride but not Cousine. It can therefore be
concluded that a lack of the pathogen in translocated birds is not the cause of the enemy
release seen in the Seychelles warbler.
- 113 -
It has also been suggested that enemy release may be a result of founding
populations that are too small to maintain the pathogen community (Torchin et al.,
2002). Pathogens require a minimum threshold host population size, below which they
cannot persist (reviewed in Hudson et al., 2001). For example, in the Gunners Quion
night gecko (Nactus coindemirensis), the coccidia of this island species are thought to
have been lost when a bottleneck caused the population size to decrease beneath the
threshold that allowed maintenance of the pathogen population (Leinwand et al., 2005).
In the Seychelles warbler, low founding population sizes may have caused the loss of
malaria in the translocated populations. However, the fact that Cousine Island was
founded with an equally small number of individuals as Aride (and half the number
moved to Denis) and malaria has persisted in these other populations argues against
this. The original Cousin Island population has also experienced a long bottleneck
(Vesey-Fitzgerald, 1940, Crook, 1960, Loustau-Lalanne, 1968), at lower population
levels than seen in the translocated populations, without malaria being lost. Therefore it
seems unlikely that low population size would have caused loss of malaria on Denis and
Aride, but not on Cousine and Cousin.
As well as population size, there is evidence that low population densities will lead
to low pathogen abundance (May and Anderson, 1979, Anderson and May, 1982,
Arneberg et al., 1998). In low density host populations, transmission between
individuals is low and could lead to pathogen extinction within the population. Evidence
for this has been shown across host species. For example, Morand and Poulin (1988)
showed helminth parasites species richness to be positively correlated with host density
in terrestrial mammal species. In a comparative study of strongylid nematodes in
mammal species, parasite abundance was highest in the species with the highest
population densities (Arneberg et al., 1998). These examples consider helminth
parasites which often have direct life cycles and the pattern may be different in
indirectly transmitted pathogens. For example, Arneberg (2001) found no relationship
between host density and abundance of indirectly transmitted pathogens. However
colonial birds, who typically live at high population densities, do have a greater
abundance of blood parasites (with indirect life cycles), than non-colonial birds (Tella,
2002). These data do, therefore, generally suggest that lower densities may reduce the
transmission of pathogens whether they are directly or indirectly transmitted. Both
Denis and Aride are relatively large islands (144 ha and 68 ha respectively) compared to
- 114 -
Cousin and Cousine Island which are much smaller (29 and 26 ha respectively). It may
be expected that the initial translocations to Denis and Aride resulted in lower
population densities than on Cousine and that this could be the cause of the loss of
malaria. However, monitoring of the initial populations on the islands shows that this
was not the case. On both Aride and Denis the initial territories were restricted to single
small high quality areas on both islands (Komdeur, 1994a, Brouwer, 2007), resulting in
much higher than expected population densities similar to those observed on the smaller
islands (Komdeur et al., 1995). Furthermore, the Cousin Island population was at low
density during the bottleneck during the middle of last century, therefore the malaria
parasite has previously survived very low population densities over much longer time
frames. All this evidence suggests that the absence of malaria on Denis and Aride is
probably not due to low population density.
The final possible reason for the lack of malaria on Denis and Aride is that the
appropriate insect vectors are lacking. Haemoproteus sp are transmitted by biting
midges Culicoides sp and louse flies Hippobascidae sp (Atkinson, 1991, Friend et al.,
1999). It is known that various different species that may act as vectors are found on the
different Seychelles islands (pers obs.). Unfortunately, it is not currently known which
specific vector is transmitting the GRW1 strain of H. payevskyi found in the Seychelles
warbler, or what the distribution of this vector across the different islands is. Surveys of
possible arthropod vector on each of the islands would give a clearer picture as to
whether a lack of intermediate vectors caused the loss of malaria from these
populations. However, as there is evidence that only specific strains of intermediate
vectors may transmit specific malaria strains (Hellgren et al., 2008) a lot more work
may need to be done to determine if the vectors on Denis can transmit the GRW1 strain.
Despite birds known to be infected with malaria being translocated to Denis, the
infection has not been transmitted to any of the birds born on the island. Along with
anecdotal evidence that the diversity of biting flies on Denis Island is less than on other
islands (D.Richardson pers. comm), this suggests that the loss of malaria on Denis, and
perhaps on Aride, is due to the lack of the relevant intermediate vector on these islands.
It is worth noting that sample size may have affected these results. While samples from
Cousine are of a similar size as those taken from Cousin, and can be considered
representative samples, samples obtained from Aride equate to only 2% of the total
- 115 -
population. This means the sample may not give a representative prevalence of malaria
in the Aride population, and a greater number of individuals would need to be sampled
in order to fully assess malaria prevalence within this population. However, that all 47
birds sampled were free of malaria is a good indications that malaria may be, at least, at
low prevalence within the population. It is also important to note that founding
individuals translocated to Denis make up a decreasing proportion of the total
population over time as these individuals die. Therefore the “translocated to Denis”
group seen in figure 5.1 shows a decreasing sample size as the group declines in size,
and as a result this may affect estimates of prevalence in this group. Despite this, birds
born on Denis have been sampled at larger sample sizes (average of 63% of total size)
and a lack of malaria in this group indicates a lack of transmission, and therefore we
expect total malaria prevalence to decrease as the founding individuals make up a
decreasing proportion of the total population.
5.5.2 Implications of loss of pathogens
The loss of pathogens in translocated populations, as seen here in the Seychelles
warbler, may have important conservation implications. The enemy release hypothesis
has been cited as an explanation for the success of some invasive species, increasing the
chances of establishment in a new area (Keane and Crawley, 2002, Mitchell and Power,
2003, Torchin et al., 2003). Therefore, it is possible that a reduced pathogen fauna could
increase the chances of translocations succeeding in creating viable populations.
However, Drake (2003) formulated a model that indicates that the enemy release
hypothesis may not affect the chances of establishment in a new range. The
translocations of Seychelles warbler to new islands has been very successful in all three
cases (Komdeur, 1994a, Komdeur and Pels, 2005, Brouwer, 2007) irrespective of
whether the population escaped malaria or not (though the sample size of three
populations is to low for any meaningful comparison). The Cousin population rapidly
increased to carrying capacity after the bottleneck as soon as the habitat was allowed to
recover, despite high malaria prevalence. Therefore it seems unlikely that the loss of
malaria was of any great benefit to the establishment of new populations in this species.
On the other hand enemy release could have detrimental effects on translocated
populations. The loss of pathogens may result in pathogen naïve populations, which
may then be more susceptible to introduced pathogens in the long run. Pathogens such
- 116 -
as malaria can have devastating effects on naïve species, the most obvious example
being the impact of malaria on endemic Hawaiian birds (Warner, 1968, van Riper et al.,
1986). Native honeycreepers are more susceptible to malaria than introduced birds (van
Riper et al., 1986, Atkinson et al., 1995) and this appears to have contributed to the
decline (and extinction) of these species. Disease outbreaks in naïve populations may
have had conservation implications for a number of other species. A review by Wikelski
et al (2004) shows pathogens have had a conservation impact across a variety of island
species of birds, mammals and reptiles. The problems arise from a lack of previous
contact with the pathogen. If a population is released from its pathogen, there is no hostpathogen coevolution; if the pathogen is later reintroduced then the population may
have reduced ability to fight the particular infection (Cunningham, 1996). Furthermore,
pathogen mediated balancing selection is thought to maintain important variation in
genes involved in the immune system, e.g. the major histocompatibility complex genes
(Hess and Edwards, 2002, Piertney and Oliver, 2006). Consequently, a lack of pathogen
in a small, newly established population, may ultimately result in the loss of genetic
diversity important in dealing with a variety of pathogens, not just those lost during
enemy release (Beadell et al., 2007). This decreased genetic diversity, in particular low
MHC diversity, may leave such populations vulnerable to disease (O'Brian and
Evermann, 1988).
The Seychelles warbler has been shown to have low levels of microsatellite
diversity (Richardson et al., 2000) and low levels of MHC class II diversity (chapter 2),
but relatively high levels of MHC class I diversity (Richardson and Westerdahl, 2003,
Hansson and Richardson, 2005). The different classes of MHC (class I and II) are
thought to be involved in defence against different kinds of pathogens (intra- and intercellular pathogens respectively, Hess and Edwards, 2002). It is, therefore, intriguing to
note that the low MHC class II diversity found in the Seychelles warbler coincides with
the fact that this species appears to harbour no obvious intracellular parasites, such as
gastrointestinal parasites (chapter 3). While on the other hand, the presence of intracellular pathogens in the Seychelles warbler, at least the single strain of malaria that
persists in the original population, coincides with relatively high levels of MHC class I
diversity that appears to have been maintained by selection (Richardson and
Westerdahl, 2003). With little or no pathogen mediated selection pressures to maintain
MHC variation, enemy release in the translocated populations may lead to the loss of
- 117 -
this remaining diversity. Further work is now needed to assess whether such a loss of
MHC diversity is, or has occurred in the malaria free populations, especially on Aride
which may have already been free of malaria for nearly 20 years (ca. eight generations).
Previous analysis on Cousin Island has shown that juvenile Seychelles warblers
have a very high prevalence of malaria; while measured prevalence in juveniles is 75%,
it is likely that the majority of juveniles are exposed to malaria at some point (chapter
4). After initial acute infection stages, malaria infections can become chronic or latent,
where parasitaemia is at a low level and there is little or no signs of infection (Atkinson
and van Riper, 1991). High juvenile prevalence means that most of the adult birds have
survived the acute phase. On Denis and Aride, the adult birds have not been through
such a selection process and will have no resistance to the malaria should it reach the
population at a later date. This could potentially have devastating effects, as all of the
population will then be susceptible at one point.
While adult birds with chronic infection may suffer relapses as a result of
environmental or physiological stresses (Redmond, 1939, Cohen, 1973, Maitland et al.,
1997), they may also develop a degree of resistance to reinfection. Chronic infection
may confer some resistance to new strains or species of malaria. Cross-species or strain
immunity means a host previously infected with one malaria strain may provide crossimmunity with other strains (Perkins, 2000, Bensch et al., 2004, Sehgal et al., 2006,
Steinauer et al., 2007). Therefore, if a new malaria pathogen was to be introduced, the
population may have little resistance. Alternatively, if such an introduction were to
occur, malaria free islands could be of benefit to an endangered island species such as
the Seychelles warbler. If the new islands do indeed lack the appropriate vectors to
transmit avian malaria, then these populations may provide important ‘refuge’
populations for endangered species if a new malarial pathogen was introduced.
A final consideration in regards to enemy release and conservation is the loss of the
pathogen itself. Recent molecular work has shown that there is an incredible amount of
cryptic diversity within pathogens such as avian malaria (but see Jousson et al., 2000,
Johnson et al., 2002, Steinauer et al., 2007, Dabert et al., 2008). Many of the genetic
strains of avian malaria identified appear to be independently evolving lineages due to
reproductive isolation (Bensch et al., 2004). Although less work has been done on other
- 118 -
pathogens, such a gastrointestinal parasites and ectoparasites (Windsor, 1995), high
levels of cryptic diversity and host specificity probably also occur within these pathogen
groups. It is likely, then, that many endangered species considered for translocation,
may also be infected with lineages/species of pathogen that are unique to them. The loss
of these unique pathogens, for example because of enemy release, can also be regarded
as a loss of important biodiversity (Windsor, 1995).
5.5.3 Conclusions
In conclusion, the loss of malaria in two out of three of the newly established Seychelles
warbler populations, alongside the lack of gastrointestinal parasites throughout all the
populations (chapter 3), suggests that enemy release, as a result of an initial historical
bottleneck and subsequent translocations, has shaped the pathogen diversity of this
species. The closely monitored Denis Island translocation provided an opportunity to
observe the enemy release process in progress and investigate, for this particular hostpathogen association, which factors caused the loss of the pathogens. These results
provide evidence that enemy release is not only an important mechanism in invasive
species, but also in regards to endangered species being translocated as part of
conservation programs. Whether the loss of pathogens associated with such
translocations is positive or negative for the conservation of the translocated species,
both in the short and long term, is not clear. However, these translocations clearly lead
to a loss of biodiversity if the pathogen species are also to be considered (Windsor,
1995).
- 119 -
Chapter 6
General Discussion
- 120 -
6.1 General Discussion
I set out to look for evidence of parasite-mediated selection in the Seychelles warbler
and to investigate the role of such selection in driving and maintaining important
genetic variation. Low parasite diversity was expected in the Seychelles warbler, due to
its nature as an island endemic, which often have depauperate parasite communities
(Dobson, 1988, Dobson et al., 1992, Font and Tate, 1994, Fromont et al., 2001). Indeed,
this was considered an attribute; a simplified system would make analysis of hostparasite interactions and their consequences more tractable. However, I found even
lower parasite diversity than expected in the Seychelles warbler. I examined a large
proportion of this species’ world population on all islands it is found for evidence of
gastrointestinal (GI) parasites, including the original remnant population from which all
the others have recently been translocated. Although this investigation was extremely
thorough, sampling individuals of different age and sex, and across every time of day,
season, and reproductive cycle I found no GI parasites that used the Seychelles warbler
as a host. This is, as far as I know, the first study to show convincingly a complete
absence of GI parasites within a wild bird species. While low parasite diversity has been
seen in a number of island species (Dobson, 1988, Dobson et al., 1992, Font and Tate,
1994, Fromont et al., 2001) a complete lack of gastrointestinal parasites appears to be
uncommon. In the few studies where such parasites were not detected in a host spp. (i.e.
Cork, 1999), this can be attributed to low host sample sizes. It is unclear whether a lack
of GI parasites in wild populations is very uncommon, or that a publication bias exists
against studies which show such negative results. Parasite surveys may be part of bigger
studies looking at, for example, parasites and MHC or sexually selected traits.
Therefore, the absence of parasites may not reach the publication stage. This knowledge
is, however, important to fully understand the impact of parasitism, especially in species
with depauperate parasite communities that may be vulnerable to introduced disease.
However, the general ubiquity of such parasites in wild populations (Clayton and
Moore, 1997) suggests that the absence of parasites in wild bird populations is not
common.
Parasite diversity does not only seem to be lacking within gastrointestinal parasites.
Only one strain of malaria, GRW1 (Bensch et al., 2004), was found in the Seychelles
warbler. This is in contrast to its more widespread congener, the great reed warbler,
- 121 -
which is host to eight Haemoproteus and 10 Plasmodium lineages (Bensch et al., 2007),
indicating that the Seychelles warbler has low overall parasite diversity. Within chapter
3 I discussed the possible causes of low parasite diversity in the Seychelles warbler. It is
possible that as an island species it has always had low parasite diversity. During
colonisation, small numbers of founding individuals may have been parasite free, or
unable to maintain a parasite community, as suggested under the enemy release
hypothesis for introduced species. Alternatively, the Seychelles warbler may have lost
its parasites more recently in its history as a result of a population bottleneck, when the
population size may have fallen below the level required for a viable parasite
population. The lack of pre-bottleneck parasite data means it is unknown if parasite
diversity has historically always been low, or at what point it has been lost. Other
isolated bird species on the same islands, such as the Seychelles fody, are host to a
larger range of parasites (including GI parasites), and due to the high density of birds on
the islands, we may expect some host switching to have occurred. However, to answer
the question as to why host switching among these species does not seem to have
occurred, would require greater knowledge of the host specificity of these parasites. In a
large number of parasites, our knowledge of their degree of host specificity is limited,
especially so where cryptic species may be present (Dobson et al., 2008), and greater
knowledge of the host-specificity of parasites could help determine the likelihood of
host switching.
I investigated further the theory that the Seychelles warbler may have lost its
parasites due to enemy release in chapter 5. The translocations carried out as part of the
long term conservation program for this species provided an opportunity to look for
evidence of enemy release in these translocated populations. Two of the four
translocated populations, on Aride and Denis islands, appear to have lost their malaria
parasite. Although there is no pre-translocation malaria prevalence data for the founding
Aride birds, the loss of malaria in the Denis island population could be tracked over the
three years following translocation. As we know that birds infected with GRW1 strain
of malaria were translocated to Denis the most likely explanation for this loss was the
lack of the appropriate vector required for transmission on Denis. Identification of the
intermediate vector of the GRW1 strain in this system, and its distribution over the
islands, would shed more light on the mechanism of enemy release in the Seychelles
warbler. Whether due to lack of vector or low founding population size, this study
- 122 -
provides direct evidence that enemy release occurred in this species as a result of the
translocation. Therefore, such enemy release, occurring during other dispersal and
establishment events during the Seychelles warbler’s history probably, at least partially,
explains the low parasite diversity we see in this species today.
The enemy release hypothesis was proposed to explain the success of invasive
species in novel environments (Mitchell and Power, 2003, Torchin et al., 2003). To our
knowledge it has only been applied once outside this field, in the butterfly the Brown
Argus (Aricia agestis) that expanded its range northwards due to climate change
(Menendez et al., 2008). Menendez et al’s study, along with the current study, now
suggests that the enemy release hypothesis may be applicable to a range of other species
that would not be termed invasive. The expansion of this hypothesis to cover this range
of other systems may help explain, and perhaps even predict, the effects that changes in
range may have on hosts and their parasite communities
As previously mentioned, a single strain of malaria was found in the Seychelles
warbler. In order to understand what selective impact this parasite may have in the
Seychelles warbler, it is important to understand the causes and consequences of
infection by this parasite. Chapter 4 showed that while malaria prevalence fluctuated
between years, there was no relationship with rainfall, and the fluctuations were not
associated with differences in survival. Furthermore, malaria infection did not appear to
have an impact on individual survival. Therefore, this study could find no evidence of
an effect of the GRW1 strain of malaria on the Seychelles warbler. While it is possible
that the relationship between parasite and host is relatively benign, there are various
reasons as to why no fitness effect was found. Due to the immobility of birds with acute
infection (Valkiunas, 2005) this study may have missed severely infected birds, among
which any fitness effect may be found. Those birds ringed as chicks and never caught
again or not caught as adults are a ‘missing cohort’, as their malaria status as juveniles
is unknown, therefore it is unclear how their survival may be affected by malaria. This
difficulty is not an easy problem to resolve. Focussed catching of young juveniles may
help improve the number of badly affected individuals caught, but the immobile nature
of those with acute malaria will still make it difficult (Valkiunas, 2005). Keeping birds
in captivity has allowed the pathogenicity of malaria in Hawaiian birds to be
investigated successfully (Atkinson et al., 1995, Atkinson et al., 2001, Atkinson et al.,
- 123 -
2001), however it is not ideal to use captive studies to extrapolate pathogenicity in
captivity to a wild situation. Furthermore, there are, of course, ethical considerations in
undertaking such a study in threatened species like the Seychelles warbler.
Another major reason why no effect of malaria infection was detected may have
been because the focus was on survival and did not include other components of fitness,
most notably reproductive success. Other studies have shown malaria to have an impact
on reproductive success (Richner et al., 1993, Merino et al., 2000). Indeed, if as I
suggest in chapter 3 malaria, is or has been, involved in the maintenance of MHC class I
diversity, then we may expect some fitness effects. Investigation of malaria in relation
to reproductive success would provide a fuller picture of the fitness effects of malaria in
this species. The intensive monitoring of the Seychelles warbler, and parentage analysis
(Richardson et al., 2001), makes this species well suited to this kind of analysis, and
therefore further work on the effect of malaria on reproductive success would be
valuable in clarifying the fitness effects of GRW1 in this species.
Although malaria infection did not appear to have an impact on individual survival,
prevalence decreased with age (even after controlling for possible mortality of infected
individuals) until approximately eight years of age, after which it increased again.
Interestingly, those individuals that were infected as a juvenile were less likely to be
infected as adults. This combination of results suggests that individuals exposed to
malaria may gain acquired immunity. It also suggests that the increase in prevalence at
older ages was due to immunosenescence. Analysis of the immune function of older
birds in comparison to younger birds, for example using leukocyte counts and the
phytohemagglutinin (PHA) skin response (Goto et al., 1978, McCorkle et al., 1980)
would allow this hypothesis to be tested. In a wider context, senescence in immunity, or
reproduction, is an interesting concept that is now being investigated as part of an
ongoing study into aging and senescence within this species (e.g. Richardson et al.,
2007).
The findings regarding the parasite fauna of the Seychelles warbler are interesting
considering the similarity in MHC class II alleles found between individuals. While 12
MHC class II alleles were found, both SSCP and RSCA analysis showed that no
detectable difference occurred between individuals. This is in contrast to MHC class I
- 124 -
diversity, which shows greater diversity than microsatellites, and seems to have been
maintained by balancing selection (Richardson and Westerdahl, 2003). This is
interesting considering that class I MHC is considered to be important in recognising
intracellular pathogens (such as malaria, which is still found in the Seychelles warbler)
while class II is thought to be most important for intracellular pathogens (which would
include GI parasites, Hess and Edwards, 2002). Low MHC class II diversity may be a
result of a historical lack of selection by GI parasites, meaning that there was no
balancing selection to help maintain variation in this MHC class, while conversely
balancing selection pressures generated by the continued presence of malaria in the
system may have maintained MHC class I selection. While, with only one wild
population to study, this is currently just speculation, it would be interesting to compare
levels of MHC diversity and intra- and intercellular parasite diversity in a wider range
of species to further investigate this. Also, 22 pre-bottleneck museum samples are
available, which would allow analysis of pre-bottleneck MHC diversity. This would tell
us whether the Seychelles warbler has historically had low MHC class II diversity, or if
diversity was lost during the bottleneck. However, here it is worth making a distinction
between low population-wide MHC diversity, and within-individual diversity. While
there appears to be little population-wide MHC class II diversity, the evidence suggests
large numbers of loci are found within populations. This may mean low population
wide diversity is of little impact to the individual Seychelles warbler, if it is able to
recognise a wide range of pathogens, and the MHC within the Seychelles warbler may
be at an equilibrium where there is a range of alleles to combat many immune assaults,
despite variation between individuals being lost.
Some interesting comparisons can be drawn between the lack of MHC class II
diversity seen in the Seychelles warbler, and that in other endangered or previously
bottlenecked species. Similar to the Seychelles warbler; in the Chatham island black
robin (Petroica traversi), eight black robins were found to be monomorphic at the MHC
class II (Miller and Lambert, 2004b), and Hedrick and Parker found that among
populations of Gila topminnows (Poeciliopis o. occidentalis), the one that had
experienced the greatest number of bottlenecks was monomorphic for a MHC class II
gene (1998). Low MHC variation has also been seen in a number of previously
bottlenecked or endangered species, for example cheetahs (Acinonyx jubatus, O'Brien
et al., 1985, Acinonyx jubatus, Drake et al., 2004), Galapagos penguins (Spheniscus
- 125 -
mendiculus, Bollmer et al., 2007), Przewalski's horse (Equus ferus przewalskii, Hedrick
et al., 1999) and Arabian oryx (Oryx leucoryx, Hedrick et al., 2000). However some
species have maintained MHC diversity despite experiencing bottlenecks, for example
the San Nicolas island fox (Urocyon littoralis dickeyi, Aguilar et al., 2004) and
Hawaiian honeycreepers (Jarvi et al., 2004), probably maintained by selection. Both of
these situations may have occurred in the Seychelles warbler; while MHC class I
diversity appears to have been maintained, MHC class II diversity may have been lost.
The findings of this thesis could have important implications for the conservation of
the Seychelles warbler. Low MHC diversity may make species more vulnerable to
infection, and island species are already particularly at risk from introduced disease
(O'Brian and Evermann, 1988). Low MHC class II diversity, and its nature as an island
endemic, may make the Seychelles warbler particularly vulnerable. There is some
disagreement about how much effort should be invested in maintaining MHC diversity
as part of conservation programmes. Preservation of the MHC may be especially
important in small, vulnerable populations, and some studies advocate focussing on
prioritising the maintenance of MHC diversity (Hughes, 1991). However, there is an
argument that focussing on maintenance of one gene group may lead to loss of diversity
at other areas of the genome (Miller and Hedrick, 1991, Vrijenhoek and Leberg, 1991),
and the focus should be on maintaining overall diversity. Low MHC diversity has been
linked to increased disease susceptibility in some species, for example cheetahs
(Acinonyx jubatus, O'Brien et al., 1985) and cotton-top tamarins (Saguinus Oedipus,
Evans et al., 1997). However, some species have been shown to be successful, and even
expanding, despite low MHC diversity, for example Scandinavian beavers (Castor
fiber, Ellegren et al., 1993), moose and deer (Mikko et al., 1999) and mountain goats
(Oreamnos americanus, Mainguy et al., 2007). A combined approach may be most
appropriate; characterisation of the MHC of endangered species will provide knowledge
of the degree diversity remaining in these populations, and conservation programmes
planned that ensure further loss of MHC diversity, as well as overall genetic diversity, is
avoided. In a species such as the Seychelles warbler, this is something that may be
worth taking into account when planning new translocations to prevent loss of
remaining class II diversity.
This thesis also raises questions about the importance of parasite mediated selection
in small populations. Translocation guidelines recommend disease screening prior to
- 126 -
translocation (IUCN, Woodford, 2000). It is important to protect native species from
being exposed to novel parasites introduced by translocations, and careful management
of disease risks may be required when reintroducing potentially parasite-naïve captive
animals to the wild. Consequently, conservation based translocations may focus on
moving individuals that are not infected by parasites (Mathews et al., 2006), and (as
shown in this study) enemy release may occur as a result of such translocation
movements. While enemy release may ensure establishment of new populations, as is it
considered to do in invasive species (although see Drake, 2003), this may result in the
loss of mechanisms which maintains MHC, and other important areas of genetic
diversity, which may be crucial in already small
and vulnerable populations, and
therefore maintaining a species’ parasite fauna may be important for the long term
viability of the population. Further analysis of the selection pressures exerted by
parasites in these populations, and associations between parasites and the MHC, will
allow a greater understanding of the role of parasites in the maintenance of genetic
diversity in small, threatened populations. Finally, it is also worth considering the loss
of the parasite itself as a result of enemy release. It is likely that many endangered
species considered for translocation may also be infected with lineages/species of
pathogen that are unique to them. The loss of these unique pathogens can also be
regarded as a loss of important biodiversity (Windsor, 1995, Dobson et al., 2008). If
our aim is to protect and maintain biodiversity, then perhaps maintenance of parasite
diversity should also be considered.
- 127 -
References
Abbot, I. (2000) Improving the conservation of threatened and rare mammal species
through translocation to islands: case study western Australia Biological Conservation,
93 195-201.
Aguilar, A., Edwards, S., Smith, T. and Wayne, R. (2006) Patterns of variation in MHC
class II β Loci of the little greenbul (Andropadus virens) with comments on MHC
evolution in birds Journal of Heredity, 97 2 133-142.
Aguilar, A., Roemer, G., Debenham, S., Binns, M., Garcelon, D. and Wayne, R. (2004)
High MHC diversity maintained by balancing selection in an otherwise genetically
monomorphic mammal Proceedings of the National Academy of Science U S A, 101 10
3490-3494.
Aidoo, M., Terlouw, D., Kolczak, M., McElroy, P., ter Kuile, O., Kariuki, S., Nahlen,
B., Lal, A. and Udhayakumar, V. (2002) Protective effects of the sickle cell gene
against malaria morbidity and mortality Lancet, 359 9314 1311-1312.
Albon, S., Stien, A., Irvine, R., Langvatn, R., Ropstad, E. and Halvorsen, O. (2002) The
role of parasites in the dynamics of a reindeer population Proceedings of the Royal
Society of London B:Biological Sciences, 269 1500 1625-1632.
Alcaide, M., Edwards, S. V., Negro, J. J., Serrano, D. and Tella, J. L. (2008) Extensive
polymorphism and geographical variation at a positively selected MHC class II B gene
of the lesser kestrel (Falco naumanni) Molecular Ecology, 17 11 2652-2665.
Alexander, R. (1974) The evolution of social behavior Annual Review of Ecology and
Systematics, 5 325-383.
Aljanabi, S. and Martinez, I. (1997) Universal and rapid salt-extraction of high quality
genomic DNA for PCR-based techniques Nucleic Acids Research, 25 22 4692-4693.
Allan, S., Bernier, U. and Kline, D. (2006) Laboratory evaluation of avian odours for
mosquito (Diptera: Culicidae) attraction Journal of Medical Entomology, 43 2 225-231.
Allander, K. (1997) Reproductive investment and parasite susceptibility in the great tit
Functional Ecology, 11 358-364.
- 128 -
Allander, K. and Bennett, G. (1994) Prevalence and intensity of haematozoan infection
in a population of great tits Parus major from Gotland, Sweden Journal of Animal
Ecology, 25 69-74.
Allander, K. and Sundberg, J. (1997) Temporal variation and reliability of blood
parasite levels in captive yellowhammer males Emberiza citrinella Journal of Avian
Biology, 28 325-330.
Allison, A. (1954) Protection afforded by sickle cell trait against subtertian malarial
infection British Medical Journal, 1 4857 290-294.
Altitzer, S., Harvell, D. and Friedle, E. (2003) Rapid evolutionary dynamics and disease
threats to biodiversity Trends in Ecology and Evolution, 18 11 589-596.
Altizer, S., Dobson, A., Hosseini, P., Hudson, P., Pascual, M. and Rohani, P. (2006)
Seasonality and the dynamics of infectious diseases Ecology Letters, 9 467-484.
Amillis, M., Jimenez, N., Jordana, J., Riccardi, A., Fernandez-Arias, A., Guiral, J.,
Bouzat, J., Folch, J. and Sanchez, A. (2004) Low diversity in the major
histocompatibility complex class II DRB1 gene of the Spanish ibex, Capra pyrenaica
Heredity, 93 3 266-272.
Anderson, R. and Crombie, J. (1984) Experimental studies of age-prevalence curves for
Schistosoma mansoni infections in populations of Biomphalaria glabrata Parasitology,
89 1 79-105.
Anderson, R. and May, R. (1979) Population biology of infectious diseases Nature, 280
361-367.
Anderson, R. and May, R. (1982) Coevolution of hosts and parasites Parasitology 85.
Anderson, R. and May, R. (1991) Infectious diseases of humans: Dynamics and control,
Oxford University Press, Oxford.
Applegate, J. (1971) Spring relapse of Plasmodium relictum infections in an
experimental field population of English sparrows Journal of Wildlife Diseases, 7 3742.
- 129 -
Applegate, J. and Beaudoin, R. (1970) Mechanism of spring relapse in avian malaria:
Effect of gondadotrophin and corticosterone Journal of Wildlife Diseases, 6 443-447.
Arguello, J., Soteriou, B., McWhinnie, A., Christian, G., Perez-Rodriguez, M., Corell,
A., Marsh, S., Little, A. and Madgrigal, J. (2002) Typing for HLA alleles by Reference
Strand Mediated Conformation Analysis (RSCA) In IHWG Technical Manual. Genomic
Analysis of the Human MHC: DNA based typing for HLA alleles and linked
polymorphisms (Ed, Tilanus, Marcel G.J) International Histocompatibility Working
Group.
Arkush, K., Giese, A., Mendonca, H., McBride, A., Marty, G. and Hedrick, P. (2002)
Resistance to three pathogens in the endangered winter-run chinook salmon
(Oncorhynchus tshawytscha): effects of inbreeding and major histocompatibility
complex genotypes Canadian Journal of Fisheries and Aquatic Sciences, 59 6 966-975.
Arneberg, P. (2001) An ecological law and its macroecological consequences as
revealed by studies of relationships between host densities and parasite prevalence
Ecogeography, 24 352-358.
Arneberg, P., Skorping, A., Grenfell, B. and Read, A. (1998) Host densities as
determinents of abundance in parasite communities Proceedings of the Royal Society of
London B, 265 1283-1289.
Atkinson, C., Dusek, R. and Lease, J. (2001) Serological responses and immunity to
superinfection with avian malaria in experimentally-infected Hawaii amakihi Journal of
Wildlife Diseases, 37 1 20-27.
Atkinson, C., Lease, J., Drake, B. and Shema, N. (2001) Pathogenecity, serological
responses, and diagnosis of experimental and natural malarial infections in native
Hawaiian thrushes Condor, 103 2 209-218.
Atkinson, C. T. (1991) Vectors, epizootiology, and pathogenicity of avian species of
Haemoproteus (Haemosporina: Haemoproteidae) Bulletin of the Society for Vector
Ecology, 16 109-126.
- 130 -
Atkinson, C. T., Forrester, D. and Greiner, E. (1988) Pathogenicity of Haemoproteus
meleagridis (Haemosporina: Haemoproteidae) in experimentally infected domestic
turkeys Journal of Parasitology, 74 2 228-39.
Atkinson, C. T. and van Riper, C. I. (1991) Pathogenicity and epizootiology of avian
haematozoa: Plasmodium, Leucocytozoon and Haemoproteus In Bird-parasite
interactions, Ecology, evolution and behavior (Eds, Loye, JE and Zuk, M) Oxford
University Press, New York, pp. 19-48.
Atkinson, C. T., Woods, K. L., Dusek, R. J., Sileo, L. S. and Iko, W. M. (1995) Wildlife
disease and conservation in Hawaii: Pathogenicity of avian malaria (Plasmodium
relictum) in experimentally infected I'iwi (Vestiaria coccinea) 111 S59-S69.
Babik, W., Durka, W. and Radwan, J. (2005) Sequence diversity of the MHC DRB gene
in the Eurasian beaver (Castor fiber) Molecular Ecology, 14 4249-4257.
Barton, N. and Charlesworth, B. (1998) Why sex and recombination? Science, 281 5385
1986-1990.
Bates, D. (2007) lme4: Linear mixed-effects models using S4 classes.
Beadell, J., Atkins, C., Cashion, E., Jonker, M. and Fleischer, R. (2007) Immunological
change in a parasite-impoverished environment: Divergent signals from four island taxa
PLos ONE, 2 9 e896.
Beadell, J., Ishtiaq, F., Covas, R., Melo, M., Warren, B., Atkinson, C., Bensch, S.,
Graves, G., Jhala, Y., Peirce, M., Rasmani, A., Ronseca, D. and Fleischer, R. (2006)
Global phylogeographic limits of Hawaii's avian malaria Proceedings of the Royal
Society of London B:Biological Sciences, 273 2935-2944.
Bennett, G., Caines, J. and Bishop, M. (1988) Influence of blood parasites on the body
mass of passeriform birds Journal of Wildlife Disease, 24 2 339-343.
Bensch, S. and Akesson, S. (2003) Temporal and spatial variation of hematozoans in
Scandinavian willow warblers Journal of Parasitology, 89 2 388-391.
- 131 -
Bensch, S., Perez-Tris, J., Waldenstrom, J. and Hellgren, O. (2004) Linkage between
nuclear and mitochondrial DNA sequences in avian malaria parasites: Multiple cases of
cryptic speciation? Evolution, 58 7 1617-1621.
Bensch, S., Stjernman, M., Hasselquist, D., Ostman, O., Hansson, B., Westerdahl, H.
and Pinheiro, R. (2000) Host specificity in avian blood parasites: a study of Plasmodium
and Haemoproteus mitachondrial DNA amplified from birds Proceedings of the Royal
Society of London B:Biological Sciences, 267 1583-1589.
Bensch, S., Waldenstrom, J., Jonzen, N., Westerdahl, H., Hansson, B., Sejberg, D. and
Hasselquist, D. (2007) Temporal dynamics and diversity of avian malaria parasites in a
single host species Journal of Animal Ecology, 76 112-122.
Bernatchez, L. and Landry, C. (2003) MHC studies in non-model vertebrates: what
have we learned about natural selection in 15 years? Journal of Evolutionary Biology,
16 363-377.
Betts, M. 1998 Aride Island Nature Reserve Annual Report 1997
Blouin, M. S. (2002) Molecular prospecting for cryptic species of nematodes:
mitochondrial DNA versus internal transcribed spacer 32 5 527-531.
Bolker, B., Brooks, M., Clark, C., Greange, S., Poulsen, J., Stevens, H. and White, J.
(2008) Generalized linear mixed models: a practical guide for ecology and evolution
Trends in Ecology and Evolution, 24 3 127-135.
Bollmer, J. L., Vargas, F. H. and Parker, P. G. (2007) Low MHC variation in the
endangered Galapogos penguin Immunogenetics, 59 593-602.
Bonneaud, C., Perez-Tris, J., Federici, P., Chastel, O. and Sorci, G. (2006) Major
histocompatibility complex alleles associated with local resistance to malaria in a
passerine Evolution, 60 2 383-389.
Bonneaud, C., Sorci, G., Morin, V., Westerdahl, D., Zoorob, R. and Witzwll, H. (2004)
Diversity of Mhc class I and IIB genes in house sparrows (Passer domseticus)
Immunogenetics, 55 855-865.
- 132 -
Borriello, F. and Krauter, K. S. (1990) Reactive site polymorphism in the murine
protease gene family is delineated using a modification of the PCR reaction (PCR+1)
Nucleic Acids Research, 18 18 5481-5487.
Bosch, M., Torres, J. and Figuerola, J. (2000) A helminth community in breeding
yellow-legged gulls (Larus cachinnans): pattern of association and it's effect on host
fitness Canadian Journal of Zoology, 78 5 777-786.
Bourlet, Y., Béhar, G., Guillemot, F., Fréchin, N., Billault, A., Chaussé, A., Zoorob, R.
and C, A. (1988) Isolation of chicken major histocompatibility complex class II (B-L)
beta chain sequences: comparison with mammalian beta chains and expression in
lymphoid organs The EMBO journal, 7 4 1031-9.
Bowen, L., Aldridge, B., Delong, R., Melin, S., Godinez, Zavala, A., Gulland, F.,
Lowenstine, L., Stott, J. and Johnson, M. (2006) MHC gene configuration variation in
geographically disparate populations of California sea lions (Zalopus californianus)
Molecular Ecology, 15 529-533.
Brawner, W. and Hill, G. (1999) Temporal variation in shedding of coccidial oocysts:
implications for sexual selection studies Canadian Journal of Zoology, 77 347-350.
Brawner, W., Hill, G. and Sundermann, C. (2000) Effects of coccidial and mycoplasmal
infections on carotenoid-based plumage pigmentation in male house finches Auk, 117 4
952-963.
Breman, J. (2001) The ears of the hippopotamus: Manifestations, determinants, and
estimates of the malaria burden American Journal of Tropical Medicine and Hygiene,
64 (1,2)S 1-11.
Briles, W., Stone, H. and Cole, R. (1977) Marek's Disease: effects of B
histocompatibility alloalleles in resistant and susceptible chicken lines Science, 195
193-195.
Brouwer, L. 2007 Cooperative breeding and density regulation in small island
populations of the Seychelles warbler University of Groningen
- 133 -
Brouwer, L., Richardson, D., Eikenaar, C. and Komdeur, J. (2006) The role of group
size and environmental factors in a cooperatively breeding tropical passerine. Journal of
Animal Ecology, 75 1321-1329.
Brown, C. and Brown, M. (1986) Ectoparasitism as a cost of coloniality in cliff
swallows (Hirundo pyrrhonota) Ecology, 67 5 1206-1218.
Brown, C., Brown, M. and Rannala, B. (1995) Ectoparasites reduce long term survival
of their avian host Proceedings of the Royal Society of London B, 262 313-319.
Brown, J., Jardetzky, T., Gorga, J. and Stern, L. (1993) Three-dimensional structure of
the human class II histocompatibility complex antigen HLA-DR1 Nature, 364 33-39.
Bryja, J., Galan, M., Charbonnel, N. and Cosson, J. (2005) Analysis of major
histocompatibility complex class II gene in water voles using capillary electrophoresissingle stranded conformation polymorphism Molecular Ecology Notes, 5 173-176.
Buchanan, K. L., Catchpole, C. K., Lewis, J. W. and Lodge, A. (1999) Song as an
indicator of parasitism in the sedge warbler Animal Behaviour, 57 307-314.
Buchholz, R., Jones Dukes, M., Hecht, S. and Findley, A. (2004) Investigating the
turkey's 'snood' as a morphological marker of heritable disease resistance Journal of
Animal Breeding and Genetics, 121 176-185.
Buitkamp, J., Filmether, P., Stear, M. and Epplen, J. (1996) Class I and class II major
histocompatibility complex alleles are associated with faecal egg counts following
natural, predominantly Ostertagia circumcincta infection Parasitology Research, 82
693-696.
Butlin, R. (2002) The costs and benefits of sex: new insights from old asexual lineages
Nature reviews genetics, 3 311-317.
Carrington, M., Nelson, G., Martin, M., Kissner, T., Vlahov, D., Goedert, J., Kaslow,
R., Buchbinder, S., Hoots, K. and O'Brian, S. (1999) HLA and HIV-1: Heterozygote
advantage and B*35-Cw*04 disadvantage Science, 283 1748-1752.
- 134 -
Cassinello, J., Gomedio, M. and ERS, R. (2001) Relationship between coefficient of
inbreeding and parasite burden in endangered gazelles Conservation Biology, 15 4
1171-1174.
Charbonnel, N. and Pemberton, J. (2005) A long-term genetic survey of an ungulate
population reveals balancing selection acting on MHC through spatial and temporal
fluctuations in selection Heredity, 95 377-388.
Clay, K. (2003) Parasites lost Nature, 421 585-586.
Clayton, D. and Moore, J. (1997) Host-parasite evolution: General principles and avian
models, Oxford University Press, Oxford.
Cohen, J. (1973) Heterologous immunity in human malaria Quarterly Review of
Biology, 48 3 467-489.
Colautti, R., Muirhead, J., Biswas, R. and MacIssac, H. (2005) Realized vs. apparent
reduction in enemies of the European starling Biological Invasions, 7 723-732.
Coltman, D., Pilkington, J., Smith, J. and Pemberton, J. (1999) Parasite mediated
selection against inbred Soay sheep in a free living island population Evolution, 53 4
1259-1267.
Cork, S. 1999 The prevalence of nematode parasites in transcontinental songbirds
University of Aberystwyth
Cosgrove, C., Knowles, S., Day, K. P. and Sheldon, B. (2006) No evidence for avian
malaria infection during the nestling phase in a passerine bird Journal of Parasitology,
92 6 1302-1304.
Cosgrove, C., Wood, M., Day, K. P. and Sheldon, B. (2008) Seasonal variation in
Plasmodium prevalence in a population of blue tits Cyanistes caeruleus Journal of
Animal Ecology, 77 540-548.
Cote, I. M. and Poulin, R. (1995) Parasitism and Group-Size in Social Animals - a
Metaanalysis Behavioral Ecology, 6 2 159-165.
- 135 -
Criscione, C. D., Poulin, R. and Blouin, M. S. (2005) Molecular ecology of parasites:
elucidating ecological and microevolutionary processes 14 8 2247-2257.
Crook, J. 1960 The present status of certain rare landbirds of the Seychelles islands
Unnumbered Seychelles Government Bulletin
Cunningham, A. (1996) Disease risks of wildlife translocations Conservation Biology,
10 2 349-353.
Cutrera, A. and Lacey, E. (2007) Trans-species polymorphism and evidence of selection
on class II MHC loci in tuco-tucos (Rodentia: Ctenomyidae) Immunogenetics, 59 12
937-948.
Dabert, J., Ehrnsberger, R. and Dabert, M. (2008) Glaucalges tytonis sp. (Analgoidea,
Zolalgidae) from the barn owl Tyto alba (Strigiformes, Tytonidae): compiling
morphology with DNA barcode data for taxon descriptions in mites (Acari) Zootaxa,
1719 41-52.
Dale, S., Kruszewicz, A. and Slagsvold, T. (1996) Effects of blood parasites on sexual
and natural selection in the pied flycatcher Journal of the Zoology, 238 373-393.
Davidar, P. and Morton, E. (1993) Living with parasites: Prevalence of a blood parasite
and its effect on survivorship in the purple martin The Auk, 110 1 109-116.
Davies, C., Ayres, J., Dye, C. and Deane, L. (1991) Malaria infection rate of Amazonian
primates increases with body weight and group size Functional Ecology, 5 655-662.
Dawson, R. and Bortolotti, G. (2000) Effects of hematozoan parasites on condition and
return rates of American kestrels The Auk, 117 2 373-380.
de Castro, F. and Bolker, B. (2005) Mechanisms of disease-induced extinction Ecology
Letters, 8 117-126.
Deter, J., Charbonnel, N., Cosson, J. and Morand, S. (2008) Regulation of vole
populations by the nematode Trichuris arvicolae: insights from modelling European
Journal of Wildlife Research, 54 60-70.
- 136 -
Deviche, P., Greiner, E. and Manteca, X. (2001) Seasonal and age-related changes in
blood parasite prevalence in dark eyed juncos (Junco hyemalis, Aves, Passeriformes)
Journal of Experimental Biology, 289 456-466.
Ditchkoff, S., Lochmillar, R., Masters, R., Hoofer, S. and Van der Bussche, R. (2001)
Major histocompatibility complex associated variation in secondary sexual traits of
white tailed deer (Odocoileus virginianus): Evidence for good genes advertisement
Evolution 55, 3 616-625.
Dobson, A. (1988) The population biology of parasite-induced changes in host behavior
The Quarterly Review of Biology, 63 2 139-165.
Dobson, A., Lafferty, K., Kuris, A., Hechinger, R. and Jetz, W. (2008) Homage to
Linnaeus: How many parasites? How many hosts? Proceedings of the National
Academy of Sciences of the USA, 105 Supplement 1 11482-11489.
Dobson, A. and May, R. (1986) Patterns of invasions by pathogens and parasites In
Ecology of biological invasions of the USA and Hawaii (Eds, Mooney, HA and Drake,
JA) Springer-Verlag, New York, London.
Dobson, A., Pacala, S., Roughgarden, J., Carper, E. and Harris, E. (1992) The parasites
of Anolis lizards in the northern Lesser Antilles Oecologica, 91 110-117.
Doherty, P. and Zinkernagel, R. (1975) Enhanced immunological surveillance in mice
heterozygous at the H2 gene complex Nature, 256 50-52.
Dowling, D., Richardson, D., Blaakmeer, K. and Komdeur, J. (2001a) Feather mite
loads influenced by salt exposure, age and reproductive stage in the Seychelles warbler
Acrocephalus sechellensis Journal of Avian Biology, 32 4 364-369.
Dowling, D., Richardson, D. and Komdeur, J. (2001b) No effects of a feather mite on
body condition, survivorship, or grooming behavior in the Seychelles warbler,
Acrocephalus sechellensis Behavioural Ecology and Sociobiology, 50 257-262.
Drake, G., Kennedy, L., Auty, H., Ryvar, R., Ollier, W., Kitchener, A., Freemans, A.
and Radford, A. (2004) The use of reference strand-mediated conformational analysis
- 137 -
for the study of cheetah (Acinonyx jubatus) feline leucocyte antigen class II DRB
polymorphisms Molecular Ecology, 13 221-229.
Drake, J. (2003) The paradox of the parasites: implications for biological invasion
Proceedings of the Royal Society of London B, 270 S133-S135.
Duszynski, D. V., Couch, L. and Upton, S. L. 2000 Coccidia of the World
http://www.ksu.edu/parasitology/worldcoccidia/.
Earle, R., Bastianello, S., Bennett, G. and Krecek, R. (1993) Histopathology and
morphology of the tissue stages of Haemoproteus columbae causing mortality in
Columbiformes Avian Pathology, 22 67-80.
Edwards, S., Gasper, J., Garrigan, D., Martindale, D. and Koop, B. (2000a) A 39-kb
sequence around a blackbird MHC Class II gene: Ghost of selection past and songbird
genome architecture Molecular Biology and Evolution, 17 9 1384-1395.
Edwards, S., Gasper, J. and March, M. (1998) Genomics and Polymorphism of AgphDAB1, an MHC Class II B gene in red-winged blackbirds (Agelaius phoeniceus)
Molecular Biology and Evolution, 15 3 236-250.
Edwards, S., Grahn, M. and Potts, W. (1995a) Dynamics of MHC evolution in birds and
crocadilians: amplification of class II genes with degenerate primers Molecular
Ecology, 4 6 719-729.
Edwards, S. and Hedrick, P. (1998) Evolution and ecology of MHC molecules: from
genomics to sexual selection Trends in Ecology and Evolution, 13 8 305-311.
Edwards, S., Nusser, J. and Gasper, J. (2000b) Characterisation and evolution of major
histocompatibility complex (MHC) genes in non model organisms, with examples from
birds In Molecular Methods in Ecology (Ed, Baker, AJ) Blackwell Science Ltd, Oxford,
pp. 168-207.
Edwards, S. V., Wakeland, E. and Potts, W. (1995b) Contrasting histories of avian and
mammalian MHC genes revealed by class II B sequences from songbirds Proceedings
of the National Academy of Sciences of the USA, 92 12200-12204.
- 138 -
Eikenaar, C. 2008 Should I stay or should I go? Natal dispersal in the Seychelles
warbler PhD thesis University of Groningen
Eikenaar, C., Richardson, D. S., Brouwer, L. and Komdeur, J. (2007) Parent presence,
delayed dispersal, and territory acquisition in the Seychelles warbler Behavioral
Ecology, 18 5 874-879.
Ekblom, R., Aresaether, S., Jacobsson, P., Fiske, P., Sahlman, T., Grahn, M., Atle
Kalas, J. and Hoglund, J. (2007) Spatial pattern of MHC class II variation in the great
snipe (Gallinago media) Molecular Ecology, 16 1439-1451.
Ekblom, R., Grahn, M. and Hoglund, J. (2003) Patterns of polymorphism in the MHC
class II of a non-passerine bird, the great snipe (Gallinago media) Immunogenetics, 54
734-741.
Ellegren, H., Hartman, G., Johansson, M. and Andersson, L. (1993) Major
histocompatibility complex monomorphism and low levels of DNA fingerprinting
variability in a reintroduced and rapidly expanding population of beavers Proceedings
of the National Academy of Sciences of the USA, 90 8150-8153.
Evans, D., Piekarczyk, M., Allen, T., Boyson, J., Yeager, M., Hughes, A., Gotch, F.,
Hinshaw, V. and Watkins, D. (1997) Immunodominance of a single CTL epitope in a
primate species with limited MHC class I polymorphism Journal of Immunology, 159 3
1374-1382.
Ezenwa, V. and Jolles, A. (2008) Horns honestly advertise parasite infection in male
and female African buffalo Animal Behaviour, 75 6 2013-2021.
Fallon, S., Bermingham, E. and Ricklefs, R. (2003a) Island and taxon effects in
parasitism revisited: avian malaria in the lesser Antilles Evolution, 57 3 606-615.
Fallon, S., Bermingham, E. and Ricklefs, R. (2005) Host specialisation and geographic
localization of avian malaria parasites: A regional analysis in the lesser Antilles
American Naturalist, 165 4 466-480.
- 139 -
Fallon, S., Ricklefs, R., Swanson, B. and Bermingham, E. (2003b) Detecting avian
malaria: An improved polymerase chain reaction diagnostic Journal of Parasitology, 89
5 1044-1047.
Feichtlbauer-Huber, P., Stear, M., Fries, R. and Buitkamp, J. (2000) Reference-strandmediated conformation analysis of MHC alleles: a new method for high resolution
typing of the ovar-DQB genes Immunogenetics, 51 65-68.
Feldman, R., Freed, L. and Cann, R. (1995) A PCR test for avian malaria in Hawaiian
birds Molecular Ecology, 4 6 663-673.
Figueroa, F., Gunther, E. and Klein, J. (1988) MHC polymorphism pre-dating
speciation Nature, 335 265-267.
Figuerola, J. (1999) Effects of salinity on rates of infestation of waterbirds by
haematozoa Ecography, 22 681-685.
Fischer, J. and Lindenmayer, D. (2000) An assessment of the published results of
animal relocations Biological Conservation, 96 1-11.
Foldvari, G., Hell, E. and Farkas, R. (2005) Babesia canis canis in dogs in Hungary:
detection by PCR and sequencing Veterinary Parasitology, 127 221-226.
Font, W. F. and Tate, D. C. (1994) Helminth parasites of native Hawaiian fresh water
fishes:an example of extreme ecological isolation Journal of Parasitology, 80 5 682688.
Fox, A. and Hudson, P. (2001) Parasites reduce territorial behaviour in red grouse
(Lagopus lagopus scoticus) Ecology Letters, 4 139-143.
Frank, S. (2002) Immunology and Evolution of Infectious Disease, Princeton University
Press, Princeton and Oxford.
Frankham, R. (1995) Conservation genetics Annual Review of Genetics, 29 305-327.
Frankham, R. (2005) Genetics and extinction Biological Conservation, 126 131-140.
Freed, L., Cann, R., Goff, M., Kuntz, W. and Bodner, G. (2005) Increase in avian
malaria at upper elevation in Hawai'i Condor, 107 4 753-764.
- 140 -
Freeland, W. (1983) Parasites and the coexistance of animal host species American
Naturalist, 121 2 223-236.
Freeman-Gallant, C., Johnson, E., Saponara, F. and Stanger, M. (2002) Variation at the
major histocompatibility complex in savannah sparrows Molecular Ecology, 11 11251130.
Freeman-Gallant, C., O'Connor, K. and Breuer, M. (2001) Sexual selection and the
geography of Plasmodium infection in savannah sparrows (Passerculus sandwichensis)
Oecologica, 127 517-521.
Friend, M., Franson, J. and Ciganovich, E. 1999 Field Manual of Wildlife Diseases:
General Field Procedures and Diseases of Birds
Froeschke, G. and Sommer, S. MHC class II DRB variability and parasite load in the
striped mouse (Rhabdomys pumilio) in the Southern Kalahari Molecular Biology and
Evolution, 22 5 1254-1259.
Fromont, E., Morvilliers, L., Artois, M. and Pontier, D. (2001) Parasite richness and
abundance in insular and mainland feral cats: insularity or density? Parasitology, 123
143-151.
Futuyma, D. J. (1998) Evolutionary Biology, Sinaurt Asscociates Inc.
Garrigan, D. and Hedrick, P. (2001) Class I MHC polymorphism and evolution in
endangered California chinook and other Pacific salmon Immunogenetics, 53 6 483-9.
Garrigan, D. and Hedrick, P. (2003) Perspective: Detecting adaptive molecular
polymorphism: lessons from the MHC Evolution, 57 8 1707-1722.
Gasser, R. (2001) Molecular taxanomic, diagnostic and genetic studies of parasitic
helminths International Journal for Parasitology, 31 860-864.
Geluk, A., Elferink, D. G., Slierendregt, B. L., van Meijgaarden, K. E., de Vries, R. R.,
Ottenhoff, T. H. and Bontrop, R. E. (1993) Evolutionary conservation of major
histocompatibility complex- DR/peptide/T cell interactions in primates Journal of
Experimental Medicine, 177 4 979-987.
- 141 -
Goto, N., Kodama, H., Okada, K. and Fujimoto, Y. (1978) Suppression of
phytohemagglutinin skin response in thymectomized chickens Poultry Science, 57 246250.
Goto, R. M., Afanassieff, M., Ha, J., Iglesias, G. M., Ewald, S. J., Briles, W. E. and
Miller, M. M. (2002) Single-strand conformation polymorphism (SSCP) assays for
major histocompatibility complex B genotyping in chickens Poultry Science, 81 12
1832-1841.
Gregory, R., Montgomery, S. and Montgomery, W. (1992) Population biology of
Heligmosomoides polygyrus (Nematoda) in the wood mouse Journal of Animal
Ecology, 61 3 749-757.
Griffith, B., Scott, J. M., Carpenter, J. W. and Reed, C. (1989) Translocation as a
species conservation tool: Status and strategy Science, 245 4917 477-480.
Griffiths, R., Double, M. and Dawson, R. (1998) A DNA test to sex most birds
Molecular Ecology, 7 1071-1075.
Grossman, C. (1985) Interactions between the gonadal steroids and the immune system
Science, 227 4684 257-261.
Guegan, J. and Kennedy, C. (1993) Maximum local helminth parasite community
richness in British freshwater fish: a test of the colonization time hypothesis
Parasitology, 106 91-100.
Guillemot, F., Billault, A., Pourquie, O., Behar, G., Chausse, A., Zoorob, R., Kreibich,
G. and Auffray, C. (1988) A molecular map of the chicken major histocompatibility
complex: the class II b genes are closely linked to the class I genes and the nucleolar
organiser The EMBO Journal, 7 2775-2785.
Gulland, F. (1992) The role of nematode parasites in Soay sheep (Ovis aries L.)
mortality during a population crash Parasitology, 105 493-503.
Gustafsson, L., Nordling, D., Andersson, M., Sheldon, B. and Qvarnstrom, A. (1994)
Infectious diseases, reproductive effort and the cost of reproduction in birds
Philosophical transactions of the Royal Society of London B, 346 323-331.
- 142 -
Hale, K. A. 2008 Disease outbreak amongst South Island saddlebacks (Philesturnus
carunculatus carunculatus) on Long Island Department of Conservation
Hamilton, W. (1980) Sex versus non-sex versus parasite Oikos, 35 282-290.
Hamilton, W., Axelrod, R. and Tanese, R. (1990) Sexual reproduction as an adaptation
to resist parasites (a review) Proceedings of the National Academy of Sciences of the
USA, 87 3566-3573.
Hamilton, W. and Zuk, M. (1982) Heritable true fitness and bright birds: A role for
parasites? Science, 218 384-387.
Hansson, B. and Richardson, D. (2005) Genetic variation in two endangered
Acrocephalus species compared to a widespread congener: estimates based on
functional and random loci Animal Conservation, 8 83-90.
Harf, R. and Sommer, S. (2005) Association between major histocompatibility complex
class II DRB alleles ad parasite load in the hairy footed gerbil Gerbillurus paeba, in the
southern Kalahari Molecular Ecology, 14 85-91.
Hart, B. (1997) Behavioural defence In Host- Parasite Evolution: General principles
and avian models
(Eds, Clayton, DH and Moore, J) Oxford University Press, Oxford, pp. 59-77.
Hedrick, P. (1999) Balancing selection and the MHC Genetica, 104 207-214.
Hedrick, P. (2001) Conservation genetics: where are we now? Trends in Ecology and
Evolution, 16 11 629-636.
Hedrick, P. (2002) Pathogen resistance and genetic variation at MHC loci Evolution, 56
10 1902-1908.
Hedrick, P. and Kim, K. (2000) Genetics of complex polymorphisms: parasites and
maintenance of the major histocompatibility complex variation In Evolutionary
Genetics: from molecules to morphology, Vol. 1 (Eds, Singh, RS and Krimbas, CB)
Cambridge University Press.
- 143 -
Hedrick, P., Lee, R. and Garrigan, D. (2002) Major histocompatibility complex
variation in red wolves: evidence for common ancestry with coyotes and balancing
selection Molecular Ecology, 11 1905-1913.
Hedrick, P. and Loeschcke, V. (1996) MHC and mate selection in humans? Trends in
Ecology and Evolution, 11 1 24.
Hedrick, P. and Parker, K. (1998) MHC variation in the endangered Gila topminnow
Evolution, 52 1 194-199.
Hedrick, P., Parker, K., Gutierrez-Espeleta, G., Rattink, A. and Lievers, K. (2000)
Major histocompatibility complex variation in the Arabian oryx Evolution, 54 6 21452151.
Hedrick, P., Parker, K., Miller, E. and Miller, P. (1999) Major histocompatibility
complex variation in the endangered Przewalski's horse Genetics, 152 1701-1710.
Hedrick, P., Thomson, G. and Klitz, W. (1987) Evolutionary genetics and HLA: another
classic example Biological Journal of the Linnean Society, 31 5 311-331.
Hellgren, O., Bensch, S. and Malmqvist, B. (2008) Bird hosts, blood parasites and their
vectors- associations uncovered by molecular analyses of blackfly blood meals
Molecular Ecology, 17 1605-1613.
Hellgren, O., Waldenstrom, J. and Bensch, S. (2004) A new PCR assay for
simultaneous studies of Leucocytozoon, Plasmodium, and Haemoproteus from avian
blood Journal of Parasitology, 90 4 797-802.
Hess, C. and Edwards, S. (2002) The evolution of the major histocompatibility complex
in birds Bioscience, 52 5 423-431.
Hey, J. (1999) The neutralist, the fly and the selectionist Trends in Ecology and
Evolution, 14 1 35-38.
Hill, A., Jepson, A., Plebanski, M. and Gilbert, S. (1997) Genetic analysis of host
parasite coevolution in human malaria Philosophical Transactions of the Royal Society
of London B, 352 1317-1325.
- 144 -
Hill, A. V. S., Allsopp, C. E. M., Kwiatkowski, D., Anstey, N. M., Twumasi, P., Rowe,
P. A., Bennett, S., Brewster, D., McMichael, A. J. and Greenwood, B. M. (1991)
Common west African HLA antigens are associated with protection from severe malaria
Nature, 352 6336 595-600.
Hill, G., Doucet, S. and Buchholz, R. (2005a) The effect of coccidial infection on
iridescent plumage coloration in wild turkeys Animal Behaviour, 69 387-394.
Hill, G., Farmer, K. and Beck, M. (2005b) The effect of mycoplasmosis on carotenoid
plumage coloration in male house finches Journal of Experimental Biology, 207 20952099.
Hoelzel, A. R., Stephens, J. C. and O'Brien, S. J. (1999) Molecular genetic diversity and
evolution at the MHC DQB locus in four species of pinnipeds Mol Biol Evol, 16 5 611618.
Horak, P., Saks, L., Karu, U., Ots, I., Surai, P. and McGraws, K. (2004) How coccidian
parasites affect health and appearance of greenfinches Journal of Animal Ecology, 73
935-947.
Hu, W., Tong, S., Mengersen, K. and Oldenburg, B. (2006) Rainfall, mosquito density
and the transmission of Ross River virus: A time-series forecasting model Ecological
Modelling, 196 505-514.
Hudson, P. (1986) The effects of a parasitic nematode on the breeding production of red
grouse Journal of Animal Ecology, 55 85-92.
Hudson, P. and Dobson, A. (1997) Host-parasite processes and demographic
consequences In Host-parasite evolution: General principles and avian models (Eds,
Clayton, DH and Moore, J) Oxford University Press, Oxford.
Hudson, P., Dobson, A. and Lafferty, K. (2006) Is a healthy ecosystem one that is rich
in parasites? Trends in Ecology and Evolution, 21 7 381-385.
Hudson, P., Dobson, A. and Newborn, D. (1998) Prevention of population cycles by
parasite removal Science, 282 2256-2258.
- 145 -
Hudson, P., Newborn, D. and Dobson, A. (1992) Regulation and stability of a free
living host-parasite system: Trichostrongylus tenuis in red grouse. I. Monitoring and
parasite reduction experiments Journal of Animal Ecology, 61 477-486.
Hudson, P., Rizzoli, A., Grenfell, B., Heesterbeek, H. and Dobson, A. (Eds.) (2001) The
Ecology of Wildlife Diseases, Oxford University Press, Oxford.
Hughes, A., Hughes, M., Howell, C. and Nei, M. (1997) Natural selection at the class II
major histocompatibility complex loci of mammals In Infection, Polymorphism and
Evolution (Eds, Hamilton, WD and Howard, JC) Chapman & Hall, London.
Hughes, A. and Nei, M. (1988) Pattern of nucleotide substitution at major
histocompatibility complex class I loci reveals overdominant selection Nature, 335 167170.
Hughes, A. L. (1991) MHC polymorphism and the design of captive breeding programs
Conservation Biology, 5 2 249-251.
Hughes, A. L. and Nei, M. (1989) Nucleotide substitution at the major
histocompatibility complex class II loci: evidence for overdominant selection
Proceedings of the National Academy of Science U S A, 86 958-962.
Hughes, J., Albon, S., Irvine, R. and Woodin, S. (2009) Is there a cost of parasites to
caribou? Parasitology, 136 253-265.
Hung, G., Gasser, R., Beveridge, I. and Chilton, N. (1999) Species specific
amplification by PCR of ribosomal DNA from some equine strongyles Parasitology,
119 69-80.
Hurd, H. (2001) Host fecundity reduction: a strategy for damage limitation Trends in
Parasitology, 17 8 363-368.
Innes, E. and Vermeulen, A. (2006) Vaccination as a control strategy against the
coccidial parasites Eimeria, Toxoplasma and Neospora Parasitology, 133 S2 S145S168.
- 146 -
Irvine, R., Corbishley, H., Pilkington, J. and Albon, S. (2006) Low-level parasitic worm
burdens may reduce body condition in free-ranging red deer (Cervus elaphus)
Parasitology, 133 465-475.
Ishtiaq, F., Beadell, J., Baker, A., Rahmani, A., Jhala, Y. and Fleischer, R. (2006)
Prevalence and evolutionary relationships of haematozoan parasites in native versus
introduced populations of common myna Acridotheres tristis Proceedings of the Royal
Society of London B, 273 587-594.
Ishtiaq, F., Guillaumot, L., Clegg, S., Phillimore, A., Black, R., Owens, I., Mundy, N.
and Sheldon, B. (2008) Avian haematozoan parasites and their associations with
mosquitoes across Southwest Pacific Islands Molecular Ecology, 17 20 4545-4555.
IUCN IUCN guidelines for re-introductions
IUCN 1987 IUCN position statement on translocation of living organisms:
Introductions, reintroductions and re-stocking IUCN Council
Janovy, J. (1997) Protozoa, helminths and arthropods of birds In Host-parasite
evolution: General principles and avian models (Eds, Clayton, DH and Moore, J)
Oxford University Press, Oxford.
Jarvi, S., Tarr, C., McIntosh, C., Atkinson, C. and Fleischer, R. (2004) Natural selection
of the major histocompatibility complex (MHC) in Hawaiian honeycreepers
(Drepanidinae) Molecular Ecology, 13 2157-2168.
Jarvi, S. I., Schultz, J. J. and Atkinson, C. T. (2002) PCR diagnostics underestimate the
prevalence of avian malaria (Plasmodium relictum) in experimentally-infected
passerines Journal of Parasitology, 88 1 153-158.
Jeffery, K. and Bangham, C. (2000) Do infectious diseases drive MHC diversity?
Microbes and Infection, 2 1335-1341.
Jex, A., Smith, H., Monis, P., Campbell, B. and Gasser, R. (2008) CryptosporidiumBiotechnological advances in the detection diagnosis and analysis of genetic variation
Biotechnology Advances, 26 4 304-317.
- 147 -
John, T. and Samuel, R. (2000) Herd immunity and herd effect: New insights and
definitions European Journal of Epidemiology, 16 7 601-606.
Johnsen, T. and Zuk, M. (1998) Parasites, morphology and blood characters in male red
jungle fowl during development Condor, 100 749-752.
Johnson, K., Williams, B., Drown, D., Adams, R. and Clayton, D. (2002) The
population genetics of host specificity: genetic differentiation in dove lice (Insecta:
Phthiraptera) Molecular Ecology, 11 25-38.
Jousson, O., Bartoli, P. and Pawlowski, J. (2000) Cryptic speciation among intestinal
parasites (Trematoda: Digenea) infecting sympatric host fishes (Sparidae) Journal of
Evolutionary Biology, 13 5 778-785.
Kaufman, J., Milne, S., Gobel, T., Walker, B., Jacob, J., Auffray, C., Zoorob, R. and
Beck, S. (1999) The chicken B locus is a minimal essential major histocompatibility
complex Nature, 401 923-925.
Keane, R. M. and Crawley, M. J. (2002) Exotic plant invasions and the enemy release
hypothesis Trends in Ecology & Evolution, 17 4 164-170.
Kennedy, C. R. and Bush, A. O. (1994) The relationship between pattern and scale in
parasite communities: a stranger in a strange land Parasitology, 109 2 187-196.
Kennedy, L., Ryvar, R., Gaskell, R., Addie, D., Willoughby, K., Carter, S., Thomson,
W., Ollier, W. and Radford, A. (2002) Sequence analysis of MHC DRB alleles in
domestic cats from the United Kingdom Immunogenetics, 54 348-352.
Kim, K. (1985) Evolutionary relationships of parasitic arthropods and mammals In
Coevolution of parasitic arthropods and mammals (Ed, Kim, KC) John Wiley & Sons,
New York, pp. 3-82.
Kimura, M. (1983) The neutral theory of molecular evolution, Cambridge University
Press, New York.
Kirkpatrick, M. and Ryan, M. (1991) The evolution of mating preferences and the
paradox of the lek Nature, 350 33-38.
- 148 -
Kirkwood, T. (1990) The disposable soma theory of aging In Genetic Effects on Aging
II (Ed, Harrison, DE) Caldwell, Telford, pp. 9-19.
Klein, J. (1979) Major histocompatibility complex of the mouse Science, 203 4380 516521.
Klein, J. (1986) Natural history of the major histocompatibility complex, Wiley, New
York.
Klein, J. (1987) Origin of major histocompatibility complex polymorphism: The transspecies hypothesis Human Immunology, 19 155--162.
Klein, J., Akie, S. and Nikolaidis (2007) MHC, TSP and the Origin of Species: from
immunogenetics to evolutionary genetics Annual Review of Genetics, 41 281-304.
Komdeur, J. 1991 Cooperative breeding in the Seychelles warbler PhD thesis University
of Cambridge
Komdeur, J. (1992) Importance of habitat saturation and territory quality for evolution
of cooperative breeding in the Seychelles warbler Nature, 358 493-495.
Komdeur, J. (1994a) Conserving the Seychelles warbler Acrocephalus sechellensis by
translocation from Cousin Island to the islands of Aride and Cousine Biological
Conservation, 67 143-152.
Komdeur, J. (1994b) Experimental evidence for helping and hindering by previous
offspring in the cooperatively-breeding Seychelles warbler Acrocephalus sechellensis
Behavioural Ecology and Sociobiology, 34 175-186.
Komdeur, J. (1996a) Facultative sex ratio bias in the offspring of Seychelles warblers
Proceedings of the Royal Society of London B:Biological Sciences, 263 661-666.
Komdeur, J. (1996b) Seasonal timing of reproduction in a tropical bird, the Seychelles
warbler: a field experiment using translocation Journal of Biological Rhythms, 11 333346.
Komdeur, J. (1998) Long term fitness benefits of egg sex modification in the Seychelles
warbler Ecology Letters, 1 56-62.
- 149 -
Komdeur, J. (2003) Daughters on request: about helpers and egg sexes in the Seychelles
warbler Proceedings of the Royal Society of London B, 270 3-11.
Komdeur, J., Blaakmeer, K. and Richardson, D. (1997) Monitoring and studying the
Seychelles warbler Acrocephalus sechellensis In Project G1 EMPS. 1, Vol. 1 Ministry
of Environment/BIrdlife international, Mahe, pp. 185-197.
Komdeur, J. and Daan, S. (2005) Breeding in the monsoon: semi-annual reproduction in
the Seychelles warbler (Acrocephalus sechellensis) Journal of Ornithology, 146 4 305313.
Komdeur, J., Huffstadt, A., Prast, W., Castle, G., Mileto, R. and Wattel, J. (1995)
Transfer experiments of Seychelles warblers to new islands: changes in dispersal and
helping behaviour Animal Behaviour, 49 695-708.
Komdeur, J. and Kats, R. (1999) Predation risk affects trade-off between nest guarding
and foraging in Seychelles warblers Behavioural Ecology, 10 6 648-658.
Komdeur, J. and Pels, M. (2005) Rescue of the Seychelles warbler on Cousin Island,
Seychelles:The role of habitat restoration Biological Conservation, 124 15-26.
Komdeur, J., Piersma, T., Kraaijeveld, K., Kraaijeveld, F. and Richardson, D. (2004a)
Why Seychelles warblers fail to recolonize nearby islands: unwilling or unable to fly
there? Ibis, 146 299-302.
Komdeur, J., Richardson, D. and Burke, T. (2004b) Experimental evidence that kin
discrimination in the Seychelles warbler is based on association and not on genetic
relatedness Proceedings of the Royal Society of London B, 271 963-969.
Korpimaki, E., Tolonen, P. and Bennet, G. (1995) Blood parasites, sexual selection and
reproductive success of European kestrels Ecoscience, 2 4 335-343.
Kruszewicz, A. and Dyrcz, A. (2000) Intestinal parasites in five species of the genus
Acrocephalus Acta ornithologica, 35 2 153-158.
Kurtz, J., Kalbe, M., Aeschlimann, P., Haberli, M., Wegner, K., Reusch, T. and
Milinski, M. (2004) Major histocompatibility complex diversity influences parasite
- 150 -
resistance and innate immunity in sticklebacks Proceedings of the Royal Society of
London B, 271 197-204.
L'Abbe, D., Belmaaza, A., Decary, F. and Chartrand, P. (1992) Elimination of
heteroduplex artefacts when sequencing HLA genes amplified by polymerase chain
reaction (PCR) Immunogenetics, 35 395-397.
Landry, C. and Bernatchez, L. (2001) Comparative analysis of population structure
across environments and geographical scales at major histocompatibility complex and
microsatellite loci in Atlantic salmon (Salmo salar) Molecular Ecology, 10 2525-2539.
Langefors, A., Lohm, J., Grahn, M., Andersen, O. and von Schantz, T. (2001)
Association between major histocompatibility complex class IIB alleles and resistance
to Aeromonas salmonicida in Atlantic salmon Proceedings of the Royal Society of
London B, 268 479-485.
Lavoie, E. (2006) Avian immunosenescence AGE, 27 281-285.
Lavoie, E., Sorrell, E., Perez, D. and Ottinger, M. (2006) Immunosenescence and agerelated susceptibility to influenza virus in Japanese quail Developmental and
Comparative Immunology, 31 4 407-414.
Leinwand, I., Kilpatrick, A., Cole, N., Jones, C. and Daszak, P. (2005) Patterns of
coccidial prevalence in lizards of Mauritius Journal of Parasitology, 91 5 1103-1108.
Levine, N. (1963) Coccidiosis Annual Review of Microbiology, 17 179-198.
Liu, H. and Stiling, P. (2006) Testing the enemy release hypothesis: a review and metaanalysis Biological Invasions, 8 1535-1545.
Loiseau, C., Richard, M., Garnier, S., Chastel, O., Julliiard, R., Zoorob, R. and Sorci, G.
(2009) Diversifying selection on MHC class I in the house sparrow (Passer domesticus)
Molecular Ecology, 18 1331-1340.
Longeri, M. and Zanotti, M. D., G (2002) Recombinant DRB sequences produced by
mismatch repair of heteroduplexes during cloning in Escherichia coli European Journal
of Immunogenetics, 29 6 517-523.
- 151 -
Lopez-Darias, M., Ribas, A. and Feliu, C. (2008) Helminth parasites in natuve and
invasive mammal populations: comparitive study on the Barbary ground squirrel
Atlantoxerus getulus L. (Rodentia, Sciuridae) in Morocco and the Canary Islands Acta
Parasitologica, 53 3 296-301.
López-Sepulcre, A., Doak, N., Norris, K. and Shah, N. J. (2008) Population trends of
Seychelles magpie-robins Copsychus sechellarum following translocation to Cousin
Island, Seychelles Conservation Evidence, 5 33-37.
Loustau-Lalanne, P. 1968 The Seychelles, Cousin Island Nature Reserve International
Council for Bird Preservation
Lovegrove, T. (1996) Island release of saddlebacks Philesturnus carunculatus in New
Zealand Biological Conservation, 77 151-157.
Lozano, G. and Lank, D. (2003) Seasonal trade-offs in cell-mediated
immunosenescence in ruffs (Philimachus pugnax) Proceedings of the Royal Society of
London B:Biological Sciences, 270 1203-1208.
Mack, R., Simberloff, D., Lonsdale, W., Evans, H., Clout, M. and Bazzaz, F. (2000)
Biotic invasions: Causes, epidemiology, global consequences and control Ecological
Applications, 10 3 689-710.
Macleod, C., Duncan, R., Parish, D., Wratten, S. and Hubbard, S. (2005) Can increased
niche opportunities and release from enemies explain the success of introduced
yellowhammer populations in New Zealand Ibis, 147 598-607.
Mainguy, J., Worley, K., Cote, S. and Coltman, D. (2007) Low MHC DRB class II
diversity in the mountain goat: past bottlenecks and possible role of pathogens and
parasites Conservation Genetics, 8 885-891.
Maitland, K., Williams, T. N. and Newbold, C. (1997) Plasmodium vevax and P.
falciparum: Biological interactions and the possibility of cross-species immunity
Parasitology Today, 13 6 227-231.
Malinski, M. (2003) The function of mate choice in sticklebacks: optimizing MHC
genetics Journal of Fish Biology, 63 Suppl. A 1-16.
- 152 -
Marr, S., Mautz, W. and Hara, A. (2007) Parasite loss and introduced species: a
comparison of the parasites of the Puerto Rican tree frog (Eleutherodactylus coqui), in
its native and introduced ranges Biological Invasions, 10 8 1387-3547.
Martinsohn, T., Sousa, A., Guethlein, L. and Howard, J. (1999) The gene conversion
hypothesis of MHC evolution: a review Immunogenetics, 50 3 168.
Marzal, A., Bensch, S., Reviriego, M., Balbontin, J. and De Lope, F. (2008) Effects of
malaria double infections in birds: one plus one is not two Journal of Evolutionary
Biology, 21 979-987.
Masello, J., Choconi, R., Sehgal, N., Tell, L. and Quillfeldt, P. (2006) Blood and
Intestinal parasites in wild Psittaciformes: A case study of burrowing parrots
(Cyanoliseus patagonus) Ornitologia Neotropical, 17 515-529.
Mathews, F., Moro, D., Strachan, R., Gelling, M. and Buller, N. (2006) Health
surveillance in wildlife reintroductions Biological Conservation, 131 338-347.
May, R. and Anderson, R. (1979) Population biology of infectious diseases: Part II
Nature, 280 455-461.
Maynard Smith, J. (1971) The origin and maintenance of sex In Group selection (Ed,
Williams, GC) Aldine Atherton, Chicago, pp. 163-175.
McCallum, H. and Dobson, A. (2002) Disease, habitat fragmentation and conservation
Proceedings of the Royal Society of London B:Biological Sciences, 269 2041-2049.
McClelland, E., Penn, D. and Potts, W. (2003) Major histocompatibility complex
heterozygote superiority during coinfection Infection and Immunity, 71 4 2079-2086.
McCorkle, F., Taylor, R., Stinson, R., Day, E. and Glick, B. (1980) The effects of a
megalevel of vitamin C on the immune response of the chicken Poultry Science, 59
1324-1327.
McCurdy, D., Shutler, D., Mullie, A. and Forbes, M. (1998) Sex-biased parasitism of
avian hosts: Relations to blood parasite taxon and mating system Oikos, 82 2 303-312.
- 153 -
McGlade, T., Robertson, I., Elliot, A. and Thompson, R. (2003) High prevalence of
Giardia detected in cats by PCR Veterinary Parasitology, 110 197-205.
McGraw, K. and Hill, G. (2000) Differential effects of endoparasitism on the expression
of carotenoid- and melanin-based ornamental coloration Proceedings of the Royal
Society of London B:Biological Sciences, 267 1525-1531.
McLennan, D. and Brooks, D. (1991) Parasites and sexual selection: A
macroevolutionary perspective Quarterly Review of Biology, 66 3 255-286.
McManus, D. and Bowles, J. (1996) Molecular genetic approaches to parasite
identification-their value in diagnostic parasitology and systematics International
Journal for Parasitology, 26 7 687-704.
Menendez, R., Gonzalez-Megias, A., Lewis, O., Shaw, M. and Thomas, C. (2008)
Escape from natural enemies during climate-driven range expansion: a case study
Ecological Entomology, 33 413-421.
Merino, S., Moreno, J., Sanz, J. and Arriero, E. (2000) Are avian blood parasites
pathogenic in the wild? A medication experiment in blue tits (Parus caeruleus)
Proceedings of the Royal Society of London B, 267 2507-2510.
Meyer-Lucht, Y. and Sommer, S. (2005) MHC diversity and the association to
nematode parasitism in the yellow necked mouse (Apodemus flavicollis) Molecular
Ecology.
Meyer, D. and Thomson, G. (2001) How selection shapes variation of the human major
histocompatibility complex: a review Annals of Human Genetics, 65 1-26.
Mikko, S. and Andersson, L. (1995) Low major histocompatibility complex class II
diversity in European and North American moose Genetics, 92 4259-4263.
Mikko, S., Knut, R., Schmutz, S. and Leif, A. (1999) Monomorphism and
polymorphism at MHC DRB loci in domestic and wild ruminants Immunological
Reviews, 167 1 169-178.
Milinski, M. (2003) The function of mate choice in sticklebacks: optimizing MHC
genetics Journal of Fish Biology, 63 Supplement A 1-16.
- 154 -
Miller, H. and Lambert, D. (2004a) Gene duplication and gene conversion in class II
MHC genes of New Zealand robins (Petroicidae) Immunogenetics, 56 3 178-191.
Miller, H. and Lambert, D. (2004b) Genetic drift outweighs balancing selection in
shaping post bottleneck major histocompatibility complex variation in New Zealand
robins (Petroicidae) Molecular Ecology, 13 3709-3721.
Miller, K. and Withler, R. (1997) Mhc diversity in Pacific salmon: Population structure
and trans species allelism Hereditas, 127 83-95.
Miller, M., Goto, R., Bernot, A., Zoorob, R., Auffray, C., Bumstead, N. and Briles, W.
E. (1994) Two Mhc class I and two Mhc class II genes map to the chicken Rfp-Y
system outside the B complex.
Proceedings of the National Academy of Science U S A, 91 10 4397–4401.
Miller, P. and Hedrick, P. (1991) MHC polymorphism and the design of captive
breeding programs: Simple solutions are not the answer Conservation Biology, 5 4 556558.
Mitchell, C. and Power, A. (2003) Release of invasive plants of fungal and viral
pathogens Nature, 421 625-627.
Molineaux, L. (1988) The epidemiology of human malaria as an explanation of it's
distibution, including some implications for it's control In Malaria: Principles and
Practices of Malariology (Eds, Wernsdorfer, WH and McGregor, I) Churchill
Livingstone, Edinburgh.
Moller, A. (1997) Parasitism and the evolution of host life history In Host-parasite
evolution: General principles and avian models (Eds, Clayton, DH and Moore, J)
Oxford University Press, Oxford.
Moller, A. and De Lope, F. (1999) Senescence in a short-lived migratory bird: Agedependent morphology, migration, reproduction and parasitism Journal of Animal
Ecology, 68 1 163-171.
- 155 -
Montresor, A., Crompton, D., Gyorkos, T. and Savioli, L. 2002 Helminth control in
school age children: A guide for managers of control programmes World Health
Organisation
Morand, S. and Poulin, R. (1988) Density, body mass and parasite species richness of
terrestrial mammals Evolutionary Ecology, 12 717-727.
Mougeot, F., Redpath, S. and Leckie, F. (2005) Ultra-violet reflectance of male and
female red grouse, Lagopus lagopus scoticus: Sexual ornaments reflect nematode
parasite intensity Journal of Avian Biology, 36 203- 209.
Musolf, K., Meyer-Lucht, Y. and Sommer, S. (2004) Evolution of MHC-DRB class II
polymorphism in the genus Apodemus and a comparison of DRB sequences within the
family Muridae (Mammalia: Rodentia) Immunogenetics, 56 420-426.
Nei, M. and Gojobori, T. (1986) Simple methods for estimating the numbers of
synonymous and nonsynonymous nucleotide substitutions Mol Biol Evol, 3 5 418-426.
Norris, K., Anwar, M. and Read, A. (1994) Reproductive effort influences the
prevalence of haematozoan parasites in great tits Journal of Animal Ecology, 63 601610.
Novacek, M. (1992) Mammalian phylogeny: shaking the tree Nature, 356 121-125.
Nunn, C. and Heymann, E. (2005) Malaria infection and host behavior: a comparative
study of neotropical primates Behavioural Ecology and Sociobiology, 59 30-37.
O'Brian, S. and Evermann, J. (1988) Interactive influence of infectious disease and
genetic diversity in natural populations Trends in Ecology & Evolution, 3 254-259.
O'Brien, S. J., Roelke, M., Marker, L., Newman, A., Winkler, C., Meltzer, D., Colly, L.,
Evermann, J., Bush, M. and Wildt, D. (1985) Genetic basis for species vulnerability in
the cheetah Science, 227 4693 1428-1434.
Oliver, M., Telfer, S. and Piertney, S. (2009) Major histocompatibility complex (MHC)
heterozygote superiority to natural multi-parasite infections in the water vole (Arvicola
terrestris) Proceedings of the Royal Society of London B:Biological Sciences, 276
1119-1128.
- 156 -
Oosterhout, C., Joyce, D. A., Cummings, S. M., Blais, J., Barson, N. J., Ramnarine, I.
W., Mohammed, R. S., Persad, N. and Cable, J. (2006) Balancing selection, random
genetic drift, and genetic variation at the major histocompatibility complex in two wild
populations of guppies (Poecilia reticulata) Evolution, 60 2562-2574.
Orita, M., Suzaki, Y., Sekiya, Y. and Hayashi, K. (1989) Rapid and sensitive detection
of point mutations and DNA polymorphisms using the polymerase chain reaction
Genomics, 5 874-879.
Otto, S. and Lenormand, T. (2002) Resolving the paradox of sex and recombination
Nature Reviews Genetics, 3 252-261.
Palacios, M., Cunnick, J., Winkler, D. and Vleck, C. (2007) Immunosenescence in some
but not all immune components in a free living vertebrate, the tree swallow Proceedings
of the Royal Society of London B:Biological Sciences, 274 951-957.
Parker, B. and Duszynski, D. (1986) Coccidosis of sandhill cranes (Grus canadensis)
wintering in New Mexico Journal of Wildlife Diseases, 22 1 25-35.
Paterson, S. (1998) Evidence for balancing selection at the major histocompatibility
complex in a free living ruminant Journal of Heredity, 89 4 289-294.
Paterson, S., Wilson, K. and Pemberton, J. (1998) Major histocompatibility complex
variation associated with juvenile survival and parasite resistance in a large unmanaged
ungulate population (Ovis aries L.) Proceedings of the National Academy of Sciences or
the USA, 95 3714-3719.
Pauling, L., Itano, H., Singer, S. and Wells, I. (1949) Sickle cell anemia, a molecular
disease Science, 110 543-548.
Pawelec, G. (2008) Immunosenescence, Springer.
Penn, D., Damjanovich, K. and Potts, W. (2002) MHC heterozygosity confers a
selective advantage against multiple strain infections Proceedings of the National
Academy of Sciences or the USA, 99 17 11260-11264.
Penn, D. and Potts, W. (1999) The evolution of mating preferences and major
histocompatibility genes American Naturalist, 153 2 145-164.
- 157 -
Perez-Tris, J., Hasselquist, D., Hellgren, O., Krizanauskiene, A., Waldenstrom, J. and
Bensch, S. (2005) What are malaria parasites? Trends in Ecology and Evolution, 21 5
209-210.
Perkins, S. (2000) Species concepts and malaria parasites: detecting a cryptic species of
Plasmodium Proceedings of the Royal Society of London B:Biological Sciences, 267
2345-2350.
Perkins, S., Osgood, S. and Schall, J. (2002) Use of PCR for detection of subpatent
infections of lizard malaria: implications for epizootiology Molecular Ecology, 7 11
1587-1590.
Perry, B. and Randolph, T. (1999) Improving the assessment of the economic impact of
parasitic diseases and their control in production animals Veterinary Parasitology, 84 34 145-168.
Pharr, G. T., Gwynn, A. and Bacon, L. D. (1996) Histocompatibility antigen(s) linked
to the Rfp-Y (MHC-like) genes in the chicken Immunogenetics, 45 52058.
Pierre, J. (1999) Reintroduction of the South Island saddleback (Philesturnus
carunculatus carunculatus): dispersal, social organisation and survival Biological
Conservation, 89 2 153.
Piersma, T., Mendes, L., Hennekens, J., Ratiarison, S., Groenwold, S. and Jukema, J.
(2001) Breeding plumage honestly signals likelihood of tapeworm infestation in
females of a long distance migrating shorebird, the bar tailed godwit Zoology, 104 4148.
Piertney, S. and Oliver, M. (2006) The evolutionary ecology of the major
histocompatibility complex Heredity, 96 7-21.
Ploegh, H., Orr, H. and Strominger, J. (1981) Major histocompatilibty antigens-the
human HLA (HLA-A, HLA-B, HLA-C) and murine (H-2K, H-2D) class I molecules
Cell, 24 2 287-299.
Potts, W., Manning, C. and Wakeland, E. (1997) The role of infectious disease,
inbreeding and mate preferences in maintaining MHC genetic diversity: an experimental
- 158 -
test In Infection, polymorphism and evolution (Eds, Hamilton, WD and Howard, JC)
Chapman & Hall, London.
Poulin, R. (1996) Sexual inequalities in helminth infections: a cost of being a male? The
American Naturalist, 147 2 287-295.
Poulin, R. and Mouillot, D. (2003) Parasite specialisation from a phylogenetic
perspective: a new index of host specificity Parasitology, 126 473-480.
Pratt, B. F., O'Connor, D. H., Lafont, B. A. P., Mankowski, J. L., Fernandez, C. S.,
Triastuti, R., Brooks, A. G., Kent, S. J. and Smith, M. Z. (2006) MHC class I allele
frequencies in pigtail macaques of diverse origin 58 12 995-1001.
Quinnell, R. (1992) The population dynamics of Heligmosomoides polygyrus in an
enclusre population of wood mice Journal of Animal Ecology, 61 669-679.
Redmond, W. (1939) The cross-immune relationship of various strains of Plasmodium
cathemerium and P. relictum Journal of Infectious Diseases, 64 273-287.
Redpath, S., Mougeot, F., Leckie, F. and Hudson, P. (2006) Testing the role of parasites
in driving the cyclic population dynamics of a gamebird Ecology Letters, 9 4 410-418.
Richard, F. A., Sehgal, R. N. M., Jones, H. I. and Smith, T. S. (2002) A comparative
analysis of PCR-based detection methods for avian malaria Journal of Parasitology, 88
819-822.
Richardson, D., Burke, T. and Komdeur, J. (2002) Direct benefits and the evolution of
female biased cooperative breeding Evolution, 56 11 2313-2321.
Richardson, D., Burke, T. and Komdeur, J. (2007) Grandparent helpers: The adaptive
significance of older, postdominant helpers in the Seychelles warbler Evolution, 61 12
2790-2800.
Richardson, D., Jury, F., Blaakmeer, K., Komdeur, J. and Burke, T. (2001) Parentage
assignment and extra-group paternity in a cooperative breeder: the Seychelles Warbler
(Acrocephalus sechellensis) Molecular Ecology, 10 2263-2273.
- 159 -
Richardson, D., Komdeur, J. and Burke, T. (2004) Inbreeding in the Seychelles warbler:
Environment- dependent maternal effects Evolution, 58 9 2037-2048.
Richardson, D., Komdeur, J., Burke, T. and von Schantz, T. (2005) MHC-based
patterns of social and extra-pair mate choice in the Seychelles warbler Proceedings of
the Royal Society of London B, 272 759-767.
Richardson, D. and Westerdahl, H. (2003) MHC diversity in two Acrocephalus species:
the outbred great reed warbler and the inbred Seychelles warbler Molecular Ecology, 12
3523-3529.
Richardson, D. S., Bristol, R. and Shah, N. J. (2006) Translocation of the Seychelles
warbler Acrocephalus sechellensis to establish a new population on Denis Island,
Seychelles Conservation Evidence, 3 54-57.
Richardson, D. S., Jury, F. L., Dawson, D. A., Salgueiro, P., Komdeur, J. and Burke, T.
(2000) Fifty Seychelles warbler (Acrocephalus sechellensis) microsatellite loci
polymorphic in Sylviidae species and their cross-species amplification in other
passerine birds Molecular Ecology, 9 12 2225-2230.
Richie, T. (1988) Interactions between malaria parasites infecting the same vertebrate
host Parasitology, 96 3 607-639.
Richner, H., Christe, P. and Oppliger, A. (1995) Paternal investment affects prevalence
of malaria Proceedings of the National Academy of Sciences of the USA, 92 1192-1194.
Richner, H., Oppliger, A. and Christe, P. (1993) The effect of an ectoparasite on
reproduction in great tits Journal of Animal Ecology, 62 4 703-710.
Ricklefs, R. and Fallon, S. (2002) Diversification and host switching in avian malaria
parasites Proceedings of the Royal Society of London B:Biological Sciences, 269 885892.
Ricklefs, R., Swanson, B., Fallon, S., Martinez-Abrain, A., Scheuerlein, A., Gray, J. and
Latta, S. (2005) Community relationships of avian malaria parasites in Southern
Missouri Ecological Monographs, 75 543-559.
- 160 -
Roberts, L. and Janovy, J. (1996) Foundations of Parasitology, Wm. C. Brown
Publishers.
Rocamora, G. 1997 Rare and threatened species, sites and habitats monitoring
programme in Seychelles Ministry of Environment/European Union/Birdlife
International
Rozsa, L., Rekasi, J. and Reiczigel, J. (1996) Relationship of host coloniality to the
population ecology of avian lice (Insecta: Phthriaptera) Journal of Animal Ecology, 65 2
242-248.
Saif, Y., Barnes, H., Glisson.JR, Fadly, A., McDougald, L. and Swayne, D. (Eds.)
(2003) Diseases of Poultry, Blackwell Publishing.
Saino, N., Ferrari, R., Romano, M., Rubolini, D. and Moller, A. (2003) Humoral
immune response in relation to senescence, sex and sexual ornamentation the barn
swallow (Hirundo rustica) Journal of Evolutionary Biology, 16 1127-1134.
Sakai, A., Allendorf, F., Holt, J., Lodge, D., Molofsky, J., With, K., Baughman, S.,
Cabin, R., Cohen, J., Ellstrand, N., McCauley, D., O'Neil, P., Parker, I., Thompson, J.
and Weller, S. (2001) The population biology of invasive species Annual Review of
Ecological Systems, 32 305-32.
Salvador, A., Veiga, J., Martin, J., Lopez, P., Abelenda, M. and Puerta, M. (1995) The
cost of producing a sexual signal: testosterone increases the susceptibility of male
lizards to ectoparasitic infestation Behavioural Ecology, 7 2 145-150.
Schad, J., Ganzhorn, J. and Sommer, S. (2005) Parasite burden and consitution of major
histocompatability complex in the Malagasy mouse lemur, Maicrocebus murinus
Evolution, 59 2 439-450.
Schall, J. and Marghoob, A. (1995) Prevalence of a malarial parasite over time and
space: Plasmodium mexicanum in its vertebrate host, the western fence lizard
Scleoporus occidentalis Journal of Animal Ecology, 64 2 177-185.
- 161 -
Schrader, M., Walters, E., James, F. and Greiner, E. (2003) Seasonal prevalence of a
haematozoan parasite of red-bellied woodpeckers (Melanerpes carolinus) and it's
association with host condition and overwinter survival The Auk, 120 1 130-137.
Schuurs, A. H. W. M. and Verheul, H. A. M. (1990) Effects of gender and sex steroids
on the immune response Journal of Steroid Biochemistry, 35 157-172.
Scott, M. (1985) Experimental epidemiology of Gyrodactylus bullatarudis
(Monogenea) on guppies (Poecilia reticulata): short and long term studies In Ecology
and genetics of host-parasite interactions (Eds, Rollinson, D and Anderson, RM)
Academic Press, London, pp. 21-38.
Seddon, P., Armstrong, D. and Maloney, D. (2007) Developing the science of
reintroduction biology Conservation Biology, 21 2 303-312.
Sehgal, R., Hull, A., Anderson, N., Valkiunas, G., Markovets, M., Kawamura, S. and
Tell, L. (2006) Evidence for cryptic speciation of Leucocytozoon spp. (Haemosporida,
Leucocytozoidae Journal of Parasitology, 92 2 375-379.
Sehgal, R., Jones, H. and Smith, T. (2001) Host specificity and incidence of
Trypanosoma in some African rainforest birds: a molecular approach Molecular
Ecology, 10 2319-2327.
Shah, N. J. and Parr, S. (1999) Inter-island movements by Seychelles magpie-robins
Copsychus sechallarum: attempts at re-colonisation? Bird Conservation International, 9
283-286.
Sheldon, B. and Verhulst, S. (1996) Ecological immunology: costly parasite defences
and trade-offs in evolutionary ecology Trends in Ecology and Evolution, 11 8 317-321.
Siikamaki, P., Ratti, O., Hovi, M. and Bennett, G. (1997) Association between
haematozoan infections and reproduction in the pied flycatcher Functional Ecology, 11
176-183.
Simberloff, D. and Moore, J. (1997) Community ecology of parasites and free living
animals In Host-parasite evolution: General principles and avian models (Eds, Clayton,
DH and Moore, J) Oxford University Press, Oxford.
- 162 -
Skerrett, A. and Bullock, I. (2001) Field guide to the birds of the Seychelles,
Christopher Helm Publishers Ltd.
Slade, R., Hale, P., Francis, D., Marshall Graves, J. and Sturm, R. (1994) The marsupial
MHC: the tammar wallaby, Macropus eugenii, contains an expressed DNA-like gene on
chromosome 1 Journal of Molecular Evolution, 38 496-505.
Smith, D., Dushoff, J. and McKensie, F. (2004) The risk of a mosquito-borne infection
in a heterogeneous environment PLoS Biology, 2 11 1957-1964.
Smith, J., Wilson, K., Pilkington, J. and Pemberton, J. (1999) Heritable variation in
resistance to gastro-intestinal nematodes in an unmanaged mammal population
Proceedings of the Royal Society of London B, 266 1283-1290.
Smith, K., Acevedo-Whitehouse, K. and Pedersen, A. (2009) The role of infectious
diseases in biological conservation Animal Conservation, 12 1-12.
Smith, K., Sax, D. and Lafferty, K. (2006) Evidence for the role of infectious disease in
species extinction and endangerment Conservation Biology, 20 5 1349-1357.
Smyth, J. and Wakelin, D. (1994) Introduction to Animal Parasitology, Cambridge
University Press, Cambridge.
Sokolova, Y., Butaeva, F. and Dolgikh, V. (1999) Light and electron microscopic
observations on life cycle stages of Adelina grylli Butaeva 1996 (Sporozoa, Adeleidae)
from the fat body of the cricket Gryllus bimaculatus Protistology, 1 34-42.
Sol, D., Jovani, R. and Torres, J. (2000) Geographical variation in blood parasites in
feral pigeons: the role of vectors Ecography, 23 307-314.
Sol, D., Jovanni, R. and Torres, J. (2003) Parasite mediated mortality and host immune
response explain age-related differences in blood parasitism in birds Oecologia, 135
542-547.
Sommer, S. (2005) The importance of immune gene variability (MHC) in evolutionary
ecology and conservation Frontiers in Zoology, 2 16.
- 163 -
Sorci, G. and Moller, A. (1997) Comparative evidence for a positive correlation
between haematozoan prevalence and mortality in waterfowl Journal of Evolutionary
Biology, 10 731-741.
Spencer, K., Buchanan, K., Leitner, S., Goldsmith, A. and Catchpole, C. (2005)
Parasites affect song complexity and neural development in a songbird Proceedings of
the Royal Society of London B: Biological Sciences, 272 1576 2037-2043.
Spielman, D., Brook, B., Briscoe, D. and Frankham, R. (2004) Does inbreeding and loss
of genetic diversity decrease disease resistance? Conservation Genetics, 5 439-448.
Spottiswoode, C. (2008) Cooperative breeding and immunity: a comparative study of
PHA response in African birds Behavioural Ecology and Sociobiology, 62 953-974.
Steinauer, M., Nickol, B. and Orti, G. (2007) Cryptic speciation and patterns of
phenotypic variation of a highly variable acanthocephalan parasite Molecular Ecology,
16 19 4097-4109.
Strand, T., Westerdahl, H., Hoglund, J., Alatalo, R. and Siitari, H. (2007) The MHC
class II of the black grouse (Tetrao tetrix) consists of low numbers of B and Y genes
with variable diversity and expression Immunogenetics, 59 725-734.
Strickberger, M. (2005) Evolution, Jones And Bartlett Publishers Inc., Sudbury.
Super, P. E. and van Riper C, 3rd (1995) A comparison of avian hematozoan
epizootiology in two California coastal scrub communities Journal of Wildlife Disease,
31 4 447-461.
Svobodova, M. (1994) Isospora, Caryospora, and Eimeria (Apicomplexa: Eimeriidae)
in Passerisform birds from Czech Republic Acta Protozoologica, 33 101-108.
Tamura, K., Dudley, J., Nei, M. and Kumar, S. (2007) MEGA4: Molecular
Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and
Evolution, 24: 1596-1599.
Teixeira, M., Albuquerque, G., Lopes, C. and Florentino, M. (2003) An Adeleid
coccidia, a pseuodparasite of Didelphis aurita (Marsupiala:Didelphoidea) Brazilian
Journal of Veterinary Parasitology, 12 1 43-45.
- 164 -
Tella, J. L. (2002) The evolutionary transition to coloniality promotes higher blood
parasitism in birds Journal of Evolutionary Biology, 15 32-41.
Tenter, A., Barta, J., Beveridge, I., Duszynski, D., Mehlhorn, H., Morrison, D.,
Thompson, R. and Conrad, P. (2002) The conceptual basis for a new classification of
the coccidia International Journal for Parasitology, 32 595-616.
Therneau, T. survival: Survival analysis, including penalised likelihood R package
version 2.34
Thienpont, D., Rochette, F. and Vanparijs, O. (1979) Diagnosing helminthiasis through
coprological examination, Janssen Research Foundation, Beerse, Belgium.
Thursz, M., Thomas, H., Greenwood, B. and Hill, A. (1997) Heterozygote advantage
for HLA class-II type in hepatitis B virus infection Nature Genetics, 17 11-12.
Toft, C. and Karter, A. (1990) Parasite-Host Coevolution Trends in Ecology &
Evolution, 5 10 326-329.
Tompkins, D., Dobson, A., Arneberd, P., Begon, M., Cattadori, I., Greenman, J.,
Heesterbeek, H., Hudson, P., Newborn, D., Pugiliese, A., Rizzoli, A., Rosa, R., Rosso,
F. and Wilson, K. (2002) Parasites and host population dynamics In The Ecology of
Wildlife Diseases (Eds, Hudson, PJ, Rizzoli, A, Grenfell, BT, Heesterbeek, H and
Dobson, A) Oxford University Press, Oxford.
Torchin, M., Lafferty, K., Dobson, A., McKenzie, V. and Kuris, A. (2003) Introduced
species and their missing parasites Nature, 421 628-630.
Torchin, M., Lafferty, K. and Kuris, A. (2002) Parasites and marine invasions
Parasitology, 124 S137-S151.
Tregenza, T. and Wedell, N. (2000) Genetic compatibility, mate choice and patterns of
parentage: Invited review Molecular Ecology, 9 1012-1027.
Tschirren, B., Fitze, P. and Richner, H. (2003) Sexual dimorphism in susceptibility to
parasites and cell-mediated immunity in great tit nestlings Journal of Animal Ecology,
72 839-845.
- 165 -
Tschirren, B. and Richner, H. (2006) Parasites shape the optimal investment in
immunity Proceedings of the Royal Society of London B:Biological Sciences, 273 1595
1773-1777.
Valkiunas, G. (2005) Avian malaria parasites and other haemosporidia, CRC Press.
van Riper, C. I., van Riper, S., Goff, M. and Laird, M. (1986) The epizootiology and
ecological significance of malaria in Hawaiian land birds Ecological Monographs, 56 4
327-344.
Vandegrift, K., Raffel, T. and Hudson, P. (2008) Parasites prevent summer breeding in
white-footed mice, Peromyscus leucopus Ecology, 89 8 2251-2258.
VanderWerf, E., Burt, M., Rohrer, J. and Mosher, S. (2006) Distribution and prevalence
of mosquito-borne diseases in O'ahu 'Elapaio Condor, 108 4 770-777.
Vega, L. 2005 The ecology and conservation of the Seychelles fody Foudia
sechellarum University of Reading
Vesey-Fitzgerald, D. (1940) The birds of the Seychelles 1. The endemic birds Ibis, 14
480-489.
Vitousek, P., D'Antonio, C., Loope, L., Rejmanek, M. and Westbrooks, R. (1997)
Introduced species: A significant component of human-caused global change New
Zealand Journal of Ecology, 21 1 1-16.
von Schantz, T., Wittzell, H., Goransson, G. and Grahn, M. (1997) Mate choice, male
condition dependent ornamentation and MHC in the pheasant Hereditas, 127 133-140.
Vrijenhoek, R. and Leberg, P. (1991) Let's not throw out the baby with the bathwater: A
comment on management for MHC diversity in captive populations Conservation
Biology, 5 2 252-254.
Waldenstrom, J., Bensch, S., Hasselquist, D. and Ostman, O. (2004) A new nested
polymerase chain reaction method very efficient in detecting Plasmodium and
Haemoproteus Infections from avian blood Journal of Parasitology, 90 1 191-194.
- 166 -
Warner, R. (1968) The role of introduced diseases in the extinction of the endemic
Hawaiian avifauna Condor, 70 2 101-120.
Watt, C., Dobson, A. and Grenfell, B. (1995) Glossary In Ecology of infectious diseases
in natural populations (Eds, Grenfell, BT and Dobson, AP) Cambridge University
Press, pp. 510-21.
Weatherhead, P. (1990) Secondary sexual traits, parasites and polygyny in red-winged
blackbirds Behavioural Ecology, 1 125-130.
Weatherhead, P. and Bennett, G. (1991) Ecology of red-winged blackbird parasitism by
haematozoa Canadian Journal of Zoology, 69 9 2352-2359.
Weatherhead, P. and Bennett, G. (1992) Ecology of parasitism of brown-headed
cowbirds by haematozoa Canadian Journal of Zoology, 70 1 1-7.
Wedekind, C., Seebeck, T., Bettens, F. and Paepke, A. (1995) Mhc-dependent mate
preferences in humans Proceedings of the Royal Society of London B, 260 1359 245249.
Wegner, K., Reusch, T. and Kalbe, M. (2003) Multiple parasites and driving major
histocompatibility complex polymorphism in the wild Journal of Evolutionary Biology,
16 224-232.
Westerdahl, D., Hansson, B., Bensch, S. and Hasselquist, D. (2004a) Between year
variation of MHC allele frequencies in great reed warblers: selection or drift? Journal of
Evolutionary Biology, 17 485-492.
Westerdahl, D., Waldenstrom, J., Hansson, B., Hasselquist, D., von Schantz, T. and
Bensch, S. (2005) Associations between malaria and MHC genes in a migratory
songbird Proceedings of the Royal Society of London B, 272 1511-1518.
Westerdahl, D., Wittzell, H. and von Schantz, T. (1999) Polymorphism and
transcription of MHC class I genes in a passerine bird, the great reed warbler
Immunogenetics, 49 158-170.
- 167 -
Westerdahl, D., Wittzell, H., von Schantz, T. and Bensch, S. (2004b) MHC class I
typing in a songbird with numerous loci and high polymorphism using motif-specific
PCR and DGGE Heredity, 92 534-542.
Westerdahl, H., Witzell, H. and von Schantz, T. (2000) MHC diversity in two passerine
birds: no evidence for a minimum essential MHC Immunogenetics, 52 92-100.
Whiteman, N. and Parker, P. (2004) Effects of host sociality on ectoparasite population
biology Journal of Parasitology, 90 5 939-947.
Wikelski, M., Foufopoulos, J., Vargas, H. and Snell, H. (2004) Galapagos birds and
diseases: Invasive pathogens as threats to island species Ecology and Society, 9 1 5.
Wilcove, D., Rothstein, D., Dubow, J., Phillips, A. and Losos, E. (1998) Quantifying
threats to imperiled species in the United States BioScience, 48 8 607-615.
Williams, G. (1966) Natural selection, the costs of reproduction, and a refinement of
Lack's principle American Naturalist, 100 916 687-690.
Wilson, K., Bjornstad, O., Dobson, A., Merler, S., G, P., Randolph, S., Read, A. and
Skorping, A. (2002) Heterogeneities in macroparasite infections: patterns and processes
In The Ecology of Wildlife Diseases (Eds, Hudson, PJ, Rizzoli, A, Grenfell, BT,
Heesterbeek, H and Dobson, AP) Oxford University Press, New York.
Windsor, D. (1995) Equal rights for parasites Conservation Biology, 9 1 1-2.
Wittzell, H., Madsen, T., Westerdahl, D., Shine, R. and von Schantz, T. (1999) MHC
variation in birds and reptiles Genetica, 104 301-309.
Wittzell, H., Schantz, T., Zoorob, R. and Auffray, C. (1995) Rfp-Y-like sequences
assort independently of pheasant MHC genes Immunogenetics, Volume 42 1 68-71.
Wolf, C., Griffith, B., Reed, C. and Temple, S. (2002) Avian and mammalian
translocations: Update and reanalysis of 1987 survey data Conservation Biology, 10 4
1142-1154.
- 168 -
Wood, M., Cosgrove, C., Wilkin, T., Knowles, S., Day, K. P. and Sheldon, B. (2007)
Within-population variation in prevalence and lineage distribution of avian malaria in
blue tits, Cyanistes caeruleus Molecular Ecology, 16 15 3263-3273.
Woodford, M. 2000 Quarantine and health screening protocols for wildlife prior to
translocation and release into the wild
Worden, B., Parker, P. and Pappas, P. (2000) Parasites reduce attractiveness and
reproductive success in male grain beetles Animal Behaviour, 59 3 543-550.
Worley, K., Gillingham, M., Jensen, P., Kennedy, L., Pizzari, T., Kaufman, J. and
Richardson, D. (2008) Single locus typing of MHC class I and II B loci in a population
of red jungle fowl Immunogenetics, 60 5 233-247.
Wrosch, H. a. (1995) Oocyst output, periodicity, and immunity of two deer mouse
Eimerians, Eimeria arizonensis and Eimeria delicata Journal of Parasitology, 81 2 187194.
Yeager, M. and Hughes, A. (1999) Evolution of the mammalian MHC: natural
selection, recombination and convergent evolution Immunological Reviews, 167 45-58.
Zahavi, A. (1975) Mate selection -- a selection for a handicap Journal of Theoretical
Biology, 53 205-214.
Zajac, A. and Conboy, G. (2006) Veterinary clinical parasitology, Blackwell
Publishing.
Zhang, B., Fang, S. and Xi, Y. (2006) Major histocompatibility complex variation in the
endangered crested ibis Nipponia nippon and implications for reintroduction
Biochemical genetics, 44 3-4 113-123.
Zhao, X., Duszynski, D. and Loker, E. (2001) A simple method of DNA extraction for
Eimeria species Journal of Microbiological Methods, 44 131-137.
Zoorob, R., Bernot, A., Renoir, D., Choukri, F. and Auffray, C. (1993) Chicken major
histocompatibility complex class I B genes: analysis of interallelic and interlocus
sequence variance European Journal of Immunology, 23 1139-1145.
- 169 -
Zuk, M. (1990) Reproductive strategies and disease susceptibility: an evolutionary
viewpoint Parasitology Today, 6 7 231-233.
Zuk, M. and McKean, K. (1996) Sex differences in parasite infections: Patterns and
processes International Journal for Parasitology, 26 10 1009-1024.
- 170 -