Name _______________________________
Period 1 2 3 4 5 6
DNA Molecule
Background Info
Deoxyribonucleic acid (DNA) is the hereditary molecule. DNA is made of individual units called nucleotides.
Each nucleotide is made of a phosphate group, a sugar (deoxyribose), and a nitrogen base. The DNA molecule
looks like a twisted ladder. The phosphate and sugar form the sides of the molecule. Each rung contains a pair
of bases held together by weak hydrogen bonds. There are four bases: thymine (T), adenine (A), guanine (G),
and cytosine (C). A and T always pair up and C and G always pair up. In this investigation you will model the
structure of DNA using pop beads to represent the different parts of the DNA molecule.
Sugar
Phosphate
Bond
Bases (A, T, C, and G)
Setting Up Gather the required materials. Use Table 1 as a key for creating your DNA model.
Table 1: DNA Model Components
Backbone
Pop bead color
Red
White
Molecule
Phosphate group
Sugar (deoxyribose)
Bases
Pop bead color
Blue
Orange
Yellow
Green
Molecule
Cytosine (C)
Guanine (G)
Adenine (A)
Thymine (T)
Doing the Experiment
1. Begin by creating two phosphate-sugar “backbones” that will provide the framework on which to build each
strand of your DNA molecule. Connect alternating white and red pop beads. One backbone should have 11
white pop beads and 10 red pop beads – this will be your original DNA strand (top strand in picture above).
The other backbone should have 11 white pop beads and 11 red pop beads – this will be your complimentary
DNA strand (bottom strand in picture above).
2. Find the original DNA strand and put the complimentary DNA strand aside for now.
3. On the original DNA strand, attach a base to each sugar. At this point, the order of bases does not matter so
you can choose the order of the bases. Use blue to represent C, orange for G, yellow for A, and green for T (see
Table 1).
4. Once you have created the original DNA strand, complete the first two columns of Table 2 (the columns under
“Original DNA strand”). After that, go to step #5.
1
Table 2: DNA Molecule Data
Original DNA strand
Pop bead color
Complimentary DNA strand
Base letter
Base letter
Pop bead color
5. Now complete the last two columns of Table 2 (the columns under “Complimentary DNA strand”) in
order to determine the base sequence for the complimentary DNA strand. Remember, C always pairs
with G and T always pairs with A.
STOP AND CHECK: Are you done with Table 2? If your answer is ‘Yes’, then go on to #6. If your
answer is ‘No’, complete Table 2 now.
6. Find the complimentary DNA strand that you created in step #1. Use Table 2 to create your
complimentary DNA strand by attaching a base to each sugar (deoxyribose).
7. Once you have created the complimentary DNA strand, use the clear plastic connectors to bond the base
pairs together. These connectors represent the weak bonds that keep the base pairs together in all DNA.
8. Draw a sketch of your DNA molecule. Color code the backbone and base pairs OR include letters so it is
easy to identify the different molecules.
DNA Molecule Sketch
9. Hold the model from the top and gently twist the DNA ladder to the right. You should see that the
DNA looks like a spiral staircase. The model now represents the helical structure of DNA.
2
Thinking about what you observed
10. The type of sugar found in DNA is ____________________.
11. Which molecules make up the backbone (ladder sides) of the DNA molecule?
12. Why is DNA called “deoxyribonucleic acid”?
13. What type of bond keeps the bases paired together?
14. If an original DNA strand had a sequence of TAGGCTCA, what would be the complimentary DNA strand
sequence?
15. Fill in the missing bases for the strand of DNA below.
C --- ___
___ --- T
___ --- A
G --- ___
___ --- C
G --- ___
T --- ___
___ --- A
C --- ___
___ --- T
16. Sometimes there are mutations in the genetic sequence when the DNA is replicated and a complimentary
strand is being produced. Sometimes mutations are harmless and cause no change to an organism;
sometimes they are beneficial to a species; and sometimes they are harmful and cause genetic diseases. In
the DNA strands below, identify all incorrect bases in the complimentary DNA strand by crossing the
incorrect letter(s) out and writing the correct base below it.
Original DNA strand
Complimentary DNA strand
CGGTACAGCTACGTAACCTGGATCGGTACATTGCGT
GCCTTGTAGATCCATTGGACCTTACCATGAAATGCA
17. If you had the chance to choose a genetic mutation that would benefit you in some way, what would you
choose? (Feel free to be creative and be specific.)
18. If you had the ability to eliminate a genetic disease for the entire population of humans on Earth, would
you? If so, what genetic disease would you eliminate?
3