BIOLOGY 207 - Dr.McDermid
Lecture#2/3
DNA Structure & Replication
th
Readings: Griffiths et al, 7 Edition: Ch. 8 pp 243-259 (corrected)
Problems: Griffiths et al, 7th Edition: Ch. 8 Tier 1: # 2,3,5,9,13 Tier 2: #1,4,6,7,12
Concepts:
How are DNA and chromosomes replicated?
1. The structure of DNA suggests it is replicated semi-conservatively.
2. The work of Messelson & Stahl showed semi-conservative replication.
3. DNA is synthesized by enzymes at a replication fork.
4. Cairn's experiments showed chromosomes are semi-conservatively replicated.
5. Eukaryotes have multiple origins and telomerase to solve the "size" and "ends" problems.
Double helix structure provides a chemical explanation for the transmission of genes
Double helix structure explains:
1) replication
2) mutations
3) linear sequence of genes
Examine one prediction of Watson & Crick Double Helix model
- semi conservative replication
Meselson & Stahl -1958
Page 249. Fig 8-11, -12, and –13
- replication is semi-conservative
1. - grew E. coli in15N (heavy)
(14N normal)
2. - 15N ‡ 14N for one and two more cell divisions
3. - DNA extracted ‡ density gradient
Lecture#2
Page 1
Conclusion:
-DNA is replicated in a semi conservative manner
DNA synthesis / chromosome replication
Rules for chain elongation by DNA polymerases:
1) Copy already existing chain of DNA
2) Growth of the chain is in one direction only
(Figure 8-21-note error)
3) Need a primer to start DNA synthesis
Duplex DNA replication (replicate both strands) creates a
growing fork structure
Lecture#2
Page 2
Replication Fork
Figure 8-20, 27, -28, -29, -30, & -31
CD has animation (Fig 8-20, 8-21)
One parental duplex will produce two daughter duplexes
1)-Leading strand
- continuous synthesis on 3' end
- initially started with RNA primer
2)-Lagging strand
- synthesized in short discontinuous segments
- each segment consists of RNA primer and replicated DNA (Okazaki fragments)
- polymerase removes RNA primer
- ligase seals the discontinuous fragments
RESULT:
Both chains replicated and continuous
Both strands replicated simultaneously
Can you see a replication fork?
John Cairns' (1963) Experiment
E coli can incorporate 3H-thymidine into DNA
Replication is semi conservatively, therefore:
1.- New strand 2.- Parental strand Cairns Experiment:
- Replicate cells in 3H-thymidine medium for
1 cycle
- Extracted DNA ‡ spread on a microscope slide
- Put photographic emulsion over top - expose
film
- Detect silver grains under light microscope
Lecture#2
Page 3
After 1 replication cycle in 3H-thymidine
Figure 8-17
During the second replication cycle
- Figure 8-18
1) 1/2 labeled - 1/2 not
2) both labeled
- see the replication forks
-> branch in the ring of dots (silver grains)
- circular DNA molecule ‡ theta q structure
- density of silver grains reflects
- one strand ->1/2 labeled - 1/2 not
- other strand -> both labeled
Conclusions:
1) Observations are consistant with the semi-conservative model of replication
2) E. coli parental DNA remains circular throughout the DNA replication cycle
3) One origin of replication
Where does the Replication Fork begin?
- At fixed Origins of Replication
Lecture#2
Page 4
- proceeds bidirectionally (both directions)
E. coli origin of replication
- unique
- called oriC
See Fig. 8-23
Initiation Process
1) Proteins bind to origin site, unwind the local duplex, and put it in "open" conformation that is
single stranded.
2) Forms a replication fork in both directions
-> bidirectional Fig 8-22
3) Replication proceeds around the chromosome and stops at the terminus Fig 8-24
-> result is two daughter duplexes
DNA
replication
in
Eukaryotes
- two problems: SIZE and ENDS
Size
How do eukaryotes replicate their DNA in a short time? ->
Lecture#2
Page 5
- all ori initiate replication
- join up - produce long region of replicated DNA
- replication bubbles.
Note:
1) not every ori need "fire" at the same time
2) ori not all equi-distant
3) don't need specific termination sequences
Ends - Telomeres
Eukaryotic chromosome are linear
Replication problem - Figure 8-32
Lecture#2
Page 6
Problem:
Leading strand Lagging strand Potential result Special mechanism for replicating the telomere
Enzyme called telomerase adds bases to the end.
- telomere tandem arrays of simple DNA sequences.
eg. TTAGGGTTAGGGTTAGGGTTAGGG…..
Telomerase adds repeat units - Figure 8-33
- extends 3' end by many repeat units
- polymerase can then fill in the remaining section
- see animation gif at: http://www.anticancer.net/resan/tel_action.gif
______________________________________________________________________________________________
Lecture notes: Copyright © 2002 Heather McDermid and the Department of Biological Sciences, University of Alberta
Images are Copyright©2000 by W.H. Freeman & Co. in Griffiths et al, Introduction to Genetic Analysis
Lecture#2
Page 7