 1998 Oxford University Press
Human Molecular Genetics, 1998, Vol. 7, No. 3
557–562
Rodent Y chromosome TSPY gene is functional in rat
and non-functional in mouse
Sophie Mazeyrat and Michael J. Mitchell*
INSERM U406, Faculté de Médecine, 27 Boulevard Jean Moulin, 13385 Marseille, France
Received October 30, 1997; Revised and Accepted November 28, 1997
Recombination is believed to prevent genetic
deterioration in sexual populations because it allows
conservation of functional genotypes by removing
deleterious mutations. Moreover, evidence that nonrecombining segments of a genome deteriorate is
provided by genetic experiments in Drosophila and
yeast. Y chromosomes generally do not recombine
along most of their length, and thus Y chromosome
genes, despite having been selectively maintained for
their function, could be lost from the genome. Here we
present definitive evidence that functional Y genes can
be lost from the mammalian genome. TSPY genes must
have been selectively maintained on the mammalian
Y chromosome since before the radiation of eutheria,
80 million years ago, as they are found conserved on
the Y chromosome in two mammalian orders: primate
and artiodactyl. We have now identified TSPY on the
rodent Y chromosome, in mouse and rat. The gene
structure and expression of rat TSPY suggest that it is
a functional, testis-specific gene, but the closely
related mouse gene, Tspy, has clearly become nonfunctional, producing only low levels of aberrantly
spliced transcripts. Thus TSPY lost its function in the
mouse lineage after its divergence from the rat lineage.
So, in the case of Tspy at least, the absence of
recombination does appear to have led to the loss of
a functional gene.
INTRODUCTION
Sexual reproduction is generally believed to be advantageous
because recombination between homologous chromosome pairs
enables the removal of deleterious mutations and the reconstruction
of an optimal genotype (1). It therefore follows that nonrecombining genomes or segments of a genome would accumulate
deleterious mutations leading to the loss of genetic information
(2). Evidence for such genetic deterioration in the absence of
recombination is provided by genetic experiments in yeast (3) and
Drosophila (4). The Y chromosome does not recombine along
DDBJ/EMBL/GenBank accession nos AJ001377–AJ001380
much of its length, and this is thought to be the reason why it
carries less genetic information than the autosomes or the
X chromosome (5). It therefore appears that genes on the
non-recombining segment of the Y chromosome are eventually
lost from the chromosome and perhaps the genome. This is
particularly intriguing with respect to genes that have been
selectively maintained on the Y chromosome, and the comparative
study of conserved Y chromosome genes should provide valuable
insights into the molecular basis for the genetic deterioration of
non-recombining segments of a genome.
Comparative mapping suggests that several genes have been
conserved on the mammalian Y chromosome since before the
radiation of eutheria, >80 million years ago (6). Conservation is
assumed when a homologue of a gene is found on the
Y chromosome in more than one order of eutherian mammals.
Most of these conserved genes have a readily detectable
homologue on the X chromosome, but two exceptions have been
described: RBM (7) and TSPY (8). These are Y-specific genes
with no evident X homologue and they appear to be less well
conserved between orders of mammal than the X–Y homologous
genes. RBM homologues have been found on the Y chromosome
in several orders of eutherian and metatherian (marsupial)
mammal (7,9,10), but TSPY homologues have until now only
been described in primate and artiodactyl (8,11). Here we show
that TSPY is also present on the Y chromosome of rodents.
TSPY was first described on the human Y chromosome (12),
where it is present in 20–40 copies (13,14). A transcript of 1.3 kb
is produced exclusively in the testis which encodes a 33 kDa
protein, homologous to the proto-oncogene SET and the
nucleosome assembly protein 1 (NAP-1) (15), both of which are
believed to interact specifically with B-type cyclins to direct the
activity of cyclin-dependent kinases during the cell cycle (16). In
situ hybridization of anti-TSPY polyclonal antiserum to testis
sections indicates that the TSPY protein localizes primarily to the
cytoplasm of the mitotic spermatogonia, and it is suggested that
TSPY has a role in spermatogonial proliferation (15).
Here we present the isolation and characterization of mouse and
rat Y chromosome homologues of TSPY. The rat TSPY gene is an
apparently functional testis-specific gene but the closely related
mouse gene, mTspy, has clearly become non-functional. This
formally proves that genes that have been selectively maintained
during mammalian evolution can degenerate and lose their
function on the Y chromosome.
*To whom correspondence should be addressed Tel: +33 4 91 25 71 54; Fax: +33 4 91 80 43 19; Email: [email protected]
558
Human Molecular Genetics, 1998, Vol. 7, No. 3
Figure 1. Comparative structures of mouse, rat and human TSPY genes and cDNAs. (a) Mouse Tspy cDNA structures relative to human TSPY and rat Tspy. Boxes
representing exons are numbered 1–6 in accordance with the human TSPY gene structure. The thick black lines represent introns. The empty boxes represent the
sequence found at the 5′ end of three cDNAs. White boxes indicate that the presence of an exon has been verified by sequencing. Mouse Tspy exons were defined
by comparisons with rat cDNAs. Based on this definition, cryptic splice sites have been used to generate the 1.2 kb and 340 bp cDNAs, and these are indicated by
the presence of a short black intron line before exon 2 (site in intron) and an open box for exon 5 (site in exon). (b) Intron and exon sequence comparisons of human,
rat and mouse TSPY. Identities and similarities, in parentheses, are given as percentages. Exon 5 is separated into its coding and non-coding parts. nt, nucleotide; aa,
amino acid. GenBank accession nos: mouse TSPY cDNAs, AJ001378 and AJ001379; rat cDNA, AJ001377; rat genomic DNA, AJ001380.
RESULTS
Identification of a TSPY gene, Tspy, on the mouse Y
chromosome
The ∆Sxr b interval of the mouse Y chromosome is necessary for
the proliferation and survival of spermatogonia (17), and the
expression of the minor histocompatibility antigen H-Y (18,19).
As part of a systematic exon trap of DNA derived from the ∆Sxr b
interval of the mouse Y chromosome (manuscript in preparation),
two exons were isolated from the cosmid cSx2.7 (20), one of
which, eSx2.7c5, showed homology to exon 2 of human TSPY.
Screening an adult testis cDNA library with these exons identified
four cDNA clones, each of which contained sequences identical
to the trapped products. Sequencing of their extremities revealed
poly(A) tails on all four clones and three shared sequences at their
5′ ends, indicating that these cDNAs begin close to the start of
transcription. Two of these three cDNAs were sequenced entirely,
pcd2.7c5.2 (340 bp) and pcd2.7c5.4 (3.1 kb). The smaller clone
was composed of four separate regions of the larger clone. The
other two clones were partially characterized by restriction
mapping, PCR and sequencing with primers derived from the
trapped products. These cDNAs are represented in Figure 1a.
Comparisons of the amino acid sequence coded by the 3.1 kb
cDNA sequence with human and bovine TSPY (GenBank
accession nos M98524, M98525 and X74028) revealed regions
of similarity to the 3′ half of exon 1 (63%), exon 2 (86%), exon
3 (73%) and exon 4 (57%), but these are not spliced together,
suggesting that the 3.1 kb cDNA, pcd2.7c5.4, is identical to the
genomic structure of a mouse Y chromosome homologue of
TSPY. This gene has been termed Tspy, but in the interests of
clarity it will be referred to here as mTspy.
A related TSPY gene on the rat Y chromosome
The structure of the mouse TSPY cDNAs isolated here suggested
that the splicing of mTspy transcripts in the mouse is aberrant,
resulting in large unspliced forms and small over-spliced forms.
In contrast to this splicing pattern, an open reading frame (ORF)
is present throughout each conserved domain defined by
comparison with human TSPY. This suggested that mTspy had
become non-functional relatively recently on the rodent
Y chromosome. Thus, we reasoned that other rodents might
retain a functional TSPY gene which would allow a more precise
characterization of mTspy and its apparent degeneration on the
Y chromosome.
559
Human
Genetics,
1998,
7, No.
NucleicMolecular
Acids Research,
1994,
Vol. Vol.
22, No.
1 3
559
Figure 2. Amino acid comparison of rat, mouse, human and bovine TSPY and human SET. Identities with rat TSPY are boxed in black, similarities in grey. The end
of the alignment was dictated by the extent of the rat sequence. The mouse translation is derived from a virtual transcript. ‘Splicing’ was based on the structure of the
rat cDNA and the sequence was adjusted to maintain the ORF across exon 2 which contains two out-of-frame deletions. The exon junctions, none of which are found
spliced together in mRNA, are indicated by arrowheads above the mouse sequence and thus provide an approximate indication of the Tspy exon structure.
This possibility was explored successfully in the rat (Wistar).
Using primers derived from the conserved domains in the mouse,
products were amplified from rat testis cDNA whose sequence
and size corresponded to the spliced forms predicted from human
TSPY. By 3′ RACE, a 666 bp contiguous stretch of rat TSPY
(rTspy) cDNA, beginning at the 3′ end of exon 1, has been isolated
and sequenced. The corresponding genomic sequence of 2624 bp
was amplified as male-specific fragments from rat genomic DNA
and sequenced. This revealed that rTspy has at least six exons and
an organization similar to its human counterpart. An ORF was
present in the cDNA beginning at its 5′ end and extending to a
position in the 3′ half of exon 5. This differs slightly from the
human and bovine genes, where the ORF is reported to extend
into exon 6 (15). Sequences homologous to exons 5 and 6 of rTspy
were readily identified in the mTspy cDNAs, but they were not
spliced together. PCR was performed on mouse genomic DNA
between adjacent exons, and the intron–exon junctions were
sequenced. All fragments were male-specific and of the size and
sequence expected from the 3.1 kb mTspy cDNA sequence,
confirming that this cDNA represents the genomic structure of
mTspy. The relative structures of the mouse, rat and human genes
are presented in Figure 1a.
Rat TSPY has been conserved on the Y chromosome
Sequence comparisons between mouse and rat revealed that
intron sequences and the 3′ untranslated region (UTR) were 83%
identical, while coding exons showed 92% identity (Fig. 1b). This
shows that, at least in the rat lineage, there have been constraints
on the evolution of exon sequences after their divergence from a
common ancestor with the mouse and, therefore, that in the
mouse lineage TSPY lost its function after the divergence of
mouse and rat lineages. Amino acid comparison (Fig. 2) reveals
that the putative rat peptide is 88% identical (94% similar) to the
peptides encoded by mTspy exons. Rat TSPY is 47% identical
(67% similar) to human TSPY and 34% identical (57% similar)
to the proto-oncogene SET.
Figure 3. Southern analysis of mouse and rat genomic DNAs with the rat TSPY
cDNA spanning exons 1–6. (a) DNAs were digested with EcoRI and HindIII.
The DNAs were from C57BL/6 mouse and Wistar rat. M, male; F, female; Sxra,
XX∆Sxr a male; Sxrb, XX∆Sxr b. The XX∆Sxr a mouse carries only the minute
∆Sxr a region of the mouse Y chromosome. The XX∆Sxr b mouse carries a
deletion variant of the ∆Sxr a region from which the ∆Sxr b interval is absent.
Mouse Tspy maps into this deletion interval. (b) Dosage of mouse Tspy copy
number by Southern analysis. Different amounts of the cosmid that contains
Tspy, cSx2.7, were mixed with 5 µg of female DNA and electrophoresed beside
5 µg of male DNA (M). The equivalent number of copies is indicated above the
lanes. DNAs are digested with EcoRI.
TSPY is low-copy on the mouse and rat Y chromosome
In primates and artiodactyls, TSPY is multi-copy (14,21) and, if
this is also the case in the mouse, the transcripts that we have
isolated could come from a diverged, non-functional copy of
TSPY. To investigate the distribution of TSPY in the mouse and the
rat, Southern blot analysis was performed on mouse and rat
genomic DNAs digested with EcoRI or HindIII, using the rat
cDNA (exons 1–6) as probe (Fig. 3). In mouse and rat, the probe
560
Human Molecular Genetics, 1998, Vol. 7, No. 3
Figure 4. (a) Expression analysis of rat and mouse TSPY genes. PCR and RT-PCR are shown between exons 1 and 6 (primers: oMJ320/374 ), exons 2 and 3 (primers
oMJ 233/322) and exons 1 and 3 (primers: oMJ320/322). Ube1x primers oMJ149/150, modified from oMJ41/42 (25), were used as a positive control. Lanes 1–4 are
mouse and lanes 5–14 are rat: 1 and 5, female DNA; 2 and 6, male DNA; 3 and 7, testis RNA reverse transcriptase-positive (RT+); 4 and 8, testis RNA reverse
transcriptase-negative (RT–); 9, brain RNA RT+; 10, brain RNA RT–; 11, liver RNA RT+; 12, liver RNA RT–; 13, spleen RNA RT+; 14, spleen RNA RT–. (b) Location
of mutations affecting the coding and splicing of mTspy. Deletions are indicated by triangles with the number of bases deleted shown. The 8 bp deletion of exon 2 is
part of the 24 bp deletion that removes the intron 1 splice acceptor site. The asterisks indicate stop codons. The more 3′ stop is shared with rat TSPY.
was male-specific at low stringency, excluding the possibility that
the TSPY genes described are recent additions to the rodent
Y chromosome, as has been reported for the DAZ gene in
primates (22,23). In the rat, two bands are detected. As there are
neither EcoRI nor HindIII sites in the rat genomic DNA covered
by the cDNA probe, this shows that there are at least two rat TSPY
loci. The increased intensity of one band indicates that it may be
present in more than one copy. The bands detected in the mouse
are located exclusively within the ∆Sxr b interval and correspond
in size to those detected in cSx2.7, the cosmid containing the
entire mTspy gene. The low-copy nature of mouse mTspy was
demonstrated by mixing female DNA with cosmid Sx2.7 in
amounts equivalent to 1–10 copies of mTspy per 5 µg of genomic
DNA. This DNA was electropheresed beside 5 µg of male mouse
DNA, and the intensity of hybridization to the rat cDNA probe
was consistent with mTspy being single copy on the mouse
Y chromosome (Fig. 3b). Thus, we conclude that there is a single
∆Sxr b copy of TSPY on the mouse Y chromosome and at least
three Y chromosome copies in the rat.
reverse transcriptase-dependent products were PCR amplified
from male rat liver, spleen or brain cDNA (Fig. 4a).
A comparison of the rat and mouse genomic sequences allows
an assessment of the nucleotide changes in the coding regions and
the splice sites which may be associated with the loss of mTspy
expression (Fig. 4b). Most of the single base differences between
the coding regions (24 of 35) are either silent (16 of 35) or
conservative (eight of 35) at the amino acid level. Of the
remaining 11 differences, 10 cause amino acid substitutions and
one introduces a stop codon in mTspy, 18 bp upstream of the rTspy
stop codon. The most obviously significant differences are a
single base pair deletion of the third last base of exon 2 in mTspy
and a deletion of 24 bp which removes the splice acceptor site of
intron 1 and 8 bp from the 5′ end of exon 2. The other changes
which would most clearly disrupt expression of mTspy are two
single base substitutions that respectively destroy the splice donor
sites of intron 3 and intron 5. It is therefore concluded that TSPY
is a pseudogene on the mouse Y chromosome.
DISCUSSION
Expression and structure of the rat and mouse TSPY genes
The contrast in the expression of TSPY between mouse and rat
was demonstrated by performing inter-exon RT-PCR using
primers that work in both rat and mouse (Fig. 4a). In the rat, a
reverse transcriptase-dependent product is seen of the size
predicted from the cDNA sequence. In the mouse, however, no
band was amplified from testis cDNA. These results taken
together with the structure of the cDNAs isolated show that mTspy
RNAs are aberrantly spliced and present at low levels in the
poly(A)+ RNA fraction. Like the expression of human and bovine
TSPY, the expression of rTspy appears to be testis-specific as no
Here we show that the conservation of TSPY on the Y chromosome
extends to the rodent order. Unlike the genes which have been
described in primate and artiodactyl orders, rodent TSPY is not
present in large numbers of copies on the Y chromosome.
Furthermore, it seems likely that TSPY genes have diverged to such
an extent between orders of mammals that inter-order detection by
hybridization is dependent on the presence of a large number of
copies of TSPY in the target species. Therefore, our results strongly
indicate that it cannot be assumed that a TSPY gene is absent on the
Y chromosome in a given species, simply because a male-specific
band is not visible on a Southern blot (10,24). Thus it remains a
561
Human
Genetics,
1998,
7, No.
NucleicMolecular
Acids Research,
1994,
Vol. Vol.
22, No.
1 3
possibility that a TSPY gene exists on the Y chromosome in all
orders of mammal. The same reasoning can be applied to the
comparative mapping of RBM.
The structure and the expression of mTspy show it to be a
pseudogene, unable to perform the functions which have led to
the conservation of the corresponding TSPY gene on the rat
Y chromosome. Although the function of TSPY remains unknown,
it is reasonably assumed to have a role in spermatogenesis. It is clear
that this is not fulfilled by mTspy and, therefore, either this role does
not exist in the mouse or it is performed by another protein. The
identification of a functional TSPY homologue in the rat means that
an accessible model system is now available for the study of TSPY
which should greatly facilitate the elucidation of its putative
involvement in spermatogenesis.
Our data demonstrate that TSPY has been functionally conserved
on the rodent Y chromosome but has recently lost its function in the
mouse lineage. Previously, the strongest evidence for loss of
functional Y-borne genes from the genome came from comparative
analyses of mammalian X–Y homologous genes. These genes
readily detect homologues on the Y chromosome in most orders
of mammal, but exceptional species have been reported in which
no Y chromosome homologue can be detected by Southern blot
analysis or PCR (25–27). These results, although strongly
suggesting gene loss, are formally inconclusive because an
alternative to gene loss is that the gene has diverged more rapidly in
one lineage than another. By actually finding a non-functional copy
of TSPY we provide the first definitive proof that genes that have
been conserved for long evolutionary periods can be lost from the
genome, adding support to the theory that the genetic information in
non-recombining segments of the genome is being eroded (2).
MATERIALS AND METHODS
Exon trapping
Exon trapping with the vector pSPL3 (28) was performed following
the protocol of the pSPL3 exon trapping kit (Gibco BRL) with the
following modifications. Cosmid Sx2.7 was digested with BamHI
and BglII and ligated into the BamHI site of pSPL3. Ligations were
transformed into Escherichia coli NM554. Total RNA harvested
from the transfected Cos7 cells was converted to cDNA using an
oligo(dT) adaptor primer oMJ1. RT-PCR products were size
selected to avoid products of ‘vector-only’ splice events prior to
cloning in pAMP10. Individual inserts were sequenced and database
searches were performed with BLASTn and BLASTx. Sequencing
was performed manually as previously described (25).
Preparation of RNA and cDNAs
Poly(A)+ RNAs were prepared with the Mini Message Maker
(R&D Systems). Two hundred ng of poly(A)+ RNA were converted
to cDNA in a 10 µl reaction with Expand reverse transcriptase
(Boehringer Mannheim) following the manufacturer’s instructions
but using an oligo(dT) adaptor primer oMJ1 (GACTCGAGTCGACATCGA-T17). An identical control reaction was performed
without reverse transcriptase. On completion of the reactions, the
cDNA and control were diluted to 200 µl with TE. PCR was
performed with 1 µl in a 25 µl reaction. This cDNA was also used
for 3′ RACE experiments using the adaptor primer oMJ2 (GACTCGAGTCGACATCGA).
561
Isolation and characterization of mouse Tspy cDNAs
A cDNA library was made from testis poly(A)+ RNA from an
adult MF1 male carrying a Y∆Sxr a chromosome. Doublestranded cDNA was prepared from 1 µg of poly(A)+ RNA as
described in the Expand reverse transcriptase technical sheet.
Adaptors with an EcoRI compatible extremity and internal NotI site
were ligated to the cDNA. Adaptor-ligated cDNA was purified by
passage through a Chromaspin 1000 column (Clontech). The cDNA
was ligated to λNM1149 arms digested with EcoRI, packaged into
phage heads with Gigapack II Gold extracts (Stratagene) and plated
out on to E.coli NM514. A total of 1×106 clones were screened with
the exon trap products eSx2.7c5 and eSx2.7c11. The cDNA clones
pcd2.7c5.2 (340 bp) and pcd2.7c5.4 (3.1 kb) were sequenced on
both strands using ExoIII/mung bean nuclease-generated nested
deletions.
Table 1. The sequences of primers used given in the sense 5′ to 3′
Primer
oMJ223
oMJ233
oMJ234
oMJ320
oMJ321
oMJ322
oMJ327
oMJ328
oMJ370
oMJ371
oMJ372
oMJ373
oMJ374
oMJ149
oMJ150
Sequence
GTCGTCCATCATCAGCAACC
AAGCTCAACATGTAGTTCAG
ACTGAACTACATGTTGAGCTTG
CAGAAAGACCATAATCCAGG
TCAACAGGAGCTCAGCTTTG
TATCATTCTGGAAGTATGGG
GTGGAAGAGTACAACACTGG
CTCAGCAATCCTGTTGGAGC
AACTGAGGTCTTGAACGTGG
CCCTTTCCTCTACTATCATC
CTCATGAAGAGAGAATTAGG
CCTAATTCTCTCTTCATGAG
GACCTTTGCCAGTACTTATC
CGCTGTCCACACCCACTTAC
GCACTCTGCAACTCCTGGTC
Isolation and characterization of rat TSPY
The rat TSPY cDNA was isolated initially by 3′ RACE using the
adaptor primer oMJ2 and the nested Tspy primers oMJ234 and
oMJ223 from exon 2. This product was sequenced, allowing a
primer to be derived from its 3′ extremity (oMJ374) which was
used to amplify a 666 bp cDNA with oMJ321. This cDNA was
sequenced on both strands. This was used as the probe in the
Southern analysis presented in Figure 3: hybridization at 64C in
Church’s hybridization buffer as previously described (25) and
washing at low stringency in 1× SSC, 0.1% SDS, 60C. The rat
TSPY genomic sequence was derived by amplification from male
rat DNA using the following combinations of primer:
oMJ320/233 (exon 1/exon 2), oMJ320/370 (exon 1/intron 1),
oMJ371/233 (intron 1/exon 2), oMJ234/374 (exon 2/exon 6),
oMJ234/373 (exon 2/exon 5) and oMJ372/374 (exon 5/exon 6).
These products were then sequenced directly on both strands
without cloning. The sequences of primers used are listed in Table 1.
The same primers were used in the RT-PCR experiments. Sequencing was performed manually and on an ABI 373 automated
sequencer.
562
Human Molecular Genetics, 1998, Vol. 7, No. 3
PCR conditions and primer sequences
PCR from DNA and cDNA was performed using 35 cycles of 94C
for 30 s, annealing temperature for 30 s and elongation at 72C for
1 min per 1 kb. Reactions were performed using 0.015 U/µl Taq
polymerase (Appligene) using the supplier’s buffer (1×: 10 mM
Tris–HCl pH 9.0, 0.1% Triton X-100, 50 mM KCl, 1.5 mM MgCl2,
0.2 mg/ml bovine serum albumin), 200 µM of each dNTP and 1 mM
of each primer. Annealing temperatures with either rat or mouse
DNA or cDNA were as in Table 2.
Table 2. Annealing temperatures used for primer pairs in PCR from rat and
mouse DNA
Primer pairs
oMJ320/oMJ374
oMJ223/oMJ322
oMJ320/oMJ322
oMJ149/oMJ150
oMJ223/oMJ2
oMJ234/oMJ2
oMJ321/oMJ374
oMJ320/oMJ233
oMJ320/oMJ370
oMJ371/oMJ233
oMJ234/oMJ374
oMJ234/oMJ373
oMJ372/oMJ374
Annealing temperature (C)
Rat
Mouse
53
50
50
55
55
55
58
60
50
–
55
–
50
–
55
–
56
–
56
–
50
–
50
–
50
–
ACKNOWLEDGEMENTS
We thank Dr Françoise Muscatelli and Margaret Mitchell for
critical reading of the manuscript and Annicke Massacrier for rat
tissues. This work was in part supported by a grant from the
Groupement de Recherches et d’Études sur les Génomes
(GREG). S.M. was supported by a studentship from the Ministère
de l’Éducation Nationale, de l’Enseignement Supérieur et de la
Recherche (MENESR).
REFERENCES
1. Kondrashov, A.S. (1988) Deleterious mutations and the evolution of sexual
reproduction. Nature, 336, 435–440.
2. Muller, H. (1964) The relation of recombination to mutational advance.
Mutat. Res., 1, 2–9.
3. Zeyl, C. and Bell, G. (1997) The advantage of sex in evolving yeast populations.
Nature, 388, 465–468.
4. Rice, W.R. (1994) Degeneration of a nonrecombining chromosome. Science,
263, 230–232.
5. Charlesworth, B. (1978) Model for evolution of Y chromosomes and dosage
compensation. Proc. Natl Acad. Sci. USA, 75, 5618–5622.
6. Affara, N., Bishop, C., Brown, W., Cooke, H., Davey, P., Ellis, N., Graves, J.,
Jones, M., Mitchell, M., Rappold, G., Tyler-Smith, C., Yen, P. and Lau, Y.-F.
(1996) Report of the second international workshop on Y chromosome
mapping 1995. Cytogenet. Cell Genet., 73, 33–76.
7. Ma, K., Inglis, J.D., Sharkey, A., Bickmore, W.A., Hill, R.E., Prosser, E.J.,
Speed, R.M., Thomson, E.J., Jobling, M., Taylor, K., Wolfe, J., Cooke, H.J.,
Hargreave, T.B. and Chandley, A.C. (1993) A Y chromosome gene family
with RNA-binding protein homology: candidates for the azoospermia factor
AZF controlling human spermatogenesis. Cell, 75, 1287–1295.
8. Arnemann, J., Jakubiczka, S., Thuring, S. and Schmidtke, J. (1991) Cloning
and sequence-analysis of a human Y chromosome derived, testicular cDNA,
TSPY. Genomics, 11, 108–114.
9. Laval, S., Glenister, P., Rasberry, C., Thornton, C., Mahadevaiah, S., Cooke, H.,
Burgoyne, P. and Cattanach, B. (1995) Y chromosome short arm–Sxr
recombination in XSxr/Y males causes deletion of Rbm and XY female sex
reversal. Proc. Natl Acad. Sci. USA, 92, 10403–10407.
10. Delbridge, M.L., Harry, J.L., Toder, R., Oneill, R.J.W., Ma, K., Chandley,
A.C. and Graves, J.A.M. (1997) A human candidate spermatogenesis gene,
RBM1, is conserved and amplified on the marsupial Y chromosome.
Nature Genet., 15, 131–136.
11. Vogel, T., Dechend, F., Manz, E., Jung, C., Jakubiczka, S., Fehr, S.,
Schmidtke, J. and Schnieders, F. (1997) Organization and expression of
bovine TSPY. Mamm. Genome, 8, 491–496.
12. Arnemann, J., Epplen, J., Cooke, H., Sauermann, U., Engel, W. and
Schmidtke, J. (1987) A human Y-chromosomal DNA sequence expressed in
testicular tissue. Nucleic Acids Res., 15, 8713–8724.
13. Tyler-Smith, C., Taylor, L. and Muller, U. (1988) Structure of a hypervariable
tandemly repeated DNA sequence on the short arm of the human Y
chromosome. J. Mol. Biol., 203, 837–848.
14. Manz, E., Schnieders, F., Brechlin, A. and Schmidtke, J. (1993) TSPY-related
sequences represent a microheterogeneous gene family organised as
constitutive elements in DYZ5 tandem repeat units on the human Y
chromosome. Genomics, 17, 726–731.
15. Schnieders, F., Dork, T., Arnemann, J., Vogel, T., Werner, M. and Schmidtke, J.
(1996) Testis-specific protein, Y-encoded (TSPY) expression in testicular
tissues. Hum. Mol. Genet., 5, 1801–1807.
16. Kellogg, D.R., Kikuchi, A., Fujii-Nakata, T., Turck, C.W. and Murray, A.W.
(1995) Members of the NAP/SET family of proteins interact specifically with
B-type cyclins. J. Cell Biol., 130, 661–673.
17. Sutcliffe, M.J. and Burgoyne, P.S. (1989) Analysis of the testis of H-Y negative
XOSxrb mice suggests that the spermatogenesis gene (Spy) acts during the
differentiation of the A spermatogonia. Development, 107, 373–380.
18. Simpson, E., Chandler, P., Hunt, R., Hogg, H., Tomonari, K. and McLaren, A.
(1986) H-Y status of X/XXSxr′ male mice: in vitro tests. Immunology, 57,
345–349.
19. King, T.R., Christianson, G.J., Mitchell, M.J., Bishop, C.E., Scott, D.,
Ehrmann, I., Simpson, E., Eicher, E.M. and Roopenian, D.C. (1994) Deletion
mapping by immunoselection against the H-Y histocompatibility antigen
further resolves the Sxra region of the mouse Y chromosome and reveals
complexity of the Hya locus. Genomics, 24, 159–168.
20. Mitchell, M.J. and Bishop, C.E. (1992) A structural analysis of the Sxr region
of the mouse Y chromosome. Genomics, 12, 26–34.
21. Vogel, T., Borgmann, S., Dechend, F., Hecht, W. and Schmidtke, J. (1997)
Conserved Y-chromosomal location of TSPY in Bovidae. Chromosome Res., 5,
182–185.
22. Saxena, R., Brown, L.G., Hawkins, T., Alagappan, R.K., Skaletsky, H., Reeve,
M.P., Reijo, R., Rozen, S., Dinulos, M.B., Disteche, C.M. and Page, D.C. (1996)
The DAZ gene-cluster on the human Y chromosome arose from an autosomal
gene that was transposed, repeatedly amplified and pruned. Nature Genet.,
14, 292–299.
23. Shan, Z., Hirschmann, P., Seebacher, T., Edelmann, A., Jauch, A., Morell, J.,
Urbitsch, P. and Vogt, P.H. (1996) A SPGY copy homologous to the mouse
gene Dazla and the Drosophila gene boule is autosomal and expressed only in
the human male gonad. Hum. Mol. Genet., 5, 2005–2011.
24. Jakubiczka, S., Schnieders, F. and Schmidtke, J. (1993) A bovine homologue
of the human TSPY gene. Genomics, 17, 732–735.
25. Mitchell, M.J., Woods, D.R., Tucker, P.K., Opp, J.S. and Bishop, C.E. (1991)
Homology of a candidate spermatogenic gene from the mouse Y chromosome
to the ubiquitin-activating enzyme E1. Nature, 354, 483–486.
26. Agulnik, A.I., Mitchell, M.J., Lerner, J.L., Woods, D.R. and Bishop, C.E.
(1994) A mouse Y chromosome gene encoded by a region essential for
spermatogenesis and expression of male-specific minor histocompatibility
antigens. Hum. Mol. Genet., 3, 873–878.
27. Just, W., Rau, W., Vogel, W., Akhverdian, M., Fredga, K., Graves, J.A.M. and
Lyapunova, E. (1995) Absence of Sry in species of the vole Ellobius. Nature
Genet., 11, 117–118.
28. Church, D.M., Stotler, C.J., Rutter, J.L., Murrell, J.R., Trofatter, J.A. and
Buckler, A.J. (1994) Isolation of genes from complex sources of mammalian
genomic DNA using exon amplification. Nature Genet., 6, 98–105.