Chem. Senses 38: 563–575, 2013
doi:10.1093/chemse/bjt027
Advance Access publication July 4, 2013
Camphor Activates and Sensitizes Transient Receptor Potential Melastatin
8 (TRPM8) to Cooling and Icilin
Tudor Selescu1,2, Alexandru C. Ciobanu1,2, Cristian Dobre1, Gordon Reid2 and
1
Alexandru Babes
1
Department of Anatomy, Physiology and Biophysics, Faculty of Biology, University of
2
Bucharest, Splaiul Independentei 91-95, 050095 Bucharest, Romania and Department of
Physiology, University College Cork, Western Road, Cork, Ireland
Correspondence to be sent to: Tudor Selescu, Department of Anatomy, Physiology and Biophysics, Faculty of Biology, University of
Bucharest, Splaiul Independentei 91-95, 050095 Bucharest, Romania e-mail: [email protected]
Accepted May 14, 2013
Abstract
Camphor is known to potentiate both heat and cold sensations. Although the sensitization to heat could be explained by the
activation of heat-sensitive transient receptor potential (TRP) channels TRPV1 and TRPV3, the camphor-induced sensitization
to cooling remains unexplained. In this study, we present evidence for the activation of the cold- and menthol-sensitive channel transient receptor potential melastatin 8 (TRPM8) by camphor. Calcium transients evoked by camphor in HEK293 cells
expressing human and rat TRPM8 are inhibited by the TRPM8 antagonists 4-(3-chloro-2-pyridinyl)-N-[4-(1,1-dimethylethyl)
phenyl]-1-piperazinecarboxamide and 2-aminoethyl diphenylborinate. Camphor also sensitized the cold-induced calcium
transients and evoked desensitizing outward-rectifying currents in TRPM8-expressing HEK293 cells. In the presence of ruthenium red (a blocker of TRPV1, TRPV3, and TRPA1), the camphor sensitivity of cultured rat dorsal root ganglion neurons was
highest in a subpopulation of cold- and icilin-sensitive neurons, strongly suggesting that camphor activates native TRPM8.
Camphor has a dual action on TRPM8: it not only activates the channel but also inhibits its response to menthol. The icilininsensitive chicken TRPM8 was also camphor insensitive. However, camphor was able to activate an icilin-insensitive human
TRPM8 mutant channel. The activation and sensitization to cold of mammalian TRPM8 are likely to be responsible for the
psychophysical enhancement of innocuous cold and “stinging/burning” cold sensations by camphor.
Key words: chicken TRPM8, dorsal root ganglion, eucalyptol, human TRPM8, icilin, menthol
Introduction
Camphor is a bicyclic monoterpene traditionally extracted
from camphor laurel (Cinnamomum camphora) and used
historically for topical applications and inhalation. Although
the scent of camphor is mediated by odorant receptors, G
protein-coupled receptors in vertebrate olfactory receptor
neurons (Sicard 1985; Adipietro et al. 2012), camphor
has also other, less understood, sensory properties. Part
of its long-established psychophysical features consists in
modulation of temperature sensing. According to Green
(1990), camphor potentiates the perceived intensity of both
hot and cold stimuli when applied on the hairy skin. The
physiologically relevant concentration is probably very high
due to the fact that camphor is usually topically applied in
concentrations up to 10–20% (w/v; equivalent to ~0.6–1.3 M)
(Green 1990; Xu et al. 2005). Other investigators (Burrow
et al. 1983) have reported that camphor, eucalyptol, and
menthol evoke a cold sensation following vapor inhalation
from each of these compounds and conclude that all 3
stimulate cold receptors in the nose.
Transient receptor potential (TRP), subfamily M, member
8 (TRPM8) is a non-selective cation channel activated by
low temperatures (8–28 °C) and cooling mimetic compounds
such as menthol and its derivatives, by eucalyptol, and also
by the super-cooling agent icilin (McKemy et al. 2002).
Activation by icilin is calcium dependent, being absent or
very small when extracellular Ca2+ is replaced with ethylene
glycol tetraacetic acid (EGTA) (Chuang et al. 2004). TRPM8
is expressed not only in small diameter neurons from trigeminal and dorsal root ganglia (DRG; McKemy et al. 2002) but
also in olfactory receptor neurons (Nakashimo et al. 2010).
© The Author 2013. Published by Oxford University Press. All rights reserved.
For permissions, please e-mail: [email protected]
564 T. Selescu et al.
Camphor was recently shown to modulate the activity of
several temperature-activated ion channels from the TRP
family. The compound was reported to be an agonist of the
warmth-sensing TRPV3 (Moqrich et al. 2005), a partial agonist of the heat-sensing TRPV1 (Xu et al. 2005), an inhibitor
of the noxious cold sensor TRPA1 (Story et al. 2003; Xu
et al. 2005, Macpherson et al. 2006), and is also acting on
other ion channels (Park et al. 2001; Hall et al. 2004)—none
of which can explain the cooling sensation due to camphor.
In insects, camphor activates a TRPA1 homolog, the honey
bee Hymenoptera-specific TRPA channel, which is heat
activated (Kohno et al. 2010) and partially inhibits the heatelicited current mediated by the Drosophila TRP channel
Painless (Sokabe et al. 2008).
Camphor was shown, together with menthol and cinnamaldehyde, to inhibit the basal phospholipase C (PLC)
activity in HEK293T cells (Kim et al. 2008), whereas
PLC activated by Ca2+ entry is known to inhibit TRPM8
via phosphatidylinositol bisphosphate (PIP2) depletion
(Daniels et al. 2009). Although camphor was reported to
have either no effect (McKemy et al. 2002, Xu et al. 2005;
Macpherson et al. 2006) or a minor effect on TRPM8
(Vogt-Eisele et al. 2007), all the previous results were only
based on whole-cell patch clamp experiments, a technique
that may interfere with intracellular signaling pathways.
Our previous work based on calcium microfluorimetry
(Babes et al. 2006) revealed non-adapting cold-sensitive
DRG neurons displaying slight camphor sensitivity and a
general TRPM8-like pharmacological profile (menthol and
icilin sensitivity and absence of inhibition by ruthenium
red [RuR]).
In this study, we have investigated the action of camphor on recombinant human, rat, and chicken TRPM8
(cTRPM8) as well as native TRPM8 from rat DRG neurons
using calcium imaging with conventional whole-cell and
perforated patch clamp. In order to investigate the TRPV1independent action of camphor on cultured DRG neurons,
we have exploited the differential action of RuR on TRPV1
and TRPM8 (Weil et al. 2005). RuR is also a blocker of
TRPV3 (Xu et al. 2002), which is considered to be absent
from rodent DRG, although contradictory reports exist
(Peier et al. 2002; Frederick et al. 2007).
cTRPM8 was considered an interesting target for testing
camphor, considering that the chicken TRPV1 ortholog is
camphor insensitive (Xu et al. 2005). This allows the study
of a possible intraspecies conservation of activator sensitivity between different TRP ion channels.
Materials and methods
Ion channel heterologous expression
Human TRPM8 (hTRPM8) was stably expressed in
HEK293 cells (a kind gift from Prof. Thomas Voets, KU
Leuven, Belgium). Rat TRPV1 (rTRPV1; inside pcDNA3),
cTRPM8 (inside pcDNA3-Sfi2), and hTRPM8 D802A
(inside pIRES-EGFP, a kind gift from Dr Frank Kühn,
RWTH Aachen, Germany) were transiently expressed in
HEK293T cells using calcium phosphate coprecipitation.
For the experiments on rTRPV1, we also used HEK293 cells
stably expressing rTRPV1 (a kind gift from Prof. Makoto
Tominaga, OIIB Okazaki, Japan). After the transfection
procedure, cells were plated onto 35-mm Petri dishes or
24-mm borosilicate glass coverslips (0.17 mm thick), which
had been treated with poly-d-lysine (0.1 mg/mL for 30 min).
The cells were used for experiments within 1–2 days.
cTRPM8 cloning
cTRPM8 was cloned from DRG of 2–4-day-old Gallus
domesticus chicks. Trizol-extracted total RNA was reverse
transcribed (Clontech) with an anchored oligo-dT primer,
and PCR was carried out using an equal mix of Pfu (Promega)
and Turbo Pfu (Stratagene, Agilent Technologies) enzymes.
Primers for PCR were based on Gallus gallus genomic reads
at the 5′ end, and on resequencing of a chicken bursal
expressed sequence tag clone (AJ456804, a kind gift from
Dr Jean-Marie Buerstedde) to obtain a sequence from the
3′ untranslated region; SfiI enzyme sites were added for later
cloning. The primer sequences used were as follows: agctgtggccattacggccatgaggcaccgaagaaatggcaattttgag (5′ end) and
ctgggcggccgcctcggccgctcagatatctgcttttcagtcac (3′ end). After
amplification, the PCR product was cut and ligated into a
vector modified from pcDNA3 (Invitrogen) by replacement
of the multiple cloning site by one containing SfiI sites.
Rat DRG culture
DRG neuron cultures were obtained from selected DRG
(T12-S1) of adult male Wistar rats (150–200 g) killed by
2 min of CO2 exposure, followed by decapitation, according
to the European Guidelines on Laboratory Animal Care,
with the approval of the institutional ethics committee
of the University of Bucharest. The culturing procedure
was largely described elsewhere (Reid et al. 2002). Briefly,
removed DRGs were incubated in a mixture of 2 mg/
mL collagenase (type XI) and 2.5 mg/mL dispase (from
Bacillus polymyxa; Gibco, Invitrogen) for 1 h at 37 °C
in IncMix solution (155 mM NaCl, 1.5 mM K2HPO4,
5.6 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid
[HEPES], 4.8 mM Na-HEPES, 5 mM glucose, adjusted to
pH 7.4 with NaOH). After trituration, the cell suspension
was filtered through a nylon mesh sieve with 35-μm pore
size (N35S; Biodesign Inc.), and the dissociated cells were
plated onto glass coverslips (see Ion channel heterologous
expression, above) and cultured (37 °C and 5% CO2) in
Dulbecco’s modified Eagle medium/Ham’s F12 medium
(1:1) supplemented with 10% horse serum and gentamicin
(50 μg/mL). All chemicals for cell culture were from Sigma,
unless otherwise mentioned.
Camphor Activates and Sensitizes TRPM8 565
Ca2+ microfluorimetry
HEK293 cells and DRG neurons cultured on 24-mm diameter glass coverslips were incubated in standard extracellular solution (see Electrophysiology, below) containing 2 μM
Calcium Green-1 AM and 0.02% Pluronic F-127 (both from
Invitrogen) and left to recover for another 30 min before
recording. The data were recorded using Axon Imaging
Workbench 2.2 (Molecular Devices). After background
subtraction, the Ca2+ imaging data were plotted as mean ±
standard deviation (SD). Data were also quantified using custom-written software as ΔF/F0 (amplitude) for each recorded
cell, the ratio between the maximum fluorescence change during the stimulus and the baseline fluorescence before the stimulus. For DRG neurons, the ΔF/F0 threshold was arbitrarily
set at 10% to identify responding neurons. The area under the
curve (AUC) was computed from the start of the response
until the signal recovered to baseline or, if the baseline was
not reached, until the application of the next stimulus.
Electrophysiology
Whole-cell patch clamp currents were amplified using a
WPC-100 patch clamp amplifier (E.S.F. Electronic), filtered at 3 kHz, and digitized at 5–25 kHz through an Axon
Instruments DigiData 1322A interface driven by pCLAMP
8 (Molecular Devices). The extracellular solution contained
(in mM) 140 NaCl, 4 KCl, 2 CaCl2, 1 MgCl2, 10 HEPES, 4.54
NaOH, and 5 glucose (pH 7.4 at 25 °C [NaOH]). The intracellular solution for conventional whole-cell patch clamp on
HEK293 cells and DRG neurons contained (in mM) 140
KCl, 0.05 CaCl2, 1 MgATP, 0.1 EGTA, and 10 HEPES (pH
7.2 at 25 °C [KOH]).
For perforated patch clamp on HEK293 cells, we used
amphotericin B and a k-gluconate-based solution containing (in mM): 100 k-gluconate, 40 KCl, 8 NaCl, 1 MgCl2,
and 10 HEPES (pH 7.2 at 25 °C [NaOH]). For increasing the
aqueous solubility of amphotericin B, the pipette solution
was prepared using a method derived from that described by
Yawo and Chuhma (1993). Amphotericin B (5 mg) and fluorescein disodium salt (20 mg) were mixed together in 2 mL of
methanol. After vortexing and vigorous shaking, 100 μL of
this mixture were deposited at the bottom of a 2-mL polyethylene test tube. This volume was dried completely under a
stream of CO2 gas, and then 1 mL of the k-gluconate-based
solution (20 μm filtered) was added. The resulting solution,
containing 250 μg/mL of amphotericin B and 1 mg/mL of
fluorescein, was not further filtered. All procedures were
performed under low-intensity illumination. Borosilicate
capillaries with filament (GC150F-10; Harvard Apparatus)
were pulled using a vertical micropipette puller (PUL-100;
World Precision Instruments), tip polished for resistances of
2–5 MΩ, and back-filled with the aforementioned solution.
Positive pressure was applied to the pipette while also having the extracellular solution flow in the opposite direction
relative to the solution efflux from the patch pipette. Using
HEK293 cells, gigaseal was obtained normally and the perforation was gradual; the membrane capacitance and the
access resistance have stabilized after about 3–5 min.
Temperature control
During Ca2+ microfluorimetry experiments, the temperature
inside the bath was controlled via a computer-controlled custom-made Peltier-driven perfusion system, improved from
the previously described version (Reid et al. 2001) by having
2 larger Peltier elements (30 × 15 mm) each rated at 20.9 W
(Eureca Meβtechnik) and a faster exchange rate, for the
rapid delivery of controlled concentrations from the chemical stimuli to the cells. This was essential for recording the
transient responses evoked by camphor. In brief, the chamber previously described, constructed with glass coverslips,
was replaced with a 18-gauge stainless steel tubing, reducing
the solution cooling volume from ~150 to <100 μL, a miniature manifold was used (MM-6; Harvard Apparatus) and
all other dead volumes were reduced, whereas the flow rate
was maintained close to the optimal value of 1.5 mL/min.
The temperature was measured during the actual recordings in the immediate proximity of the field of cells imaged,
using a T-type thermocouple (IT-1E; Physitemp). If not
otherwise mentioned, the experiments were performed with
the temperature maintained at 25 °C. During patch clamp
experiments, the temperature of the recording chamber was
set at 25 °C also by using a Peltier-driven micro-incubator
(PDMI-2 controlled by TC-202A; Harvard Apparatus).
Data analysis
All data were analyzed in OriginPro 8.0 (OriginLab). Data
comparison of cell responses were performed by pairedsamples Student’s t-test or ratio t-test, if not otherwise mentioned. Results are presented as means ± SD. The classical
form of the Hill equation was used for fitting ΔF/F0 against
camphor concentration.
Solutions and chemicals
Stock solutions were made either in dimethyl sulfoxide
(camphor, icilin, 2-aminoethyl diphenylborinate [2-APB],
4-(3-chloro-2-pyridinyl)-N-[4-(1,1-dimethylethyl)phenyl]1-piperazinecarboxamide [BCTC], and allyl isothiocyanate
[AITC]), ethanol (menthol and capsaicin) or H2O (RuR).
The camphor stock solution (2 M) was made considering
a 20% volume displacement by camphor. The 0.5–10 mM
working solutions were vigorously shaken at 37 °C for at
least 15 min. The standard extracellular solution was vehicle
(dimethyl sulfoxide and ethanol) corrected.
All chemicals were from Sigma-Aldrich except icilin and
BCTC, from Tocris Bioscience. Menthol was (1R,2S,5R)(−)-menthol and camphor was (1R)-(+)-camphor.
566 T. Selescu et al.
Results
Camphor activates hTRPM8 in a concentration- and
temperature-dependent manner
The effect of camphor on hTRPM8 was assessed using a
HEK293 cell line stably expressing hTRPM8. Before the
recording, the cells were left for about 5 min to recover after
starting the perfusion of extracellular solution at 25 °C.
Untransfected HEK293T cells displayed either no variations or small decreases in intracellular calcium concentration ([Ca2+]i) during camphor applications (2–10 mM, 30
s–2-min duration; data not shown). In hTRPM8-HEK293
cells held at 25 °C, increasing concentrations of camphor
(0.5, 1, 2, and 10 mM, 30 s each) evoked increasing [Ca2+]i
transients with mean ΔF/F0 ± SD values of 0.03 ± 0.06,
0.06 ± 0.03, 0.16 ± 0.08, and 0.47 ± 0.14, respectively, (n = 59;
Figure 1A). At 2 and 10 mM, the responses to camphor were
fast and transient, desensitizing before the end of the 30-s
camphor perfusion. By fitting the results with a Hill equation, the resulting EC50 for hTRPM8 activation by camphor
was 4.48 mM, and the Hill coefficient was 1.38 (Figure 1B).
Menthol (100 μM, 30 s) was applied at the end of the recording to confirm functional expression of hTRPM8.
Whole-cell peak currents elicited by 10 mM of camphor
in hTRPM8-HEK293 cells were recorded in the voltage
clamp mode (at a holding potential of −80 mV). The current
densities had a large variance (range −3.2 to −109.8 pA/
pF; median −7.9 pA/pF and mean −18.8 ± 30.5 pA/pF;
n = 12). Camphor (10 mM) was applied at 25 °C for 10 s,
2 or 3 times at 2-min intervals. The larger currents were
transient and a marked desensitization ensued (not shown),
whereas the smaller currents elicited by camphor were more
sustained (Figure 1C inset). Recordings of current–voltage
relationships during voltage ramps (−100 to +80 mV and
back to −100 mV over 3.4 s) were performed during the
small but sustained currents (Figure 1C). The removal of
2+
intrapipette Ca and buffering with 2 mM of EGTA did not
substantially affect the amplitude of the currents (data not
shown). Considering the apparent discrepancy in amplitudes
and tachyphylaxis of camphor-evoked responses between
Figure 1 Camphor activates hTRPM8 expressed in HEK293 cells. (A) Increasing concentrations of camphor (0.5, 1, 2, and 10 mM) evoked increasing [Ca2+]i
transients. Menthol (100 µM) was applied at the end of the experiment to confirm functional expression of TRPM8. The solid black line shows the mean
(n = 59) and the dotted lines show the SD (n = 59). (B) Calcium imaging data from A, fitted using a Hill equation with EC50 = 4.48 mM and a Hill coefficient
n = 1.38. (C) Whole-cell currents elicited by camphor (10 mM) recorded in conventional patch clamp on hTRPM8-HEK293 cells. Representative current–
voltage relationship showing the increase of the outwardly rectifying currents in response to camphor and menthol (100 μM). Inset: typical inward current
recorded at –80 mV in response to camphor (t ≈ 25 °C). (D) Inward currents elicited by camphor and recorded in perforated patch clamp at –80 mV are
larger and show reduced tachyphylaxis. Please note: This figure is reproduced in color in the online version of this issue.
Camphor Activates and Sensitizes TRPM8 567
calcium imaging and whole-cell patch clamp recordings
and suspecting the decisive contribution of an intracellular
factor, we performed perforated patch clamp experiments on
hTRPM8-HEK293 cells. These experiments revealed indeed
much larger inward currents at the −80 mV holding potential
with a lower variance (range −19.9 to −85.7 pA/pF; median
−37.0 pA/pF and mean −47.3 ± 27.2 pA/pF; n = 8). The
currents were transient, and tachyphylaxis was similar to the
results from calcium imaging (Figure 1D).
To investigate the temperature dependence of camphorevoked activation of recombinant hTRPM8, the temperature
of the extracellular solution was switched from 32 to 25 °C,
which evoked an increase in [Ca2+]i in all cells (Figure 2A).
At 32 °C, the response to camphor (10 mM) was very small
and slow, with a mean ΔF/F0 of 0.03 ± 0.04 (n = 54) at the end
of the 1-min application; in contrast, the response at 25 °C
was fast and transient, with a mean ΔF/F0 of 0.24 ± 0.06
(n = 54; Figure 2A right). The 1-min perfusions also revealed
the transient nature of the response to camphor compared
with the sustained increase in [Ca2+]i evoked by menthol, illustrated by the difference in the half-width durations and the
mean AUC of the response to the 2 compounds (14.7 ± 6.4
s/323.6 ± 251.3 arbitrary unit for the acquired fluorescence
signal [a.u.s] for camphor and 70.3 ± 4.9 s/1567.1 ± 556.2
a.u.s for menthol; P < 0.001, n = 54).
The same experiment was also performed on HEK293T
cells transiently transfected with rat TRPM8 (rTRPM8;
Figure 2B). Camphor (10 mM) application at 32 °C produced a decrease in fluorescence in some cells, similar to
the effect recorded in untransfected cells, whereas at 25 °C,
camphor evoked fast [Ca2+]i transients with a mean ΔF/F0 of
0.19 ± 0.01 (n = 50).
The sensitizing effect of camphor on the cold-induced
activation of hTRPM8 was investigated by applying the
compound during a succession of mild cooling ramps (from
33 to 27 °C in about 44 s). Camphor (5 mM) was applied
before, during, and after the 4th temperature ramp in the
series and also on the descending part of the 5th temperature ramp (Figure 2C). At the baseline temperature of 33 °C,
camphor did not evoke a response by itself. The half-width
duration of the cold-induced increase in [Ca2+]i was substantially increased in the presence of camphor (from 26.4 ± 23.9
s for the 3rd ramp to 138.9 ± 83.5 s for the 4th ramp;
P < 0.001, n = 51). The AUC also increased (Figure 2D)
from 286.4 ± 204.1 a.u.s for the 3rd ramp to 2220.2 ± 1175.1
a.u.s for the 4th (n = 51, P < 0.001), whereas the mean ΔF/F0
Figure 2 Camphor activates hTRPM8 and rTRPM8 in a temperature-dependent manner. (A) A cooling step from 32 to 25 °C shows the enhanced response
to camphor at 25 °C in hTRPM8-HEK293 cells. Camphor (10 mM) and menthol (100 µM) were applied for 1 min each. Note the transient nature of the
response to camphor, compared with the sustained response to menthol; mean trace ± SD (n = 54). Right: the responses to camphor at 32 and 25 °C are
plotted as mean ΔF/F0 ± SD (***P < 0.001, n = 54). (B) rTRPM8 transiently expressed in HEK293T cells was activated by camphor (10 mM) at 25 °C but not
at 32 °C. (C) Camphor (5 mM) sensitizes the response of hTRPM8 to mild cooling ramps (c.r.; from ~33 to ~27 °C) by increasing the amplitude and recovery
time to baseline. At 33 °C, camphor alone did not evoke a calcium transient; mean trace ± SD (n = 51). A recorded c.r. is displayed in detail in the inset.
(D) The AUC from C is plotted for each cold-induced response; the difference in AUC between the 3rd and 4th ramp (in the presence of 5 mM camphor)
is statistically significant (***P < 0.001, n = 51). Data presented as individual cell AUC and AUC mean ± SD. Please note: This figure is reproduced in color
in the online version of this issue.
568 T. Selescu et al.
increased from 0.27 ± 0.16 to 0.48 ± 0.22 (n = 51, P < 0.001).
Camphor also markedly desensitized the responses to the
following cooling ramps in the series (6th and 7th).
To reveal the origin of the [Ca2+]i transients, we switched
the perfusion to a nominally calcium-free extracellular solution. The removal of external calcium ions inhibited the
[Ca2+]i increase evoked by camphor and menthol by 96.3 ±
8.0% (n = 114) and 54.3 ± 28.9% (n = 114), respectively
(Figure 3A). This suggests that, contrary to menthol, camphor does not trigger endoplasmic reticulum Ca2+ release.
to +100 mV over 400 ms; Figure 4C). Camphor (5 mM)
inhibited in average ca. 68% of the inward plateau current
elicited by menthol (100 μM) at −60 mV, whereas at +80
mV, the mean inhibition of the outward current reached ca.
85% and was again reversible (Figure 4D).The normalized
TRPM8 antagonists block hTRPM8 activation by camphor
We tested the inhibitory effect of the TRPM8 and TRPV1
antagonist BCTC (Weil et al. 2005) on hTRPM8 activation by camphor. When BCTC (5 μM) was pre- and then
co-applied with 5 mM of camphor, it almost completely
(94.5 ± 20.9%, n = 109) and reversibly blocked the response
to camphor at 25 °C (Figure 3B).
We also tested the effect of 2-APB, an agonist of other
2 TRP ion channels activated by camphor (TRPV1 and
TRPV3; Hu et al. 2004) and a known TRPM8 inhibitor
(Hu et al. 2004). 2-APB (150 μM) blocked almost entirely
(93.8 ± 7.3%, n = 77) and reversibly the [Ca2+]i transient
evoked by 5 mM of camphor in hTRPM8-HEK293 cells at
25 °C (Figure 3C). These 2 antagonists (BCTC and 2-APB)
also produced a marked decrease in the baseline fluorescence
at 25 °C, indicating sustained activation of hTRPM8 at this
temperature.
Interestingly, BCTC (1 μM) was also found to completely
and persistently inhibit TRPV1 activation by camphor
(10 mM), unlike other TRPV1 competitive antagonists (Xu
et al. 2005; Supplementary Figure S1).
Camphor modulates differently the TRPM8 responses to
its agonists menthol and icilin
We first investigated the effect of camphor on the activation
of hTRPM8 by its known agonists, menthol and icilin, using
calcium microfluorimetry. In these experiments, the concentrations for menthol (5 μM) and icilin (0.1 μM) were chosen
close to their estimated EC50 values from our calcium imaging recordings on hTRPM8-expressing HEK293 cells and
similar to those found in other studies performed in similar
conditions (Behrendt et al. 2004; Klein et al. 2011). When
coapplied, camphor (5 mM) strongly (ca. 62%) and reversibly inhibited the sustained response to menthol (5 μM;
Figure 4A), from 0.36 ± 0.15 to 0.14 ± 0.09 (ΔF/F0; n = 77,
P < 0.001; Figure 4D). This inhibition was also tested and
confirmed at higher menthol (10–50 μM) and lower camphor concentrations (1–2 mM; data not shown).
We also investigated this inhibition in whole-cell patch
clamp experiments on hTRPM8-HEK293 cells recorded at
constant negative (−60 mV) and positive (+80 mV) holding
potentials (Figure 4B) and also during voltage ramps (−100
2+
Figure 3 Theorigin
originofof
camphor-evoked
[Ca
]i transients
and inhibiFigure 3 The
thethe
camphor-evoked
[Ca2+
]i transients
and inhibition
by
tion
by antagonists.
TRPM8 antagonists.
(A)2+The
[Ca2+]i transients
byare
camphor
TRPM8
(A) The [Ca
]i transients
evoked byevoked
camphor
due to
are
dueentry.
to calcium
entry.
switch Ca
to 2+a-free
nominally
Ca2+-free
extracelcalcium
The switch
to The
a nominally
extracellular
solution
abol2+
lular
abolished
the response
camphor
(5 mM
), whereas
the
ished solution
the response
to camphor
(5 mM ), to
whereas
the [Ca
]i transient
evoked
2+
[Ca
]i transient
evoked
byonly
menthol
(100 μM)
only partially
by menthol
(100 μM)
was
partially
inhibitedwas
(n = 114).
(B) Theinhibited
TRPM8
(n = 114).
The(5 μM)
TRPM8blocked
antagonist
BCTC (5 μM)
blocked(5 the
response
to
antagonist (B)
BCTC
the response
to camphor
mM;
n = 109).
camphor
n = 109).
(C)the
2-APB
inhibited
[Ca2+]i transient
(C) 2-APB (5 mM;
(150 μM)
inhibited
[Ca2+(150 μM)
]i transient
evoked the
by camphor
(5 mM)
evoked
by camphorcells
(5 mM)
in hTRPM8-HEK293
cells (n = 77).
AllSD.
data
are
in hTRPM8-HEK293
(n = 77).
All data are presented
as mean ±
Please
­p
resented
as mean
± SD.
note:
This figure
is reproduced
in color in the online version of this issue.
Camphor Activates and Sensitizes TRPM8 569
Figure 4 Camphor inhibits the activation of TRPM8 by menthol in hTRPM8-HEK293 cells. (A) Camphor (5 mM) reversibly inhibited the sustained activation of hTRPM8 by menthol (5 µM). Also, by successively applying camphor, camphor with menthol, and menthol alone, a gradual increase in [Ca2+]i was
obtained; mean trace ± SD (n = 77). (B) Representative examples of inward and outward currents elicited by menthol (100 µM) reversibly inhibited camphor
(5 mM). (C) Typical current–voltage relationship showing the same TRPM8 current inhibition during voltage ramps. (D) Left: normalized fluorescence, the
ratio between the fluorescence change during and after camphor coapplication (arrows at “b” and “c” in A) and that evoked by menthol alone (arrow at
“a”), all measured from the same baseline (***P < 0.001, n = 77). Right: pooled data for the relative currents measured during and after camphor coapplication (marked with “ii” and “iii” in B) normalized to the initial plateau current (marked “i”) elicited by menthol, at −60 and +80 mV (***P < 0.001,
n = 7 for both). Please note: This figure is reproduced in color in the online version of this issue.
currents during and after the camphor coapplication were
0.32 ± 0.20 and 1.74 ± 0.63 (P < 0.001, n = 7) at −60 mV,
respectively, whereas at +80 mV, normalized currents were
0.15 ± 0.17 and 1.17 ± 0.09, respectively (P < 0.001, n = 7;
Figure 4C).
Following an icilin challenge (0.1 μM, 20 s), the response
of hTRPM8-HEK293 to camphor (2 mM) was absent
(Figure 5A), indicating a profound and lasting cross-tachyphylaxis. During a prolonged second icilin application, after
the installment of acute desensitization (to 2.2% of the icilin
response amplitude), coapplication of camphor (2 M) evoked
a strong increase in [Ca2+]i, recovering from the desensitized
state to 118% of the amplitude evoked by the previous icilin
response (ΔF/F0 = 0.33 ± 0.13, compared with 0.297 ± 0.096,
for icilin alone, 2nd application, n = 66; Figure 5A). The
potentiation of the icilin [Ca2+]i transients was reproducible
during multiple camphor applications (data not shown).
The peak whole-cell currents elicited by camphor
(10 mM) and icilin (2 μM) recorded in hTRPM8-HEK293
cells in voltage clamp (−80 mV) were markedly enhanced
when the 2 compounds were applied together, displaying a
supra-additive mutual potentiation (Figure 5B). The peak
current densities were −6.6 ± 3.0 pA/pF for camphor alone,
−25.0 ± 20.8 pA/pF for icilin alone, and −119.2 ± 19.8 pA/
pF for camphor plus icilin (n = 4, P < 0.01). The camphor potentiation of the icilin-evoked inward currents
abated over time in this type of experiments (Figure 5B).
As expected for the potentiation by camphor of an
570 T. Selescu et al.
Figure 5 Camphor enhances the hTRPM8-HEK293 cells responses to icilin. (A) Following the icilin-induced desensitization, camphor (2 mM) evoked a new
response when coapplied with icilin (0.1 μM ); mean trace ± SD (n = 66). Right: fluorescence change from baseline, ΔF in the desensitized state (arrow
at “b”) and at camphor coapplication (arrow at “c”) normalized to ΔF at the peak of the icilin response (arrow at “a”; ***P < 0.001, n = 66). (B) The
current elicited by coapplying camphor (10 mM) and icilin (2 μM) is supra-additive in relation to the currents elicited by camphor or icilin alone (t ≈ 25 °C).
Right: the current densities for the points marked on the current trace; the difference between “ii” and “iv” is statistically significant (**P < 0.01, n = 4).
Please note: This figure is reproduced in color in the online version of this issue.
icilin-elicited current, under both extracellularly and intracellularly Ca2+-free conditions (by replacing Ca2+ with
2 mM EGTA extracellularly and 5 mM intracellularly), no
resolvable currents could be recorded when icilin and camphor were coapplied (data not shown).
Camphor activates native rTRPM8
All experiments on rat DRG neurons were performed on
small diameter neurons (filtered through a 35-μm cell sieve)
in the presence of RuR (10 μM) in order to block other ion
channels known to be activated by camphor (TRPV1 and
TRPV3) or by icilin (TRPA1, although it is activated at substantially higher icilin concentrations than the one we have
used here [Story et al. 2003]).
We have already shown that recombinant rTRPM8 channels are activated by camphor (10 mM) at 25 °C (Figure 2B).
RuR (10 μM) did not inhibit the camphor (5 mM) activation
of rTRPM8 (Supplementary Figure S2), whereas it entirely
blocked the response of rTRPV1 to camphor, as previously
described (data not shown; Xu et al. 2005).
The efficacy of the RuR blocking effect on TRPV1 and
TRPA1 was tested by applying capsaicin (2 µM, 30 s) at
32 °C and AITC (100 µM, 1–2 min) at 32 or 25 °C: only
9.0% (15/166) of the total neuronal population treated
with RuR was activated by capsaicin compared with 51.9%
(80/154) of a control group (P < 0.001, Fisher’s Exact test,
2-tailed). Similarly, only 6.0% (10/166) of the RuR-treated
neurons responded to 100 µM AITC compared with
21.4% in control conditions (P < 0.001). Moreover, the
mean response amplitude (ΔF/F0) to AITC was strongly
reduced, 0.15 ± 0.013 for the RuR-treated group compared
with 0.38 ± 0.04 for control (P < 0.001, unpaired Student’s
t-test).
In the presence of RuR, capsaicin activated only 1 of
26 camphor-sensitive neurons and AITC activated 4 of 39
icilin-sensitive neurons. The effects of camphor (10 mM)
and icilin (2 μM) were recorded at 25 °C (Figure 6A and
B). Of the total number of recorded neurons, 15.6%
(26/166) were activated by camphor and 23.5% (39/166)
were activated by icilin (Figure 6C). The camphor- and
icilin-sensitive neurons represented 69.23% (18/26) of
the camphor-sensitive group and 46.15% (18/39) of the
icilin-sensitive group. The camphor-evoked responses
were fast and transient, similar to those mediated by
recombinant TRPM8.
A mild cooling step (from 32 to 25 °C) was also used to
identify cold-sensitive neurons with high activation temperature (low threshold). We found that 42.3% (11/26) of
the camphor-sensitive neurons, 28.2% (11/39) of the icilinsensitive neurons, and 81.8% (9/11) of the camphor- and
icilin-sensitive neurons were also activated by the cooling
step (Figure 6C). In total, 20 neurons were considered cold
sensitive, of which 45% (9/20) were camphor and icilin
sensitive, 1 neuron was icilin-only sensitive, and 1 neuron
camphor-only sensitive. The remaining 9 neurons were not
activated by camphor or icilin. Altogether, this indicates a
strong coexpression of cold, camphor, and icilin sensitivity in our population of RuR-treated, small-sized DRG
neurons.
In another set of experiments using RuR, DRG neurons
were exposed to icilin (2 µM) for 1 min and subsequently to
a 30-s camphor (10 mM) coapplication. Most of the icilin
responses in DRG neurons displayed acute desensitization.
Camphor Activates and Sensitizes TRPM8 571
The coapplication of icilin and camphor evoked [Ca2+]i
transients in all 26 icilin-sensitive neurons recorded, with
the mean amplitude recovering to 99.4 ± 20.8% of the initial icilin response amplitude, compared with 61.0 ± 22.8%
of the same initial amplitude during the desensitized state
(n = 26, P < 0.001; Figure 7B and C right), similar to the
effect observed with recombinant hTRPM8.
We further investigated this effect on rat DRG neurons
with conventional whole-cell patch clamp on cold-sensitive
neurons preselected using calcium imaging. A cooling ramp
from ~34 to ~18 °C in ca. 42 s was used as a stimulus for
identifying cold-sensitive neurons (Figure 7A left).
RuR (10 μm) was present in the extracellular solution
through the entire duration of the patch clamp recordings,
performed at 25 °C. During the initial 1-min exposure to
icilin (2 µM), only 3 of the 6 recorded neurons presented a
fast inward current at the −80 mV holding potential (mean
current density −13.6 ± 11.0 pA/pF) and a marked acute
desensitization followed. All 6 cold-sensitive neurons displayed a large, rapidly desensitizing inward current when
camphor (10 mM) and icilin were coapplied (Figure 7A
right, current traces from 5 out of the 6 neurons recorded),
with a mean peak current density significantly larger compared with that recorded in the icilin desensitized state,
−33.7 ± 25.0 and 4.3 ± 8.5 pA/pF, respectively (P < 0.05,
n = 6; Figure 7C right). Repeating the coapplication after
a further 30 s–1-min exposure to icilin elicited a smaller
and more sustained current (Figure 7A right). In 1 neuron,
we recorded a small but resolvable current when camphor
was applied alone (data not shown), in agreement with the
small amplitude of the camphor-elicited currents recorded
using conventional whole-cell mode with the same intracellular solution in HEK293 cells expressing hTRPM8
(Figure 1C inset).
Camphor does not activate cTRPM8: relation between
camphor and icilin sensitivity
Figure 6 Camphor activates a subpopulation of cold- and icilin-sensitive
rat DRG neurons. (A) Examples of traces from individual DRG neurons
showing responses to a cooling step (from 32 to 25 °C), camphor (10 mM;
applied after 1 min from the cooling stimulus), and icilin (2 μM), all in the
presence of 10 μM RuR. (B) Same as in A, except for an inserted AITC
challenge (100 μM), which evoked no response. (C) Left: 23.5% of the
total number of neurons imaged responded to icilin (2 μM) in the presence
of RuR (10 μM); 46.15% of these neurons also responded to camphor
(10 mM). Right: 28.2% of icilin-sensitive neurons also responded to the
initial mild cooling step (from 32 to 25 °C); 81.8% of these icilin- and coldsensitive neurons were also camphor sensitive. Please note: This figure is
reproduced in color in the online version of this issue.
cTRPM8 is known to be menthol sensitive and icilin insensitive (Chuang et al. 2004). Camphor (5 mM) did not evoke
an increase in [Ca2+]i in HEK293T cells expressing cTRPM8
at 25 °C, but nonetheless displayed the inhibitory effect on
the calcium transient evoked by menthol (Figure 8A): the
mean inhibition exerted by 5 mM of camphor on the sustained response of cTRPM8 to 100 μM of menthol was
46.3 ± 26.9% (n = 12, P < 0.01). In experiments consisting
of 3 successive menthol (100 µM) applications with the second one in the presence of camphor (10 mM; Supplementary
Figure S3), the mean inhibition reached 71.8 ± 14.9% (n = 28,
P < 0.001).
The structurally camphor-related compound eucalyptol,
which is a rTRPM8 agonist (McKemy et al. 2002), also
failed to activate cTRPM8 at 25 °C when tested at 2–5 mM
(Figure 8B). Eucalyptol (2 mM) inhibited the sustained
response of cTRPM8 to 100 µM of menthol (49.6 ± 25.3%
572 T. Selescu et al.
Figure 7 Camphor enhancement of the icilin-evoked activation of rat DRG neurons. (A) Left: cold-sensitive neurons were identified using calcium
imaging and a cooling stimulus (ramp, from ~34 to ~19 °C in about 42 s). Right: the same neurons were recorded in whole-cell patch clamp at −80
mV and 25 °C, revealing a larger inward current when icilin and camphor were coapplied after acute desensitization to icilin; also visible is the smaller
current in response to a second camphor challenge after another 30 s–1-min icilin. (B) All icilin-sensitive neurons recorded at 25 °C displayed a recovery of the Ca2+ signal (arrows at “c”) close to the initial amplitude (arrows at “a”) when camphor was coapplied after a period of acute desensitization (arrows at “b”). (C) Pooled data from patch clamp and calcium imaging experiments. Left: current densities at the points labeled in A (*P < 0.5,
n = 6). Right: fluorescence change marked with arrows at “b” and at “c” (in B) normalized to that at “a,” all measured from the same baseline
(***P < 0.001, n = 26). Please note: This figure is reproduced in color in the online version of this issue.
mean inhibition; n = 24, P < 0.001). We have also found that
although eucalyptol is activating rTRPM8 and hTRPM8, it
can also inhibit the response to menthol of these orthologs
(Supplementary Figure S4; data not shown), similar to the
effects of camphor on TRPM8.
The relation between icilin and camphor sensitivity in
hTRPM8 was investigated using an icilin-insensitive mutant,
D802A (Chuang et al. 2004). The response to camphor
(10 mM) was present at 25 °C as in the case of the wild-type
channel (Figure 8C). As expected, the D802A mutant was
not activated by icilin (10 µM).
Discussion
In this study, we describe the activation of hTRPM8 and
rTRPM8 by camphor. Although our experiments were performed at 25 °C, temperature at which recombinant TRPM8
was constitutively active, camphor evoked a large and
Camphor Activates and Sensitizes TRPM8 573
Figure 8 Relation between icilin and camphor sensitivity of TRPM8. (A) Camphor (5 mM) does not activate the icilin-insensitive cTRPM8 at 25 °C, but it still
inhibits the response to menthol (100 μM); mean trace ± SD (n = 12). (B) A similar effect was recorded for another agonist of rTRPM8, eucalyptol (2 mM),
structurally related to camphor; mean trace ± SD (n = 26). (C) Camphor (10 mM) and menthol (300 µM; but not icilin [10 µM]) activated HEK293T cells
transiently transfected with the icilin-insensitive hTRPM8 D802A mutant. Please note: This figure is reproduced in color in the online version of this issue.
transient increase in [Ca2+]i with an EC50 of about 4.5 mM.
The transient [Ca2+]i increase during TRPM8 agonist exposure was also reported in the past for linalool, geraniol,
hydroxycitronellal, and eucalyptol when tested on HEK293
cells transfected with mouse TRPM8 (Behrendt et al. 2004).
As expected for a TRPM8 activator, camphor’s action was
temperature dependent and it potentiated the [Ca2+]i increase
during cooling. During repeated cold stimulation, the amplitudes of the cooling-evoked responses following the camphor challenge were attenuated, likely a consequence of the
high Ca2+ influx, known to induce TRPM8 desensitization
mediated by PLC hydrolysis of PIP2 (Yudin et al. 2011).
The already-reported common pharmacological properties of TRPM8 and TRPV1 (Weil et al. 2005) can now be
further extended. Besides having camphor as a common
agonist in the same concentration range, we demonstrate
that TRPM8 and TRPV1 share BCTC as an antagonist in
relation to camphor. Also, the synergic action of capsaicin
and camphor on TRPV1 (Xu et al. 2005; Marsakova et al.
2012) is paralleled by the action of icilin and camphor on
TRPM8. It is known that residues important for capsaicin
and icilin gating of TRPV1 and TRPM8, respectively, are
located in analog positions on the putative S2-S3 linker
(Chuang et al. 2004). We also show that the icilin-insensitive cTRPM8 ortholog is camphor insensitive, similar to its
TRPV1 counterpart (Chuang et al. 2004). This may suggest
that icilin and camphor share a common important domain
for TRPM8 activation. Through experiments on an icilininsensitive mutant of hTRPM8 (D802A), we have shown
that icilin sensitivity is not required for the camphor sensitivity of TRPM8.
Interestingly, the well-known mammalian TRPM8 agonist eucalyptol (McKemy et al. 2002), which is structurally
related to camphor, also failed to activate cTRPM8 and,
similarly to camphor, inhibited the [Ca2+]i transients induced
by menthol in cTRPM8, rTRPM8, and hTRPM8 expressed
in HEK293 cells.
Taken together, our results suggest that camphor has
a bimodal action, being not only an inhibitor of TRPM8
menthol-evoked responses but also a mammalian TRPM8
activator, apparently in an independent manner from the
menthol and icilin modalities. Both camphor and menthol are monoterpenes, whereas camphor and eucalyptol
are bicyclic and menthol monocyclic. This difference may
explain the different actions of these 2 classes of compounds on TRPM8, namely the efficacious concentration
ranges and possible different mechanisms of activation. In
contrast with the synergic effect of icilin and camphor that
we describe, the reported absence of such an effect from icilin and menthol (Kühn et al. 2009), supports the hypothesis of a different mode of action of camphor and menthol
on TRPM8.
We were able to record whole-cell currents (although displaying a large variance) elicited by 10 mM of camphor at
~25 °C in hTRPM8-expressing HEK293 cells, unlike previous studies (McKemy et al. 2002; Xu et al. 2005; Macpherson
et al. 2006). This may be due in part to the different pipette
solution formulation and the speed of solution exchange.
When recorded using the perforated patch clamp method,
the currents were significantly larger, had a smaller variance,
and displayed reduced tachyphylaxis, similar to the results
obtained using Ca2+ imaging. This suggests that a cytosolic factor is essential for TRPM8 activation by camphor.
Although the nature of this factor remains for the moment
unknown, possible candidates are cytosolic enzymes like
PLA2 (Andersson et al. 2007) or the dependence on a narrow
range of cytosolic Ca2+. The transient nature of the increase
in [Ca2+]i and of the large whole-cell currents evoked by
camphor is likely to be calmodulin dependent (Sarria et al.
2011). Further studies on menthol- and cold-insensitive
mutants will also be required to provide more information
concerning the molecular determinants and the mechanisms
involved in the gating of TRPM8 by camphor and eucalyptol. The inability of camphor to induce Ca2+ release from
endoplasmic reticulum under Ca2+-free conditions, suggests
that camphor does not interact with TRPM8 in a Gq protein-activating manner, at least in the absence of extracellular Ca2+. The recent study discussing these effects (Klasen
574 T. Selescu et al.
et al. 2012) is not mentioning Gq activation being induced by
the calcium-dependent TRPM8 agonist icilin.
The camphor sensitivity in cultured rat DRG neurons
recorded in the continuous presence of RuR was highest in
a subpopulation of mild (25 °C) cooling- and icilin-sensitive
neurons, 81% of which responded to camphor. This strongly
suggests that camphor is activating native TRPM8. The
camphor-sensitive neurons from our experiments are likely
to be those most sensitive to TRPM8-like stimuli. Although
the proportion of cold-responding neurons was low even
when compared with the icilin-sensitive population, this can
be explained by the relatively mild cooling stimulus used in
this study. The cold responses of the icilin-insensitive neurons are possibly mediated by a different receptor. It should
also be noted that icilin and camphor displayed in neurons the same synergic action observed in experiments on
recombinant TRPM8.
These results show that camphor can activate TRPM8 in
a physiologically relevant range of concentrations, lower
than those usually found in topically applied preparations.
Moreover, the potentiation of hTRPM8 cold sensitivity by
camphor can explain the results of psychophysical experiments on human subjects (Burrow et al. 1983; Green 1990).
The transient camphor activation of TRPM8 observed in
our study, the slow cooling procedure employed by Green
(1990), and the use of ethanol (80%) as vehicle could explain
the small enhancement of the cold sensation reported by
the subjects. Ethanol is known to inhibit TRPM8 by limiting the PIP2–TRPM8 interaction (Benedikt et al. 2007).
The camphor potentiation of the cold-evoked “burning”
sensation that was reported by Green (1990) could be well
explained by TRPM8-mediated activation of the cold- and
menthol-sensitive type 2 C fibers, which evoke “burning/
stinging” sensations (Campero et al. 2009) and further supported by immunohistochemistry evidence for TRPM8positive C fibers (Kobayashi et al. 2005). Interestingly,
the largest camphor-induced relative increase in the cold
“burning” sensation is shown by Green (1990) at 27 °C,
close to the TRPM8 threshold and to the base temperature used in our experiments. In another study, subjects
reported cold sensation at the level of the nasal mucosa
and increased nasal airflow sensation after inhaling camphor, eucalyptus, or menthol vapors (Burrow et al. 1983);
camphor was reported by a larger number of subjects to
evoke cold and increased airflow sensations compared with
eucalyptus oil. The much stronger psychophysical evidence
from Burrow et al. (1983) probably reflects also camphor’s
shorter access time to nerve terminals in the nasal mucosa
following vapor inhalation, compared with camphor’s permeation through skin.
As a possible direct application of our findings, camphor
does not appear to be a suitable adjuvant in menthol-containing preparations directed at TRPM8 activation, whereas
it can be effective as a TRPM8 potentiator in icilin-containing solutions.
Supplementary material
Supplementary material can be found at http://www.chemse.
oxfordjournals.org/
Funding
This work was supported by the European Social Fund
[POSDRU 107/1.5/S/80765 to T.S.], the Romanian Research
Council (CNCS) [PCE 117/2011 to C.D., A.C.C., and A.B.],
and by the Science Foundation Ireland [BIM085 to G.R.].
Acknowledgements
The authors thank Cristian Neacsu and Liviu Soltuzu for developing the software for extracting and analyzing the calcium imaging
data.
References
Adipietro KA, Mainland JD, Matsunami H. 2012. Functional evolution of
mammalian odorant receptors. PLoS Genet. 8(7):e1002821.
Andersson DA, Nash M, Bevan S. 2007. Modulation of the cold-activated
channel TRPM8 by lysophospholipids and polyunsaturated fatty acids. J
Neurosci. 27(12):3347–3355.
Babes A, Zorzon D, Reid G. 2006. A novel type of cold-sensitive neuron in
rat dorsal root ganglia with rapid adaptation to cooling stimuli. Eur J
Neurosci. 24(3):691–698.
Behrendt HJ, Germann T, Gillen C, Hatt H, Jostock R. 2004. Characterization
of the mouse cold-menthol receptor TRPM8 and vanilloid receptor
type-1 VR1 using a fluorometric imaging plate reader (FLIPR) assay. Br J
Pharmacol. 141(4):737–745.
Benedikt J, Teisinger J, Vyklicky L, Vlachova V. 2007. Ethanol inhibits
cold-menthol receptor TRPM8 by modulating its interaction with
membrane phosphatidylinositol 4,5-bisphosphate. J Neurochem.
100(1):211–224.
Burrow A, Eccles R, Jones AS. 1983. The effects of camphor, eucalyptus and
menthol vapour on nasal resistance to airflow and nasal sensation. Acta
Otolaryngol. 96(1–2):157–161.
Campero M, Baumann TK, Bostock H, Ochoa JL. 2009. Human cutaneous C fibres activated by cooling, heating and menthol. J Physiol.
587:5633–5652.
Chuang HH, Neuhausser WM, Julius D. 2004. The super-cooling agent icilin
reveals a mechanism of coincidence detection by a temperature-sensitive TRP channel. Neuron. 43(6):859–869.
Daniels RL, Takashima Y, McKemy DD. 2009. Activity of the neuronal cold
sensor TRPM8 is regulated by phospholipase C via the phospholipid
phosphoinositol 4,5-bisphosphate. J Biol Chem. 284(3):1570–1582.
Frederick J, Buck ME, Matson DJ, Cortright DN. 2007. Increased TRPA1,
TRPM8, and TRPV2 expression in dorsal root ganglia by nerve injury.
Biochem Biophys Res Commun. 358(4):1058–1064.
Green BG. 1990. Sensory characteristics of camphor. J Invest Dermatol.
94(5):662–666.
Hall AC, Turcotte CM, Betts BA, Yeung WY, Agyeman AS, Burk LA. 2004.
Modulation of human GABAA and glycine receptor currents by menthol and related monoterpenoids. Eur J Pharmacol 506:9–16
Camphor Activates and Sensitizes TRPM8 575
Hu HZ, Gu Q, Wang C, Colton CK, Tang J, Kinoshita-Kawada M, Lee LY, Wood
JD, Zhu MX. 2004. 2-aminoethoxydiphenyl borate is a common activator of TRPV1, TRPV2, and TRPV3. J Biol Chem. 279(34):35741–35748.
Kim KY, Bang S, Han S, Nguyen YH, Kang TM, Kang KW, Hwang SW. 2008.
TRP-independent inhibition of the phospholipase C pathway by natural
sensory ligands. Biochem Biophys Res Commun. 370(2):295–300.
Klasen K, Hollatz D, Zielke S, Gisselmann G, Hatt H, Wetzel CH. 2012.
The TRPM8 ion channel comprises direct Gq protein-activating capacity.
Pflugers Arch. 463(6):779–797.
Klein AH, Iodi Carstens M, McCluskey TS, Blancher G, Simons CT, Slack JP,
Furrer S, Carstens E. 2011. Novel menthol-derived cooling compounds
activate primary and second-order trigeminal sensory neurons and
modulate lingual thermosensitivity. Chem Senses. 36(7):649–658.
Kobayashi K, Fukuoka T, Obata K, Yamanaka H, Dai Y, Tokunaga A, Noguchi
K. 2005. Distinct expression of TRPM8, TRPA1, and TRPV1 mRNAs in rat
primary afferent neurons with adelta/c-fibers and colocalization with trk
receptors. J Comp Neurol 493(4):596–606.
Kühn FJ, Kühn C, Lückhoff A. 2009. Inhibition of TRPM8 by icilin distinct
from desensitization induced by menthol and menthol derivatives. J Biol
Chem. 284(7):4102–4111.
Kohno K, Sokabe T, Tominaga M, Kadowaki T. 2010. Honey bee thermal/chemical sensor, AmHsTRPA, reveals neofunctionalization
and loss of transient receptor potential channel genes. J Neurosci.
30(37):12219–12229.
Macpherson LJ, Hwang SW, Miyamoto T, Dubin AE, Patapoutian A, Story
GM. 2006. More than cool: promiscuous relationships of menthol and
other sensory compounds. Mol Cell Neurosci. 32(4):335–343.
Marsakova L, Touska F, Krusek J, Vlachova V. 2012. Pore helix domain is
critical to camphor sensitivity of transient receptor potential vanilloid 1
channel. Anesthesiology. 116(4):903–917.
McKemy DD, Neuhausser WM, Julius D. 2002. Identification of a cold
receptor reveals a general role for TRP channels in thermosensation.
Nature. 416(6876):52–58.
Moqrich A, Hwang SW, Earley TJ, Petrus MJ, Murray AN, Spencer KS,
Andahazy M, Story GM, Patapoutian A. 2005. Impaired thermosensation in mice lacking TRPV3, a heat and camphor sensor in the skin.
Science. 307(5714):1468–1472.
Nakashimo Y, Takumida M, Fukuiri T, Anniko M, Hirakawa K. 2010. Expression
of transient receptor potential channel vanilloid (TRPV) 1–4, melastin (TRPM)
5 and 8, and ankyrin (TRPA1) in the normal and methimazole-treated
mouse olfactory epithelium. Acta Otolaryngol. 130(11):1278–1286.
Park TJ, Seo HK, Kang BJ, Kim KT. 2001. Noncompetitive inhibition by camphor of nicotinic acetylcholine receptors. Biochem Pharmacol 61:787–793.
Peier AM, Reeve AJ, Andersson DA, Moqrich A, Earley TJ, Hergarden
AC, Story GM, Colley S, Hogenesch JB, McIntyre P, et al. 2002.
A heat-sensitive TRP channel expressed in keratinocytes. Science.
296(5575):2046–2049.
Reid G, Amuzescu B, Zech E, Flonta ML. 2001. A system for applying rapid
warming or cooling stimuli to cells during patch clamp recording or ion
imaging. J Neurosci Methods. 111(1):1–8.
Reid G, Babes A, Pluteanu F. 2002. A cold- and menthol-activated current
in rat dorsal root ganglion neurones: properties and role in cold transduction. J Physiol. 545:595–614.
Sarria I, Ling J, Zhu MX, Gu JG. 2011. TRPM8 acute desensitization is mediated by calmodulin and requires PIP(2): distinction from tachyphylaxis. J
Neurophysiol. 106(6):3056–3066.
Sicard G. 1985. Olfactory discrimination of structurally related molecules: receptor cell responses to camphoraceous odorants. Brain Res.
326(2):203–212.
Sokabe T, Tsujiuchi S, Kadowaki T, Tominaga M. 2008. Drosophila pain2+
less is a Ca -requiring channel activated by noxious heat. J Neurosci.
28(40):9929–9938.
Story GM, Peier AM, Reeve AJ, Eid SR, Mosbacher J, Hricik TR, Earley TJ,
Hergarden AC, Andersson DA, Hwang SW, et al. 2003. ANKTM1, a
TRP-like channel expressed in nociceptive neurons, is activated by cold
temperatures. Cell. 112(6):819–829.
Vogt-Eisele AK, Weber K, Sherkheli MA, Vielhaber G, Panten J, Gisselmann
G, Hatt H. 2007. Monoterpenoid agonists of TRPV3. Br J Pharmacol.
151(4):530–540.
Weil A, Moore SE, Waite NJ, Randall A, Gunthorpe MJ. 2005.
Conservation of functional and pharmacological properties in the distantly related temperature sensors TRVP1 and TRPM8. Mol Pharmacol.
68(2):518–527.
Xu H, Blair NT, Clapham DE. 2005. Camphor activates and strongly desensitizes the transient receptor potential vanilloid subtype 1 channel in a
vanilloid-independent mechanism. J Neurosci. 25(39):8924–8937.
Xu H, Ramsey IS, Kotecha SA, Moran MM, Chong JA, Lawson D, Ge P, Lilly
J, Silos-Santiago I, et al. 2002. TRPV3 is a calcium-permeable temperature-sensitive cation channel. Nature. 418(6894):181–186.
Yawo H, Chuhma N. 1993. An improved method for perforated
patch recordings using nystatin-fluorescein mixture. Jpn J Physiol.
43(2):267–273.
Yudin Y, Lukacs V, Cao C, Rohacs T. 2011. Decrease in phosphatidylinositol 4,5-bisphosphate levels mediates desensitization of the cold sensor
TRPM8 channels. J Physiol. 589:6007–6027.