Wesleyan University
An investigation of the cis and trans factors required for maintaining adjacent gene
co-regulation in Saccharomyces cerevisiae
By
Anand R. Soorneedi
Faculty Advisor: Dr. Michael A. McAlear
A Thesis submitted to the Faculty of Wesleyan University in partial fulfillment
of the requirements for the degree of Master of Arts
Middletown, Connecticut
September 2014
ACKNOWLEDGEMENTS
I would like to take this opportunity to thank my advisor Dr. Michael McAlear who has been
a constant source of support and criticism during my period here at Wesleyan. I would like to
extend my heartfelt gratitude to him for his patience while training me as a graduate student
and a responsible scientist. He is no doubt one of the smartest scientists I have ever had a chance
to work with. I would also like to thank my committee members Dr. Scott Holmes and Dr.
Robert Lane for their constructive criticism and support in helping me accomplish this
otherwise gargantuan task of writing up a master’s thesis.
I would also like to extend my thanks to all the faculty members of the Department of Molecular
Biology and Biochemistry department. Thanks are due to the past and current members of the
McAlear lab. Last but not least, I would like to thank my family members and friends here at
Wesleyan for their support and love. I would like to specially thank my mom, dad and my sister
who have always been my support system.
2
TABLE OF CONTENTS
ACKNOWLEDGEMENTS ....................................................................................................2
TABLE OF CONTENTS ........................................................................................................3
INDEX OF FIGURES .............................................................................................................5
INDEX OF TABLES ...............................................................................................................6
Abstract ....................................................................................................................................7
Introduction..............................................................................................................................8
Section I: Model organisms and their significance in biology. ............................................. 8
Yeast as a model organism. .............................................................................................. 8
Section II: Structure of eukaryotic ribosome ...................................................................... 10
Ribosome biogenesis in eukaryotes. ............................................................................... 11
Role of Ras/PKA pathway in ribosome biogenesis. ....................................................... 14
Role of TOR pathway in ribosome biogenesis. .............................................................. 15
Section III: Regulation of transcription in eukaryotes and its importance.......................... 17
Pre-initiation complex and its role in transcription. ........................................................ 19
Trans factors in regulation of transcription..................................................................... 20
The SAGA complex and its role in transcription. ........................................................... 25
Chromatin structure and its role in regulation of transcription. ...................................... 28
Histone post translational modifications and their role in transcription. ........................ 32
Stress induced chromatin remodeling in yeast. ............................................................... 33
Section IV: Mechanism of adjacent gene co-regulation in S. cerevisiae. ........................... 34
Materials and methods: .........................................................................................................40
Yeast strains. ....................................................................................................................... 40
Culture conditions for heat shock response. ....................................................................... 40
RNA preparation and expression analysis. ......................................................................... 40
Chromatin Immunoprecipitation (ChIP) for measuring H2A.Z abundance. ...................... 41
Results:....................................................................................................................................45
Section I: An actively transcribed RNA Pol II unit disrupts adjacent gene co-regulation.. 45
Section II: The coding region of YJR003C is not responsible for maintaining AGC with
MPP10. ............................................................................................................................... 47
3
Section III: The Spt20 subunit of the SAGA complex is required for maintaining the AGC
between MPP10 and YJR003C. .......................................................................................... 48
Section IV: The SUS1 subunit of the SAGA complex is required for activating but not
required for maintaining the co-regulated expression of the RP gene pair under conditions
of stress ............................................................................................................................... 49
Section V: Adjacent gene co-regulation of the MPP10-YJR003C gene pair is not dependent
on the catalytic activity of the SAGA complex. ................................................................. 51
Section VI: Adjacent gene co-regulation is dependent on the chromatin remodeler SWI6
but not SWI4........................................................................................................................ 52
Section VII: Adjacent gene co-regulation of metabolically important genes extends beyond
the RRB regulon. ................................................................................................................ 54
Section VIII: The promoter region of MPP10 shows relatively higher levels of H2A.Z
occupancy. .......................................................................................................................... 55
Discussion ...............................................................................................................................58
An active RNA Pol II transcriptional unit is sufficient to abrogate co-regulation between
MPP10-YJR003C ................................................................................................................ 58
AGC of YJR003C could be driven from its promoter ......................................................... 59
AGC of metabolically important gene pairs could be a widespread phenomenon ............. 60
AGC of MPP10-YJR003C is dependent on the structural integrity and the PIC forming
activity of the SAGA complex, but not on its HAT catalytic activity ................................ 60
AGC of MPP10-YJR003C could be driven by chromatin remodelers that modify the
chromatin landscape............................................................................................................ 61
Histone modifications might play a role in maintaining AGC ........................................... 62
Summary ................................................................................................................................64
References ...............................................................................................................................68
4
INDEX OF FIGURES
Figure 1 Molecular model of S.cerevisiae 80S ribosome.................................................... 11
Figure 2 S. cerevisiae rDNA locus representation .............................................................. 13
Figure 3 The Ras/PKA signaling pathway.......................................................................... 15
Figure 4 TOR pathway is involved in the transcription of genes responsible for
ribosome production and protein synthesis in eukaryotes. ............................................... 16
Figure 5 RNA Pol II pre-initiation complex assembly....................................................... 20
Figure 6 Outcomes of chromatin remodeling. .................................................................... 22
Figure 7 Remodeler Families, defined by their ATPase. ................................................... 23
Figure 8 the SAGA complex................................................................................................. 26
Figure 9 Structure of a nucleosome. .................................................................................... 30
Figure 10 Post-translational modifications of core histones. ............................................ 33
Figure 11 MPP10-YJR003C gene pair. ................................................................................ 35
Figure 12 the transcriptional control of the MPP10-YJR003C gene pair is directed from
the promoter of MPP10.. ...................................................................................................... 36
Figure 13 the co-regulated expression of YJR003C with MPP10 is dependent on its
immediate adjacency to MPP10. .......................................................................................... 37
Figure 14 Pol III transcription or the presence of a nucleosome barrier element do not
disrupt adjacent gene co-regulation. . ................................................................................ 38
Figure 15 Co-regulation of MPP10-YJR003C is disrupted only when an actively
transcribed Pol II unit is inserted between them.. ............................................................. 46
Figure 16 the promoter region of YJR003C could be responsible in maintain AGC with
MPP10. ................................................................................................................................... 47
5
Figure 17 Co-regulation of MPP10-YJR003C is dependent on the Spt20 subunit of the
SAGA complex. ..................................................................................................................... 49
Figure 18 Co-regulation of RPS27A-RSM22 is dependent on the Sus1 subunit of the
SAGA complex. ..................................................................................................................... 51
Figure 19 the catalytic activity of SAGA complex is dispensable for the AGC of MPP10YJR003C. ................................................................................................................................ 52
Figure 20 SWI6 is necessary for the adjacent co-regulation of YJR003C from the
promoter of MPP10............................................................................................................... 53
Figure 21 Rap1 motif in RPS27A’s promoter is necessary for regulating the expression
of both RPS27A and RSM22................................................................................................. 55
Figure 22 the promoter region of MPP10 shows highest relative H2A.Z occupancy.. ... 57
INDEX OF TABLES
Table 1: Yeast strains used in this study
................................................................................................................................................. 42
Table 2: Oligonucleotides used in this study ...................................................................... 43
6
Abstract
For a cell to be able to divide actively and progress through the cell cycle, a large number of
new proteins are required. The production of proteins is carried out by ribosomes, whose
biogenesis, in turn, plays an important role in the overall growth of the cell. Since ribosome
production is an energetically demanding process, the cell has to ensure that it is precisely
regulated in response to varying cellular conditions. Many ribosomal RNA (rRNA), ribosomal
and rRNA biosynthesis (RRB) and ribosomal protein (RP) genes are essential in the production
of ribosomes. The RRB regulon contains ~300 genes, and is distinct from the RP regulon, in
that its members are required for the production of rRNA’s. A significant number of the genes
in the RRB and RP regulon occur as immediately adjacent pairs in all possible orientations i.e.
convergent, tandem and divergent. Studies in our lab have shown the significance of gene
pairing in regulating gene expression, in particular for the RRB gene pair MPP10-YJR003C.
The transcriptional regulation of YJR003C from the promoter of MPP10 has also been
experimentally studied. We show that AGC between MPP10-YJR003C could be abrogated by
an active RNA Pol II transcriptional unit. Since the coding region of YJR003C has been shown
not to play a role in maintaining AGC, it is possible that the 5’ and 3’ untranslated regions of
YJR003C might play a role in maintaining AGC with MPP10. The requirement of the SAGA
component Spt20 in maintaining AGC between MPP10 and YJR003C is shown, hinting
towards the importance of maintaining the structural integrity of the SAGA complex for AGC.
The Sus1 subunit of the SAGA complex on the other hand is not required from maintaining the
AGC in the RP gene pair (RPS27A-RSM22). AGC between MPP10-YJR003C could be
partially dependent on the activity of Swi6, a chromatin remodeler. The phenomenon of AGC
is not confined to the RRB regulon but is also seen in the RP regulon (RPS27A-RSM22), hinting
towards the possibility of this being a widespread one within the genome.
7
Introduction
Section I: Model organisms and their significance in biology.
A model organism is one that can be easily cultured in the laboratory, and can be used to study
various biological processes which are otherwise harder to study in humans and other animals.
The quest for model organisms that can be used to study life’s essential processes has been
going on for centuries (Bolker, 2012; Müller and Grossniklaus, 2010). In the late 1800’s,
Theodor Escherich, a German microbiologist was saddened by the deaths of innocent children
due to diarrhea. He set out to investigate the causative agent. His initial experiments led him to
discover the causative agent which he then called Bacillus communis coli. Little did he know
that the same organism would revolutionize the field of molecular biology in the years that
ensued. The Bacillus was named as Escherichia coli in his honor (Hacker and Blum-Oehler,
2007). E. coli happens to be the most studied organism in molecular genetics as it has many
advantages to its credit, like rapid division time (~30 mins) and easier manipulation of its
genetic material. Since most of the E coli strains studied are non-pathogenic, it happens to be
the most favored organism for genetic studies across laboratories world-wide (Keseler et al.,
2005). The quest for model organisms didn’t stop with E. coli. Scientists felt the need for a
model organism to study processes common in eukaryotes as well. They started using
Drosophila melanogaster (fruit fly) as a model organism to study development (Chintapalli et
al., 2007). Also, since a number of genes in humans and yeast encode very similar proteins,
yeast has become one of the most studied organisms.
Yeast as a model organism.
Budding yeast, the unicellular ascomycotan fungi is considered to be the best organism
for understanding eukaryotic genetics, even though there are millions of fungal species
inhabiting earth. One of the fundamental advantages of using yeast as a model organism stems
8
from the fact that it is the first organism whose genome has been completely sequenced and
annotated (Müller and Grossniklaus, 2010). Some of the important properties of budding yeast
that make it an ideal candidate for eukaryotic genetic studies include (i) a cheaper and easier
manipulation of the genome compared to its mammalian counterpart (ii) a short generation
time (~90 mins) (iii) viability even when numerous markers are incorporated into the genome
(iv) stable as both haploids and diploids (v) availability of an exhaustive selection of plasmids
and gene fusion cassettes for gene manipulation studies (vi) availability of genome-wide gene
deletion libraries (vii) availability of genome-wide transcriptome and protein interaction data
and (viii) essential gene disruption with little or no observable detrimental phenotypes (Botstein
et al., 1997; Gershon and Gershon, 2000; Reid et al., 1998; Zeyl, 2000).
Over the years, efforts have been made not just to study and manipulate the genome of yeast,
but to study the various biochemical processes that are a part and parcel of it. Given the high
similarity that the yeast genome shares with higher eukaryotic cells (human cells etc.), it is the
choice of many researchers wanting to study the effects of various genes and their products in
higher eukaryotes. Some of the major metabolic pathways seen in higher eukaryotes like DNA
repair, cell cycle progression etc., are also seen in yeast, despite it being single celled (Fontana
et al., 2010; McGary et al., 2010; Wood et al., 2001). It comes as no surprise that yeast is
referred to as the “honorary mammal” by some scientists (Resnick and Cox, 2000). Given the
various experimental advantages yeast has, it has been, and is being used in better
understanding various conserved biological processes like replication, transcription and
translation. Translation is a part of the gene expression process. It results in the production of
proteins, which are essential for driving various biochemical pathways in the cell. Translation
in eukaryotes is carried out by 80S ribosomes, which decode the messenger RNA (mRNA), to
produce a specific protein (polypeptide chain).
9
Section II: Structure of eukaryotic ribosome.
The eukaryotic ribosome is an enormous ribonucleoprotein particle that is made of a large (60S)
and a small (40S) subunit. The large 60S subunit is the catalytic center of the ribosome that
catalyzes the formation of a peptide bond by its peptidyl transferase activity. It also carries a
nascent polypeptide exit tunnel. The small 40S subunit of the ribosome is responsible for
decoding the mRNA and monitoring its complementarity to the aminoacylated tRNA. The
eukaryotic ribosome is a complex assembly of four ribosomal RNAs (rRNAs) and about 80
ribosomal proteins (RPs), and it is associated with 150 non ribosomal factors (Granneman and
Baserga, 2004). Apart from the translation of mRNA into polypeptides, ribosomes also act as
a platform for several non-ribosomal proteins involved in various fundamental biological
processes. Some of them include docking of the ribosome to cellular organelles, and kinase
recruitment to facilitate the efficient functioning of various signaling pathways. The large
ribosomal subunit, or the 60S subunit of the yeast ribosome is composed of 3 rRNAs and 46
RPs, while the small subunit (40S) is composed of an 18S rRNA and 32 RPs. Although the
rRNA core of the eukaryotic ribosome is homologous to that of the 70S bacterial ribosome, a
few modifications set them apart. The 80S ribosome contains 5.8S rRNA containing 158
nucleotides. It is homologous to the 5’ end of 23S rRNA of the 70S ribosome. Similarly, the
25S rRNA of the 80S ribosome is homologous to the remaining 3’ sequence of the 23S rRNA
of the 70S ribosome. The 5S rRNA is the last piece of rRNA in the 60S subunit of the ribosome
and it is conserved among all the ribosomes across various kingdoms. The 40S subunit of the
80S ribosome consists of a single 18S rRNA which is homologous to the 16S rRNA in bacteria
(Dragon et al., 2002; Fatica and Tollervey, 2002; Henras et al., 2008; Jorgensen et al., 2002;
Krogan et al., 2004).
10
The large 60S subunit of the eukaryotic chromosome carries the peptidyl transerfase center
which catalyzes the peptidyl transferase reaction crucial for polypeptide production. The 40S
subunit helps for the correct tRNA-mRNA recognition which in turn is crucial for preventing
errors in protein synthesis. The concerted action of both the subunits helps in the efficient
translation of the mRNA template into a polypeptide (Fig. 1). Given the important role
ribosomes play in polypeptide production and in turn various biological pathways, their
production has been a subject of interest for many scientists.
Figure 1 Molecular model of S.cerevisiae 80S ribosome. Depicted in yellow and orange are
the rRNA and protein for the small subunit and gray and blue for the large subunit, respectively
(Armache et al., 2010).
Ribosome biogenesis in eukaryotes.
The process of ribosome biogenesis is a very important pathway in the context of cellular
metabolism. It is a very tightly regulated process, and its activity is dependent on the many
number of genes involved in the process, that respond to varying cellular conditions (Fatica
and Tollervey, 2002; Li et al., 2009). Ribosomes are the cell’s protein manufacturing
11
organelles, and in yeast the ribosome production rate is about 2000 min-1. Ribosome biogenesis
is an important cellular activity in eukaryotes and it occurs primarily, although not exclusively
in the sub-nuclear compartment of the nucleus, the nucleolus. It is a complex pathway
dependent on the combined activity of hundreds of gene products necessary to produce the four
heavily processed and modified rRNAs and 79 ribosomal proteins (RPs) that are assembled
together in the final ribosome (Warner, 1999). The rDNA genes, make up ~10% of the total
yeast genome. The genes exist as a single tandem array of ~150 identical repeats on
chromosome XII, and are templates in the production of the rRNAs (Fig. 2). These repeats are
transcribed in a RNA Pol I-dependent manner, and contribute to approximately 60% of the
total cellular transcription. Within the nucleolus, the rRNA genes are transcribed as precursors
(35S pre-rRNAs), which undergo processing and various covalent modifications and
eventually mature into the 25S, 18S and 5.8S rRNAs and also a 5S rRNA transcript. The yeast
ribosome also consists of 79 ribosomal proteins (RPs), which are encoded by a separate group
of 138 genes that are part of the RP regulon. It is interesting to note that although the RP genes
only make up 2% of the total yeast genome, roughly 90% of the total mRNA splicing events
and close to 50% of RNA Pol II dependent transcription is dedicated to the production of RP’s
(Fatica and Tollervey, 2002; Grandi et al., 2002; Larson et al., 1991; Martin et al., 2006a;
Nissan et al., 2002; Tschochner and Hurt, 2003). The production of a fully mature ribosome is
also dependent on the transcription of another group of genes which constitute the RRB regulon
(rRNA and ribosome biogenesis regulon). The RRB regulon has some 300 genes, whose
products are responsible for the proper transcription and eventual processing of the rRNAs, and
their assembly into the ribosomes along with RP’s (Rudra and Warner, 2004; Wade et al., 2001,
2006).
12
Figure 2 S. cerevisiae rDNA locus representation. The position of the rDNA repeeat cluster
found on Chr XII with respect to its centromere (CEN) and telomeres (tel) is shown. Each
rDNA repeat consists of a Pol I-transcribed 35S rRNA gene (precursor for 18S,5.8S and 25S
rRNAs), the RNA Pol II transcribed 5S rRNA gene, and two intergenic spacer regions
(IGS1and2). DNA elements- enhancer (ENH), core promoter (CP) and upstream element (UE)
are also shown (Goetze et al., 2010).
As mentioned above, 60% of cellular transcription and approximately 50% and 90% of total
cellular RNA Pol II transcription and mRNA splicing events respectively, are dedicated to the
process of ribosome biogenesis. This makes ribosome production the major consumer of
cellular resources. So, the cell has to make sure that the genes responsible for the production
of a ribosome are regulated in an effective manner in response to environmental and cellular
cues. Yeast cells grow and divide in response to favorable conditions i.e., normal environment
and availability of nutrients. It is the responsibility of the various nutrient-sensing pathways to
make sure that the availability of nutrients and growth factors is conveyed to the cell, which
responds by triggering division and growth. These pathways are referred to as signal
transduction pathways. These pathways aid in converting the extracellular stimulus into an
intracellular signal, often referred to as the secondary messenger. For example, the Srb9
protein which is associated with the RNA Pol II holoenzyme acts as a secondary messenger in
13
response to nutrient sensing by the Ras/PKA signal transduction pathway. PKA phosphorylates
Srb9p thus enhancing its activity (inhibition of gene expression of some genes). The secondary
messengers are recognized by specific proteins inside the responding cell. The signaling protein
activation triggers a wide variety of physiological changes inside the cell’s environment. One
such significant physiological change that is observed during the process of signaling protein
activation is the change in Pol II activity. For the cells to be able to enter the cell cycle, various
proteins are required. This in essence means that during active cellular growth and division,
the cellular translation rates increase. So, the ribosome production process is targeted by
various nutrient sensing pathways (Martin and Hall, 2005; Martin et al., 2004, 2006b;
Wullschleger et al., 2006).
Role of Ras/PKA pathway in ribosome biogenesis.
One of the major pathways that senses glucose levels and initiates a signaling cascade for cell
division and growth is the Ras/PKA pathway (Schmelzle et al., 2004). In eukaryotes, the
products of Ras genes are small GTP binding proteins that play a critical role in the signaling
pathways regulating the cell proliferation. The Ras proteins usually act as molecular switches
in that they could switch from an inactive GDP-bound form to an active GTP-bound form. This
switching is triggered by the availability of glucose (Fig. 3). In S. cerevisiae, two Ras proteins
Ras1p and Ras2p have been identified, which interact with the enzyme adenylyl cyclase and
activate it. Activated adenylyl cyclase converts ATP to cyclic AMP or cAMP. Increase in the
levels of the intracellular cAMP activates the cAMP-dependent protein kinase A. Mutational
analysis studies have established the role of the Ras/PKA signaling pathway in cell
proliferation. Inactivating mutations in this pathway lead to the premature entry of the cells
into the G0-like stationary phase. The Ras/PKA pathway influences the gene expression of a
number of genes by targeting the RNA Pol II transcription machinery. RP mRNA levels have
14
been shown to double in conditions where PKA is constitutively active. In converse, reduced
PKA levels have shown to reduce the RP mRNA levels even in response to increased glucose
levels (Schneper et al., 2004).
Figure 3 The Ras/PKA signaling pathway. (De Virgilio and Loewith, 2006)
Role of TOR pathway in ribosome biogenesis.
The TOR (Target Of Rapamycin) signal transducing pathway is also one of the important
mechanisms by which growth is regulated in eukaryotes. TOR signaling has been implicated
in regulating the protein biosynthesis of the cells in response to nutrient availability. In S.
cerevisiae, TOR signaling plays a crucial role in that it not only regulates the coordinated
changes in both translational initiation, but also the production of ribosomes (Schmelzle et al.,
2004). Normal functioning of the TOR signaling pathway (nutrient rich conditions) in S.
cerevisiae is required for the continual transcription of RP genes. Similarly, it is also required
for the processing of the 35S pre-rRNA. The TOR pathway is disrupted in the presence of the
drug rapamycin, which is indicated by the decrease in RP mRNA levels upon exposure of the
15
cells to rapamycin. The synthesis of 35S pre-rRNA is also inhibited in the presence of the drug.
These results are indicative of the direct involvement of the TOR signaling pathway in
ribosome biogenesis (Fig.4). Zaragoza et al., have shown the involvement of the TOR pathway
in Pol I (35S rRNA synthesis) and Pol III (5S rRNA and tRNA synthesis) activity, further
reinforcing the role of this signaling pathway in the production of a ribosome (Zaragoza et al.,
1998).
Figure 4 TOR pathway is involved in the transcription of genes responsible for ribosome
production and protein synthesis in eukaryotes. In S. cerevisiae, transcription of Pol I, II
and III transcribed genes involved in ribosome production is under the control of the TOR
pathway. Similarly, control over the production of proteins via translational control is also
brought about by the TOR pathway (Martin et al., 2006b).
The TOR and Ras/PKA pathways represent two evolutionarily conserved signal transduction
pathways that couple nutrient availability to regulation of various processes that drive cell
growth and division. The TOR and Ras/PKA signaling pathways control a number of processes
including the ribosome biogenesis in eukaryotes. TORC1 regulates the Pol III activity in a
Maf1 dependent fashion. Maf1 is a phosphoprotein under normal growth conditions and
becomes dephosphorylated when TORC1 is inhibited by rapamycin or during conditions of
stress, nutrient deprivation or DNA damage. The dephosphorylated form of Maf1 can interact
16
with RNA Pol III and down regulate its activity. It has been shown that Maf1 is recruited to
RNA Pol III transcribed genes in vivo under repressing conditions. Maf1 localization in the
nucleus is directed by TORC1 by regulating its phosphorylation, which is dependent on PP2A
phosphatases. These protein phosphatases dephosphorylate Maf1 under conditions of stress or
low nutrient availability. Maf1 localization in nucleus was shown in experiments where
rapamycin treatment of cells induced its accumulation in the nucleus (Hallett et al., 2014;
Michels, 2011).
On the other hand, PKA has been shown to phosphorylate Maf1. Interestingly enough, the
regulation of phosphorylation of Maf1 is achieved by the competing action of PKA and PP2A
phosphatase, which is in turn inhibited by TORC1 (Wei et al., 2009). TORC1 activates Sch9p
which in turn inhibits stress responsive transcription factors thereby promoting activation of
ribosome biogenesis genes. Some of the proteins that are regulated by TORC1 through Sch9p
are also regulated by the Ras/cAMP pathway but through PKA. The TORC1 and Ras/cAMP
pathways converge on Sch9p and Sfp1 kinase, which target the RRB gene transcriptional
repressors Stb3p, Dot6p and Tod6p. The collaborative action of these signaling pathways is
vital in controlling the production of ribosomes in the cell (Lippman and Broach, 2009; Zhang
et al., 2011).
Studying the process of gene expression at the level of transcriptional regulation would help
understand how various genes involved in metabolically important pathways are regulated.
Section III: Regulation of transcription in eukaryotes and its importance.
Gene expression in eukaryotes, in particular transcription, is a very important process and is
regulated by the changes in the structural properties of the DNA (packaging of DNA) and the
interaction with various transcription factors, which bind and affect their target genes (Carey
et al., 2009; Harbison et al., 2004; Johnson and McKnight, 1989; Wray et al., 2003).
17
It can be inferred that the sequence of a genome is what specifies the gene expression programs
in eukaryotic cells. Cells as we know are the products of specific gene expression programs.
These gene expression programs encompass the regulated transcription of thousands of genes.
The transcriptional regulation programs are dependent on various factors such as the cell’s
progression through cell cycle and changes in the environment during the course of
development of the organism.
Three distinct RNA polymerases in eukaryotes regulate the transcription of different classes of
genes. The three RNA polymerases are involved in the synthesis of different classes of RNA.
The protein-coding genes are transcribed by RNA Pol II, while the rRNA (ribosomal RNA)
and tRNA (transfer RNA) genes are transcribed by the polymerases I and III, respectively. The
28S, 18S and 5.8S rRNA (largest rRNA’s) are specifically transcribed by RNA Pol I. All three
RNA polymerases in eukaryotes are complex enzymes, each carrying around 8-14 different
subunits (Cormack and Struhl, 1992; Fan et al., 1996; Young and Davis, 1983). Two of the
large subunits of all three polymerases are related to the β and β′ subunits found in the E.coli
polymerase. In addition to sharing common subunits with E.coli, all three eukaryotic
polymerases carry 5 common subunits (Sweetser et al., 1987). All three of these eukaryotic
RNA polymerases share a number of functional properties, one of which is the dependence on
various transcription factors for the effective transcription of different classes of genes they
regulate (Cormack and Struhl, 1992).
RNA Pol II has been studied in detail by many research groups since it is responsible for the
transcription of protein coding genes. Robert Roeder and colleagues in 1979 demonstrated that
eukaryotic RNA Pol II functions differently from that of the prokaryotic polymerase in that it
requires additional proteins (specific transcription factors) for its activity. They established the
dependence of eukaryotic RNA Pol II on specific initiation factors that are not part of the RNA
18
Pol II enzyme itself. The transcription factors that facilitate transcription by RNA Pol II were
identified by biochemical fractionation studies of the nuclear extracts (Roeder, 2003). Leu and
Kornberg, 1987 isolated the transcriptionally active form of Pol II from yeast for the first time
and paved way for the detailed functional and structural analyses of eukaryotic RNA
polymerases in general (Edwards et al., 1990).
Pre-initiation complex and its role in transcription.
The initial stages in the process of transcription involve the formation of a Pre Initiation
Complex (PIC) and its post-assembly control. The binding of TBP (TATA-binding protein), to
the TATA box marks the beginning of the formation of the basal transcription machinery
(Roeder, 1991). The basal transcription machinery comprises of the minimal components that
are required for transcription to occur in vitro (the general transcription factors TFIID, TFIIA,
TFIIB, TFIIE, TFIIF, and TFIIH as well as RNA Pol II). Once the basal transcriptional
machinery is assembled at promoters, it triggers the formation of the PIC (Kadonaga, 1998;
Weigel and Jäckle, 1990; Zawel and Reinberg, 1995).
19
Figure 5 RNA Pol II pre-initiation complex assembly. TATA box recognition by the TBP
(TATA-binding protein) is brought about by TAFs (TBP-associated factors). In vitro
experiments suggest that TFIIA, TFIIB, TFIIF/RNA Pol II, TFIIE and TFIIH are recruited in
a sequential manner which marks the completion of the PIC formation (Strachan and Read,
1999).
TBP is recruited to the promoters as part of the TFIID complex. TFIID is a multi-subunit
complex that also carries various TAF’s (TBP-associated factors). The RNA Pol II is recruited
along with its general transcription factors in a TBP-TFIID complex dependent fashion at
promoters (Fig.5). The formation of the PIC occurs at the upstream regions of the gene
promoter which are referred to as nucleosome free regions (NFR’s) due to the lack of
nucleosomal structures in these regions. These NFR’s are flanked by two nucleosomes, one
upstream (-1 nucleosome) and one downstream (+1 nucleosome) in the 5’ end of the
transcription start site (Rhee and Pugh, 2012).
Trans factors in regulation of transcription.
Despite high nucleosome occupancy, some genes continue to be expressed at a high
rate under favorable conditions. Such high expression is brought about by various trans acting
factors. These trans factors include RNA polymerase, general transcription factors, chromatin
20
remodeling complexes and histone variants. These trans factors, either individually or as part
of a complex help alter the nucleosome structure thereby altering the overall levels of gene
expression (Chen and Rajewsky, 2007; Jones et al., 1988).
The process of transcription mediated by RNA Pol II is carried out by specifically altering the
nucleosomes present in the promoter, coding and termination regions of the genes. The
nucleosomes are either evicted, repositioned such that the DNA is exposed and the Pol II could
slide along the exposed DNA. The -1 nucleosome (nucleosome upstream of NFR) is evicted to
facilitate RNA Pol II binding at the transcription initiation site. As the RNA Pol II starts sliding
over the DNA during the transcription process, the +1 nucleosome is also evicted. The +1
nucleosome is reformed after the RNA polymerase passes it by into the body of the gene.
Nucleosome occupancy at actively transcribed gene loci is relatively low and wider NFR’s
correspond to higher levels of transcription (Schwabish and Struhl, 2004; Struhl, 1998).
Transcription factors and chromatin remodeling complexes work in tandem to affect the
nucleosome structure rendering it more relaxed and thus allowing transcription to occur. There
is a competition for gaining access to the DNA in between the transcription factors and
nucleosomes. The transcription factors have the capability of binding to the DNA and
increasing the NFR. NFR regions carrying binding sites for transcription factors Rap1, Abf1
and Reb1 have shown increased nucleosome occupancy when the levels of the corresponding
transcription factor are decreased in the cell (Jansen and Verstrepen, 2011).
As mentioned earlier, chromatin remodeling complexes help transcription factors “remodel”
the nucleosome landscape and aid in transcription. Most of the chromatin remodeling
complexes are ATP driven and utilize the energy from ATP hydrolysis to reposition, remove
or restructure the nucleosomes (Fig. 6).
21
Figure 6 Outcomes of chromatin remodeling. a) Remodeler (green) action on nucleosomes
can result in b) DNA site exposure (red) for a DNA binding protein (DBP) which was initially
occluded by the histone octamer. The exposure of the DNA site is brought about by either
repositioning/ejection/unwrapping c) The composition of the nucleosome could be altered by
either dimer exchange or dimer ejection (Clapier and Cairns, 2009).
Four different highly conserved remodeler complexes sharing a common ATPase domain have
been identified in eukaryotes. They are the SWI/SNF, ISWI, CHD and the INO80 family
remodelers. Individual complexes are conserved from yeast to humans despite some variation
in the detailed protein composition (Fig. 7). These remodeler complexes also carry unique
associated subunits which help differentiate them from one another. All the remodelers share
five basic properties (i) affinity for the nucleosome, beyond DNA itself, (ii) domains that can
recognize covalent histone modifications, (iii) DNA dependent ATPase domain, required for
remodeling the nucleosomes and (iv) domains that can regulate the ATPase domain and (v)
domains for recognizing and binding other transcription factors. These shared properties help
the remodeling complexes to select, bind and remodel the nucleosomes.
22
Figure 7 Remodeler Families, defined by their ATPase. All remodeler families carry a
SWI2/SNF2- family ATPase subunit, characterized by its DExx (red) and HELICc (orange)
subunits. Each family of remodelers has a distinguishable domain residing either within or
adjacent to the ATPase domain. SWI/SNF, ISWI and CHD family remodelers have a small
insertion (gray) within their ATPase domains. On the other hand, in the members of INO80, a
long insertion separates the two subunits of the ATPase domain. The domains flanking the
ATPase domain are also distinct for each family of remodelers (Clapier and Cairns, 2009).
The SWItching defective/Sucrose Non-Fermenting (SWI/SNF) family of chromatin
remodelers were first purified from S. cerevisiae. They are composed of 8-14 subunits. Most
of the eukaryotes utilize two related SWI/SNF family remodelers that are built around two
related catalytic subunits. The catalytic ATPase subunit of the members of this family includes
an HAS (Helicase-SANT), a post-HSA and a C-terminal bromodomain. The SANT domain is
a protein-protein interaction module which can bind to histone tails and mediate remodeling of
nucleosomes. The post-HSA module (helicase SANT associated module) acts as the primary
actin-related protein (ARP) binding platform and regulates the chromatin remodeling
ATPase’s. The recruitment of the SWI/SNF to genes that are regulated by this complex is
brought about by the recognition of the acetylated lysines by the C-terminal bromodomain. In
fungal complexes, additionally a pair of actin-related proteins (ARPs) are also present. The
members belonging to this family of remodelers have many activities which include sliding
23
and ejecting nucleosomes at many loci but lack a chromatin assembly capability (Smith and
Peterson, 2004).
The Imitation SWItch (ISWI) family of remodelers contain 2-4 subunits. The
subunits were initially purified from D. melanogaster. Most of the eukaryotes build multiple
ISWI family complexes with one of the two different catalytic subunits, with specialized
attendant proteins. The C-terminus of the ISWI family ATPase’s have a characteristic set of
domains. The SANT domain (ySWI3, yADA2, hNCoR, hTFIIIB) adjacent to a SLIDE
domain (SANT- like ISWI). Together, these two domains form a nucleosome recognition
module that can bind to unmodified histone tails and DNA. Many ISWI family complexes
help optimize nucleosome spacing thereby promoting chromatin assembly and repression of
transcription. Some complexes can promote Pol II transcription by randomizing nucleosome
spacing. The different subunit combinations impart different functions to the complexes
belonging to this family of remodelers (Berger, 2002; Phelan et al., 1999; Smith and
Peterson, 2004; Urnov, 2001).
The Chromodomain, Helicase, DNA binding (CHD) family of remodelers usually
have 1-10 subunits and were first purified from Xenopus laevis. The members of this family
have two tandemly arranged chromodomains towards the N-terminus of the ATPase subunit.
The catalytic subunit could be either monomeric (lower eukaryotes) or multimeric
(vertebrates). The attendant proteins often carry a DNA-binding domain and PHD, BRK, CR13 and SANT domains. Some CHD remodelers can either slide or eject nucleosomes to facilitate
transcription whereas others have repressive roles. Examples include the vertebrate Mi2/NuRD (nucleosome remodeling and deacetylase) complex which contains histone
deacetylases and methyl CpG binding domain (MBD) proteins. Chd1, a member of the CHD
family of remodelers is also a component of the SAGA complex. The variability observed in
24
the members of the CHD family is attributed in part to the chromodomain diversity in this
family (Hargreaves and Crabtree, 2011; Xue et al., 1998).
The INOsitol requiring 80 (INO80) family of remodelers contain more than 10
subunits and include the SWR1-related complexes. The subunits of this family were initially
purified from S. cerevisiae. Some of the higher orthologs of the subunits of this family contain
HAT activity which is linked to transcriptional activation. The members of this family carry a
split ATPase domain. A long insertion between the ATPase domain helps the helicase related
(AAA-ATPase) Rvb1/2 proteins and one ARP protein to bind. They yeast INO80 and SWR1
complexes contain actin and Arp4. The INO80 family of remodelers can promote
transcriptional activation and DNA repair. SWR1 although is related to INO80 has a slightly
different function of restructuring the nucleosome by replacing the canonical H2A-H2B dimers
with H2A.Z-H2B dimers (Clapier and Cairns, 2009).
The SAGA complex and its role in transcription.
Many eukaryotic promoters contain a TATA box within their promoters. The TATA box
typically lies very close to the transcriptional start site (often within 50 bases). In genes
containing the consensus TATA box motif, the SAGA complex directs the TBP to their
promoters. On the other hand, in genes that don’t carry the TATA box, TBP binding occurs in
a TFIID dependent fashion. In S. cerevisiae, approximately 80-90% of genes are designated
TATA-less due to the lack of the consensus TATA motif (TATAWAWR) in their promoters.
These TATA-less promoters have later been renamed as TATA-like owing to the presence of
only two or less mismatches in comparison to the TATA box consensus.
As mentioned above, in promoters carrying a consensus TATA motif, TBP recruitment occurs
in a SAGA dependent manner. The yeast SAGA (Spt-Ada-Gcn5-Acetyltransferase)
transcriptional co-activator complex is a 1.8 MDa, 21-protein complex. The yeast SAGA
25
complex is a novel transcription regulatory complex that functions as a co-activator complex.
The 19 SAGA subunits have been shown to be conserved from yeast to humans. The yeast
SAGA complex is modular in structure and has distinct functional units which include a
recruitment module (Tra1), an acetylation module (Gcn5, Ada2, and Ada3), a TBP interaction
unit (Spt3 and Spt8), deubiquitination module (Ubp8, Sus1, Sgf11, and Sgf73) and the
architecture unit (Spt7, Spt20, Ada1, TAF5, TAF6, TAF9, and TAF12) (Fig.8) (Baker and
Grant, 2007; Timmers and Tora, 2005; Yu et al., 2000).
Figure 8 the SAGA complex. Activator (Gcn4) binding at the UAS is facilitated by Ada2,
which allows the HAT activity of Gcn5 in cooperation with the bromodomain (BrD) to
acetylate nucleosomal histone tails. This process facilitates effective binding of TBP to the
TATA box. Spt8 and Spt3 mediate TBP-SAGA interactions and further regulation (Sterner et
al., 1999a).
The process of transcriptional activation is dependent on the activity of the various transcription
factors. One of the major obstacles for transcriptional by RNA Pol II in eukaryotes is chromatin
structure. The packing of the DNA into the nucleosomal unit makes it inaccessible to the
transcriptional machinery. For the transcriptional machinery to perform its function, the
nucleosomal structure should be disrupted. Histone acetylation is one of the modifications
26
through which nucleosome stability could be disrupted. The lysine side chains on the amino
terminals of the core histones (H2A, H2B, H3 and H4) can be acetylated, which results in a
reduction in their positive charge. This charge reduction in turn reduces the affinity of the
histones for the DNA around which they are wrapped, making it more accessible. Both in vitro
and in vivo studies on histones have shown that hyper acetylated histones are more permissive
for transcription whereas hypo acetylated histones are associated with inactive and repressive
chromatin (Eberharter and Becker, 2002). Gcn5 is the component of the SAGA complex which
is involved in the histone acetylation activity. Histone acetyltransferases (HATs) function by
transferring the acetyl moiety from acetyl co-A onto one or more lysine residues within the Nterminal tails of histone proteins (Grant et al., 1997). The HAT activity of Gcn5 was
demonstrated by the analysis of HAT substitution mutants. Specific alanine substitutions in the
N-terminal portion of the HAT domain of gcn5 has shown to lower the rate of transcription and
growth. The decrease in transcription and growth rates was severe in some cases (Wang et al.,
1998). In studies conducted with recombinant yeast Gcn5, it has been shown that Gcn5
efficiently acetylates free histones but it fails to acetylate histones contained in nucleosomes
thus indicating that additional components are required for acetylation of chromosomal
histones. Gcn5 has been identified as a part of two distinct nucleosome modifying complexes,
which also contained the Ada2 and Ada3 adaptors. These adaptors associate with the activation
domains and function as part of a complex involved in activating transcription. One of the
Gcn5-dependent HAT complexes also carries four Spt proteins as part of the complex. Hence,
the complex was aptly named the SAGA (Spt-Ada-Gcn5-Acetyltransferase) complex. Another
component of the SAGA complex that has been identified to be playing a role in the HAT
activity is Tra1. Tra1 has been shown to form complexes with multiple transcriptional
adaptor/HAT complexes which suggests a possible conserved function of this protein in the
27
regulation of transcription. Tra1 could be playing a role in providing a bridging surface for
various factors owing to its large size. The Tra1 protein interaction with specific transcriptional
activators and the acetylation of histone H3 by Gcn5 helps initiate the recruitment of the SAGA
complex to gene loci (Grant et al., 1998a).
The four Spt proteins that are part of the SAGA complex are Spt3, Spt7, Spt8 and Spt20. Null
mutations in either Spt7 or Spt20 have been shown to cause severe growth defects (Roberts
and Winston, 1996). The overall structural integrity of the SAGA complex is disrupted in these
mutant strains hinting towards the possible role of the Spt7 and Spt20 in maintaining the
structural integrity of the complex (Sterner et al., 1999b).
The SAGA complex is unique in that members of this complex function as different subgroups
and the mutations in members of each of the subgroups gives rise to a different phenotype. This
exemplifies SAGA as a complex in which each individual component has a distinct
biochemical function. The distinct modules that make up the SAGA complex collaborate
intimately to maintain structural integrity, genomic recruitment, and interactions with the basal
transcription machinery (Eberharter et al., 1999; Grant et al., 1998b, 1998c; Larschan and
Winston, 2001; Sterner et al., 2002; Wu et al., 2004).
Chromatin structure and its role in regulation of transcription.
The structure of chromatin dictates the fate of transcription in eukaryotes and higher organisms.
Chromatin structure is dynamic in nature and has a profound effect on regulating gene
expression and inheritance of traits from one generation to the next. In higher organisms like
yeast and humans, the DNA is packaged inside the cells in a separate compartment called the
nucleus. During the process of cell division, the DNA-protein complex can be visualized as
individual chromosomes. In cells that are not undergoing division, the chromatin is distributed
28
throughout the nucleus in a condensed form called “heterochromatin” or a more relaxed form
called “euchromatin” (Fig. 9a) (Struhl, 1999; Wolffe, 1998).
The core components of the chromatin structure are the histone proteins. Core histones have
been shown to be the most highly conserved eukaryotic proteins, suggesting the possibility of
evolution of chromatin in ancient eukaryotes. Histones have evolved to carry out the
compaction of the rather large amount of DNA present in eukaryotes (Felsenfeld and Groudine,
2003).
In modern eukaryotes, with expanded genome sizes, the compaction function of the chromatin
is reflected in the form of a complex nucleosome structure. The chromatin structure might seem
to be inert owing to its compact nature, but is in fact the hub for a plethora of biochemical
activities which are essential for controlling gene expression as well as DNA replication and
repair mechanisms (Van Holde and Isenberg, 1975).
The nucleosome is the fundamental subunit of the chromatin in eukaryotes. The nucleosome
structure comprises of a 147-base-pair stretch of DNA, which is bent sharply and wrapped
tightly around a histone protein octamer (Fig. 9b). The octamer is composed of core histones
(two each of histones H2A, H2B, H3 and H4). The bending of the DNA occurs at every helical
repeat (10 bp), when the major groove of the DNA faces inwards towards the histone octamer,
and again 5 bp away, with opposite direction, when the major groove faces outward. This
bending of DNA is facilitated by specific dinucleotides. In general AA/TT/AA dinucleotides
recurring periodically at the helical DNA repeat are shown to facilitate the sharp bending of
DNA around the nucleosome (Felsenfeld and Groudine, 2003). Since, the DNA sequences in
the genome differ greatly in their inherent ability to bend sharply, the ability of the histone
octamer to wrap different DNA sequences into nucleosomes depends greatly on the specific
DNA sequence. In vitro studies have shown that the range of affinities is 1000- fold or greater.
29
The intergenic and coding regions of the yeast genome were shown to contain DNA sequences
that have a high-affinity for nucleosome formation. Alternately, low nucleosome occupancy is
encoded at the transcription start sites (Lee et al., 2007).
The eukaryotic genome has evolved such that the nucleosomes have a substantial preference
when it comes to DNA sequences and unstable nucleosomes are encoded over regions where
transcription factors bind and facilitate gene expression (Lee et al., 2007; Pokholok et al., 2005;
Segal et al., 2006).
The bending and winding of DNA around the histone octamer results in a five-to tenfold
compaction. Neighboring nucleosomes are separated from each other by a 10-80 bp linker
DNA segment. The connected nucleosomes appear as “beads on a string”. This
polynucleosome structure is further compacted into a fiber like structure with a diameter of
~30nm.
Figure 9 Structure of a nucleosome. a) Multiple levels of DNA compaction. DNA
compaction in an interphase nucleus follows a hierarchy. Strings of nucleosomes are part of
the primary structure. The second level of compaction is achieved by histone-tail mediated
inter nucleosomal interactions. Interactions mediated by the tails of the individual fibers gives
rise to a tertiary structure b) Nucleosome core particle with 146-bp DNA (brown and turquoise)
and the core histone proteins (H2A:yellow; H2B:red; H3: blue; H4:green) (Felsenfeld and
Groudine, 2003).
30
Approximately 75-90% of the genomic DNA is wrapped into nucleosome structures. In this
state, the DNA facing the inside of the core is occluded from polymerases and other regulatory
and repair complexes. The DNA wound around the surface of the histone octamer is partially
accessible to regulatory proteins though and could become more accessible if the nucleosome
could be either moved out of their way or if the underlying DNA is partially unwound from the
histone octamer. Nucleosomes can recruit other proteins through their histone tail domain
interactions. These histone tails (amino-terminal ends of the histone protein) are active sites for
the various enzymes that can modify these tails and in turn promote nucleosome movement
and unwinding. Such movement and unwinding would have a profound effect on the overall
structure of the chromatin complex (Felsenfeld and Groudine, 2003).
Genome-wide studies have shown that the intrinsic encoding of nucleosome occupancy differs
across different regions of the chromosome. For example, the centromeres in yeast have the
highest predicted occupancy which indicates that for the centromeres to function efficiently,
they require enhanced stability of histone-DNA interactions, the information for which is
encoded in the underlying genomic sequence. On the other hand, gene expression levels in
genes which are highly expressed are dependent on the presence of unstable nucleosomes. One
important example for this is the very low predicted nucleosome occupancy at the highly
expressed rRNA and tRNA genes (Parnell et al., 2008). Unlike the ubiquitously expressed
tRNA genes, a number of genes in the genome need to either up or down-regulate their
expression in response to different conditions. Since, the genome sequence is static, it is highly
impossible for it to simultaneously encode a nucleosome organization that would facilitate the
up and down regulation of specific genes. The RP gene expression better explains how the
nucleosome organization facilitates either up or down regulation of these genes under different
conditions. Studies by Segal et al., have predicted that genes such as those involved in
31
ribosomal protein production have a high nucleosome occupancy encoded within their loci and
that the genome sequence doesn’t facilitate nucleosome depletion. The high expression of such
genes observed under favorable conditions could be governed by other factors. Alternately,
under conditions of stress, the genome facilitates rapid nucleosome reassembly which in turn
helps in the repression of these genes. The nucleosome organization encoded within the
genome is static but it may very well contribute to the dynamic process of gene regulation.
Histone post translational modifications and their role in transcription.
Histones, the building blocks of the compact nucleosome structure contribute to the
process of remodeling by undergoing post-translational modifications. Histone proteins are
subjected to posttranslational modifications which include acetylation, methylation of lysines
(K) and arginines (R), phosphorylation of serines (S) and threonines (T), ubiquitylation and
sumolyation of lysines etc. (Fig. 10). These post-translational modifications usually occur at
the N or C-terminal of the histone tail (Peterson and Laniel, 2004; Strahl and Allis, 2000; Sun
and Allis, 2002). Given that the chromatin is the physiological template for all processes that
are mediated by DNA, it makes perfect sense that the histones could likely be controlling the
structure and/or function of the chromatin with the different modifications yielding different
functions. Recent studies have shown that locus-specific combinations of histone posttranslational modifications could help trigger a specific biological function. Locus-specific
histone modifications are a consequence of targeting histone modifying enzymes to the loci
and also due to the inherent substrate specificity of the modifying enzymes to such loci
(Peterson and Laniel, 2004). In the case of transcription, histone modifications in the target
nucleosomes are brought about by the direct interactions between histone modifying enzymes
and sequence specific transcriptional regulators. In yeast, the HAT domain of the SAGA
complex interacts with the transcription activation domains of a number of yeast gene-specific
32
activator proteins. This interaction helps target the HAT activity to specific gene promoters in
vivo (Grant et al., 1997).
Figure 10 Post-translational modifications of core histones. Histone tails can be either
methylated at lysine and arginines (green), phosphorylated at serines or threonines (yellow),
ubiquitylated (blue) and acetylated at lysines (red) (Peterson and Laniel, 2004).
Together, the histone variants, patterns of posttranslational histone modifications, and histone
tail binding proteins contribute to the establishment of either an open or closed chromatin
domain that exhibit specialized folding properties and functions. Some of these domains can
be inherited through DNA replication and mitosis (Moazed, 2011).
Stress induced chromatin remodeling in yeast.
Yeast cells respond to changes in the environment by activating defined gene expression
programs. The coordinated regulation of expression of various genes ensures appropriate
responses to changes in the environment, nutrient availability and conditions of stress etc.
Studies have identified common sets of genes that are either transcriptionally repressed or
induced under conditions of stress in the budding yeast S. cerevisiae (Causton et al., 2001).
The chromatin remodeling complexes including Swi/Snf, Swr1p, Isw1, Isw2, and Chd1 are
involved in the stress response in yeast (Shivaswamy and Iyer, 2008). Genes that are otherwise
normally repressed under normal conditions but expressed under conditions of stress are
33
categorized as ESR (Environmental stress response) genes. These genes are not actively
transcribed under normal conditions due to the promoter nucleosome occupancy. Under
conditions of stress, the chromatin remodelers help evict the promoter nucleosomes from the
ESR gene promoters. Genome wide mapping of nucleosome occupancy has shown that the
overall nucleosome positioning on the genome scale while remains unchanged, gene specific
eviction, sliding or restructuring of nucleosomes occur (Gasch and Werner-Washburne, 2002;
Verna et al., 1997).
Section IV: Mechanism of adjacent gene co-regulation in S. cerevisiae.
For the cell to be able to effectively regulate the transcription of a number of genes,
their relative positions on the chromosomes plays a critical role. Earlier studies in our lab have
characterized the RRB regulon, which is an important pathway that helps in the proper
assembly of a fully functional ribosome along with the RP regulon and rRNA genes (Wade et
al., 2001, 2006). One of the important observations made in the genes that make up the RRB
and RP regulons is that a significant number of those genes happen to occur as immediate
adjacent gene pairs. The adjacent gene pairing phenomenon extends to other large co-regulated
gene sets, which include DNA damage response, carbohydrate metabolism, nitrogen
metabolism etc.(Arnone et al., 2012).
In S. cerevisiae, 25% and 13% of the genes that make up the RRB and RP gene pairs
respectively, occur as immediately adjacent gene pairs. These gene pairs occur in all possible
orientations i.e., convergent, tandem and divergent. Adjacent gene pairing observed in these
regulons is associated with tighter transcriptional co-regulation than is observed for non-paired
genes belonging to the same regulons. A significant percentage of RRB and RP genes occur as
pairs across widely divergent fungal lineages (Arnone and McAlear, 2011a).
34
In order to study the adjacent gene co-regulation phenomenon in greater detail, studies were
conducted to uncover the cis and trans requirements of the genes that are involved in AGC.
Earlier studies conducted in our lab were directed towards the understanding of the AGC
phenomenon in the MPP10-YJR003C gene pair. The MPP10-YJR003C gene pair is an RRB
gene pair involved in ribosome biogenesis.
Figure 11 MPP10-YJR003C gene pair. Located on Chromosome X in S. cerevisiae. A 348
bp intergenic region separates the two genes. R=RRPE motif and P=PAC motif.
The two genes in this gene pair are convergently oriented with only the promoter of MPP10
carrying the signature promoter motifs (Fig. 11). Expression profile analyses carried out in
strains in which the PAC and RRPE motifs of MPP10 are mutated, showed that the expression
of MPP10 deviates from the expression of the rest of the RRB regulon (i.e., the classical heat
shock induced repression is not observed). Not only does MPP10’s expression fail to respond
to a heat shock but the expression of YJR003C also follows suit. This result highlights the
importance of the PAC (Polymerase A and C) and RRPE (rRNA Processing Element) motifs
in maintaining the regulated expression of both MPP10 and YJR003C. This is quite interesting
because the promoter of YJR003C is some 3.8 kilobases away from that of MPP10’s promoter
and still happens to be under its influence (Fig. 12).
35
Figure 12 the transcriptional control of the MPP10-YJR003C gene pair is directed from
the promoter of MPP10. Expression profile analysis for MPP10 (red), YJR003C (yellow), and
the unpaired RRB gene EBP2 (blue) in wild-type (A) and ∆RRPE ∆PAC (B) strains following
a 30°C to 37°C heat shock.
To study the effect of immediate adjacency on the co-regulation of MPP10 and YJR003C gene,
their expression was monitored in a strain in which a 3 kbp KANr URA3 pCORE reporter
cassette was engineered into their intergenic region (Fig. 13). The expression profile data
obtained from this strain under conditions of stress showed that AGC between MPP10YJR003C is abrogated when the immediate adjacency between this gene pair is disrupted.
36
Figure 13 the co-regulated expression of YJR003C with MPP10 is dependent on its
immediate adjacency to MPP10. A) Strain construct carrying the pCORE cassette in the
intergenic region of MPP10-YJR003C. B)Expression levels of MPP10, YJR003C and EBP2
under conditions of (B) heat shock and (C) osmotic stress.
The above result is indicative of the importance of the immediate gene adjacency for
the MPP10-YJR003C gene pair. The results from this study were reinforced by the observations
that a significant number of co-regulated adjacent genes in S. cerevisiae occur as pairs and that
occurrence of co-regulated triplets or quadruplets is a rarity.
Arnone et al., also reported that the insertion of RNA pol III driven tRNA-Thr gene
(Fig. 14A) or a Ty1 nucleosome barrier element (Fig. 14B) between MPP10 and YJR003C does
not interfere with the co-regulated expression of the MPP10-YJR003C gene pair.
37
Figure 14 Pol III transcription or the presence of a nucleosome barrier element do not
disrupt adjacent gene co-regulation. Heat shock expression levels of MPP10, YJR003C and
EBP2 in a strain carrying the Pol III transcribed tRNA-THR gene (A) and a nucloeosome
barrier element (B).
To summarize the findings by Arnone et al., the adjacent gene co-regulation of YJR003C is
dependent on the integrity of MPP10’s promoter and the immediate adjacency of these two
genes.
The current study is aimed at further investigating the cis and trans requirements of the AGC
phenomenon of the MPP10-YJR003C gene pair. We found that an actively transcribed Pol II
unit would abrogate the adjacent gene co-regulation phenomenon. We found that the
coordinated regulation of YJR003C is dependent on the Spt20 subunit of the SAGA complex
but not its catalytic subunit Gcn5 indicating the importance of maintaining the structural
integrity of the SAGA complex in AGC. Also, the AGC is partially dependent on the Swi6 unit
of the SWI4-SWI6 complex. We further report that the coding region of YJR003C is not
responsible for maintaining the AGC with MPP10 and that the AGC phenomenon is not just
38
confined to the RRB gene pairs and that it could be a genome-wide phenomenon observed in
other regulons.
39
Materials and methods
Yeast strains. A complete list of all strains used in this study, as well as their relevant
genotypes, is included in Table 1. Strain YMM13 (MATa leu2Δ1trp1Δ63 ura3-52) was used
as a wild type and is the parent strain used to generate the various mutants. The insertions in
the intergenic region of MPP10 and YJR003C were generated using the two-step delitto
perfetto method, targeting the integration of the LEU2 gene in either orientation between
MPP10 and YJR003C by Dr. James Arnone. The strain in which YJR003C’s coding sequence
is replaced with that of LEU2 is generated by the delitto perfetto approach by Teryn Citino.
The single deletion mutant strains were purchased from the Open Biosystems Yeast Deletion
Collection. A complete list of the oligonucleotide primers used in this study is provided in
Table 2. The primers are named according to their targeted gene, the strand and position that
they anneal to (W or C), and whether they were used for mRNA expression studies (quantitative
reverse transcription, qRT, or Chromatin Immunoprecipitation, ChIP).
Culture conditions for heat shock response. Strains were grown in YPD (1% yeast extract,
2% peptone, 2% dextrose) medium to the early to mid-log phase (optical density at 600 nm of
0.40 to 0.90). A heat shock time course was induced by growing cultures at 30°C and
transferring to 37°C medium. Cultures then continued to grow at 37°C and aliquots of cells
were taken at each time point.
RNA preparation and expression analysis. Aliquots of yeast were obtained across a time
course and washed at 4°C to remove the medium. RNA was obtained by a hot acid phenol
extraction with the following modifications. Samples were extracted twice with phenol and
once with chloroform and then ethanol precipitated prior to re-suspension in diethyl
pyrocarbonate (DEPC) water. 10μg of RNA was cleared of genomic contaminants by treatment
with DNase I according to the manufacturer’s instructions (DNA-free; Ambion) and were
40
checked by PCR using primers directed to the ACT1 coding region. cDNA was generated with
oligo (dT) primers using the Retro-script kit according to the manufacturer’s instructions
(Ambion). Linear conditions were identified by the titration of cDNA template for PCR
followed by native PAGE. Quantitative PCR (qPCR) was then performed across the time
course and the products were analyzed by native PAGE stained with Sybr Gold (Invitrogen).
Images were obtained on either a Typhoon or a Storm phosphorimager scanner (Molecular
Dynamics) and quantified using the manufacturer’s ImageQuant software. Each expression
profile represents the normalized average to ACT1.
Chromatin Immunoprecipitation (ChIP) for measuring H2A.Z abundance. Yeast culture
in which H2A.Z is HA tagged was grown as described above, and chromatin was
immunoprecipitated as described in reference 34 with the following modifications.
Crosslinking of cells was performed with 1% formaldehyde at room temperature for 30 min.
The crosslinking reaction was quenched with 333mM glycine for 15 min. Samples were
washed twice in cold phosphate-buffered saline (PBS) and resuspended in high-salt lysis buffer
(50 mM HEPES-KOH, 500 mM NaCl, 1% Triton X-100, 0.1% Na deoxycholate, 0.1% SDS,
1 mM EDTA) supplemented with protease inhibitors (Protease Inhibitor Cocktail Set 1;
Calbiochem). Equal volume of glass beads was used for lysing the cells. Sonication conditions
were optimized to achieve an average size of 400-600bp fragments. Cellular debris is cleared
by centrifugation and the lysate was transferred to a fresh tube. 50 μl lysates were precleared
with magnetic protein A/G beads (Thermo scientific) prior to immunoprecipitation. HA-H2A.Z
was immunoprecipitated with antibody specific for HA (Roche; Anti-HA catalog no.
11583816001) at 4°C overnight. Immune complexes were harvested by incubating them with
protein A/G magnetic beads, washed twice with high-salt lysis buffer and once with wash
buffer (10 mM Tris-HCl, pH 8.0, 250 mM LiCl, 0.5% NP-40, 0.5% Na deoxycholate, 1 mM
41
EDTA), and once with TE (50 mM Tris, pH 8.0, 10 mM EDTA). DNA was eluted into 30 μl
elution buffer (50 mM Tris, pH 8.0, 10 mM EDTA, 1.0% SDS), and cross-links were reversed
by incubation at 65°C overnight. Samples were purified by extraction twice with phenolchloroform–isoamyl alcohol and once with chloroform and then ethanol precipitated with
glycogen as a carrier. Samples were then resuspended in Tris-EDTA (TE). Enrichment of a
fragment was determined by calculating the abundance in the immunoprecipitated fraction and
subtracting the presence in the no-antibody control and is presented as a ratio with the
abundance in the whole-cell lysate.
TABLE 1: Yeast strains used in this study.
Strain
Genotype
Source
YMM13
MATa leu2Δ1 trp1Δ63 ura3-52
(25)
YMM554
MATa leu2Δ1 trp1Δ63 ura3-52 MPP10::LEU2
This study
YMM559
MATa leu2Δ1 trp1Δ63 ura3-52 MPP10::LEU2
This study
YMM590
MATa leu2Δ0 met15Δ0 ura3Δ0 swi4∆::KANr
Open Biosystems
YMM591
MATa leu2Δ0 met15Δ0 ura3Δ0 swi6Δ::KANr
Open Biosystems
YMM598
MATa leu2Δ0 met15Δ0 ura3Δ0 gcn5Δ::KANr
Open Biosystems
YMM597
MATa leu2Δ0 met15Δ0 ura3-52 YJR003C::LEU2
This study
YMM562
MATa leu2Δ0 met15Δ0 ura3Δ0 spt20Δ::KANr
Open Biosystems
YMM598
MATa leu2Δ0 met15Δ0 ura3Δ0 sus1 Δ::KANr
Open Biosystems
42
TABLE 2: Oligonucleotides used in this study.
Name
Forward primer
Reverse primer
(5’-3’)
Anne
al
site
Use
(5’-3’)
Anne
al
site
ACT1qRT
ATCGTTATGTCCGGTGGTACC
1,196
TGGAAGATGGAGCCAAAGC
1,281
qPCR
EBP2qRT
AACGCTACCTTACAGAAACG
957
TCCGTTAGGCCTGCCTCTAT
1,122
qPCR
844
qPCR
447
qPCR
811
qPCR
1435
qPCR
419
qPCR
CGAA
MPP10qRT
CGAGGAGGAGGAGGCTATTT
674
AT
YJR003CqRT
ACCACCATTGACCCATACTC
TC
147
TC
RPS27A (EP)
GATTCAGGATGGACGTATGA
CTTCTTCATGACGGGAATCA
GACCACTTCCATCAGTTCAT
CA
1179
GC
RSM22 (EP)
CTTCCTCATCCGCAAATAAG
AAGTACGATCTTGGACCTTG
GA
1760
AGGTGCAATCACCTTCAGAA
A
Leu2WP20
GGTACCGGTAGTGTTAGACC
A
246
TG
SWI4 WP1
CCAAGGACCAAATAGGCAA
TGG
CTCAAGCGCAATGAGAAAAGT
CGATTCTTCCTCCACTTACC
G
CT
CTTCATCTGGACCGTTTGGA
GTGGAAGGACAGGCTTAAG
Deletio
n check
SWI6 WP1
Deletio
n check
TA
GCN5 DEL CHK
ATC
CTTTTCAATACTCGAGAGCA
Deletio
GTTGTATAACAAAGCAAGA
n check
WP1
AAGAC
CGGATT
Spt20 Del Chk
GAAGCATGAGGTCTATGGTA
AGTGACAATAGTTCTTGTTA
Deletio
n check
WP01
TATGG
YJR003C Coding F1
TCGCGTTAGCAACAATTAAC
TCCGC
1246
AC
MPP10-YJR
ATATTCATGACGAGATGCGG
intergenic W
AAC
ACT1-ChIP-WP01
GGGAAGAAAAAAGCAGTAA
CTGCCAGGGTTATAAAAGCA
1124
GTA
1928
GCTATCTTCCAATACCTCTT
is
2052
GCGTG
CCCCTTTCTACTCAAACCAA
GAAG
43
ChIP
analys
GTTTC
26
ChIP
analys
is
138
ChIP
analys
is
EBP2-ChIP-WP01
GTGATATAACTACTCATCGG
137
GACTG
MPP10-ChIP-WP01
TCACCGCCTTTTCTGTACTGG
136
TTTG
ChIP-YJR003C-WP1
TCTCATCGAACTCTTTCATG
CTTGGGTCTTTCGTGCACAC
7
CATTACCCGAAGGCTGTTTC
is
12
GTGATG
TTATCCTTTTCCGTCTCACCG
C
44
ChIP
analys
is
124
ChIP
analys
AGTAG
41
ChIP
analys
ATCAT
TGGCGGTTAGCTGTTAAGCA
WP01
10
CTTTG
CCGC
YJR003C-ChIP-
CCGTTGTTCAACTAACTGTG
is
217
ChIP
analys
is
Results
Section I: An actively transcribed RNA Pol II unit disrupts adjacent gene co-regulation.
To investigate the mechanism whereby tighter transcriptional co-regulation is observed in the
genes belonging to the RRB regulon, the MPP10-YJR003C gene pair was chosen for detailed
analysis. This gene pair is found in a convergent orientation on chromosome X, and
experiments done earlier in our lab have shown the role of MPP10’s promoter in regulating
YJR003C’s expression. The PAC and RRPE promoter motifs of MPP10 are required for the
regulated transcription of YJR003C, whose transcription is initiated from a site 3.8kb away
from those motifs. It has been shown by Dr. James Arnone that separation of the two genes by
inserting a KANr-URA3 gene pair under a constitutively active promoter disrupts the AGC
under conditions of stress. The above study prompted us to further investigate what other cis
element requirements were necessary for maintaining AGC. To study the cis element
requirements, strains were constructed in which the LEU2 gene was engineered in both possible
orientations (LEU2 tandem to MPP10 and LEU2 convergent to MPP10) into the intergenic
region between MPP10 and YJR003C. These constructs could be repressed by including
leucine in the media, or induced when leucine was absent. Dr. James Arnone showed that the
AGC between MPP10-YJR003C is disrupted only under conditions where the intergenic LEU2
was activated i.e., when the growth media was not supplemented with leucine (data not shown).
Given that the experiments were conducted in YPD media, it could be possible that additional
components in the media might alter the expression of MPP10, YJR003C and LEU2 genes.
YPD media even though has a defined composition, the sources for individual components that
make up the media could be different. This might alter the expression of the three genes. To
eliminate the possibility of media components in YPD altering the expression of the three
genes, synthetic complete (SC) media supplemented with or without leucine was used as
45
control to check that the results are consistent with the previous profiles (obtained by Dr. James
Arnone) of the strains grown in YPD media.
Expression profile data was generated following a heat shock induction of a stress response
under conditions where LEU2 is repressed (SC+Leucine) or when LEU2 is activated (SCLeucine). Our results indicate that the additional components present in YPD media don’t have
any effect on the expression of MPP10, YJR003C and LEU2 and that mere insertion of a 1.5kb
LEU2 unit in between MPP10 and YJR003C is not sufficient to abrogate the characteristic
transcriptional repression observed under conditions of stress in a wild type strain background
(Fig.15). However, when LEU2 is actively transcribed, YJR003C no longer responds to the
heat shock induced stress as it is supposed to be (Arnone and McAlear, 2011b).
Figure 15 Co-regulation of MPP10-YJR003C is disrupted only when an actively
transcribed Pol II unit is inserted between them. Strains were grown in SC (A, B where
LEU2 is inhibited) subjected to a 37°C heat shock, and monitored for their expression profiles
over a 30 min time course at the EBP2, MPP10, and YJR003C genes by RT-PCR. The
expression profile of the leftward oriented MPP10.LEU2 insert (YMM554) are represented in
A and the profile of the rightward oriented MPP10.LEU2 insert (YMM559) are presented in
B.
46
Section II: The coding region of YJR003C is not responsible for maintaining AGC with
MPP10.
Earlier studies in our lab have shown that deleting the PAC and RRPE consensus motifs within
the promoter region of MPP10 not only prevents MPP10 from responding to a heat shock but,
it also affects the expression of YJR003C. This is indicative of the effect that MPP10’s
promoter has on the overall AGC phenomenon. To test whether the coding region of YJR003C
is responsible for its expression pattern under conditions of stress, we engineered mutants in
which the coding region of YJR003C is replaced with the coding sequence (CDS) of a LEU2
gene. When this strain was subjected to a heat shock over a 30 min time course, we observed
that the expression of the engineered LEU2 gene remains coupled with that of MPP10. If
YJR003C’s coding region was responsible for maintaining AGC with that of MPP10, we would
expect the expression of LEU2 to be uncoupled from that of MPP10. That is not the case
indicating that the coding region of YJR003C is not responsible for maintaining the AGC
(Fig.16). The co-regulated expression of YJR003C with that of MPP10 could be directed from
either the 5’ or 3’ untranslated region of YJR003C.
Figure 16 the promoter region of YJR003C could be responsible in maintain AGC with
MPP10. Gene expression profiles following a 300C to 370C heat shock induced environmental
stress response were obtained (B) for a strain in which the coding sequence of YJR003C is
replaced with that of LEU2 (A). The expression profile is a mean from 3 qPCRs. The standard
error is shown.
47
Section III: The Spt20 subunit of the SAGA complex is required for maintaining the
AGC between MPP10 and YJR003C.
Chromatin remodeling, which facilitates the modification of the DNA and histones associated
with it, is an important step in transcriptional regulation of genes. The chromatin remodeling
process helps expose the DNA to various transcription factors and RNA polymerases. Previous
lab members have studied the effect of various chromatin remodelers on AGC. Snf2 and Chd1
are two such chromatin remodelers that have been shown to mediate the AGC phenomenon
between MPP10 and YJR003C.
The yeast SAGA complex is a large multi-protein complex required for the normal
transcription of many genes. Snf2 contains a bromodomain that has specificity to SAGA
acetylated histones residues and Chd1 has been found in a complex with both SAGA and SLIK
(SAGA-like, also called SALSA) complexes. To test the role of the SAGA complex in the
AGC phenomenon, we obtained the expression profiles of a yeast strain in which the gene that
codes for an integral structural component of the SAGA complex has been deleted: spt20Δ
(strain provided by the Holmes lab). Heat shock expression profile data over a time course of
30 min was obtained for MPP10, YJR003C and EBP2. We observed that in spt20Δ strain
background, YJR003C’s expression is uncoupled from that of MPP10 (Fig.17). This result
establishes a role for the structural component of the SAGA complex in conferring the AGC
phenomenon at this locus.
48
Figure 17 Co-regulation of MPP10-YJR003C is dependent on the Spt20 subunit of the
SAGA complex. Yeast strain with a deletion for the SPT20 subunit of the SAGA complex was
grown in YPD media, subjected to a 37°C heat shock, and expression profile monitored over a
30 min time course at the EBP2, MPP10, and YJR003C genes by RT-PCR.
Section IV: The SUS1 subunit of the SAGA complex is required for activating but not
required for maintaining the co-regulated expression of the RP gene pair under
conditions of stress.
Sus1, a component of the deubiquitylating sub module of the SAGA complex and the mRNA
export complex (TREX-2), has been shown to promote the formation of a pre-initiation
complex (PIC) at the upstream activating sequence of transcriptionally active genes and, thus,
promote transcription. The deubiquitylating activity of the SAGA complex is regulated by
Sus1p by helping maintain the association of Ubp8 (which carries a H2B deubiqutylating
activity) with the complex.
Sus1p has been shown to interact physically with mRNA transport factors like Thp1p and
Sac3p, which are components of the TREX-2 mRNA export complex. The TREX-2 mRNA
export complex facilitates mRNA export from the nucleus to the cytoplasm by tethering itself
to the various nucleoporins of the nuclear pore complex. Sus1 also promotes PIC formation at
SAGA dependent gene loci. The Sus1 mediated PIC formation at these gene loci is independent
49
of its histone H2B de-ubiquitylation activity. Sus1 thus plays a role in two major steps of
transcription i.e., transcription initiation and mRNA export through its association with the
SAGA and TREX-2 complexes, respectively. Since the Spt20 subunit of the SAGA complex
plays a role in maintaining the AGC between MPP10-YJR003C, we decided to test the effect
of the PIC forming capability (Sus1p) of this complex on maintaining AGC phenomenon. We
also wanted to test the role of Sus1p in maintaining AGC in a gene pair belonging to a different
regulon. We chose the RPS27A-RSM22 gene pair from the RP regulon for this purpose. The
AGC between RPS27A and RSM22 was lost in a strain where the Rap1 binding motif of
RPS27A has been mutated, hinting towards the possible role of this motif in the AGC
phenomenon. Heat shock expression profile data over a time course of 30 min was obtained
for EBP, MPP10, YJR003C, RPS27A and RSM22 in both the wild type and Δsus1 strain
backgrounds. We observed that while Sus1p doesn’t play a role in maintaining AGC between
MPP10-YJR003C (Fig. 18A, C), it is required for maintaining the coordinated expression
between RPS27A-RSM22 (Fig.18B, D). Further studies are required to understand the exact
mechanism behind the coordinated expression of the RP gene pair.
50
Figure 18 Co-regulation of RPS27A-RSM22 is dependent on the Sus1 subunit of the
SAGA complex. Wild type and strain with a deletion for the SUS1 subunit of the SAGA
complex was grown in YPD media, subjected to a 37°C heat shock, and expression profiles
monitored over a 30 min time course at the EBP2, MPP10, YJR003C, RPS27A and RSM22
genes by RT-PCR. Sus1p isn’t required for maintaining the AGC between MPP10-YJR003C
(A and C) while it is required for maintaining the coordinated expression of RPS27A-RSM22
gene pair (B and D).
Section V: Adjacent gene co-regulation of the MPP10-YJR003C gene pair is not
dependent on the catalytic activity of the SAGA complex.
The lysine acetyl-transferase (KAT) activity of the SAGA complex has been implicated in the
transcriptional regulation of a number of genes. In some other SAGA dependent genes, the
lysine acetyl transferase activity is dispensable for transcriptional regulation. This rather
interesting duality of the SAGA complex in regulating transcription prompted us to look at the
catalytic activity of the SAGA complex and determine its role in AGC of MPP10-YJR00C.
Gcn5 is the acetyl transferase subunit of the SAGA complex. To test the role of GCN5 in
maintaining AGC between MPP10-YJR003C, expression profile data for EBP2, MPP10
51
andYJR003C in a gcn5Δ strain (provided by the Holmes lab) was obtained. We observed that
in a gcn5Δ strain, the co-regulation of MPP10-YJR003C gene pair under conditions of stress
was not perturbed (Fig.19). This result indicates that while the AGC of MPP10-YJR003C is
dependent on the structural integrity of the SAGA complex, it is not dependent on the KAT
catalytic activity of the complex.
Figure 19 the catalytic activity of SAGA complex is dispensable for the AGC of MPP10YJR003C. Yeast strain with a deletion for the GCN5 subunit of the SAGA complex was grown
in YPD media, subjected to a 37°C heat shock, and expression profile monitored over a 30 min
time course at the EBP2, MPP10, and YJR003C genes by RT-PCR.
Section VI: Adjacent gene co-regulation is dependent on the chromatin remodeler SWI6
but not SWI4.
To determine the role that chromatin remodelers may play in mediating adjacent gene coregulation we conducted a screen of these complexes looking for a genetic background that
would result in an uncoupling of YJR003C’s transcription from that of MPP10. Chd1
(Chromodomain Helicase DNA-binding 1) is the sole representative of a family of remodeling
enzymes that are conserved from yeast to humans. It carries a characteristic chromodomain at
its N-terminus. Synthetic lethality studies carried out on CHD1 and SWI/SNF genes have shown
the interactions between them and, in particular, between CHD1, SWI4 and SWI6. SWI4 is a
52
component of the Swi4p-Swi6p complex which acts as a transcriptional activator in
conjunction MBF (Mbp1-Swi6p) and is instrumental in regulating G1-specific transcription of
target genes.
Studies on the chd1 strain earlier have shown that gene co-regulation of YJR003C is
dependent on the activity of this chromatin remodeler. Since CHD1 has been shown to interact
with SWI4 and given SWI4’s role as a transcriptional activator, we wanted to study if SWI4
contributes to the AGC of MPP10-YJR003C. We obtained expression profile data for MPP10,
YJR003C and EBP2 over a 30 min time course under conditions of heat stress in a swi4Δ strain
background (CDS of SWI4 is replaced with that of a KANMX gene). We observed that in this
strain background, YJR003C expression is not uncoupled from that of MPP10 showing that
SWI4 is dispensable for maintaining AGC (Fig. 20A). On the other hand, in a swi6Δ
background there is a partial disruption of AGC between MPP10 and YJR003C (Fig. 20B). The
exact mechanism by which SWI6 contributes to AGC needs further investigation.
Figure 20 SWI6 is necessary for the adjacent co-regulation of YJR003C from the promoter
of MPP10. Gene expression profiles following a 300C to 370C heat shock induced
environmental stress response were obtained for (A) swi4Δ and (B) swi6Δ strains. Each profile
is a mean from 6 qPCR’s performed on two independent RNA extractions. The standard error
is shown.
53
Section VII: Adjacent gene co-regulation of metabolically important genes extends
beyond the RRB regulon.
Ribosome production is a concerted effort of rRNA genes and those belonging to the
RRB and RP regulons. Conservation of immediate gene pair adjacency in co-regulated genes
is not just confined to the members of the RRB regulon, but is a wide spread phenomenon. In
our lab, we have been studying the co-regulated adjacent convergent gene pair MPP10YJR003C, of which MPP10 has been implicated in playing a role in the ribosome biogenesis
as part of the RRB regulon. A significant number of genes in the RP regulon of S. cerevisiae
(24 of 180 genes, p-value of 4.4 x 10-5) occur as pairs. To check whether the phenomenon of
AGC is observed in the gene pairs of the RP regulon, we picked a convergent gene pair from
the RP regulon: RPS27A-RSM22. One of the characteristic features of this gene pair is the
presence of a Rap1 binding motif in the upstream region of RPS27A’s promoter. To test the
effect of cis elements on the co-regulated expression of this RP gene pair, expression profile
analysis under conditions of heat shock in a strain where the Rap1 binding motif is mutated
(strain construction- Teryn Citino) was performed. We observed that, in this strain background
there is perturbation of the AGC phenomenon between RPS27A-RSM22, albeit some
differences as compared to its RRB counterpart (Fig.21). The expression of RSM22 is
uncoupled from that of RPS27A (Fig. 21B) while the expression of RPS27A showed similar
levels in comparison to the wild type strain (Fig. 21A).
54
Figure 21 Rap1 motif in RPS27A’s promoter is necessary for regulating the expression of
both RPS27A and RSM22. Gene expression profiles following a 300C to 370C heat shock
induced environmental stress response were obtained for strain in which the Rap1 motif was
substituted with an Xho1 cut site (A) by the delitto perfetto approach (Teryn Citino). Each
profile is a mean from 6 qPCR’s performed on two independent RNA extractions. The left
panel in B is the expression profile in a wild type strain and the right panel shows the expression
profile in a RAP1 motif substitution strain background. The standard error is shown (B).
Section VIII: The promoter region of MPP10 shows relatively higher levels of H2A.Z
occupancy.
Transcriptional regulation in eukaryotes is regulated by different mechanisms. Some of the
known mechanisms include (i) recruitment of co-activators and general transcription factors to
promoters; (ii) conformational changes in transcription machinery leading to increased activity;
(iii) enhancing steps that occur after preinitiation complex formation; and (iv) modification of
chromatin structure by ATP-dependent remodelers or through covalent nucleosome
modifications (Hahn, 2004; Hampsey, 1998).
Earlier studies in our lab have shown that during a heat shock induction of the budding yeast
environmental stress response, the promoter region of YJR003C doesn’t undergo nucleosome
remodeling (Jeffrey Arace). This led us to hypothesize that the expression of YJR003C under
conditions of stress could be dependent on histone modifications of one of the subunits of the
nucleosome. The histone variant H2A.Z is a variant of histone H2A that is highly conserved
55
and widespread throughout the eukaryotic chromatin. Genome-wide studies have shown that
in approximately two-thirds of the S.cerevisiae genes H2A.Z is present. In a majority of genes,
H2A.Z localizes to the first nucleosome downstream of the nucleosome free region (referred
to as the +1 nucleosome) and in a fewer subset of genes, it localizes to the upstream region of
the NFR (-1 nucleosome) (Albert et al., 2007; Ranjan et al., 2013). H2A.Z has been implicated
in controlling transcription (by altering the properties of the chromatin template), DNA repair,
genome stability, and the control of antisense transcription. To test the promoter and coding
sequence occupancy of H2A.Z and its role in regulating transcription of the MPP10-YJR003C
gene pair ChIP analysis was done. We used a strain in which HTZ1 is hem agglutinin (HA)
tagged. Antibody against the HA tag were used to pull down DNA fragments that have H2A.Z
occupancy. We observed that the promoter region of MPP10 shows a higher relative occupancy
of H2A.Z in comparison to that of its coding region and the promoter, coding regions of
YJR003C (Fig. 22). While these results help verify the published data on H2A.Z occupancy
(Albert et al., 2007), future experiments would help measure the relative occupancy of other
TF’s and their possible role in adjacent gene co-regulation. Further exploration of this histone
variant under conditions of stress may lead to an understanding of co-regulation of this and
other gene pairs.
56
80
70
60
% Input
50
40
30
20
10
0
MPP10 Promoter
MPP10 Coding
YJR003C Coding
YJR003C Promoter
Figure 22 the promoter region of MPP10 shows highest relative H2A.Z occupancy. Yeast
in which HTZ1 was HA tagged was grown up to log phase and ChIP using an anti-HA antibody
was performed. The relative occupancy of H2A.Z was measured using PCR primers which
span the promoter and coding regions of MPP10 and YJR003C.
57
Discussion
An active RNA Pol II transcriptional unit is sufficient to abrogate co-regulation between
MPP10-YJR003C.
Previous studies in our lab have shown that inserting a KANr-URA3 gene pair under a
constitutively active promoter disrupts the AGC under conditions of stress. While this
experiment helped us understand the requirement of adjacency between the gene pair for
maintaining co-regulated expression, it doesn’t help us understand if transcriptional activity
across the intergenic region of MPP10-YJR003C has a role in AGC (since the KANr-URA3
gene pair is always active). To address this issue, strains in which LEU2 has been engineered
between MPP10 and YJR003C in either orientation were used to study the effects of
transcription on maintaining AGC. The advantage of using LEU2 is that it can help us not only
understand what the spacing requirements are for maintaining AGC (when LEU2 is repressed)
but, also help us understand whether or not insertion of a Pol II transcriptional unit would have
an effect on the AGC phenomenon. Initially this experiment was carried out in YPD and SCLEU media where in the LEU2 gene is either turned off or on respectively. Since, the individual
components in YPD media are derived from various sources, it is possible that they might affect
the expression of MPP10, YJR003C or LEU2. To address this issue, the same experiment was
carried out in a synthetic complete (SC) media with leucine (LEU2 repressed). The results
obtained were similar to that of what we saw when YPD media was used. This makes it clear
that no matter what the media conditions, as long as an actively transcribed Pol II unit is present
in between MPP10 and YJR003C, the AGC is lost under conditions of stress. Since the
expression of LEU2 in either orientation is not under the control of MPP10 or the RRB regulon,
we can speculate that the co-regulation of YJR003C is not being driven from the promoter of
58
LEU2. The next step would be to test the promoter and coding region requirements of YJR003C
in maintaining AGC.
AGC of YJR003C could be driven from its promoter.
Earlier experiments in our lab were focused on deciphering the role of MPP10’s promoter
region and the various factors (both cis and trans) that might play a role in maintaining AGC.
It could be possible that the promoter, coding, and 3’ UTR regions of YJR003C might also play
a role in maintaining co-regulation with MPP10. To test this, we used a strain in which the
entire ORF of YJR003C was replaced with that of LEU2, while keeping the promoter and
3’untranslated regions of YJR003C intact. Expression profile analysis of this strain under heat
stress conditions showed that the engineered LEU2 gene with YJR003C’s promoter showed the
classic heat shock response. If the coding region were to play a role in maintaining YJR003C’s
co-regulation with that of MPP10, we would expect to see LEU2’s expression being uncoupled
from that of MPP10. However, that was not the case. The results also pointed to the possibility
of YJR003C’s promoter and 3’ UTR playing a role in maintaining AGC. Contrary to what has
been published about the experimental perturbation of an antisense RNA altering the
expression of sense mRNA, this study shows that it is not the case for this co-regulated
convergent gene pair. If the transcript from MPP10 were to alter the expression of YJR003C,
we wouldn’t be observing a decrease in the expression levels of both MPP10 and YJR003C.
This is a preliminary result and warrants more detailed studies. The autonomously replication
sequence in the 5’ UTR of YJR003C can be mutated to understand its role in maintaining AGC.
Similarly, sequence mutations in the 3’ UTR of YJR003C might also help further understand
the sequence requirements within this region for maintaining AGC.
59
AGC of metabolically important gene pairs could be a widespread phenomenon.
In order to study whether or not the phenomenon of AGC extends beyond the RRB genes, we
chose to study a gene pair of the RP regulon (RPS27A-RSM22). It has to be noted that only one
of the genes in the gene pair (RPS27A) carries the signature promoter RAP motif. Expression
profile data was obtained under heat shock time course for EBP2, RPS27A and RSM22 genes.
Our analyses indicate that in this strain background, under conditions of stress the AGC
between RPS27A-RSM22 was lost. This result is interesting because we would expect RPS27A
to fall under the control of its own proximal promoter motif, but that was not the case. Instead,
a distal paired gene responds to a mutation in the Rap1 motif pointing to the possibility that
there could be a cross talk between the promoters of the paired genes. Since only RPS27A
carries the RAP motif, we can say that it is driving the AGC phenomenon for this gene pair. It
would be worthwhile investigating the promoter sequence of RSM22 to further understand its
dependence on the promoter of RPS27A. Searching for signature motifs, if any within the
RSM22 promoter region would also help understand their importance in maintaining AGC (by
means of mutational analyses). It could also be possible that the CDS of RSM22 might help
maintain its AGC with RPS27A. Experiments wherein RSM22’s CDS is replaced with that of
LEU2 may help us understand the CDS requirement of RSM22 for maintaining AGC. ChIP
analysis could also be done to identify the transcription factor requirements that might facilitate
this novel AGC phenomenon.
AGC of MPP10-YJR003C is dependent on the structural integrity and the PIC forming
activity of the SAGA complex, but not on its HAT catalytic activity.
Spt20, the structural sub-unit of the SAGA complex, helps maintain AGC according to our
expression profile analyses. Similarly, Sus1, the component of the SAGA complex that helps
establish a PIC at the promoter regions of SAGA dependent genes, also helps maintain AGC.
60
So, it is possible that the AGC is controlled at the level of PIC formation. ChIP studies in a
Sus1 deletion strain background would help answer the PIC formation requirement in
maintaining AGC between the MPP10-YJR003C gene pair.
On the contrary, the catalytic subunit of the SAGA complex that facilitates the histone acetyl
transferase activity (Gcn5) is not required for maintaining AGC, indicating that while the
overall structural integrity of the SAGA complex is important in maintaining AGC, the
catalytic properties of the complex are dispensable. Perhaps other catalytic units within the
SAGA complex might be involved in the AGC phenomenon. For example, the Sgf11, Ubp8
subunits which are involved in deubiquitylation of histone H2B could play a role in maintaining
AGC.
Also, since the Sus1 subunit which is involved in the PIC formation at the SAGA dependent
genes has been shown to play a role in maintaining AGC of the RP gene pair, it would be
interesting to study other components of the SAGA complex that help establish a PIC (e.g.,
Sgf73) (Shukla et al., 2006).
The results from the above experiments indicate that the phenomenon of AGC is dependent on
various components of the same complex in some regulons and also that AGC requirements
differ from regulon to regulon. ChIP analyses of promoter regions of paired genes involved in
AGC would help better understand the various protein requirements for maintaining AGC.
AGC of MPP10-YJR003C could be driven by chromatin remodelers that modify the
chromatin landscape.
Chromatin remodelers are useful for exposing the compacted DNA to various transcription
factors and co-activators etc., to promote transcription. The SWI/SNF complex is one such
complex involved in chromatin remodeling. Snf2 has been shown to play a role in AGC earlier.
Since Snf2 is linked to both SWI4 and SWI6, we looked at their importance in maintaining
61
AGC. While SWI4 is not required for AGC, SWI6 is indispensable for AGC. Swi6 has been
previously shown to recognize and bind histone H3 tails that are methylated at Lys-9 and
facilitate repression. It is possible that in a wild type strain background, Swi6 localizes to the
promoter region of YJR003C and facilitates its repression when subjected to heat stress.
The expression profile data indicates that while AGC is driven by components of various
chromatin-remodeling complexes, they don’t necessarily belong to the same subclass of
remodelers. Given the dependence of AGC on various subunits belonging to different
chromatin remodeling complexes, general transcription factors that facilitate transcription and
transcriptional repressors (e.g., Swi6), it would be interesting to look at the protein-protein
interactions between the various factors to get a better understanding of the AGC phenomenon
in general.
Histone modifications might play a role in maintaining AGC.
Nucleosome scanning assays performed earlier in our lab have shown that heat shock induced
ESR has no effect on the nucleosome remodeling at the MPP10-YJR003C loci. The downside
of the nucleosome-scanning assay is that it cannot detect subtle changes in the nucleosome
remodeling. Moreover, it is proven that nucleosome remodeling can occur by modifying the
histones that make up the core octamer of the nucleosome structure. Since earlier results from
the nucleosome scanning assay have shown that transcriptional repression of MPP10-YJR003C
is not associated with changes in nucleosome positions, it would be worth testing the effect of
various histone posttranslational modifications (PTM’s) on maintaining AGC. ChIP analysis
to verify the relative occupancy of such modified histones at the MPP10-YJR003C gene loci
could be performed. To test the efficiency of ChIP for detecting histone modifications, we
performed ChIP to detect the relative occupancy of a known histone modification (histone
H2A.Z) at the promoter and coding regions of MPP10-YJR003C. Our results are consistent
62
with that of published ones indicating that the promoter of MPP10 has higher relative
occupancy of H2A.Z compared to its coding region and that of YJR003C’s promoter and coding
regions. It has to be noted that this experiment is performed under normal log growth
conditions. In order to better understand the role of various histone modifications in
maintaining AGC under stress, ChIP should be performed under conditions that can evoke the
ESR. Various other histone modifications like ubiquitylation, sumoylation etc, might play a
role in remodeling the nucleosome structure. So, studying other PTM’s might also help better
understand the AGC phenomenon. Studies have also shown that regulation of gene expression
is dependent on specific histone PTM codes, it would be worthwhile trying to investigate any
such PTM code requirement codes for maintaining AGC.
63
Summary
The questions addressed and the significance of the results obtained in the current study can be
summarized as follows:
Do the various components of different growth media have an effect on the expression of
MPP10, YJR003C or LEU2 in a strain engineered to study the effect of an active Pol II
transcriptional in disrupting AGC?
To study if the individual components in YPD media have an effect on the expression of
MPP10. YJR003C and LEU2 in a strain where LEU2 is engineered in between MPP10 and
YJR003C, synthetic complete media (SC) was used. In this media condition, LEU2 is repressed.
The results indicate that as long as the intergenic Pol II transcriptional unit is not active, the
adjacent gene co-regulation between MPP10 and YJR003C was not abrogated irrespective of
the culture media used.
Does the coding region of YJR003C play a role in helping it maintain AGC with MPP10?
To study the effect of the coding sequence of YJR003C in maintaining AGC with MPP10,
expression profile data from a strain in which the entire coding sequence of YJR003C is
replaced with that of LEU2 while leaving the 5’ and 3’ UTR regions intact. The profile data
showed that the coding sequence of YJR003C is not required for maintaining AGC with
MPP10. Future experiments can be focused on studying the 5’ and 3’ untranslated region
requirements of YJR003C in maintaining AGC with MPP10.
Is adjacent gene co-regulation a widespread phenomenon in the genome?
Studies earlier in our lab have focused on understanding the mechanism of AGC in a gene pair
belonging to the RRB regulon. To investigate whether or not the AGC phenomenon is
widespread, a gene pair of the RP gene pair (RPS27A-RSM22) is studied. This gene pair is
similar to the RRB gene pair MPP10-YJR003C. The promoter region of RPS27A has the
64
characteristic Rap1 binding motif in its promoter while the promoter region of RSM22 does
not. Expression profile data in a strain where the Rap1 binding motif is mutated was obtained.
The data indicated that mutations in the Rap1 binding motif proximal to RPS27A doesn’t have
an effect on its expression level while it uncouples the AGC of RSM22 with RPS27A under
conditions of stress. This result points to the possibility that there is a cross-talk between the
promoter of RPS27A and RSM22. We can hypothesize that mutations in the Rap1 binding motif
might result in the failure of recruitment of a specific factor that might help maintain RSM22’s
characteristic up regulation which is observed in a wild type strain.
What are the various components of the SAGA complex that might help maintain AGC?
Studies performed by Dr. James Arnone have shown that the chromatin remodelers Snf2 and
Chd1 help maintain AGC between MPP10-YJR003C. Snf2 and Chd1 have specificity for
SAGA acetylated histones. This led us to believe that the SAGA complex might also play a
role in maintaining AGC. Expression profile analysis in a spt20Δ strain has shown that it is
required for maintaining AGC. This result is indicative of the importance of the structural
integrity of the SAGA complex in maintaining AGC. The Sus1 component of the SAGA
complex is required for the establishment of PIC at the promoter regions of SAGA dependent
genes. We looked at the AGC phenomenon in a sus1 Δ strain background and observed that
while this subunit is required for increased expression of both RPS27A and RSM22, it is not
required for maintaining their co-regulated expression.
The catalytic activity of the SAGA complex is brought about by the Gcn5 subunit. Expression
profile analysis data from a gcn5 Δ strain has shown that the catalytic activity is not required
for maintaining AGC between MPP10-YJR003C. It would be interesting to study the effect of
the catalytic activity of the SAGA complex in maintaining AGC for the RP gene pair.
65
Is adjacent gene co-regulation dependent on the remodeling activities of various
chromatin remodelers?
Earlier studies in our lab by Dr. James Arnone have showed that Snf2 and Chd1 chromatin
remodelers play a role in maintaining AGC between MPP10-YJR003C. Snf2 is a component
of the SWI/SNF chromatin remodeling complex. Synthetic lethality studies carried on CHD1
and SWI/SNF genes have shown the interactions between them. Swi4 acts a transcriptional
activator in conjunction with Swi6.
We wanted to test the effect of SWI4/SWI6 components of the SWI/SNF complex in maintaining
AGC. Expression profile analysis in swi4 Δ and swi6 Δ strains showed that while Swi4 is not
required for maintaining AGC, swi6 is partially required for maintaining AGC. Since the
phenotype observed is partial, swi6 might require another component for it to be fully
functional. Studying the protein-protein interactions between Swi6 and various other
transcription factors could help understand the partial phenotype.
What is the role of histone modifying enzymes on AGC?
While chromatin remodelers help in the eviction or sliding of nucleosomes thereby mediating
gene regulation, modified histones help regulate the stability of the nucleosomes. Earlier results
from the nucleosome scanning assay (performed by Jeffrey Arace) have shown that
transcriptional repression of MPP10-YJR003C is not associated with changes in nucleosome
positions. Based on these results, we wanted to test the effect of various histone
posttranslational modifications (PTM’s) on maintaining AGC. ChIP analysis for determining
the histone H2A.Z occupancy at the promoter, coding regions of MPP10, YJR003C has shown
that the promoter region of MPP10 has a higher relative H2A.Z occupancy in comparison to
the coding and promoter regions of MPP10 and YJR003C. This experiment was performed to
test for the efficiency of the ChIP procedure. Our results are consistent with that of published
66
data. Future studies should be focused on determining the relative occupancy of H2A.Z at the
promoter and coding regions of MPP10 and YJR003C under conditions of stress.
67
References
Albert, I., Mavrich, T.N., Tomsho, L.P., Qi, J., Zanton, S.J., Schuster, S.C., and Pugh, B.F.
(2007). Translational and rotational settings of H2A.Z nucleosomes across the
Saccharomyces cerevisiae genome. Nature 446, 572–576.
Armache, J.-P., Jarasch, A., Anger, A.M., Villa, E., Becker, T., Bhushan, S., Jossinet, F.,
Habeck, M., Dindar, G., Franckenberg, S., et al. (2010). Localization of eukaryote-specific
ribosomal proteins in a 5.5-? cryo-EM map of the 80S eukaryotic ribosome. Proc. Natl. Acad.
Sci. U. S. A. 107, 19754–19759.
Arnone, J.T., and McAlear, M.A. (2011a). Adjacent Gene Pairing Plays a Role in the
Coordinated Expression of Ribosome Biogenesis Genes MPP10 and YJR003C in
Saccharomyces cerevisiae. Eukaryot. Cell 10, 43–53.
Arnone, J.T., and McAlear, M.A. (2011b). Adjacent Gene Pairing Plays a Role in the
Coordinated Expression of Ribosome Biogenesis Genes MPP10 and YJR003C in
Saccharomyces cerevisiae. Eukaryot. Cell 10, 43–53.
Arnone, J.T., Robbins-Pianka, A., Arace, J.R., Kass-Gergi, S., and McAlear, M.A. (2012).
The adjacent positioning of co-regulated gene pairs is widely conserved across eukaryotes.
BMC Genomics 13, 546.
Baker, S.P., and Grant, P.A. (2007). The SAGA continues: expanding the cellular role of a
transcriptional co-activator complex. Oncogene 26, 5329–5340.
Berger, S.L. (2002). Histone modifications in transcriptional regulation. Curr. Opin. Genet.
Dev. 12, 142–148.
Bolker, J. (2012). Model organisms: There’s more to life than rats and flies. Nature 491, 31–
33.
Botstein, D., Chervitz, S.A., and Cherry, J.M. (1997). Yeast as a Model Organism. Science
277, 1259–1260.
Carey, M., Peterson, C.L., and Smale, S.T. (2009). Transcriptional regulation in eukaryotes.
Causton, H.C., Ren, B., Koh, S.S., Harbison, C.T., Kanin, E., Jennings, E.G., Lee, T.I., True,
H.L., Lander, E.S., and Young, R.A. (2001). Remodeling of Yeast Genome Expression in
Response to Environmental Changes. Mol. Biol. Cell 12, 323–337.
Chen, K., and Rajewsky, N. (2007). The evolution of gene regulation by transcription factors
and microRNAs. Nat. Rev. Genet. 8, 93–103.
Chintapalli, V.R., Wang, J., and Dow, J.A.T. (2007). Using FlyAtlas to identify better
Drosophila melanogaster models of human disease. Nat. Genet. 39, 715–720.
Clapier, C.R., and Cairns, B.R. (2009). The Biology of Chromatin Remodeling Complexes.
Annu. Rev. Biochem. 78, 273–304.
68
Cormack, B.P., and Struhl, K. (1992). The TATA-binding protein is required for transcription
by all three nuclear RNA polymerases in yeast cells. Cell 69, 685–696.
Dragon, F., Gallagher, J.E.G., Compagnone-Post, P.A., Mitchell, B.M., Porwancher, K.A.,
Wehner, K.A., Wormsley, S., Settlage, R.E., Shabanowitz, J., Osheim, Y., et al. (2002). A
large nucleolar U3 ribonucleoprotein required for 18S ribosomal RNA biogenesis. Nature
417, 967–970.
Eberharter, A., and Becker, P.B. (2002). Histone acetylation: a switch between repressive and
permissive chromatin. EMBO Rep. 3, 224–229.
Eberharter, A., Sterner, D.E., Schieltz, D., Hassan, A., Yates, J.R., Berger, S.L., and
Workman, J.L. (1999). The ADA Complex Is a Distinct Histone Acetyltransferase Complex
in Saccharomyces cerevisiae. Mol. Cell. Biol. 19, 6621–6631.
Edwards, A.M., Darst, S.A., Feaver, W.J., Thompson, N.E., Burgess, R.R., and Kornberg,
R.D. (1990). Purification and lipid-layer crystallization of yeast RNA polymerase II. Proc.
Natl. Acad. Sci. U. S. A. 87, 2122–2126.
Fan, H.-Y., Cheng, K.K., and Klein, H.L. (1996). Mutations in the RNA Polymerase II
Transcription Machinery Suppress the Hyperrecombination Mutant hpr1 Δ of Saccharomyces
cerevisiae. Genetics 142, 749–759.
Fatica, A., and Tollervey, D. (2002). Making ribosomes. Curr. Opin. Cell Biol. 14, 313–318.
Felsenfeld, G., and Groudine, M. (2003). Controlling the double helix. Nature 421, 448–453.
Fontana, L., Partridge, L., and Longo, V.D. (2010). Extending Healthy Life Span—From
Yeast to Humans. Science 328, 321–326.
Gasch, A.P., and Werner-Washburne, M. (2002). The genomics of yeast responses to
environmental stress and starvation. Funct. Integr. Genomics 2, 181–192.
Gershon, H., and Gershon, D. (2000). The budding yeast, Saccharomyces cerevisiae, as a
model for aging research: a critical review. Mech. Ageing Dev. 120, 1–22.
Goetze, H., Wittner, M., Hamperl, S., Hondele, M., Merz, K., Stoeckl, U., and Griesenbeck,
J. (2010). Alternative Chromatin Structures of the 35S rRNA Genes in Saccharomyces
cerevisiae Provide a Molecular Basis for the Selective Recruitment of RNA Polymerases I
and II. Mol. Cell. Biol. 30, 2028–2045.
Grandi, P., Rybin, V., Baßler, J., Petfalski, E., Strauß, D., Marzioch, M., Schäfer, T., Kuster,
B., Tschochner, H., Tollervey, D., et al. (2002). 90S Pre-Ribosomes Include the 35S PrerRNA, the U3 snoRNP, and 40S Subunit Processing Factors but Predominantly Lack 60S
Synthesis Factors. Mol. Cell 10, 105–115.
Granneman, S., and Baserga, S.J. (2004). Ribosome biogenesis: of knobs and RNA
processing. Exp. Cell Res. 296, 43–50.
69
Grant, P.A., Duggan, L., Côté, J., Roberts, S.M., Brownell, J.E., Candau, R., Ohba, R.,
Owen-Hughes, T., Allis, C.D., Winston, F., et al. (1997). Yeast Gcn5 functions in two
multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada
complex and the SAGA (Spt/Ada) complex. Genes Dev. 11, 1640–1650.
Grant, P.A., Schieltz, D., Pray-Grant, M.G., Yates III, J.R., and Workman, J.L. (1998a). The
ATM-Related Cofactor Tra1 Is a Component of the Purified SAGA Complex. Mol. Cell 2,
863–867.
Grant, P.A., Schieltz, D., Pray-Grant, M.G., Steger, D.J., Reese, J.C., Yates III, J.R., and
Workman, J.L. (1998b). A Subset of TAFIIs Are Integral Components of the SAGA
Complex Required for Nucleosome Acetylation and Transcriptional Stimulation. Cell 94, 45–
53.
Grant, P.A., Schieltz, D., Pray-Grant, M.G., Yates III, J.R., and Workman, J.L. (1998c). The
ATM-Related Cofactor Tra1 Is a Component of the Purified SAGA Complex. Mol. Cell 2,
863–867.
Hacker, J., and Blum-Oehler, G. (2007). In appreciation of Theodor Escherich. Nat. Rev.
Microbiol. 5, 902–902.
Hahn, S. (2004). Structure and mechanism of the RNA Polymerase II transcription
machinery. Nat. Struct. Mol. Biol. 11, 394–403.
Hallett, J.E.H., Luo, X., and Capaldi, A.P. (2014). State Transitions in the TORC1 Signaling
Pathway and Information Processing in Saccharomyces cerevisiae. Genetics
genetics.114.168369.
Hampsey, M. (1998). Molecular Genetics of the RNA Polymerase II General Transcriptional
Machinery. Microbiol. Mol. Biol. Rev. 62, 465–503.
Harbison, C.T., Gordon, D.B., Lee, T.I., Rinaldi, N.J., Macisaac, K.D., Danford, T.W.,
Hannett, N.M., Tagne, J.-B., Reynolds, D.B., Yoo, J., et al. (2004). Transcriptional regulatory
code of a eukaryotic genome. Nature 431, 99–104.
Hargreaves, D.C., and Crabtree, G.R. (2011). ATP-dependent chromatin remodeling:
genetics, genomics and mechanisms. Cell Res. 21, 396–420.
Henras, A.K., Soudet, J., Gérus, M., Lebaron, S., Caizergues-Ferrer, M., Mougin, A., and
Henry, Y. (2008). The post-transcriptional steps of eukaryotic ribosome biogenesis. Cell.
Mol. Life Sci. 65, 2334–2359.
Van Holde, K.E., and Isenberg, I. (1975). Histone interactions and chromatin structure. Acc.
Chem. Res. 8, 327–335.
Jansen, A., and Verstrepen, K.J. (2011). Nucleosome Positioning in Saccharomyces
cerevisiae. Microbiol. Mol. Biol. Rev. 75, 301–320.
70
Johnson, P.F., and McKnight, S.L. (1989). Eukaryotic Transcriptional Regulatory Proteins.
Annu. Rev. Biochem. 58, 799–839.
Jones, N.C., Rigby, P.W., and Ziff, E.B. (1988). Trans-acting protein factors and the
regulation of eukaryotic transcription: lessons from studies on DNA tumor viruses. Genes
Dev. 2, 267–281.
Jorgensen, P., Nishikawa, J.L., Breitkreutz, B.-J., and Tyers, M. (2002). Systematic
Identification of Pathways That Couple Cell Growth and Division in Yeast. Science 297,
395–400.
Kadonaga, J.T. (1998). Eukaryotic transcription: an interlaced network of transcription
factors and chromatin-modifying machines. Cell 92, 307–313.
Keseler, I.M., Collado-Vides, J., Gama-Castro, S., Ingraham, J., Paley, S., Paulsen, I.T.,
Peralta-Gil, M., and Karp, P.D. (2005). EcoCyc: a comprehensive database resource for
Escherichia coli. Nucleic Acids Res. 33, D334–D337.
Krogan, N.J., Peng, W.-T., Cagney, G., Robinson, M.D., Haw, R., Zhong, G., Guo, X.,
Zhang, X., Canadien, V., Richards, D.P., et al. (2004). High-Definition Macromolecular
Composition of Yeast RNA-Processing Complexes. Mol. Cell 13, 225–239.
Larschan, E., and Winston, F. (2001). The S. cerevisiae SAGA complex functions in vivo as
a coactivator for transcriptional activation by Gal4. Genes Dev. 15, 1946–1956.
Larson, D.E., Zahradka, P., and Sells, B.H. (1991). Control points in eucaryotic ribosome
biogenesis. Biochem. Cell Biol. 69, 5–22.
Lee, W., Tillo, D., Bray, N., Morse, R.H., Davis, R.W., Hughes, T.R., and Nislow, C. (2007).
A high-resolution atlas of nucleosome occupancy in yeast. Nat. Genet. 39, 1235–1244.
Li, Z., Lee, I., Moradi, E., Hung, N.-J., Johnson, A.W., and Marcotte, E.M. (2009). Rational
Extension of the Ribosome Biogenesis Pathway Using Network-Guided Genetics. PLoS Biol
7, e1000213.
Lippman, S.I., and Broach, J.R. (2009). Protein kinase A and TORC1 activate genes for
ribosomal biogenesis by inactivating repressors encoded by Dot6 and its homolog Tod6.
Proc. Natl. Acad. Sci. 106, 19928–19933.
Martin, D.E., and Hall, M.N. (2005). The expanding TOR signaling network. Curr. Opin.
Cell Biol. 17, 158–166.
Martin, D.E., Soulard, A., and Hall, M.N. (2004). TOR Regulates Ribosomal Protein Gene
Expression via PKA and the Forkhead Transcription Factor FHL1. Cell 119, 969–979.
Martin, D.E., Powers, T., and Hall, M.N. (2006a). Regulation of ribosome biogenesis: Where
is TOR? Cell Metab. 4, 259–260.
71
Martin, D.E., Powers, T., and Hall, M.N. (2006b). Regulation of ribosome biogenesis: Where
is TOR? Cell Metab. 4, 259–260.
McGary, K.L., Park, T.J., Woods, J.O., Cha, H.J., Wallingford, J.B., and Marcotte, E.M.
(2010). Systematic discovery of nonobvious human disease models through orthologous
phenotypes. Proc. Natl. Acad. Sci. 107, 6544–6549.
Michels, A.A. (2011). MAF1: a new target of mTORC1. Biochem. Soc. Trans. 39, 487–491.
Moazed, D. (2011). Mechanisms for the Inheritance of Chromatin States. Cell 146, 510–518.
Müller, B., and Grossniklaus, U. (2010). Model organisms — A historical perspective. J.
Proteomics 73, 2054–2063.
Nissan, T.A., Baßler, J., Petfalski, E., Tollervey, D., and Hurt, E. (2002). 60S pre-ribosome
formation viewed from assembly in the nucleolus until export to the cytoplasm. EMBO J. 21,
5539–5547.
Parnell, T.J., Huff, J.T., and Cairns, B.R. (2008). RSC regulates nucleosome positioning at
Pol II genes and density at Pol III genes. EMBO J. 27, 100–110.
Peterson, C.L., and Laniel, M.-A. (2004). Histones and histone modifications. Curr. Biol. 14,
R546–R551.
Phelan, M.L., Sif, S., Narlikar, G.J., and Kingston, R.E. (1999). Reconstitution of a Core
Chromatin Remodeling Complex from SWI/SNF Subunits. Mol. Cell 3, 247–253.
Pokholok, D.K., Harbison, C.T., Levine, S., Cole, M., Hannett, N.M., Lee, T.I., Bell, G.W.,
Walker, K., Rolfe, P.A., Herbolsheimer, E., et al. (2005). Genome-wide Map of Nucleosome
Acetylation and Methylation in Yeast. Cell 122, 517–527.
Ranjan, A., Mizuguchi, G., FitzGerald, P.C., Wei, D., Wang, F., Huang, Y., Luk, E.,
Woodcock, C.L., and Wu, C. (2013). Nucleosome free region dominates histone acetylation
in targeting SWR1 to yeast promoters for H2A.Z replacement. Cell 154.
Reid, R.J.D., Benedetti, P., and Bjornsti, M.-A. (1998). Yeast as a model organism for
studying the actions of DNA topoisomerase-targeted drugs. Biochim. Biophys. Acta BBA Gene Struct. Expr. 1400, 289–300.
Resnick, M.A., and Cox, B.S. (2000). Yeast as an honorary mammal. Mutat. Res. 451, 1–11.
Rhee, H.S., and Pugh, B.F. (2012). Genome-wide structure and organization of eukaryotic
pre-initiation complexes. Nature 483, 295–301.
Roberts, S.M., and Winston, F. (1996). SPT20/ADA5 encodes a novel protein functionally
related to the TATA-binding protein and important for transcription in Saccharomyces
cerevisiae. Mol. Cell. Biol. 16, 3206–3213.
72
Roeder, R.G. (1991). The complexities of eukaryotic transcription initiation: regulation of
preinitiation complex assembly. Trends Biochem. Sci. 16, 402–408.
Roeder, R.G. (2003). The eukaryotic transcriptional machinery: complexities and
mechanisms unforeseen. Nat. Med. 9, 1239–1244.
Rudra, D., and Warner, J.R. (2004). What better measure than ribosome synthesis? Genes
Dev. 18, 2431–2436.
Schmelzle, T., Beck, T., Martin, D.E., and Hall, M.N. (2004). Activation of the RAS/Cyclic
AMP Pathway Suppresses a TOR Deficiency in Yeast. Mol. Cell. Biol. 24, 338–351.
Schneper, L., Düvel, K., and Broach, J.R. (2004). Sense and sensibility: nutritional response
and signal integration in yeast. Curr. Opin. Microbiol. 7, 624–630.
Schwabish, M.A., and Struhl, K. (2004). Evidence for Eviction and Rapid Deposition of
Histones upon Transcriptional Elongation by RNA Polymerase II. Mol. Cell. Biol. 24,
10111–10117.
Segal, E., Fondufe-Mittendorf, Y., Chen, L., Thåström, A., Field, Y., Moore, I.K., Wang, J.P.Z., and Widom, J. (2006). A genomic code for nucleosome positioning. Nature 442, 772–
778.
Shivaswamy, S., and Iyer, V.R. (2008). Stress-Dependent Dynamics of Global Chromatin
Remodeling in Yeast: Dual Role for SWI/SNF in the Heat Shock Stress Response. Mol. Cell.
Biol. 28, 2221–2234.
Shukla, A., Bajwa, P., and Bhaumik, S.R. (2006). SAGA-associated Sgf73p facilitates
formation of the preinitiation complex assembly at the promoters either in a HAT-dependent
or independent manner in vivo. Nucleic Acids Res. 34, 6225–6232.
Smith, C.L., and Peterson, C.L. (2004). ATP-Dependent Chromatin Remodeling. In Current
Topics in Developmental Biology, (Academic Press), pp. 115–148.
Sterner, D.E., Grant, P.A., Roberts, S.M., Duggan, L.J., Belotserkovskaya, R., Pacella, L.A.,
Winston, F., Workman, J.L., and Berger, S.L. (1999a). Functional Organization of the Yeast
SAGA Complex: Distinct Components Involved in Structural Integrity, Nucleosome
Acetylation, and TATA-Binding Protein Interaction. Mol. Cell. Biol. 19, 86–98.
Sterner, D.E., Grant, P.A., Roberts, S.M., Duggan, L.J., Belotserkovskaya, R., Pacella, L.A.,
Winston, F., Workman, J.L., and Berger, S.L. (1999b). Functional Organization of the Yeast
SAGA Complex: Distinct Components Involved in Structural Integrity, Nucleosome
Acetylation, and TATA-Binding Protein Interaction. Mol. Cell. Biol. 19, 86–98.
Sterner, D.E., Belotserkovskaya, R., and Berger, S.L. (2002). SALSA, a variant of yeast
SAGA, contains truncated Spt7, which correlates with activated transcription. Proc. Natl.
Acad. Sci. 99, 11622–11627.
Strachan, T., and Read, A.P. (1999). Human Molecular Genetics (New York: Wiley-Liss).
73
Strahl, B.D., and Allis, C.D. (2000). The language of covalent histone modifications. Nature
403, 41–45.
Struhl, K. (1998). Histone acetylation and transcriptional regulatory mechanisms. Genes Dev.
12, 599–606.
Struhl, K. (1999). Fundamentally different logic of gene regulation in eukaryotes and
prokaryotes. Cell 98, 1–4.
Sun, Z.-W., and Allis, C.D. (2002). Ubiquitination of histone H2B regulates H3 methylation
and gene silencing in yeast. Nature 418, 104–108.
Sweetser, D., Nonet, M., and Young, R.A. (1987). Prokaryotic and eukaryotic RNA
polymerases have homologous core subunits. Proc. Natl. Acad. Sci. 84, 1192–1196.
Timmers, H.T.M., and Tora, L. (2005). SAGA unveiled. Trends Biochem. Sci. 30, 7–10.
Tschochner, H., and Hurt, E. (2003). Pre-ribosomes on the road from the nucleolus to the
cytoplasm. Trends Cell Biol. 13, 255–263.
Urnov, F.Dw., Alan P (2001). Chromatin remodeling and transcriptional activation: the cast
(in order of appearance). Oncogene 20, 2991.
Verna, J., Lodder, A., Lee, K., Vagts, A., and Ballester, R. (1997). A family of genes required
for maintenance of cell wall integrity and for the stress response in Saccharomyces
cerevisiae. Proc. Natl. Acad. Sci. 94, 13804–13809.
De Virgilio, C., and Loewith, R. (2006). Cell growth control: little eukaryotes make big
contributions. Oncogene 25, 6392–6415.
Wade, C., Shea, K.A., Jensen, R.V., and McAlear, M.A. (2001). EBP2 Is a Member of the
Yeast RRB Regulon, a Transcriptionally Coregulated Set of Genes That Are Required for
Ribosome and rRNA Biosynthesis. Mol. Cell. Biol. 21, 8638–8650.
Wade, C.H., Umbarger, M.A., and McAlear, M.A. (2006). The budding yeast rRNA and
ribosome biosynthesis (RRB) regulon contains over 200 genes. Yeast 23, 293–306.
Wang, L., Liu, L., and Berger, S.L. (1998). Critical residues for histone acetylation by Gcn5,
functioning in Ada and SAGA complexes, are also required for transcriptional function in
vivo. Genes Dev. 12, 640–653.
Warner, J.R. (1999). The economics of ribosome biosynthesis in yeast. Trends Biochem. Sci.
24, 437–440.
Wei, Y., Tsang, C.K., and Zheng, X.F.S. (2009). Mechanisms of regulation of RNA
polymerase III-dependent transcription by TORC1. EMBO J. 28, 2220–2230.
Weigel, D., and Jäckle, H. (1990). The< i> fork head</i> domain: A novel DNA binding
motif of eukaryotic transcription factors? Cell 63, 455–456.
74
Wolffe, A. (1998). Chromatin: Structure and Function (Academic Press).
Wood, R.D., Mitchell, M., Sgouros, J., and Lindahl, T. (2001). Human DNA Repair Genes.
Science 291, 1284–1289.
Wray, G.A., Hahn, M.W., Abouheif, E., Balhoff, J.P., Pizer, M., Rockman, M.V., and
Romano, L.A. (2003). The Evolution of Transcriptional Regulation in Eukaryotes. Mol. Biol.
Evol. 20, 1377–1419.
Wu, P.-Y.J., Ruhlmann, C., Winston, F., and Schultz, P. (2004). Molecular Architecture of
the S. cerevisiae SAGA Complex. Mol. Cell 15, 199–208.
Wullschleger, S., Loewith, R., and Hall, M.N. (2006). TOR Signaling in Growth and
Metabolism. Cell 124, 471–484.
Xue, Y., Wong, J., Moreno, G.T., Young, M.K., Côté, J., and Wang, W. (1998). NURD, a
Novel Complex with Both ATP-Dependent Chromatin-Remodeling and Histone Deacetylase
Activities. Mol. Cell 2, 851–861.
Young, R.A., and Davis, R.W. (1983). Yeast RNA polymerase II genes: isolation with
antibody probes. Science 222, 778–782.
Yu, Y., Eriksson, P., and Stillman, D.J. (2000). Architectural Transcription Factors and the
SAGA Complex Function in Parallel Pathways To Activate Transcription. Mol. Cell. Biol.
20, 2350–2357.
Zaragoza, D., Ghavidel, A., Heitman, J., and Schultz, M.C. (1998). Rapamycin Induces the
G0 Program of Transcriptional Repression in Yeast by Interfering with the TOR Signaling
Pathway. Mol. Cell. Biol. 18, 4463–4470.
Zawel, L., and Reinberg, D. (1995). Common Themes in Assembly and Function of
Eukaryotic Transcription Complexes. Annu. Rev. Biochem. 64, 533–561.
Zeyl, C. (2000). Budding yeast as a model organism for population genetics. Yeast 16, 773–
784.
Zhang, A., Shen, Y., Gao, W., and Dong, J. (2011). Role of Sch9 in regulating Ras-cAMP
signal pathway in Saccharomyces cerevisiae. FEBS Lett. 585, 3026–3032.
75