ECO-PHYSIOLOGICAL CONSEQUENCES OF
DIETARY POLYUNSATURATED FATTY ACIDS
FOR HOST-PARASITE INTERACTIONS
Dissertation submitted for the degree of Doctor of Natural Sciences
Presented by
NINA SCHLOTZ
at the
Faculty of Biology
Limnological Institute
Date of oral examination: June 13, 2014
First referee: Prof. Dr. Karl-Otto Rothhaupt
Second referee: Prof. Dr. Dieter Ebert
Third referee: Prof. Dr. Bernhard Schink
Konstanzer Online-Publikations-System (KOPS)
URL: http://nbn-resolving.de/urn:nbn:de:bsz:352-0-263874
SUPERVISED BY
PD Dr. Dominik Martin-Creuzburg
EXAMINED BY
Prof. Dr. Karl-Otto Rothhaupt
Prof. Dr. Dieter Ebert
Prof. Dr. Bernhard Schink
FINANCIALLY SUPPORTED BY
the German Research Foundation (DFG, MA 5005/1-1)
TABLE OF CONTENTS
1
General introduction
7
2
The potential of dietary polyunsaturated fatty acids to modulate
eicosanoid synthesis and reproduction in Daphnia magna: a gene
expression approach
13
Introduction
14
Material and methods
16
Results
19
Discussion
22
Dietary supply with polyunsaturated fatty acids and resulting
maternal effects influence host-parasite interactions
27
Background
28
Results
30
Discussion
35
Conclusions
38
Material and methods
39
3
4
5
A dietary polyunsaturated fatty acid improves consumer performance
during challenge with an opportunistic bacterial pathogen
43
Introduction
44
Material and methods
46
Results
49
Discussion
54
Supplementary Information
60
Effects of dietary polyunsaturated fatty acids and parasite-exposure
on eicosanoid-related gene expression
63
Introduction
64
Material and methods
66
Results and discussion
70
Conclusion
78
5
TABLE OF CONTENTS
6
7
Assessing host-parasite resource competition using nutrient-limited
growth responses
80
Introduction
81
Material and methods
83
Results and discussion
85
Concluding remarks and perspectives
88
Abstract
95
Zusammenfassung
97
Cited literature
99
Record of achievement / Abgrenzung der Eigenleistung
116
Acknowledgement
117
Curriculum Vitae
118
List of publications
119
6
1
GENERAL INTRODUCTION
The concept of food quality and implications for consumer fitness
Reminders that the composition of our food is important are omnipresent in our society:
children are taught to eat their vegetables, ‘functional foods’ found their way into our
supermarkets (Shahidi 2004, Siro et al. 2008). The concept of food quality – saying that not
every unit of food which is equal regarding its energy is of the same nutritional value – is
important for animals in natural populations as well. However, even when they experience
food quantities above subsistence values in terms of energy, they often have to cope with a
lack of choice between diets of differing quality (due to the absence of suitable food or the
consumers’ inability to actively choose). Thus, dietary restrictions by essential nutrients apart
from carbon are frequent (Sterner and Schulz 1998).
Elemental (e.g. nitrogen or phosphorus) and biochemical (e.g. essential lipids, amino acids,
vitamins) components are major factors determining the nutritional value of the diet. Many of
the mentioned biochemicals cannot be synthesized de novo from low molecular precursors by
animals (or only at a very low rate) and thus must be acquired with the diet. The essentiality
of these biochemicals can have severe consequences for development, growth and
reproduction of the consumer if not available in sufficient amounts to meet the physiological
demands. A limited availability of essential nutrients can also result in physiological tradeoffs, i.e. nutrient allocation between two or more functions competing for the same resources
within a single individual might occur; giving more resource to one trait implies that less will
be allocated to the other (Stearns 1992). The trade-off between reproduction and immunity is
among the most intensively studied ones (Zuk and Stoehr 2002, Harshman and Zera 2007).
Furthermore, food quality effects might not only affect the consumer directly, but are possibly
conveyed to the next generation via maternal effects (Mousseau and Dingle 1991, Bernardo
1996). A class of essential lipids, the polyunsaturated fatty acids (PUFAs), received great
attention within food quality research due to their manifold functions in animal physiology.
7
GENERAL INTRODUCTION
The role of polyunsaturated fatty acids in nutritional and physiological ecology
PUFAs are fatty acids that contain two or more double bonds within their carbon chain and
can be categorized according to the position of the first double bond proximate to the methyl
end (Fig. 1). Accordingly, PUFAs can be classified into two major groups, the n-6 (ω6) and
n-3 (ω3) families. In general, five PUFAs falling in those categories are considered to be
essential: linoleic acid (LIN, 18:2n-6), arachidonic acid (ARA, 20:4n-6), α-linolenic acid
(ALA, 18:3n-3), eicosapentaenoic acid (EPA, 20:5n-3), and docosahexaenoic acid (DHA,
22:6n-3); these cannot be synthesized by most animals. ARA, EPA, and DHA have been
termed ‘conditionally dispensable’ (Cunnane 2000) because there are animals that can further
desaturate and elongate dietary precursor PUFAs (e.g. LIN to ARA or ALA to EPA) or
reconvert PUFAs with longer carbon chains (e.g. DHA to EPA) to form these PUFAs.
Figure 1 Schematic view of a fatty acid with the backbone of 20 carbon atoms (black), the carboxy
end (green) and the methyl end (blue). Arrows indicate the position of the first double bond counted
from the methyl end for n-6 or n-3 PUFAs (red).
PUFAs are important structural components of cell membranes that confer fluidity and
permeability and are important for temperature acclimation (Clandinin et al. 1991, Guschina
and Harwood 2006, van Meer et al. 2008). They also serve as precursors for eicosanoids (see
below) and therefore have profound effects on various physiological processes.
The importance of PUFAs for normal development of both vertebrates and invertebrates has
been discovered decades ago (Burr and Burr 1930, Fraenkel and Blewett 1947), and for a long
time the interest in PUFA nutrition was a purely physiological one. The same is true for the
metabolites of the three PUFAs ARA, EPA, and dihomo-γ-linoleic acid (DGLA, 20:3n-6), a
group of signalling molecules called eicosanoids. Since the original investigations of their
action in human physiology (e.g. von Euler 1936, Bergstrom and Samuelsson 1962) countless
studies have revealed the significance of PUFAs and eicosanoids first and foremost in
vertebrate pathophysiology and immunity (Calder 1998, de Pablo and de Cienfuegos 2000,
8
GENERAL INTRODUCTION
James et al. 2000, Funk 2001, Fritsche 2006, Calder 2007). Although having lagged behind,
today their role in invertebrates is appreciated as well (Stanley 2000, Stanley 2010).
Interestingly, research on the nutritional ecology related to C20 PUFAs and their metabolites
has been slow to follow. After initial studies revealing strong correlations between somatic
growth and dietary concentrations of EPA (Müller-Navarra 1995, Wacker and Von Elert
2001) numerous studies on C20 PUFA-mediated food quality ensued. Due to the fact that
terrestrial plants produce mainly C18 PUFAs while C20 PUFAs are in their majority of
aquatic origin (Tocher et al. 1998, Gladyshev et al. 2009), the literature on the ecological
relevance of C20 PUFAs focuses on marine and freshwater model systems. Of those, only a
few were able to unequivocally link fitness consequences to the dietary availability of C20
PUFAs by performing supplementation experiments (von Elert 2002, Becker and Boersma
2003, Martin-Creuzburg et al. 2009, Martin-Creuzburg et al. 2010, Martin-Creuzburg et al.
2012). All these studies focused on life history parameters. Underlying physiological
mechanisms have only been assumed. In chapter 2, I show that changes in reproductive output
related to differences in C20 PUFA nutrition can be followed on the gene expression level and
provide first evidence that the expression of genes coding for enzymes involved in eicosanoid
production are responsive to the dietary availability of these PUFAs. This study suggests that
the beneficial effects of dietary ARA and EPA are at least partially mediated via the
eicosanoid pathway.
The fitness increase owing to dietary C20 PUFAs reported by the nutritional studies and the
fact that eicosanoids as C20 PUFA metabolites have been shown to act in reproduction and
immunity of vertebrates and invertebrates led to the questions underlying the thesis at hand:
does the role of PUFA-mediated food quality in nutritional ecology of herbivorous consumers
extend to pathophysiological conditions? If so, are the effects related to the action of
eicosanoids?
No organism stands completely on its own but instead it provides the environment for
microorganisms living on or inside the body and is constantly threatened by invading
pathogens and parasites. The commensal microbiota in the gut is highly exposed to
environmental influences and probably provides nutrients for the host themselves; pathogens
and parasites depend on the nutrient supply provided by the host. Consequently, all of them
are potentially affected by the host’s nutrition (Garber 1960, Smith 2007) and the nutritional
state of the host – together with environmental factors and genetic predisposition – can
influence the resistance of animals to infections (Fig. 2; Schmid-Hempel 2011).
9
GENERAL INTRODUCTION
Figure 2 Relationship between host nutrition, immunity, parasites, gut microbiota, and host fitness
(modified from Ponton et al. 2011b).
The Daphnia-microorganism model systems and their suitability for this work
Species of the genus Daphnia have been used as models in ecological and evolutionary
research for decades: to elucidate their role as keystone species in freshwater food webs, to
study phenomena like phenotypic plasticity or diel vertical migration; in resurrection ecology,
parasitology and ecotoxicology; the first crustacean genome sequenced is that of Daphnia
pulex (Colbourne et al. 2011) officially turning D. pulex in a model species for biomedical
research and foreshadowing a great “genomic future” for this model system (Ebert 2011,
Lampert 2011).
For the research presented in this thesis two facts about Daphnia were especially intriguing:
(1) The role of C20 PUFAs in the nutritional ecology of herbivorous consumers is most
profoundly investigated in Daphnia species and diet manipulation is well-established (von
Elert 2002, Becker and Boersma 2003, Martin-Creuzburg et al. 2009, Martin-Creuzburg et al.
2010, Martin-Creuzburg et al. 2012). (2) Daphnia can harbour a multitude of symbionts and
parasites (Green 1974, Qi et al. 2009, Freese and Schink 2011), some of which are welldescribed and frequently used to investigate the evolution, genetics and ecology of hostparasite interactions in laboratory experiments (Ebert 2005). Taken together this gave the
opportunity to test our hypothesis that the dietary availability of C20 PUFAs can affect the
10
GENERAL INTRODUCTION
performance of the consumer under pathogen-challenge and influence host-parasite
interactions. Predominantly, host-parasite-food interactions have been investigated in relation
to food quantity (Bedhomme et al. 2004, Krist et al. 2004, Pulkkinen and Ebert 2004, Sadd
2011) and only a limited number of studies suggests that food quality is equally potent in
modulating the outcome of infections (Frost et al. 2008, Hall et al. 2009).
When investigating PUFAs, which evidentially greatly influence reproduction of our focal
host, employing a parasite that specifically targets reproduction is compelling. Pasteuria
ramosa is one such parasite. The bacterium proliferates in the hemolymph of its host,
castrates it in the course of infection, and induces gigantism (Ebert et al. 1996; Fig. 3).
Figure 3 Comparison of healthy and P. ramosa-infected D. magna (ca. 30 days post infection). Left:
uninfected female; the brood chamber holds developing neonates. Right: heavily infected female; the
brood chamber is empty, reddish colour, in comparison larger body size (gigantism); the hemolymph
is filled with P. ramosa spores, hence the opaque appearance.
11
GENERAL INTRODUCTION
Chapter 3 is devoted to the consequences of an infection with P. ramosa under different food
regimes and highlights the significance of maternal effects mediated by dietary ARA and EPA
for healthy and infected hosts. In chapter 4, I investigated changes in the survival and life
history of D. magna challenged by an opportunistic pathogen (Pseudomonas sp.) using a
newly established oral infection model. This Pseudomonas strain was isolated from the gut of
D. magna and thus is a member of the natural microbiota whose natural balance was disturbed
by the experimental procedure. Observed effects on host fitness were clearly related to the
dietary availability of C20 PUFAs, in particular ARA.
The greatest challenge in trying to relate dietary PUFA consumption to eicosanoid action is to
measure changes in eicosanoid production. Direct measurement of these compounds is timeconsuming and cost-intensive and is carried out by only a few specialized groups. Here, a first
approach to estimating eicosanoid biosynthesis dynamics in relation to precursor intake was
to assess the expression of genes coding for key enzymes in the eicosanoid biosynthesis
machinery. In chapter 5, a gene expression study was carried out to elucidate time-dependent
responses of the eicosanoid biosynthesis to different diets in healthy and parasite-exposed
hosts. Concomitantly, genes involved in oogenesis were assessed to evaluate their suitability
as indicators for reproductive success and possibly reveal a connection to eicosanoid action.
The final chapter 6 brings a basic assumption of many studies on the role of nutrition in hostparasite interactions into focus which says that host and parasite compete for resources
acquired by the host. However, currently there are no methods available to conclusively
measure this competition which should lead to an increased demand of the host for energy in
general or for certain nutrients in particular. I used nutrient-limited growth responses to
compare PUFA requirements of healthy and infected hosts using the D. magnaHamiltosporidium tvaerminnensis system. H. tvaerminnensis is a microsporidium that is
vertically transmitted and resides in ovaries and fat cells of its host (Jirovec 1936, Vizoso et
al. 2005) making the proposition that PUFAs are possible key nutrients in this host-parasite
interaction very likely.
12
2
THE POTENTIAL OF DIETARY POLYUNSATURATED FATTY ACIDS
TO MODULATE EICOSANOID SYNTHESIS AND REPRODUCTION IN
DAPHNIA MAGNA: A GENE EXPRESSION APPROACH
Nina Schlotz, Jesper Givskov Sørensen, and Dominik Martin-Creuzburg
Published in Comparative Biochemistry and Physiology - Part A, 2012
ABSTRACT — Nutritional ecology of the aquatic model genus Daphnia has received much
attention in past years in particular with regard to dietary polyunsaturated fatty acids (PUFAs)
which are crucial for growth and reproduction. Besides their significant role as membrane
components, C20 PUFAs serve as precursors for eicosanoids, hormone-like mediators of
reproduction, immunity and ion transport physiology. In the present study we investigate
transcriptomic changes in Daphnia magna in response to different algal food organisms
substantially differing in their PUFA composition using quantitative real-time PCR and relate
them to concomitantly documented life history data. The selection of target genes includes
representatives that have previously been shown to be responsive to the eicosanoid
biosynthesis inhibitor ibuprofen. The beneficial effect of C20 PUFA-rich food on
reproduction and population growth rates was accompanied by an increased vitellogenin
(DmagVtg1) gene expression in D. magna. Additionally, genes involved in eicosanoid
signaling were particularly influenced by dietary C20 PUFA availability. For example, the
cyclooxygenase gene (Cox), coding for a central enzyme in the eicosanoid pathway, was
highly responsive to the food treatments. Our results suggest that dietary PUFAs are
fundamental in Daphnia physiology as substrate for eicosanoid synthesis and that these
eicosanoids are important for Daphnia reproduction.
KEYWORDS — Arachidonic acid, Daphnia magna, eicosanoids, eicosapentaenoic acid, food
quality, gene expression, nutrition, vitellogenin
13
CHAPTER 2
INTRODUCTION
Species of the genus Daphnia have become important model organisms in ecology,
ecotoxicology and evolutionary biology (Ebert 2005, Lampert 2011). As keystone herbivores
in freshwater food webs they provide a crucial link between primary and secondary
production. Owing to the long history of ecological research, our knowledge of e.g. life
history traits or phenotypic plasticity is vast compared to many other model organisms. With
the fully sequenced genome of Daphnia pulex another major advantage was given to Daphnia
as a model (Colbourne et al. 2011, Ebert 2011). However, our understanding of the
physiological mechanisms involved in coping with environmental stress situations (e.g.
temperature changes, predation, pathogen challenge, or nutrient limitations) is still scarce.
One of the factors greatly influencing Daphnia’s performance is nutrition. Besides the
obvious need to obtain enough food, i.e. the role of food quantity (Pietrzak et al. 2010), it also
proved to be crucial to consume food of good quality in order to meet the requirements for
optimal growth and reproduction. Even food organisms that are non-toxic and readily
assimilated can be of poor quality (Lampert 1977), one reason being the lack of essential
elemental or biochemical nutrients, which impairs the fitness of the consumer. Among the
elements, phosphorus (P) and nitrogen (N) are by far the best studied representatives (Sterner
and Elser 2002). Among biochemical food quality constraints are, for example, essential
lipids and amino acids. Amino acids have been reported recently to affect population growth
and the reproductive mode of daphnids (Koch et al. 2011). As yet, however, the majority of
studies on biochemical food quality constraints have focused on polyunsaturated fatty acids
(PUFAs) and sterols (Müller-Navarra et al. 2000, von Elert 2002, Martin-Creuzburg et al.
2009). The main sterol in animals is cholesterol. It is an integral part of membranes where it
influences fluidity and permeability and thus plays a role in temperature acclimation
(Mouritsen and Zuckermann 2004). Furthermore, in arthropods, it serves as precursor for
moulting hormones, the ecdysteroids (Mykles 2011). The lack of sterols has been proposed to
be a major constraint of energy transfer at the Daphnia-cyanobacteria interface (MartinCreuzburg et al. 2008) and has shown to be one reason for the poor food quality of
heterotrophic bacteria (Martin-Creuzburg et al. 2011a). The role of PUFAs has been
investigated using different approaches. Correlative field studies suggested limitations by
different PUFAs in the field (Müller-Navarra 1995, Müller-Navarra et al. 2000, Wacker and
Von Elert 2001) and results from laboratory growth experiments corroborate the importance
of PUFAs for Daphnia fitness by demonstrating for example a better performance under
temperature stress and revealing allocation patterns during PUFA deficiencies (Wacker and
14
CHAPTER 2
Martin-Creuzburg 2007, Masclaux et al. 2009, Martin-Creuzburg et al. 2012). However, there
is a lack of knowledge concerning the mechanisms underlying these beneficial effects as most
of the available research merely compares various fitness parameters as a function of the
dietary PUFA content.
PUFAs not only are indispensable components of membranes, where they alter membrane
properties and contribute to, e.g., temperature acclimation, three of them also are precursors
of a family of bioactive molecules, the eicosanoids (Stanley 2000, Guschina and Harwood
2006, van Meer et al. 2008). These three precursor PUFAs are dihomo-γ-linolenic acid
(DGLA, 20:3n-6), arachidonic acid (ARA, 20:4n-6), and eicosapentaenoic acid (EPA, 20:5n3). They can be metabolized by a cascade of enzymes to prostaglandins, leukotrienes, and
thromboxanes. In mammals, there are three distinct pathways leading to formation of
eicosanoids (Stanley 2000); bioinformatics data suggests that only two of these pathways are
present in Daphnia (Heckmann et al. 2008b). The genomic structure of the involved pathway
(“arachidonic acid pathway”, termed after the main substrate ARA) reveals significant
expansion and contraction of relevant gene families in Pancrustacea and the lineage leading to
D. pulex (Colbourne et al. 2011). This gain or loss of genes indicates evolutionary recent and
extensive restructuring of an important metabolic pathway.
Even though there are a considerable number of studies that argue for the importance of
PUFAs in invertebrate physiology, few are able to conclusively attribute the observed effects
to actions exerted by these essential lipids or their metabolites. In this first attempt to
elucidate mechanisms underlying the beneficial effects of dietary lipids on Daphnia growth
and reproduction, we adopted and modified the idea of Heckmann et al. (2008a) and related
life history parameters to gene expression. Yet, instead of applying a substance interfering
with the pathway of interest we provided food organisms of different lipid quality. Heckmann
et al. (2008a) used ibuprofen, one of the best-known non-steroidal anti-inflammatory drugs, to
find out if the mode of action of this eicosanoid biosynthesis inhibitor in D. magna is akin to
that in mammals. In mammals, ibuprofen works by inhibiting the enzyme cyclooxygenase
(COX) which comprises, together with lipoxygenase (LOX), the central part of the eicosanoid
synthesis pathway. The genes examined here are involved in lipid metabolism and the
immune and/or endocrine system, all of which might be affected by the availability of dietary
PUFAs; furthermore, most of them were responsive to ibuprofen in the study by Heckmann et
al. (2008a). By simultaneously investigating life history traits and gene expression responses
of D. magna we hope to gain first insights in how important pathways are influenced by
15
CHAPTER 2
PUFA-mediated food quality and to reveal new avenues that should be explored in future
studies.
MATERIAL AND METHODS
Food organisms
We chose three algae differing in their lipid profiles for the growth experiments: the green
alga Scenedesmus obliquus (SAG 276-3a), the eustigmatophyte Nannochloropsis limnetica
(SAG 18.99), and the cryptophyte Cryptomonas sp. (SAG 26.80). Algae were obtained from
the culture collection of the University of Göttingen (SAG, Germany). The algae were each
cultured semi-continuously in modified Woods Hole (WC) medium (Guillard 1975) in aerated
5 L vessels (20°C; dilution rate: 0.2 d-1; illumination: 100 mmol quanta m–2 s–1). Food
suspensions were produced by centrifugation of the harvested algae and resuspension in fresh
medium. Carbon concentrations were estimated from photometric light extinctions (480 nm)
and from previously determined carbon-extinction equations. The carbon – light extinction
regressions were confirmed by subsequent carbon analysis of the food suspensions.
Biochemical analyses — Fatty acids – For the analysis of fatty acids approximately 1 mg
particulate organic carbon (POC) was filtered separately onto precombusted GF/F filters
(Whatman, 25 mm). Total lipids were extracted three times from filters with
dichloromethane/methanol (2:1, v/v). Pooled cell-free extracts were evaporated to dryness
under a nitrogen stream. The lipid extracts were transesterified with 3 M methanolic HCl
(60°C, 20 min). Subsequently, fatty acid methyl esters (FAMEs) were extracted three times
with 2 ml of iso-hexane. The lipid-containing fraction was evaporated to dryness under
nitrogen and resuspended in a volume of 20 µl iso-hexane. Lipids were analyzed by gas
chromatography on a HP 6890 GC equipped with a flame ionization detector (FID) and a DB225 (J&W Scientific, 30 m × 0.25 mm ID × 0.25 mm film) capillary column to analyse
FAMEs. Details of GC configurations for the analysis of FAMEs are given elsewhere
(Martin-Creuzburg et al., 2010). FAMEs were quantified by comparison with the internal
standard (C23:0 ME) of known concentration, considering response factors determined
previously with lipid standards (Sigma-Aldrich). FAMEs were identified by their retention
times and their mass spectra, which were recorded with a gas chromatograph-mass
spectrometer (Agilent Technologies, 5975C) equipped with a fused-silica capillary column
(DB-225MS, J&W). Spectra were recorded between 50 and 600 dalton in the electron impact
ionization mode. The limit for quantitation of fatty acids was 20 ng. The absolute amount of
each lipid was related to the POC.
16
CHAPTER 2
Elemental composition – Aliquots of food suspensions were filtered onto precombusted glass
fibre filters (Whatman GF/F, 25 mm diameter) and analyzed for POC and nitrogen using an
EuroEA3000 elementar analyzer (HEKAtech GmbH, Wegberg, Germany). For the
determination of particulate phosphorus, aliquots were collected on acid-rinsed polysulphone
filters (HT-200; Pall, Ann Arbor, MI, USA) and digested with a solution of 10 per cent
potassium peroxodisulfate and 1.5 per cent sodium hydroxide for 60 min at 121°C. Soluble
reactive phosphorus was determined using the molybdate-ascorbic acid method (Greenberg et
al. 1985).
Experimental design
For all experiments the same clone of D. magna (HO2, originally isolated in Hungary) was
used. Stock cultures were cultivated in artificial medium (Aachener Daphnien Medium
(ADaM)), modified after Klüttgen et al. (1994) and fed with saturating amounts of S.
obliquus. All experiments were conducted with third-clutch neonates born within 12h at 20°C.
Life history experiment — Animals were kept individually in 80 ml ADaM. They were
randomly assigned to one of the three food regimes: S. obliquus (Scen), N. limnetica (Nanno),
and Cryptomonas sp. (Crypto). Every other day, they were transferred to fresh medium and
received algal food suspensions corresponding to 3 mg carbon per litre. During the
experiment mortality and reproduction were recorded.
Population growth rates were estimated from the Euler-Lotka equation 1 
n
l m e
x 0
x
 rx
x
where lx is the age-specific survivorship; mx is the age-specific fecundity (number of neonates
per individual); and x is the age at reproduction (in days).
Gene expression experiment — Simultaneously to the life history experiment we raised
animals for the gene expression study; treatments consisted of the same three algae S.
obliquus, N. limnetica, and Cryptomonas sp. Animals were raised in 1.5 L beakers each
containing 20 individuals. Cultivation, frequency of transfer and amounts of food were as
described for the life history experiment. After releasing their second clutch offspring
daphnids were sampled using a “cylindrical sieve system” (Heckmann et al. 2007) and stored
at -80°C in 400 µl RNAlater® (Ambion) for subsequent RNA extraction.
Gene expression analysis
RNA extraction and DNA synthesis — Total RNA was extracted using the RNeasyMini kit
with on-column DNase treatment (Qiagen) according to the manufacturer’s instructions. RNA
17
CHAPTER 2
concentrations were determined using a NanoDrop™ spectrophotometer (NanoDrop
Technologies). Agarose (1.5 %) gel electrophoresis was used to verify the quality of RNA.
cDNA was synthesized from 4 µg total RNA using the First Strand cDNA Synthesis Kit
(Fermentas) following the manufacturer’s instructions. Subsequently, cDNA was diluted 50fold to a concentration equivalent to 4 ng total RNA µl-1 and stored at -20°C.
Relative expression of mRNA — Analysis comprised eight genes: Cox (cycloxygenase), Gpx
(glutathione peroxidase), Clect (C-type lectin like), Ltb4dh (leukotriene B4 12hydroxydehydrogenase), DmagVtg1 (vitellogenin 1), Jhe (juvenile hormone esterase), Lip
(triacylglycerol lipase), Fabp3 (fatty acid binding protein 3). Primer sequences were taken
from Heckmann et al. (2008a) (additional data files 3, 8); primers were synthesized by
biomers.net (Ulm, Germany). Real-time quantitative polymerase chain reactions (qPCR) were
conducted on a Stratagene MX3005P (AH Diagnostics) using Stratagene Brilliant® II
SYBR® Green qPCR Mastermix (AH Diagnostics). Each reaction was run in duplicate and
contained 5 µl of cDNA template (equivalent to 20 ng total RNA) along with 900 nM primers
in a final volume of 15 µl. The amplification was performed under the following conditions:
95°C for 10 min to activate the DNA polymerase, then 40 cycles of 95°C for 10 s and 60°C
for 60 s. Melting curves were visually inspected to verify a single amplification product with
no primer-dimers. No inconsistencies were detected in the present data set.
Data analysis and statistics
Raw qPCR data were analyzed using Data Analysis for Real-Time PCR (DART-PCR)
(Peirson et al. 2003). The calculated reaction efficiencies verified the expected amplification
of around 2-fold for all genes. The few outliers detected were removed. The associated
melting curves were inspected to verify the presence of a single and specific amplicon. The
resulting data set was normalized by NORMA-Gene (Heckmann et al. 2011). Differences in
relative normalized expression of the target genes among treatments were assessed using oneway analysis of variance (ANOVA) if assumptions of normality and homogeneity of
variances were met. If assumptions were violated, Kruskal-Wallis one-way ANOVA on ranks
was performed. For illustration, gene expressions of animals fed N. limnetica or Cryptomonas
sp. were calibrated to those of animals fed S. obliquus, i.e. the relative expression for the S.
obliquus treatment was fixed to 1. All statistics were carried out using Sigmaplot (v 12.0,
Systat Software) or Statistica (v 6.0, StatSoft).
18
CHAPTER 2
RESULTS
Elemental stoichiometry and lipid composition of food organism
The elemental composition of the food organisms was characterized by high contents of
nitrogen and phosphorus and low C:N and C:P ratios (means ± s.d.; S. obliquus: C:N 17.2 ±
0.6, C:P 201.3 ± 9.7; N. limnetica: C:N 10.5 ± 3.6, C:P 129.5 ± 5.1; Cryptomonas sp.: C:N 5.4
± 0.1, C:P 145.6 ± 8.7). A limitation of D. magna by N or P could therefore be excluded.
The three food organisms differed notably in their PUFA composition (Table 1). S. obliquus
contained linoleic acid (LIN, 18:2n-6), γ-linolenic acid (GLA, 18:3n-6), α-linolenic acid
(ALA, 18:3n-3), and stearidonic acid (SDA, 18:4n-3), but no PUFAs with more than 18
carbon atoms were detected. N. limnetica contained LIN and the C20 PUFAs ARA and EPA,
the latter in exceptionally high amounts. In Cryptomonas sp., we found LIN, ALA, SDA,
EPA and docosahexaenoic acid (DHA, 22:6n-3). The amounts of total saturated fatty acids
(SAFAs) and total monounsaturated fatty acids (MUFAs) were highest in N. limnetica; S.
obliquus and Cryptomonas sp. were comparable concerning the total amount of SAFAs, but
Cryptomonas sp. contained less MUFAs. The total PUFA content was generally higher than
the SAFA or MUFA content in all three algae. Cryptomonas sp. contained the highest
amounts of total PUFA followed by N. limnetica; both algae contained more PUFAs than S.
obliquus. Only N. limnetica and Cryptomonas sp. contained C20 PUFAs, the amount in N.
limnetica being almost four times that in Cryptomonas sp.
Table 1 Fatty acid composition of S. obliquus, N. limnetica and Cryptomonas sp.. Data are means of
three replicates ± s.d. expressed in µg mg C-1 (n.d. = not detectable).
S. obliquus
N. limnetica
Cryptomonas sp.
18:2n-6 (LIN)
39.1 ± 1.3
6.0 ± 0.8
23.7 ± 0.7
18:3n-6 (GLA)
3.0 ± 0.1
n.d.
n.d.
18:3n-3 (ALA)
60.1 ± 0.9
n.d.
68.5 ± 2.1
18:4n-3 (STA)
8.2 ± 0.1
n.d.
21.3 ± 0.6
20:4n-6 (ARA)
n.d.
24.1 ± 2.5
n.d.
20:5n-3 (EPA)
n.d.
124.4 ± 12.4
36.4 ± 0.7
22:6n-3 (DHA)
n.d.
n.d.
4.4 ± 0.0
total SAFAs
46.6 ± 2.4
73.6 ± 6.0
42.2 ± 0.3
total MUFAs
82.9 ± 7.9
125.7 ± 2.6
3.4 ± 0.1
total PUFAs
110.4 ± 2.2
145.4 ± 1.7
154.4 ± 2.8
n.d.
139.8 ± 1.6
36.4 ± 0.7
239.8 ± 9.1
344.7 ± 6.0
200.0 ± 2.4
total C20 PUFAs
total FA
19
CHAPTER 2
Reproduction and population growth rates
Cumulative numbers of viable offspring produced within the first three reproduction cycles
and the estimated population growth rates increased significantly from animals fed S. obliquus
to animals fed N. limnetica and again to those fed Cryptomonas sp. (Fig. 1a+b). The
differences in cumulative offspring numbers caused by different algal diets were already
apparent in the first clutch, where both N. limnetica and Cryptomonas sp. as diet for D. magna
led to significantly larger clutch sizes compared to a S. obliquus diet, but they were most
pronounced after three reproduction cycles (Fig. 1a).
Figure 1 Cumulative numbers of viable neonates produced per individual (a) and estimated
population growth rates (b) of D. magna raised on S. obliquus (Scen), N. limnetica (Nanno) or
Cryptomonas sp. (Crypto). Data are means of 16 replicates ± s.e. Symbols or bars labelled with the
same letters are not significantly different (Tukey’s HSD test, p < 0.05 following ANOVA).
Comparisons were carried out within each clutch.
Expression of target genes
The expression of all examined genes was influenced by the food treatments (Fig. 2), only
two were not significantly affected (DmagVtg1, p = 0.156; Ltb4dh, p = 0.228). The most
prominent changes in gene expressions were observed for Cox, Fabp3, and Clect. Cox was
up-regulated ~3-fold in both the N. limnetica and Cryptomonas sp. treatment. Fabp3, in
contrast, was down-regulated ~4-fold when N. limnetica or Cryptomonas sp. was used as
food. Similarly, Clect was down-regulated ~3- and 4-fold with N. limnetica and Cryptomonas
sp. as food, respectively.
20
CHAPTER 2
Figure 2 Relative expression of eight selected genes of D. magna raised on S. obliquus (Scen), N.
limnetica (Nanno) or Cryptomonas sp. (Crypto). For graphic presentation, expression levels are
related to gene expression observed on a S. obliquus diet (= calibrator). Shown are mean relative
expressions (N=3 ± s.e.). Bars labelled with the same letters are not significantly different (Tukey’s
HSD test, p < 0.05 following ANOVA or Kruskal-Wallis). N.S. = not significant
21
CHAPTER 2
Changes in the expression of Lip, Gpx, and Jhe were less distinct. While Lip was clearly upregulated in the N. limnetica treatment (~3.5-fold), this was less pronounced in the
Cryptomonas sp. treatment (~2-fold). The expression of Gpx did not differ in animals fed S.
obliquus and N. limnetica, but was slightly reduced in animals fed Cryptomonas sp. (~ 2fold). Jhe-expression differed in animals feeding on N. limnetica and Cryptomonas sp., but
both treatments did not differ significantly from the expression level obtained with S. obliquus
as food.
Although not significant, the expression levels of Ltb4dh as well as DmagVtg1 were clearly
affected by the food sources. Ltb4dh expression was almost halved in animals feeding on N.
limnetica or Cryptomonas sp. whereas DmagVtg1 displayed the opposite trend, i.e. its
expression was up-regulated 2- and 3-fold in animals fed N. limnetica and Cryptomonas sp.,
respectively, compared to animals fed S. obliquus.
DISCUSSION
As a first approach to link biochemical nutrient availabilities to gene expression, we raised
Daphnia magna on food sources differing in their PUFA composition and assessed associated
changes in the expression of selected candidate genes. We found all of these candidate genes
to be responsive to the different food sources and propose that the observed effects on gene
expression can be mainly attributed to differences in the availability of dietary fatty acids.
Differences in fatty acid profiles among the three algae used as food for D. magna are
substantial and are expected to be responsible for the superior food quality of N. limnetica and
Cryptomonas sp. as was observed in the concomitantly performed life history experiment
where both algae rich in PUFAs (> 18C) yielded higher offspring numbers and population
growth rates than S. obliquus. Although the elemental nutrient ratios (C:P and C:N) found in
the three algae differed slightly, both N and P are present in a supply far from what is thought
to be limiting for Daphnia (Sterner and Elser 2002).
In contrast to S. obliquus, N. limnetica and Cryptomonas sp. contain C20 PUFAs which in
Daphnia can serve as precursors for eicosanoid biosynthesis. Only N. limnetica contains
ARA, the main substrate for this biosynthesis. In addition, the amounts of EPA found in this
alga are exceptionally high. Genes examined here included representatives of different
pathways possibly influenced by changing dietary PUFA availabilities, as indicated by their
response to the eicosanoid biosynthesis inhibitor ibuprofen (Heckmann et al. 2008a). Hayashi
et al. (2008) reported that reproduction of daphnids is impaired upon exposure to ibuprofen,
which is in line with the finding that dietary C20 PUFAs, i.e. eicosanoid precursors, increase
22
CHAPTER 2
the reproductive success of daphnids (Martin-Creuzburg et al. 2010). Vitellogenin, a
lipoprotein and precursor of the major egg yolk protein vitellin, is indispensable for oogenesis
and thus reproduction (Bownes 1986). Therefore, one would expect that a higher egg number
is accompanied by an increase in the expression of DmagVtg1. Although the increase in
transcription of DmagVtg1 from S. obliquus to N. limnetica and further to Cryptomonas sp.
was not significant due to the comparatively large within-treatment variance, this increase
nicely reflects the increasing reproductive output of animals feeding on these diets.
Besides DmagVtg1, Jhe expression should be considered when looking at oogenesis as the
encoded esterase cleaves the active juvenile hormone thereby rendering it inactive and as a
consequence releases vitellogenin from the suppressive influence of juvenile hormone
(Tokishita et al. 2006). If an increase in DmagVtg1 expression would require a synchronous
increase in JHE, we would expect to find a similar expression pattern for both genes.
However, we were examining mature, reproducing animals and as increased levels of juvenile
hormone may be disruptive of reproduction we would not expect to find any differences in
Jhe expression among the three algae. Methyl farnesoate, the crustacean juvenile hormone,
has been shown to induce male production in D. magna (Olmstead and Leblanc 2002) and
hence should be suppressed under favourable standard experimental conditions. In this study,
all experimental animals reproduced parthenogenetically, i.e. no males were observed, and the
expression of Jhe in animals raised on N. limnetica or Cryptomonas sp. was not significantly
different from that in animals raised on S. obliquus. Hence, one might argue against a
connection between vitellogenesis and juvenile hormone synthesis and, therefore, against a
role for PUFAs in juvenile hormone signalling.
Lip codes for a triacylglycerol lipase and hence is directly involved in lipid metabolism,
particularly in the glycerolipid metabolism (Prentki and Madiraju 2008). Lip was up-regulated
in animals feeding on N. limnetica, and also to a smaller extend in animals feeding on
Cryptomonas sp.. The strong increase in Lip expression in animals feeding on N. limnetica is
most likely a general response to the high SAFA and/or total fatty acid content of N. limnetica
rather than a specific, PUFA-related response. LIP presumably is a secreted protein as
suggested by the presence of a predicted signal sequence; hence, the observed increase in Lip
expression might indicate an increased lipid assimilation process, in which available fatty
acids in the diet are released from triacylglycerides in the gut through the activity of lipases,
absorbed through the epithelium, and subsequently processed and stored in lipid droplets (Mu
and Hoy 2004, Lass et al. 2011).
23
CHAPTER 2
Lectins act as recognition molecules within the immune system and are, through their ability
to bind glucoproteins and glycolipids and to mediate e.g. endocytosis, important modules of
pathogen defence (Kilpatrick 2002). Clect expression was down-regulated in both N.
limnetica and Cryptomonas sp. consuming animals. This pattern may represent a trade-off
situation between immune response and reproductive output, i.e. an increased allocation of
resources towards reproduction in animals fed N. limnetica or Cryptomonas sp. might lead to
a reduced investment in components of the immune system. Indications for a trade-off of
immunity for other fitness parameters have been described in many organisms (Zuk and
Stoehr 2002, Allen and Little 2011). Rono et al. (2010) observed interference of vitellogenin
with the immune response to an invading pathogen in Anopheles gambiae.
Another group of genes can be associated directly with eicosanoid metabolism as they are
coding for the required enzymes: COX, one of the central enzymes in the biosynthesis of
eicosanoids and LTB4DH, an enzyme responsible for rendering some eicosanoids inactive
(Stanley 2000); GPX provides protection against toxic oxygen derivatives and is able to
reduce lipid hydroperoxides formed during eicosanoid synthesis (Schoene 1985, Arthur
2000).
As key enzyme within the eicosanoid biosynthesis pathway, we expected the Cox gene to be
highly responsive to changes in substrate availability, i.e. the availability of the three relevant
C20 PUFAs. In both the N. limnetica and Cryptomonas sp. treatment, where these C20
precursors are present, gene expression levels were clearly elevated compared to S. obliquus.
This might reflect an induction of the Cox gene by the presence of the substrate (ARA or
EPA) of the encoded enzyme and would thus indicate a higher rate of eicosanoid synthesis.
Supporting this possibility is the concomitantly slightly lowered Ltb4dh expression in animals
fed N. limnetica or Cryptomonas sp., as the enzyme encoded by this gene is, at least in
vertebrates, responsible for the inactivation of eicosanoids. Moreoever, leukotriene B4 (LTB4)
has been shown to play a role in yolk formation during oogenesis in insects (Medeiros et al.
2004). As Ltb4dh expression is down-regulated in animals raised on a N. limnetica or
Cryptomonas sp. diet, there should be more LTB4 present, which in turn would (according to
Medeiros et al.) support yolk formation. Together with the increased expression of the
vitellogenin gene DmagVtg1 in animals fed the C20 PUFA-rich diets in our experiment, this
argues for a similar role of LTB4 in insect and Daphnia reproduction.
Glutathione peroxidases reduce the hydroperoxides formed by ARA metabolism during
eicosanoid synthesis. Although eicosanoids exert crucial biological activities their peroxide
24
CHAPTER 2
nature can also cause severe damage to membranes. Hence, one would expect a more
pronounced expression of Gpx in animals that are able to extensively synthesize eicosanoids,
i.e. in our case, in animals feeding on the C20 PUFA-rich algae N. limnetica or Cryptomonas
sp.. Yet, we did not find the expected up-regulation of Gpx expression. While Gpx expression
levels did not differ between animals fed S. obliquus and N. limnetica, they were slightly
lower in the Cryptomonas sp. treatment. Whether or not animals feeding on Cryptomonas sp.
are in fact exposed to lower hydroperoxide-mediated stress than animals feeding on S.
obliquus and N. limnetica remains unclear and has to be re-assessed in future studies.
Another gene closely related to the eicosanoid pathway is Fabp3. Fatty acid binding proteins
(FABPs) are involved in signalling processes of vertebrates and invertebrates as intracellular
carrier proteins for fatty acids, eicosanoids and other lipophilic substances (Zimmerman and
Veerkamp 2002, Esteves and Ehrlich 2006). Possible destinations for both free fatty acids and
eicosanoids bound to FABPs can be peroxisome proliferator-activated receptors (PPARs).
These nuclear receptors dimerize upon ligand binding (i.e. activation) with the retinoid X
receptor (RXR) and the resulting complex consequently binds to the promoter region of target
genes (Berger and Moller 2002). In our study, the expression pattern of Fabp3 in animals fed
the different food sources was similar to the expression pattern of Ltb4dh, but reversed to that
of Cox, which implies a connection to eicosanoid signalling. However, the reason for the
significant down-regulation of Fabp3 in animals feeding on the C20 PUFA-containing algae
N. limnetica and Cryptomonas sp. requires further investigation, in which receptors involved
in the above described signaling cascade, e.g. PPAR or RXR, are considered. Also, as for all
genes examined, it remains to be tested if the observed changes in gene expression are
reflected in changes in the functional protein.
Eicosanoids play an important role in reproduction and immunity of many invertebrates
(Stanley 2000). So far there are only few hints as to their significance in Daphnia. Hayashi et
al. (2008) used the eicosanoid synthesis inhibitor ibuprofen to assess its toxicity for D. magna
and found strong concentration dependent effects on reproduction. Here, we demonstrated
effects of food quality on reproduction in a life history experiment and hypothesized that
PUFAs, as one of the major factors distinguishing the employed algae, exert their influence
on offspring production in part through eicosanoid actions. As the relevance of PUFAs for
Daphnia reproduction is well-established (e.g. Martin-Creuzburg et al. 2010) and the
necessary enzymatic machinery for eicosanoid synthesis exists in Daphnia (Heckmann et al.
2008b; Colbourne et al. 2011), we are directing future studies along this line of thought. To
elucidate the role of PUFAs in eicosanoid production further studies are required in which the
25
CHAPTER 2
dietary PUFA supply is experimentally modified by specific PUFA supplementation. It also
has to be considered that the activity of COX is potentially influenced by other dietary
substances, such as carotenoids (Reddy et al. 2005). With this approach we hope to get further
insights in how PUFAs act in Daphnia physiology and to establish a link between dietary
PUFA availability and eicosanoid synthesis.
ACKNOWLEDGEMENT
We thank Lars-Henrik Heckmann for advice, discussion and valuable comments on the
manuscript. This study was supported financially by the German Research Foundation (DFG,
MA 5005/1-1).
26
3
DIETARY SUPPLY WITH POLYUNSATURATED FATTY ACIDS AND
RESULTING MATERNAL EFFECTS INFLUENCE HOST-PARASITE
INTERACTIONS
Nina Schlotz, Dieter Ebert, and Dominik Martin-Creuzburg
Published in BMC Ecology, 2013
ABSTRACT — Interactions between hosts and parasites can be substantially modulated by
host nutrition. Polyunsaturated fatty acids (PUFAs) are essential dietary nutrients; they are
indispensable as structural components of cell membranes and as precursors for eicosanoids,
signalling molecules which act on reproduction and immunity. Here, we explored the
potential of dietary PUFAs to affect the course of parasitic infections using a well-established
invertebrate host – parasite system, the freshwater herbivore Daphnia magna and its bacterial
parasite Pasteuria ramosa. Using natural food sources differing in their PUFA composition
and by experimentally modifying the availability of dietary arachidonic acid (ARA) and
eicosapentaenoic acid (EPA) we examined PUFA-mediated effects resulting from direct
consumption as well as maternal effects on offspring of treated mothers. We found that both
host and parasite were affected by food quality. Feeding on C20 PUFA-containing food
sources resulted in higher offspring production of hosts and these effects were conveyed to a
great extent to the next generation. While feeding on a diet containing high PUFA
concentrations significantly reduced the likelihood of becoming infected, the infection success
in the next generation increased whenever the maternal diet contained PUFAs. We suggest
that this opposing effect was caused by a trade-off between reproduction and immunity in the
second generation. Considering the direct and maternal effects of dietary PUFAs on host and
parasite we propose that host – parasite interactions and thus disease dynamics under natural
conditions are subject to the availability of dietary PUFAs.
KEYWORDS — Arachidonic acid, Daphnia magna, eicosapentaenoic acid, food quality,
host– parasite interactions, immunity, nutrition, Pasteuria ramosa, resistance
27
CHAPTER 3
BACKGROUND
Resistance of animals to parasitic infections is influenced by various factors, among them
genetic predisposition, environmental conditions, and nutritional state (Schmid-Hempel
2011). The role of nutrition in infectious diseases has been extensively investigated, as it is
thought to affect establishment, pathogenesis, and duration of infections (e.g. Chandra 1997,
Field et al. 2002, Smith et al. 2005). The consensus is that under- or malnutrition impairs
immunocompetence leading to increased susceptibility to and severity of infection. However,
it becomes increasingly clear that disease patterns generated by the diet can be much more
complex. Host – parasite interactions can be affected by the foraging activity per se (Kuris
1974, Lafferty 1999, Hall et al. 2007b), the amount of available food, as well as its quality
(Krist et al. 2004, Hall et al. 2009). While the search for food often establishes the contact
between host and pathogen, food quantity and quality may play a role later in the infection
process. Infected hosts and their parasites compete for the same nutrients acquired by the host
(Garber 1960); i.e. nutrient supply could have direct effects on growth and reproduction of the
host and simultaneously on the performance of the parasite. Moreover, certain components of
the host’s defence mechanisms could be affected by dietary nutrients and, in consequence,
indirectly influence pathogen success (Lee et al. 2008). In contrast to what is often seen in
mammals, food quantity limitation of the invertebrate host seems to impair the parasite,
resulting in reduced within-host proliferation and decreased transmission (Bedhomme et al.
2004, Pulkkinen and Ebert 2004, Ryder et al. 2007, Seppala et al. 2008, Sadd 2011).
Although still in their early stage, the combined efforts of nutritional ecology and ecoimmunological research have brought to light exciting aspects of food quality effects under
parasite challenge in invertebrates. For example, ratios of dietary protein to carbohydrates or
dietary carbon (C) to phosphorus (P) have been shown to modify the incidence and intensity
of infections (Thompson et al. 2005, Frost et al. 2008, Cotter et al. 2011). While dietary
deficiencies in elements can have severe consequences for the consumer’s fitness (Sterner and
Elser 2002) there are other essential nutrients which have rarely been considered in research
on the role of nutrient supply in pathophysiology of invertebrate hosts.
A dietary deficiency in polyunsaturated fatty acids (PUFAs) can severely constrain growth
and reproduction of consumers (Müller-Navarra et al. 2000, von Elert 2002, Tocher 2010).
Under parasite challenge, PUFA requirements may change and single PUFAs may be
assigned to other roles. Three of the C20 PUFAs – arachidonic acid (ARA, 20:4n-6),
eicosapentaenoic acid (EPA, 20:5n-3), and dihomo-γ-linolenic acid (DGLA) – are the
28
CHAPTER 3
substrates for a family of hormone-like substances called eicosanoids, which in vertebrates
and invertebrates act on reproduction, the immune system, and ion transport physiology
(Stanley 2000). The importance of an adequate functioning of the arachidonic acid cascade
for host defence mechanisms has been demonstrated in experiments in which animals were
unable to clear an imposed bacterial infection when eicosanoid biosynthesis was blocked; this
block could be bypassed by the injection of ARA into the body cavity (Stanley-Samuelson et
al. 1991).
In order to shed light upon the potential of dietary PUFAs to modulate infection in
invertebrates we used the freshwater crustacean Daphnia magna, which is well understood
regarding its nutritional ecology. An adequate dietary supply with PUFAs has been shown to
support proper growth and reproduction and to influence temperature acclimation (Wacker
and Von Elert 2001, Martin-Creuzburg et al. 2009, Martin-Creuzburg et al. 2010, MartinCreuzburg et al. 2012). Furthermore, first evidence suggests that eicosanoids are active in
Daphnia physiology (Heckmann et al. 2008a, Heckmann et al. 2008b) and that the eicosanoid
biosynthesis machinery responds to the level of dietary precursor PUFAs (Schlotz et al.
2012). To challenge our host, we chose Pasteuria ramosa, a castrating endoparasitic
bacterium, for combined life history – infection experiments. The D. magna – P. ramosa
system has been thoroughly investigated (Ebert et al. 1996) and several aspects of the
infection process and the inheritance of resistance have been elucidated (Duneau et al. 2011,
Luijckx et al. 2011b).
Depending on the conditions experienced by mothers, eggs may be provisioned differentially
with nutrients. Thus, offspring performance can greatly be affected by stress- or resourcerelated maternal effects (Mitchell and Read 2005, Ben-Ami et al. 2010, Frost et al. 2010,
Gibbs et al. 2010, Stjernman and Little 2011, Boots and Roberts 2012, Hall and Ebert 2012).
Daphnia preferentially allocates PUFAs into their eggs (Wacker and Martin-Creuzburg 2007).
Hence, if dietary PUFAs have the potential to influence an infection when consumed directly,
offspring of mothers differing in their dietary PUFA provisioning might experience the same
benefit or harm even if they do not have access to dietary C20 PUFAs.
Here, we provided hosts (D. magna) with food sources differing in their PUFA content and
composition and additionally manipulated a diet deficient in C20 PUFAs by ARA and EPA
supplementation. Subsequently, we reared offspring of mothers raised on the different food
regimes exclusively on the C20 PUFA-deficient food to be able to assess PUFA-related
maternal effects. Animals of both generations were exposed to the parasite (P. ramosa) and
29
CHAPTER 3
fitness consequences were recorded as host reproductive success, susceptibility to the parasite
and within-host reproduction of the parasite.
RESULTS
Elemental and biochemical composition of the food sources
The algal food organisms were characterized by low molar carbon to nitrogen (C:N) and
carbon to phosphorus (C:P) ratios, i.e. high contents of nitrogen and phosphorus (Table 1). As
the C:P ratios of the algae were rather low, a P-limitation of the host could be excluded.
Moreover, C:P ratios within the range observed here (~100-230) are unlikely to change the
elemental conditions within the host in a way that the parasite’s establishment or growth is
hampered (Frost et al. 2008).
Table 1 Elemental nutrient ratios (molar) and PUFA content (µg mg C -1) of the three food organisms.
Data are means of three replicates ± s.d. (n.d. = not detectable). Food suspensions consisting of S.
obliquus and PUFA -containing liposomes contained either 26.1 ± 0.4 ARA or 20.3 ± 0.7 EPA (all
values in µg mg C-1 ± s.d.), respectively.
S. obliquus
N. limnetica
Cryptomonas sp.
C:N
13.7 ± 0.0
13.0 ± 0.6
5.4 ± 0.0
C:P
232.9 ± 4.6
162.2 ± 3.9
100.1 ± 3.2
18:2n-6 (LIN)
45.5 ± 1.6
8.5 ± 0.4
10.2 ± 0.2
18:3n-3 (ALA)
62.4 ± 4.0
n.d
50.9 ± 1.1
18:4n-3 (STA)
8.5 ± 0.3
n.d
17.9 ± 0.4
20:3n-6 (DGLA)
n.d
2.2 ± 0.4
n.d
20:4n-6 (ARA)
n.d
24.5 ± 1.1
n.d
20:5n-3 (EPA)
n.d.
121.6 ± 1.1
45.5 ± 1.0
22:6n-3 (DHA)
n.d.
n.d
4.6 ± 0.0
Fatty acid profiles differed considerably between the three algae, especially with regard to
PUFAs (Table 1). S. obliquus contained linoleic acid (LIN, 18:2n-6), high amounts of αlinolenic acid (ALA, 18:3n-3), and stearidonic acid (STA, 18:4n-3), but no PUFAs with more
than 18 C atoms. In contrast, the PUFA composition of N. limnetica was characterized by the
presence of DGLA and ARA as well as exceptionally high amounts of EPA. C18 PUFAs
were present only in very low concentrations or were not detectable at all in N. limnetica.
Cryptomonas sp. contained the three C18 PUFAs LIN, ALA, and STA and, additionally,
30
CHAPTER 3
considerable amounts of EPA, albeit in much lower concentrations than N. limnetica, and
small amounts of DHA.
PUFA profiles of D. magna eggs
Eggs basically reflected the PUFA composition of their mothers’ food source. In eggs
produced on a S. obliquus diet no PUFAs of more than 18 C atoms could be detected (Fig.1).
Eggs of N. limnetica-consuming mothers contained considerable amounts of ARA and EPA.
When mothers where raised on Cryptomonas sp., their eggs contained EPA and also low
amounts of ARA, although ARA could not be detected in Cryptomonas sp. Supplementation
of S. obliquus with control liposomes did not affect the PUFA composition of the produced
eggs. In contrast, low amounts of ARA or EPA were detected in eggs produced on ARA- or
EPA-supplemented S. obliquus, indicating that these supplemented PUFAs were allocated
into the eggs (Fig.1).
Figure 1 PUFA content of second clutch eggs (ng egg-1). Eggs collected from mothers raised on S.
obliquus (Scen), S. obliquus supplemented with either control liposomes (+ lipo) or liposomes
containing ARA or EPA (+ARA, + EPA), N. limnetica (Nanno), or Cryptomonas sp. (Crypto). Data
are presented on a logarithmic scale as means of three replicates ± s.d.
Susceptibility of the host
The parasite’s success in establishing an infection in spore-exposed hosts varied with food
quality, regardless of whether the food sources were consumed directly (factor “food”, df = 5,
deviance = 16.58, p < 0.01; Fig. 2a) or were experienced only as maternal provisioning in the
second generation experiment, where all offspring were raised on S. obliquus, irrespective of
the food regimes their mother were raised on (factor “food”, df = 5, deviance = 37.65, p <
31
CHAPTER 3
0.001; Fig. 2b). However, direct and maternal effects differed substantially in pattern and
extent. When animals were raised directly on the different food sources, the infection
efficiency dropped significantly on a N. limnetica diet. Only ~40 % of exposed animals were
infected, which is a 6-fold decrease (odds ratio) compared to the S. obliquus diet (~80 %). The
other food treatments did not induce significant changes in infection efficiency (Fig. 2a). The
second generation experiment revealed that the maternal food regime strongly influenced the
infection success of the parasite. Although all offspring fed exclusively on S. obliquus, the
proportion of infected animals increased ~ 6-fold (odds ratio; from ~35% to >80 %) when
mothers were raised on diets containing C20 PUFAs, i.e. N. limnetica, Cryptomonas sp., as
well as ARA- and EPA-supplemented S. obliquus.
Figure 2 Infection efficiency of P. ramosa in D. magna. a) Animals raised on different food sources
directly. b) Animals raised exclusively on S. obliquus, but mothers raised on different food sources.
Data indicate the percentages of infected animals after exposure to the parasite (total numbers of
individuals are given in brackets). Asterisks indicate a significant deviation from the grand mean
(general linear hypothesis testing following GLM).
Reproductive success of healthy and infected hosts
The cumulative numbers of viable offspring produced by healthy and P. ramosa-infected D.
magna during the experiments were influenced by the quality of the different food source,
both when these food sources were consumed directly (Fig. 3a, Table 2) and when they were
used as maternal food sources only (Fig. 3b, Table 2). Strikingly, direct and maternal effects
generated very similar patterns. When directly consumed, long-chain PUFAs increased
offspring production of control (i.e. non-exposed) animals up to the level obtained with N.
limnetica as food. Animals feeding on Cryptomonas sp. produced the highest numbers of
32
CHAPTER 3
offspring. These effects were conveyed to the next generation. In the maternal effects
experiment, control animals whose mothers were provided with ARA or EPA produced
significantly more offspring than those from mothers without dietary ARA or EPA supply.
This trans-generational food quality effect was even stronger when N. limnetica or
Cryptomonas sp. were used as maternal food source.
Figure 3 Cumulative numbers of viable offspring produced by uninfected and P. ramosa-infected D.
magna. a) Animals raised on different food sources directly. b) Animals raised exclusively on S.
obliquus, but mothers raised on different food sources. Shaded areas indicate the proportion of total
offspring produced after the sterile phase (castration relief). Error bars indicate s.d. Bars labelled with
the same letters are not significantly different (general linear hypothesis testing, p < 0.05 following
GLM).
P. ramosa is a castrating parasite and thus greatly impacts the fitness of its host. In
accordance with what was seen in earlier studies (Ebert et al. 2004), parasite-induced
mortality was absent during the experimental period. However, infected animals of all
treatments showed a distinct decrease in the production of viable offspring (Fig. 3). Total
numbers of offspring produced by infected animals were comparable between both direct
(Fig. 3a) and maternal (Fig. 3b) food regimes. Supplementation of S. obliquus with ARA or
EPA significantly increased offspring production of infected animals relative to the liposome
control treatment in the mother generation (directly feeding on the different food sources), but
this trend was not significant in infected animals of the next generation. In both generations,
offspring numbers produced by infected animals were significantly higher when N. limnetica
and Cryptomonas sp. were provided as food source. When feeding on PUFA-rich diets
directly, infected hosts were able to produce offspring after the sterile phase caused by P.
33
CHAPTER 3
ramosa (Fig. 3, hatched areas). This ‘castration relief’ was most prominent on a Cryptomonas
sp. diet where more than 50 % of total offspring were produced after the sterile phase. This
restart of reproduction could be observed also, albeit to a lower extent, on N. limnetica as well
as ARA- and EPA-supplemented S. obliquus. In the second generation experiment, animals
started to reproduce again only when their mothers were raised on either N. limnetica or
Cryptomonas sp.
Table 2 Results of statistical analysis of the cumulative number of offspring using a generalized linear
model. Error distribution = quasi-Poisson, link function = log. (1) D. magna raised under different
food regimes (direct supply). (2) D. magna raised under the same food regime (S. obliquus), but
mothers raised under different food regimes (maternal effects).
cumulative number of host offspring (GLM2)
(1) direct
df
deviance
residual df
residual deviance
p
subset control
“food”
5
494.38
98
181.37
< 0.001
subset infected
“food”
5
1035.1
128
812.2
< 0.001
subset control
“food”
5
685.94
76
131.35
< 0.001
subset infected
“food”
5
481.41
104
482.33
< 0.001
(2) maternal
Spore production by the parasite
The life cycle of P. ramosa within its host ends with the formation of endospores in the body
cavity and thus the spore load can be used as a proxy for the reproductive success of the
parasite (Ebert et al. 1996). In the first generation experiment, when exposed directly to the
different food regimes, the total number of endospores per individual host was affected by
food quality (factor “food”; per individual: F5, 54 = 6.18, p < 0.001; per mg dry mass: df = 5, F
= 4.67, p < 0.01; Fig. 4a). The spore load per individual was significantly higher in animals
raised on, N. limnetica, Cryptomonas sp., or EPA-supplemented S. obliquus as compared to
animals raised on unsupplemented S. obliquus. Compared to the liposome control treatment,
however, only animals raised on N. limnetica had significantly higher spore loads (Tukey’s
HSD, p < 0.05). In the second generation experiment, food quality mediated effects on the
34
CHAPTER 3
total number of endospores per individual were virtually absent (factor “food”, F5, 54 = 0.95, p
= 0.49; Fig. 4b).
Figure 4 Number of endospores counted in P. ramosa-infected D. magna 27 days post infection. a)
Animals raised on different food sources directly. b) Animals raised exclusively on S. obliquus, but
mothers raised on different food sources. Data are means of n = 10 ± s.d. Bars labelled with the same
letters are not significantly different (Tukey’s HSD test, p < 0.05 following ANOVA). Treatments in
b) did not differ statistically.
DISCUSSION
The potential of dietary PUFAs to modulate vertebrate and invertebrate physiology has
intrigued researchers for decades. However, their role in host – parasite interactions and the
consequent ecological significance are yet to be revealed. By providing our invertebrate host
with food sources differing in their PUFA content and composition, we investigated direct
and maternal effects of dietary PUFAs on the outcome of an infection with a bacterial
parasite. Our results show that dietary PUFAs influence host – parasite interactions both when
provided with the diet and when derived from maternal resources.
PUFA-mediated food quality affects the susceptibility to and the severity of infection — By
using a compatible host – parasite pair we could attribute the observed food quality effects
specifically to changes in the ability of the host to cope with the parasite after it entered the
host (Duneau et al. 2011). Whether the host can initially prevent the establishment of the
parasite must therefore be associated with differences in within-host defence mechanisms.
Feeding on N. limnetica, which contains high concentrations of ARA and EPA, resulted in a
6-fold reduction of the host’s susceptibility to infection. As the clearance of the invading
parasite is an event very early in the infection process it is rather unlikely that competition for
35
CHAPTER 3
resources plays a role (assuming it does, a high quality food like N. limnetica would lead to
higher infection rates). Thus, the biochemical composition of N. limnetica, characterized by
high ARA and EPA concentrations, is most likely responsible for the higher resistance to
infection. ARA and EPA serve as precursors for eicosanoids, signalling molecules which are
known to modulate invertebrate immune responses (Stanley 2000). It has been shown that
feeding on diets differing in their PUFA composition can affect the expression of key
enzymes within the eicosanoid pathway in Daphnia (Schlotz et al. 2012), suggesting that the
high dietary supply with PUFAs has supported a more pronounced immune response to the
invading parasite resulting in increased resistance. Transcriptomic and metabolomic studies
will help to elucidate links between defence mechanisms and the eicosanoid pathway in
Daphnia. Supplementation of S. obliquus with ARA or EPA did not lead to higher resistance,
possibly because a higher concentration or the combination of both PUFAs is required to
obtain a similar effect as observed with N. limnetica.
An alternative explanation for the increased resistance against P. ramosa on a N. limnetica
diet could be directly related to effects of the exceptionally high amounts of EPA present in
this alga. Although PUFAs are typically covalently bound to lipids in living tissue, free
PUFAs might be released from phospholipids of N. limnetica as a consequence of cell damage
during the feeding process of D. magna (Watson et al. 2009). Free PUFAs are cytotoxic and
bactericidal (Desbois and Smith 2010) and thus may have directly impaired the invading
bacterium. However, we did not find evidence for the release of free PUFAs out of N.
limnetica after cell damage (G. Pohnert, unpubl. data).
Interestingly, once the parasite was able to establish an infection, parasite performance was
not impaired by the PUFA-rich N. limnetica diet. On the contrary, these hosts exhibited the
highest spore load per animal. This implies that the immune system of D. magna is rather
ineffective against P. ramosa once the parasite could overcome the initial defences. In
general, animals reared on high PUFA food by tendency contained more spores per individual
than animals reared on the moderate food source S. obliquus, indicating that host-parasite
interactions later during the infection are subject to resource competition and that increased
food quality sustains increased within-host reproduction of the parasite. Similar findings have
been reported for food quantity and elemental food quality (Ebert et al. 2004, Frost et al.
2008). In accordance with previous studies (Martin-Creuzburg et al. 2009, 2010), the
reproductive output of healthy hosts was significantly higher on food sources containing C20
PUFAs, including supplemented diets, than on C20 PUFA-deficient food (S. obliquus).
Similarly, infected hosts benefited from feeding on high quality algae and PUFA
36
CHAPTER 3
supplementation. The higher reproductive output of infected animals was partially due to
reproduction after the parasite-induced sterile phase (castration relief). The ability to produce
eggs late during the infection has been observed previously in the same combination of host
and parasite clones (Hall and Ebert 2012); we show here that this castration relief is clearly
affected by food quality.
P. ramosa inherently pursues the strategy to castrate its host. Thus, resources that are
normally invested in host reproduction and consequently lost to the parasite stay within the
host and are available for parasite growth. Whether PUFAs or host-produced PUFA
metabolites that are being retained by this re-allocation process are of special interest to the
parasite cannot be conclusively stated at this point.
PUFA-mediated maternal effects on unchallenged and infected hosts — In the second
generation experiment we found that the quality of the maternal diet has far-reaching
consequences for offspring fitness with and without parasite challenge. The PUFA
composition of the eggs mirrored that of the maternal food, indicating a limited capacity to
modify dietary PUFAs and to adjust the allocation of specific PUFAs into the eggs. It has
been reported that dietary EPA and ARA are preferentially allocated into the eggs by D.
magna, suggesting that these PUFAs are particularly important for egg production and
offspring development (Wacker and Martin-Creuzburg 2007). Even the low concentrations of
ARA and EPA detected in eggs produced on the supplemented diets in our study had
pronounced effects on offspring fitness. The impact of maternal PUFA supply on the
reproductive output of their offspring was of unanticipated extent. Even though the offspring
have never consumed PUFA-rich diets they produced the same numbers of offspring as their
mothers over a period of 30 days. This is especially intriguing as the amounts of
supplemented PUFAs that were allocated to a single egg were a lot smaller than the amounts
the mothers received daily with their diet. Apparently, this “starter kit” provided by the
mothers was sufficient to significantly improve offspring fitness. The finding that these
animals managed to keep up high offspring production during 30 days suggests low C20
PUFA requirements and a strong ability to retain these PUFAs (Taipale et al. 2011).
Alternatively, this could be a consequence of better developed reproductive organs in
neonates maternally provisioned with PUFAs allowing for high reproductive success
independent of a direct dietary C20 PUFA supply.
Under parasite challenge, effects of maternally derived PUFAs on host resistance were
strikingly clear. Whenever mothers had access to dietary PUFAs the susceptibility of their
37
CHAPTER 3
offspring to infection increased more than 6-fold. It has been reported previously that mothers
raised under good conditions (i.e. no stress, high food concentrations) produce offspring
which are more susceptible to parasite infection (Mitchell and Read 2005, Ben-Ami et al.
2010, Stjernman and Little 2011). A possible explanation could be that these offspring
constitute a more favourable environment where resources (and especially PUFAs) are
abundant and where parasites find good conditions for proliferation. Thus the situation would
be similar to the one described above for the direct consumption of dietary PUFAs (resource
competition). However, our results did not show increased spore production thus arguing
against this possibility. This suggests that PUFA-mediated benefits for host reproduction were
conveyed to the offspring in a form not accessible to the parasite. Hence, the fitness advantage
linked to the maternal PUFA-supply lies primarily on the side of the host. Alternatively,
animals might face a trade-off between immunity and reproduction as both are costly traits
and might rely in part on the same resources (Harshman and Zera 2007, Allen and Little 2011,
Schmid-Hempel 2011). Figuring that daughters of animals which have had access to dietary
C20 PUFAs had already started to invest more extensively into reproduction at parasite
exposure (compared to those whose mothers were raised on C20 PUFA-deficient food
sources) resources might not have been sufficiently allocated towards immunity-related
functions. This potential trade-off could be more pronounced in the second generation,
because the offspring had no direct access to dietary PUFAs and thus relied on the limited
amounts of PUFAs allocated into the eggs (in contrast to the constant supply in the first
generation experiment). PUFAs can play a role in both reproduction and immunity,
presumably via the action of eicosanoids, and hence we propose that the significantly higher
investment in reproduction observed in offspring of mothers raised on PUFA-containing food
sources has compromised defence mechanisms and thus resulted in the very high infection
success.
CONCLUSIONS
We show here that biochemical food quality can strongly affect both host and parasite fitness.
Differences in resistance and reproduction can be mediated by single dietary PUFAs.
Furthermore, our results pointed out that PUFA-mediated effects on the characteristics of
infection are not limited to the direct consumption, but can also be conveyed to the offspring.
However, direct and maternal effects may differ greatly in the extent and direction of fitness
consequences for the host. Thus, food quality in general and the availability of PUFAs in
38
CHAPTER 3
particular have a great potential to affect host – parasite interactions making them a
significant factor to be considered when studying disease patterns and dynamics in the field.
MATERIAL AND METHODS
Cultivation of organisms
The experiments were conducted with a clone of Daphnia magna (clone HO2, originating
from Hungary). Stock cultures of D. magna were cultivated in artificial medium (ADaM;
modified after Klüttgen et al. (1994)) containing 2 mg C L-1 of the chlorophyte Scenedesmus
obliquus (culture collection of the University of Göttingen, Germany, SAG 276-3a).
During the life history experiment, D. magna were raised on either S. obliquus, the
eustigmatophyte Nannochloropsis limnetica (SAG 18.99), or on the cryptophyte
Cryptomonas sp. (SAG 26.80), which were all cultured semi-continuously in modified Woods
Hole (WC) medium with vitamins (Guillard 1975) in aerated 5 L vessels (20°C; dilution rate:
0.2 d-1; illumination: 100 µmol quanta m–2 s–1). Food suspensions were produced by
centrifugation of the harvested algae and resuspension in ADaM. Carbon concentrations of
the food suspensions were estimated from photometric light extinctions and from previously
determined carbon-extinction equations. The carbon – light extinction regressions were
confirmed by subsequent carbon analysis of the food suspensions.
Preparation of liposomes
Liposomes were prepared as described in Martin-Creuzburg et al. (2009). The amount of daily
supplied ARA-containing liposomes was adjusted to provide similar carbon-based dietary
ARA concentrations as in the N. limnetica treatment. However, we did not apply EPA
concentrations as high as in the N. limnetica treatment, but instead provided similar amounts
of ARA and EPA to be able to compare the effects potentially produced by these two PUFAs.
Egg preparation
For the chemical analysis, second-clutch eggs of animals raised on the different food regimes
were collected under a stereomicroscope by gently flushing them out of the brood chamber
with a lengthened glass Pasteur pipette (Wacker and Martin-Creuzburg 2007). The eggs were
washed with ultra-pure water and transferred directly into dichloromethane/methanol for
subsequent fatty acid extraction (as described below). At least three Daphnia were used to
collect a minimum of 25 eggs per sample. All eggs sampled were in the first egg stage and did
not show any morphological differentiation.
39
CHAPTER 3
Parasite handling
For the infection of the host a clone of the Gram positive bacterium Pasteuria ramosa (C19,
derived from a D. magna population from Garzerfeld, Germany and characterized in Luijckx
(2011a) was used. Stocks of P. ramosa endospores were stored at -20°C within the infected
host. Prior to use, the stock was thawed and the infected animal squashed in a small volume of
ADaM. Endospore concentrations within these suspensions were determined under a
microscope using a counting chamber (Neubauer improved).
Life history experiments
A two generation life history experiment was conducted to assess food quality effects on
healthy and P. ramosa-challenged D. magna. In the first generation experiment animals
(third-clutch neonates born within 12h) were kept individually in 80 mL of ADaM at 20°C
and a 16:8 h light:dark cycle. They were randomly assigned to one of the following food
regimes: S. obliquus (Scen), S. obliquus supplemented with control liposomes (+ lipo), S.
obliquus supplemented with ARA- or EPA-containing liposomes (+ ARA, + EPA), N.
limnetica (Nanno), or Cryptomonas sp. (Crypto). For the second generation experiment,
mothers from the first generation were placed into fresh medium without algae shortly before
the expected release of their second clutch neonates. These neonates were collected and
placed individually in jars exclusively containing S. obliquus, irrespective of the food
conditions under which they were produced. The mothers were put back into their previous
food treatments. Culturing conditions corresponded to those of the first generation. All
animals were transferred to fresh medium and received freshly prepared food suspensions
corresponding to a total of 2 mg C L-1 every other day. 18 animals of each treatment were not
exposed to parasite spores, 30 animals were subjected to the parasite. For infection, all
animals were placed individually in 20 mL of medium at day three of the experiment and
were exposed on three consecutive days to a total of ca. 12,000 P. ramosa spores per
individual (4,000 spores per day) in the first generation experiment and to a total of ca. 6,000
spores per individual (2,000 spores per day) in the second generation experiment. This was
done because of high infections rates in the first generation. Control animals in both
experiments were treated as described for the spore-exposed animals; instead of infectious
spores a suspension of uninfected, macerated D. magna was added (mock-exposure).
Subsequently, animals were transferred to new, spore-free jars containing 80 mL of ADaM.
Both experiments were terminated after 30 days due to expected high death rates of infected
animals after approximately 40 days (Ebert et al. 2000). During this time period reproduction
40
CHAPTER 3
(viable offspring) and infection status were recorded. On day 30, all infected individuals were
stored at -20°C for subsequent determination of the spore load per animal. Subsamples of
infected animals of each treatment were dried for 24 h and their dry mass determined using a
microbalance (Mettler Toledo XP2U; ± 0.1 µg).
Biochemical analyses
Elemental composition — Aliquots of food suspensions were filtered onto precombusted glass
fibre filters (Whatman GF/F, 25 mm diameter) and analyzed for particulate organic carbon
(POC) and nitrogen using an EuroEA3000 elemental analyzer (HEKAtech GmbH, Wegberg,
Germany). For the determination of particulate phosphorus, aliquots were collected on acidrinsed polysulfone filters (HT-200; Pall, Ann Arbor, MI, USA) and digested with a solution
of 10 % potassium peroxodisulfate and 1.5 per cent sodium hydroxide for 60 min at 121°C.
Soluble reactive phosphorus was determined using the molybdate-ascorbic acid method
(Greenberg et al. 1985).
Fatty acids — For the analysis of fatty acids in the prepared food suspensions approximately
1 mg POC were filtered onto pre-combusted GF/F filters (Whatman, 25 mm). Total lipids
were extracted three times from filters with dichloromethane/methanol (2:1, v/v). Pooled cellfree extracts were evaporated to dryness under a nitrogen stream. For the analysis of fatty
acids in the liposomes, aliquots of the liposome stock solutions were evaporated to dryness
directly. The lipid extracts were transesterified with 3 M methanolic HCl (60°C, 20 min).
Subsequently, fatty acid methyl esters (FAMEs) were extracted three times with 2 ml of isohexane. The lipid-containing fraction was evaporated to dryness under nitrogen and
resuspended in a volume of 20 µL iso-hexane. Lipids were analyzed by gas chromatography
on a HP 6890 GC equipped with a flame ionization detector (FID) and a DB-225 (J&W
Scientific, 30 m × 0.25 mm ID × 0.25 mm film) capillary column to analyse FAMEs. Details
of GC configurations for the analysis of FAMEs are given elsewhere (Martin-Creuzburg et al.
2010). FAMEs were quantified by comparison with an internal standard (C23:0 ME) of
known concentration, using multipoint standard calibration curves determined previously with
lipid standards (Sigma-Aldrich). FAMEs were identified by their retention times and their
mass spectra, which were recorded with a gas chromatograph-mass spectrometer (Agilent
Technologies, 5975C) equipped with a fused-silica capillary column (DB-225MS, J&W).
Spectra were recorded between 50 and 600 Dalton in the electron impact ionization mode.
The limit for quantitation of fatty acids was 20 ng. The absolute amount of each fatty acid was
related to the POC.
41
CHAPTER 3
Data analysis and statistics
Infection efficiencies were analyzed using a generalized linear model (GLM) with logit
function as the link function for binominal distribution. Treatment effects were evaluated by
assessing deviation from the grand mean. Numbers of offspring produced on the different
food regimes were analyzed using a GLM with log function as the link function for quasiPoisson distribution. To compensate for overdispersion the model was fitted using quasiPoisson errors (Crawley 2002). To specify differences among food regimes the subsets
“control” and “infected” were analyzed separately. For both GLMs, multiple comparisons
among food regimes were conducted with the ‘multcomp package’ in R (R Development Core
Team, 2010) using general linear hypotheses testing as an implementation of the framework
for simultaneous inference according to Hothorn et al. (2008). To test for differences in
within-host reproduction of the parasite between food treatments one-way analyses of
variance (ANOVA) were carried out followed by multiple comparisons (Tukey’s HSD);
assumptions for ANOVA were met. All analyses were performed using the statistical software
package R (v.2.12.0).
AUTHORS’ CONTRIBUTIONS
NS and DMC planned the experiment and wrote the manuscript. NS carried out the
experiments and analysed the data. DE contributed to the planning of the study, to the
interpretation of the results and to revising the manuscript. All authors approved the
publication of the study.
ACKNOWLEDGEMENT
We are grateful to Alexander Wacker for statistical advice and comments on the manuscript
and thank Bernd Kress and Rebecca Fies for experimental assistance. This work was
supported financially by the German Research Foundation (DFG, MA 5005/1-1). DE was
supported by the Swiss National Fund.
42
4
A DIETARY POLYUNSATURATED FATTY ACID INCREASES THE
RESISTANCE OF A FRESHWATER KEY HERBIVORE TO
PATHOGENIC INFECTIONS
Nina Schlotz, Michael Pester, Heike M. Freese, and Dominik Martin-Creuzburg
Published in FEMS Microbiology Ecology, 2014
ABSTRACT — A dietary deficiency in polyunsaturated fatty acids (PUFAs) and/or sterols
can severely constrain growth and reproduction of invertebrate consumers. Single nutrients
are potentially assigned to different physiological processes, for example to support defense
mechanisms; therefore, lipid requirements of healthy and pathogen-challenged consumers
might differ. In an oral exposure experiment we explored the effects of dietary PUFAs and
cholesterol on growth, reproduction, and survival of an aquatic key herbivore (Daphnia
magna) exposed to an opportunistic pathogen (Pseudomonas sp.). We show that healthy and
pathogen-challenged D. magna are strongly albeit differentially affected by the biochemical
composition of their food sources. Supplementation of a C20 PUFA-deficient diet with
arachidonic acid (ARA) resulted in increased survival and reproduction of pathogenchallenged D. magna. We propose that the observed benefit of consuming an ARA-rich diet
during pathogen challenge is conveyed partially via ARA-derived eicosanoids. This study is
one of the first to consider the importance of dietary PUFAs in modifying fitness parameters
of pathogen-challenged invertebrate hosts. Our results suggest that dietary PUFA supply
should receive increased attention in host-microbe interactions and invertebrate disease
models to better understand and predict disease dynamics in natural populations.
KEYWORDS — Food quality, gut pathogen, host resistance, intestinal microbiology
43
CHAPTER 4
INTRODUCTION
The natural diet of the freshwater keystone herbivore Daphnia consists of various
microorganisms, including both eukaryotic microalgae and prokaryotes (Lampert, 1987).
Depending on the environmental conditions, cyanobacteria and heterotrophic bacteria can
constitute a substantial share of lake seston (Simon et al., 1992, Paerl & Huisman, 2008,
Hartwich et al., 2012). The different blends of food organisms can crucially influence the
performance of the filter-feeder Daphnia, which is unable to discriminate between food
particles of different nutritional quality (DeMott, 1986).
Cyanobacteria and heterotrophic bacteria are of low food quality for Daphnia and other
aquatic consumers (Martin-Creuzburg et al., 2008, Martin-Creuzburg et al., 2011, Basen et
al., 2012, Taipale et al., 2012, Wenzel et al., 2012) since they lack sterols and are
characterized by a deficiency in long-chain polyunsaturated fatty acids (PUFAs) (Napolitano,
1998, Volkman, 2003). Both lipid classes, sterols and PUFAs, are indispensable structural
components of cell membranes (Clandinin et al., 1991, van Meer et al., 2008) and serve as
precursors for a large number of bioactive molecules. For instance, sterols serve as precursors
for the moult-inducing ecdysteroids in arthropods (Mykles, 2011) and certain C20 PUFAs –
including arachidonic acid (ARA, 20:4n-6) and eicosapentaenoic acid (EPA, 20:5n-3) – are
required as precursors for prostaglandins and other eicosanoids. Eicosanoids are involved in
reproduction, ion transport physiology and an array of defense mechanisms in vertebrates and
invertebrates (Stanley, 2000). In vertebrates, n-6 long-chain PUFAs are considered to
predominantly mediate pro-inflammatory processes and n-3 PUFAs are deemed to be their
anti-inflammatory counterparts (Calder, 2007, Schmitz & Ecker, 2008, Alcock et al., 2012).
Whether n-6 and n-3 PUFAs can be assigned similarly to differential functions with opposing
outcome in invertebrates has not yet been conclusively investigated. Nevertheless, long-chain
PUFAs of both families, like ARA and EPA, greatly impact growth and reproduction of
Daphnia (von Elert, 2002, Becker & Boersma, 2003, Martin-Creuzburg et al., 2010).
Besides being deficient in essential biochemicals, bacteria may be associated with consumers
as members of the natural gut microbiota or may act as pathogenic agents within their
consumers (Carmichael, 1994, Deines et al., 2009,Freese & Schink, 2011). Representatives of
the genus Pseudomonas, for instance, are ubiquitous and belong to the most common bacteria
in aquatic habitats (Pearce et al., 2005). While many Pseudomonas species are benign or even
beneficial, e.g. for plants (Mercado-Blanco & Bakker, 2007), some are notorious pathogens of
vertebrates and invertebrates, e.g. P. aeruginosa or P. entomophila (Ziprin & Hartman, 1971,
44
CHAPTER 4
Tan et al., 1999, Vodovar et al., 2005, Hardalo & Edberg, 1997, Ramos, 2004b). The
mechanisms of pathogenicity are manifold and can involve toxin production as well as
detrimental bacteremia, i.e. the presence and proliferation of bacteria in the blood (Tan et al.,
1999, Ramos, 2004c, a, Limmer et al., 2011, Le Coadic et al., 2012).
In Daphnia, Pseudomonas species have been identified as members of the intrinsic microbiota
(Qi et al., 2009, Freese & Schink, 2011). In its natural state, the gut microbiota of
invertebrates may benefit the host by, e.g., aiding digestion, producing vitamins or providing
protection from pathogens (e.g. Dillon et al., 2005, Pester et al., 2007, Koch & SchmidHempel, 2011). Disturbance of this natural balance between host and gut microbiota,
however, may facilitate growth and establishment of opportunistic pathogens (Stecher &
Hardt, 2008). Differences in lipid-mediated food quality can strongly influence the fitness of
consumers and affect the gut microbiota (Scott et al., 2013), may affect the outcome of hostparasite interactions (Schlotz et al., 2013), and even provide signals for the host inflammatory
machinery (Alcock et al., 2012). At the same time, there is evidence that some Pseudomonas
species have the potential to modulate eicosanoid production of its host, thereby interfering
with the host’s defense mechanisms (Vance et al., 2004).
Therefore, we raised the question whether supplementation of dietary lipids can ameliorate
fitness costs imposed by opportunistic pathogenic bacteria. To test this hypothesis we orally
exposed D. magna to a Pseudomonas strain, which was previously isolated from the gut of the
same clone of D. magna. This strain has been shown to be acutely detrimental for D. magna
regarding somatic growth and survival both when provided as the sole food source and in
combination with algae (Martin-Creuzburg et al., 2011, Freese & Martin-Creuzburg, 2013).
In an oral exposure experiment, in which the total dietary carbon provided was partially
substituted by Pseudomonas sp., we investigated if the ability of D. magna to cope with this
pathogenic threat is affected by the dietary sterol or PUFA supply. To disentangle general
nutritional constraints imposed by feeding on bacterial food sources (i.e. a sterol and PUFA
deficiency) from pathogenic effects, we additionally used the picocyanobacterium
Synechococcus elongatus as a non-pathogenic reference food. S. elongatus is non-toxic and
well-assimilated by Daphnia (Lampert, 1981), but, like the Pseudomonas strain, does not
contain sterols and PUFAs (Martin-Creuzburg et al., 2008, Martin-Creuzburg et al., 2011).
Both prokaryotes were provided in conjunction with the eukaryotic green alga Scenedesmus
obliquus, which is of moderate food quality for Daphnia primarily because it is deficient in
PUFAs with more than 18 carbon atoms (von Elert, 2002, Martin-Creuzburg et al., 2012). To
45
CHAPTER 4
unequivocally attribute food quality effects to certain lipids, the PUFAs ARA and EPA as
well as cholesterol were supplemented to the algal-bacterial food mixtures via liposomes.
Another alga (Nannochloropsis limnetica), rich in all of the examined lipids and thus of
superior food quality for Daphnia (Martin-Creuzburg et al., 2010), completed the set of
examined microorganisms. Bacterial effects on survival, somatic growth, and reproduction of
the consumer were recorded.
MATERIALS AND METHODS
Cultivation of food organisms and preparation of food suspensions
The green alga S. obliquus (culture collection of the University of Göttingen, Germany, SAG
276-3a) and the eustigmatophyte N. limnetica (SAG 18.99) were cultured semi-continuously
in modified Woods Hole (WC) medium (Guillard, 1975) with vitamins in aerated 5 L vessels
(20°C; dilution rate: 0.2 d-1; illumination: 100 µmol quanta m–2 s–1); S. elongatus was cultured
in Cyano medium (Jüttner et al., 1983) under the same conditions. The opportunistic pathogen
Pseudomonas sp. (strain DD1; 99.9% similarity to P. gessardii CIP 105469; NCBI accession
number NR_024928) was cultivated in a mineral medium using glucose as carbon source
(Martin-Creuzburg et al., 2011).
Food suspensions were prepared by centrifugation of the harvested cells and resuspension in
<0.2 µm filtrated Lake Constance water. Carbon concentrations of the food suspensions were
estimated from photometric light extinctions and from previously determined carbonextinction equations. The carbon – light extinction regressions were confirmed by subsequent
carbon analysis of the food suspensions.
Liposomes were produced and prepared as described in Martin-Creuzburg et al., 2009. The
amount of daily supplied ARA-containing liposomes was adjusted to an amount of ARA
comparable to what is found in the daily supplied N. limnetica food suspension in order to
create similar conditions with respect to this PUFA (Table 1). To be able to directly compare
effects of dietary ARA to those of EPA we did not provide the exceptionally high amounts of
EPA contained in N. limnetica (Table 1), but instead supplemented equal amounts of ARA
and EPA.
Chemical analyses of food organisms
Fatty acids and sterols. For the analysis of dietary fatty acids and sterols, ~ 1 mg particulate
organic carbon (POC) was filtered separately onto precombusted GF/F filters (Whatman, 25
mm). Filters were placed in 5 mL of dichloromethane:methanol (2:1, v:v) and stored at -20°C.
46
CHAPTER 4
Total lipids were extracted three times from sonicated filters with dichloromethane:methanol
(2:1, v:v). Pooled cell-free extracts were evaporated to dryness under a N2-atmosphere. The
lipid extracts were transesterified with methanolic HCl (3 M, 60°C, 15 min) for fatty acid
analysis or saponified with methanolic KOH (0.2 M, 70°C, 1 h) for sterol analysis.
Subsequently, fatty acid methyl esters (FAME) were extracted 3 times with iso-hexane (2
mL); the neutral lipids were partitioned into iso-hexane:diethyl ether (9:1, v:v). The lipidcontaining fraction was evaporated to dryness under N2 and resuspended in iso-hexane (10–20
µL). Lipids were analysed by gas chromatography (GC; Hewlett-Packard 6890TM) equipped
with a flame ionization detector (FID) and a DB-225 (J&W Scientific, 30 m × 0.25 mm inner
diameter (i.d.) × 0.25 µm film) capillary column for FAME analysis and with a HP-5
(Agilent, 30 m × 0.25 mm i.d. × 0.25 µm film) capillary column for sterol analysis. Details of
GC configurations are given elsewhere (Martin-Creuzburg et al., 2009, Martin-Creuzburg et
al., 2010). Lipids were quantified by comparison to internal standards (C23:0 ME; 5αcholestane) of known concentrations using multipoint standard calibration curves. Lipids were
identified by their retention times and their mass spectra, which were recorded with a GCmass spectrometer (7890A GC system, 5975C inert MSD, Agilent Technologies) equipped
with a fused-silica capillary column (DB-225MS, J&W for FAMEs; DB-5MS, Agilent for
sterols; GC configurations as described for FID). Sterols were analysed in their free form and
as their trimethylsilyl derivatives, which were prepared by incubating 20 µL of iso-hexane
sterol extract with 10 µL of N,O-bis(trimethylsilyl)trifluoroacetamide (BSTFA) including 1%
trimethylchlorosilane (TMCS) for 1 h at room temperature. Spectra were recorded between 50
and 600 amu in the electron impact (EI) ionization mode. The limit for quantitation of fatty
acids and sterols was 20 ng. The absolute amount of each lipid was related to POC.
Elemental composition. Aliquots of food suspensions were filtered onto precombusted glass
fibre filters (Whatman GF/F, 25 mm diameter) and analysed for POC and nitrogen using an
elemental analyser (EuroEA3000, HEKAtech GmbH, Wegberg, Germany). For the
determination of particulate phosphorus, aliquots were collected on acid-rinsed polysulphone
filters (HT-200; Pall, Ann Arbor, MI, USA) and digested with a solution of 10 % potassium
peroxodisulfate and 1.5 % sodium hydroxide for 60 min at 121°C. Soluble reactive
phosphorus was determined using the molybdate-ascorbic acid method (Greenberg et al.
1985).
47
CHAPTER 4
Experimental design
The life history experiment was conducted with a clone of Daphnia magna originally isolated
from Großer Binnensee, Germany (Lampert, 1991). Stock cultures were cultivated in filtrated
Lake Constance water (<0.2 µm) containing saturating amounts of S. obliquus (2 mg C L-1).
Experimental animals (third-clutch neonates born within 12 h) were kept individually in 80 ml
of 0.2 µm filtrated lake water (20°C, 16:8 h light:dark cycle). They were randomly assigned to
one of the following food regimes: (1) 100 % S. obliquus or N. limnetica; (2) S. obliquus or N.
limnetica of which 30 % of the provided carbon was exchanged by bacterial carbon
represented either by S. elongatus or Pseudomonas sp.; (3) The S. obliquus-S. elongatus or S.
obliquus-Pseudomonas sp. mixtures supplemented with single lipids (cholesterol, ARA, or
EPA) via liposomes. Liposomes not containing any C20 PUFAs or sterols served as control
supplements. Animals were transferred daily to fresh medium and freshly prepared food
suspensions. The experiment lasted for 21 days during which mortality and reproduction
(viable offspring) were recorded. The experiment started with 30 individuals per treatment;
six individuals of each treatment were subsampled at day 6 of the experiment to determine
somatic growth rates leaving 24 individuals per treatment for the determination of cumulative
numbers of viable offspring.
Data analyses
To determine somatic growth rates subsamples of the experimental animals were taken at the
beginning and at day 6 of the experiment, dried for 24 h, and weighed on an electronic
balance (Mettler Toledo XP2U; ± 0.1 µg). Juvenile somatic growth rates (g) were calculated
as the increase in dry mass from day 0 (M0) to day 6 (Mt) using the equation:
g
ln M t  ln M 0
t
.
Somatic growth rates and cumulative numbers of offspring of D. magna were analysed using
factorial analyses of variance (two-way ANOVA). The experimental factors were “algae”
(ANOVA1: S. obliquus, N. limnetica; ANOVA2: S. obliquus, N. limnetica, S. obliquus +
liposomes, ARA, EPA, or cholesterol) and “bacteria” (ANOVA1: none, S. elongatus,
Pseudomonas sp.; ANOVA2: S. elongatus, Pseudomonas sp.). In the first ANOVA, we
analysed the effects associated with the exchange of 30 % of total provided carbon by the
bacteria by comparing growth rates or offspring numbers obtained on the pure algal diets S.
obliquus and N. limnetica with those obtained on the mixtures S. obliquus-S. elongatus, S.
obliquus-Pseudomonas sp., N. limnetica-S. elongatus, N. limnetica-Pseudomonas sp.
48
CHAPTER 4
(ANOVA1; Table 3). In the second ANOVA, we analysed the effects of supplementation by
comparing the results obtained on the mixtures S. obliquus-S. elongatus and S. obliquusPseudomonas sp. with those obtained on the mixed diets supplemented with control
liposomes, cholesterol-, ARA-, or EPA-containing liposomes. In addition, to evaluate the
obtained effects of supplementation, the mixed diets N. limnetica-S. elongatus and N.
limnetica-Pseudomonas sp. were included in the second analysis (ANOVA2; Table 3 and Fig.
3). Somatic growth rates were log-transformed and offspring numbers were square root
transformed to meet the assumptions of ANOVA. In ANOVA2, homogeneity of variances
could not be accomplished by data transformation. However, in large experiments with
balanced data the ANOVA is robust to departures from its assumptions (Underwood, 2006)
and thus the non-heterogeneity of variances was ignored. Treatment effects were tested by
Tukey’s honestly significant difference (HSD) post hoc tests. Effects of “algae” and
“bacteria” on the survival of D. magna were analysed using a generalized linear model
(GLM) and the logit link function for binominal distribution. All analyses were carried out
using the statistical software package R (v.2.12.0).
RESULTS
Element ratios and lipid profiles of food organisms
The algal and especially bacterial food sources were characterized by high nitrogen and
phosphorus contents, resulting in low carbon to nitrogen (C:N) and carbon to phosphorus
(C:P) ratios (means ± s.d.; S. obliquus: C:N 5.9 ± 0.0, C:P 103.4 ± 2.1; N. limnetica: C:N 7.9
± 0.1, C:P 151.0 ± 1.2; S. elongatus: C:N 5.0 ± 0.1, C:P 72.7 ± 0.3; Pseudomonas sp.: C:N 4.4
± 0.0, C:P 36.6 ± 2.1). As saturating amounts of food (2 mg C L-1) were provided daily and as
the C:N and C:P ratios of the food sources were clearly below any published thresholds (C:N
> 20; C:P > 200) for N- or P-limited growth (Sterner & Elser, 2002), a limitation of D. magna
by C, N or P in our experiment is very unlikely.
PUFA and sterol profiles of the two algae differed considerably (Table 1). S. obliquus
contained linoleic acid (LIN, 18:2n-6), γ-linolenic acid (GLA, 18:3n-6), stearidonic acid
(STA, 18:4n-3), and high concentrations of α-linolenic acid (ALA, 18:3n-3), but no PUFA
with more than 18 C atoms. In contrast, the PUFA composition of N. limnetica was
characterized by moderate concentrations of ARA and exceptionally high concentrations of
EPA. The concentrations of LIN and GLA in N. limnetica were comparable to those of S.
obliquus, but the concentration of ALA was notably lower (Table 1).
49
CHAPTER 4
Table 1 Lipid composition (PUFAs and sterols) of S. obliquus, of the sterol- or PUFA-containing
liposomes used for supplementation (= +cholesterol, +ARA, +EPA), and of N. limnetica. Data are
means of three replicates ± s.d. in µg mg C-1 (n.d. = not detectable). No PUFAs or sterols were
detected in S. elongatus, Pseudomonas sp. or control liposomes.
S. obliquus
+ cholesterol
+ ARA
+ EPA
N. limnetica
18:2n-6 (LIN)
14.77 ± 0.75
n.d
n.d
n.d
14.68 ± 0.13
18:3n-6 (GLA)
1.81 ± 0.07
n.d
n.d
n.d
1.84 ± 0.01
18:3n-3 (ALA)
110.07 ± 5.85
n.d
n.d
n.d
2.13 ± 0.04
18:4n-3 (STA)
7.73 ± 0.39
n.d
n.d
n.d
n.d.
20:3n-6 (DGLA)
n.d.
n.d
n.d
n.d
2.17 ± 0.01
20:4n-6 (ARA)
n.d.
n.d
29.20 ± 0.34
n.d
24.33 ± 0.45
20:5n-3 (EPA)
n.d.
n.d
n.d
28.05 ± 2.35
186.08 ± 3.68
fungisterol
4.67 ± 0.58
n.d
n.d
n.d
n.d.
chondrillasterol
8.71 ± 0.84
n.d
n.d
n.d
n.d.
schottenol
0.93 ± 0.33
n.d
n.d
n.d
n.d.
cholesterol
n.d.
15.82 ± 1.33
n.d
n.d
11.64 ± 0.31
sitosterol
n.d.
n.d
n.d
n.d
2.53 ± 0.03
isofucosterol
n.d.
n.d
n.d
n.d
3.04 ± 0.26
Principal sterols found in S. obliquus were fungisterol (5α-ergost-7-en-3β-ol) and
chondrillasterol ((22E)-5α-poriferasta-7,22-dien-3β-ol), together with lower amounts of
schottenol (5α-stigmast-7-en-3β-ol). N. limnetica contained, in addition to the two
phytosterols sitosterol (stigmast-5-en-3β-ol) and isofucosterol ((24Z)-stigmasta-5,24(28)dien-3β-ol), notable amounts of cholesterol (cholest-5-en-3β-ol), the main sterol found in
animals (Table 1). In S. elongatus and Pseudomonas sp., PUFA or sterols could not be
detected. Liposomes did not contain any lipids apart from phospholipid-derived fatty acids
(16:0 and 18:1n-9) and the respective added PUFA or cholesterol. In relation to carbon, the
amounts of ARA and cholesterol supplied via liposomes were comparable to those provided
with N. limnetica (Table 1). As intended, the amount of EPA supplied via liposomes equalled
the amount of ARA.
Performance of D. magna
Survival of D. magna was strongly affected by Pseudomonas sp. When raised on S. obliquusPseudomonas sp., only 29 % of the animals survived until the end of the experiment (Fig. 1a).
In contrast, when raised on N. limnetica-Pseudomonas sp., mortality was absent (Fig. 1b).
50
CHAPTER 4
Figure 1 Survival of D. magna raised on (A) S. obliquus (Scen) or (B) N. limnetica (Nanno) and on
70:30 % mixtures (with respect to total provided carbon) with S. elongatus (Syn) or Pseudomonas sp.
(Pseudo) and on (C) the S. obliquus- Pseudomonas sp. mixture supplemented with control liposomes
(+lipo), and cholesterol-, ARA-, or EPA-containing liposomes (+ chol/ARA/EPA). Mortality on the
supplemented S. obliquus-S. elongatus-mixtures did not differ from the unsupplemented S. obliquus-S.
elongatus treatment (data not shown). Note, all treatments were performed together in one experiment,
but are shown here in three graphs for better presentation.
51
CHAPTER 4
Exchanging 30 % of the provided carbon by S. elongatus in S. obliquus- or N. limnetica-based
diets did not affect survival. Supplementation of S. obliquus-Pseudomonas sp. with ARA
significantly increased survival (71 %; Fig. 1c, Table 2). In contrast, neither cholesterol- nor
EPA-supplementation increased survival in the S. obliquus-Pseudomonas sp. treatment.
Survival rates of animals fed the S. obliquus-S. elongatus mixtures were not affected by lipid
supplementation (Table 2b; data not shown). Additional pairwise comparisons revealed that
survival rates did not differ between S. obliquus and N. limnetica (p = 0.899), between
unsupplemented and with control liposome-supplemented S. obliquus-S. elongatus mixtures
(p = 0.476), between unsupplemented and with control liposome-supplemented S. obliquusPseudomonas sp. mixtures (p = 0.247), and also not between the N. limnetica-Pseudomonas
sp. and the ARA-supplemented S. obliquus- Pseudomonas sp. mixtures (p = 0.033; not
significant after Bonferroni adjustment).
Figure 2 Somatic growth rates of D. magna raised on S. obliquus (Scen) or N. limnetica (Nanno)
(black bars) or on 70:30 % mixtures (with respect to total provided carbon) with S. elongatus (grey
bars) or Pseudomonas sp. (hatched bars). Labels on the x-axis indicate food treatments. S. obliquus-S.
elongatus and S. obliquus-Pseudomonas sp. mixtures were supplemented using liposomes (w/o =
without liposome supplementation; + lipo = control liposomes; + chol/ARA/EPA = supplementation
with cholesterol, ARA or EPA, respectively). Data are means of 6 replicates ± s.d. Bars labelled with
the same letters are not significantly different (Tukey’s HSD test, p < 0.05 following ANOVA; lower
case letters: ANOVA1, upper case letters: ANOVA2; cf. Table 3).
52
CHAPTER 4
Juvenile somatic growth rates of animals raised on N. limnetica were significantly higher than
those of animals raised on S. obliquus (Fig. 2). Growth rates obtained on the algal mixtures
with S. elongatus did not differ from those obtained on the respective alga alone (Table 3).
When fed the S. obliquus-Pseudomonas sp. mixture, somatic growth rates were significantly
reduced by 64 %, when fed N. limnetica-Pseudomonas sp. by 49 % (compared to the
respective alga-S. elongatus control; Fig. 2). Supplementation of S. obliquus-S. elongatus with
ARA and EPA significantly increased somatic growth rates. In contrast to the effect observed
on survival, we could not find a significant effect of any of the supplemented lipids on
somatic growth of Pseudomonas sp.-exposed animals (Fig. 2).
Figure 3 Cumulative numbers of viable offspring produced by D. magna within the experimental
period (21 d) on S. obliquus (Scen) or N. limnetica (Nanno) (black bars) or on 70:30 % mixtures (with
respect to total provided carbon) with S. elongatus (grey bars) or Pseudomonas sp. (hatched bars).
Labels on the x-axis indicate food treatments. S. obliquus-S. elongatus and S. obliquus-Pseudomonas
sp. mixtures were supplemented using liposomes (w/o = without liposome supplementation; + lipo =
control liposomes; + chol/ARA/EPA = supplementation with cholesterol, ARA or EPA, respectively).
Data are means of 24 replicates ± s.d. Bars labelled with the same letters are not significantly different
(Tukey’s HSD test, p < 0.05 following ANOVA; lower case letters: ANOVA1, upper case letters:
ANOVA2; cf. Table 3).
The cumulative numbers of viable offspring produced by D. magna during the experiment
were significantly higher when fed N. limnetica than when fed S. obliquus (Table 3, Fig. 3).
The presence of 30 % S. elongatus in both algal food mixtures did not impact reproduction
(Table 3). Supplementation of the S. obliquus-S. elongatus mixture with cholesterol
53
CHAPTER 4
significantly increased offspring production, but offspring numbers increased even more upon
supplementation with ARA and EPA. The cumulative numbers of viable offspring produced
on cholesterol-, ARA- and EPA-supplemented S. obliquus-S. elongatus mixtures did not
significantly differ from those produced on N. limnetica (Fig. 3). In the presence of
Pseudomonas sp., offspring production was drastically reduced, but animals fed N. limnetica
produced significantly more offspring than animals fed S. obliquus. We did not find beneficial
effects of cholesterol or EPA on reproduction when given as supplement along with the S.
obliquus-Pseudomonas sp. mixture. However, supplementation with ARA significantly
increased offspring production in Pseudomonas sp.-exposed animals. The numbers of viable
offspring produced on the ARA-supplemented S. obliquus-Pseudomonas sp. mixture did not
differ significantly from those produced on the N. limnetica-Pseudomonas sp. mixture (Fig.
3).
DISCUSSION
Pathogens immensely impair growth, fecundity and survival of their hosts and thus can
crucially affect population dynamics. Members of the genus Daphnia are keystone species in
freshwater food webs, where they play a major role in the transfer of biomass from primary
producers to higher trophic levels. Moreover, Daphnia species have become important model
organisms to study evolutionary phenomena, such as co-evolution in host-pathogen
interactions. Consequently, assessing the potential of pathogens to impair Daphnia life history
traits and to understand the underlying physiological mechanisms is of great ecological and
evolutionary interest. Host nutrition presumably impacts both the host and its pathogens,
implying complex resource-consumer-microbe interactions (Cory & Hover, 2006).
It has been demonstrated that bacterial food sources, i.e. cyanobacteria and heterotrophic
bacteria, are of poor quality for Daphnia due to the absence of essential lipids and hence do
not sustain growth and reproduction to the same extent as eukaryotic food sources (MartinCreuzburg et al., 2008, Martin-Creuzburg et al., 2011). To disentangle these nutritional
constraints from pathogenic effects we compared life history traits of D. magna exposed to
the opportunistic bacterial pathogen Pseudomonas sp. with life history traits of animals
exposed to the non-toxic cyanobacterium S. elongatus. As the partial substitution of algal for
cyanobacterial carbon did not provoke any fitness impairment we concluded that adverse
effects seen in the presence of Pseudomonas sp. can specifically be attributed to its
pathogenicity and not generally to a lack of essential nutrients.
54
CHAPTER 4
Table 2 Comparison of survival rates of D. magna raised on different food sources using a
generalized linear model. (a) Survival of D. magna fed the eukaryotic algae S. obliquus (Scen) or N.
limnetica (Nanno) (references) in comparison to the survival on algal-based diets containing 30 % of
prokaryotic carbon, i.e. either S. elongatus (Syn) or Pseudomonas sp. (Pseudo). (b) Survival of D.
magna fed S. obliquus (Scen) in mixtures with either S. elongatus (Syn) or Pseudomonas sp. (Pseudo)
supplemented with control liposomes (reference) in comparison to survival obtained by
supplementing either cholesterol-, ARA-, or EPA-containing liposomes (* = significant after
Bonferroni adjustment).
(a)
Scen + bacteria
Nanno + bacteria
(Reference: Scen)
(Reference: Nanno)
z-value
p-value
z-value
p-value
(intercept)
8.233
< 0.001
7.271
< 0.001
time
-1.773
0.076
-0.996
0.319
+ Syn
2.182
0.029
-0.463
0.643
+ Pseudo
-0.687
0.492
-1.172
0.241
time*Syn
-0.924
0.355
0.686
0.493
time*Pseudo
-4.416
< 0.001*
-0.254
0.800
(b)
Scen + Syn supplemented
Scen + Pseudo supplemented
(Reference: Scen+Syn+lipo)
(Reference: Scen+Pseudo+lipo)
z-value
p-value
z-value
p-value
(intercept)
7.769
< 0.001
9.937
< 0.001
time
-1.512
0.130
-10.578
< 0.001
+ cholesterol
0.449
0.654
0.257
0.797
+ ARA
0.031
0.976
1.582
0.114
+ EPA
-0.104
0.917
0.328
0.743
time*cholesterol
-0.177
0.860
0.041
0.967
time*ARA
0.955
0.340
2.975
0.003*
time*EPA
0.954
0.340
1.057
0.290
When exposed to Pseudomonas sp., the probability of survival, somatic growth rates, and
offspring production of D. magna were all drastically reduced. The extent of this reduction
was clearly affected by the food treatment. The ability to resist the adverse effects of
Pseudomonas sp. exposure was most pronounced in the presence of N. limnetica, in particular
with respect to survival. This provides strong evidence for a diet-induced resistance to an
opportunistic pathogen. A similar dietary impact on the outcome of infection has been
reported recently in a study using Pasteuria ramosa, a bacterial parasite of D. magna (Schlotz
et al., 2013). The effect of PUFA supplementation in the present study suggests that the
55
CHAPTER 4
increased resistance to Pseudomonas sp. on a N. limnetica-containing diet is at least partially
due to the availability of ARA in N. limnetica, because the enrichment of S. obliquus with
ARA significantly reduced the pathogen-induced mortality and fecundity loss. However, as
effects obtained by ARA supplementation never completely matched those on a N. limneticabased diet other factors must contribute to the protective effect. For example, EPA was not
provided in the same amounts as present in N. limnetica; likewise, additive or synergistic
effects of combined ARA and EPA provision cannot be excluded. Furthermore, the n-6 to n-3
ratio might be important and the optimal ratio may vary with the presence and kind of
pathogenic agents. Therefore, future investigations should consider potential effects of dietary
nutrient mixing on the performance of Daphnia under pathogen challenge.
Table 3 Results of factorial analysis of variance (ANOVA) of somatic growth rates and cumulative
numbers of offspring of D. magna raised on different food regimes. ANOVA1: effects associated with
the exchange of 30 % of total provided carbon by bacterial carbon; comprised the two algae S.
obliquus and N. limnetica (= algae), as sole food source or as mixtures of each alga with either S.
elongatus or Pseudomonas sp. (= bacteria) as categorical variables. ANOVA2: effects of lipid
supplementation; comprised S. obliquus, N. limnetica, S. obliquus supplemented with control
liposomes, cholesterol-, ARA-, and EPA-containing liposomes (= algae) as mixtures of each food
treatment with either S. elongatus or Pseudomonas sp. (= bacteria) as categorical variables.
somatic growth rate
Algae only
(ANOVA1)
cumulative number of offspring
df
SS
F
p
df
SS
F
p
algae
1
0.252
331.4
< 0.001
1
198.40
199.7
< 0.001
bacteria
2
0.056
368.8
< 0.001
2
1526.3
768.0
< 0.001
algae × bacteria
2
0.0001
0.5
0.592
2
7.68
3.9
0.023
residuals
30
0.002
133
132.16
algae
5
0.035
32.1
< 0.001
5
326.4
46.8
< 0.001
bacteria
1
0.188
850.3
< 0.001
1
4740.5
3401.8
< 0.001
algae × bacteria
5
0.004
3.8
0.005
5
116.5
16.7
< 0.001
residuals
60
0.013
271
377.6
Supplemented
(ANOVA2)
Concerning somatic growth and reproduction, N. limnetica was the superior food source to S.
obliquus, irrespective of the bacterial food source present. In animals not exposed to
Pseudomonas sp., supplementation of both ARA and EPA increased somatic growth rates and
offspring numbers at least up to the level obtained on a N. limnetica diet, indicating that the
moderate food quality of S. obliquus is due to the absence of C20 PUFA, which corroborates
56
CHAPTER 4
previous studies on the effects of PUFAs on Daphnia life history traits (von Elert, 2002,
Martin-Creuzburg et al., 2012). Although to a lower extent than upon PUFA supplementation,
offspring numbers also increased upon cholesterol supplementation, suggesting that animals
raised on the S. obliquus–S. elongatus mixtures were simultaneously limited by C20 PUFA
and sterols, as has been reported previously for diets consisting solely of the cyanobacterium
S. elongatus (Martin-Creuzburg et al., 2009, Sperfeld et al., 2012).
In pathogen-exposed animals, a distinct pattern diverging from this general beneficial lipid
supplementation effect was observed. When exposed to Pseudomonas sp., offspring
production on a S. obliquus-based diet increased upon ARA supplementation up to the level
obtained on a N. limnetica-based diet. However, the addition of EPA or cholesterol to the S.
obliquus-Pseudomonas sp. mixture did not improve reproduction. Together with the reduced
mortality observed on the ARA-supplemented diet, this suggests that a dietary source of ARA
is crucial not only for reproduction but also for sustaining resistance to pathogenic threats. As
ARA gives rise to eicosanoids mediating important reproductive and immunological functions
(Stanley, 2000, Machado et al., 2007, Hayashi et al., 2008, Tootle & Spradling, 2008, Zhao et
al., 2009, Wimuttisuk et al., 2013), we hypothesize that the increased resistance of D. magna
to Pseudomonas sp. on ARA-containing diets is related to the host’s eicosanoid repertoire. A
possible involvement of eicosanoids in host-pathogen interactions – either through
modulation by the pathogen or through mediation of host defense mechanisms – is especially
intriguing, because this could assign a major role to dietary PUFAs as eicosanoid precursors
in influencing the outcome of a bacterial challenge. In vertebrates, eicosanoids synthesized
from ARA and EPA have different functions and partially even opposing effects, best
described regarding their pro- versus anti-inflammatory activity (Schmitz & Ecker, 2008,
Alcock et al., 2012). Assuming similar processes in Daphnia, this may explain why EPAsupplementation failed to induce the same effect as seen upon ARA-supplementation.
The potential of algal food sources differing in their C20 PUFA content to modulate gene
expression related to eicosanoid synthesis has been demonstrated recently (Schlotz et al.
2012). In contrast to earlier research employing eicosanoid biosynthesis inhibitors (e.g.
Carton et al., 2002, Garcia et al., 2004, Heckmann et al., 2008, Merchant et al., 2008, Zhao et
al., 2009), we here varied the dietary supply of eicosanoid precursors and thus show that
dietary ARA can crucially influence consumer performance under pathogen challenge. The
exact mechanism of pathogenesis of Pseudomonas sp. (strain DD1) in D. magna remains to
be elucidated. However, additional experiments suggest that viable bacterial cells are required
to mediate the observed pathogenicity during an infection process, since the pathogenicity of
57
CHAPTER 4
Pseudomonas strain DD1 can be abrogated by heat-inactivating the bacterial cells prior to
exposure (supplementary information S1). Hence, the involvement of toxic secondary
metabolites seems unlikely although we cannot exclude that the observed harmful effects on
D. magna are mediated by heat-sensitive toxins. The mechanism may resemble that observed
in Drosophila melanogaster after ingestion of another pathogenic Pseudomonas species, P.
aeruginosa. Here, bacteria crossed the gut barrier, proliferated in the haemolymph and caused
severe bacteremia (Limmer et al., 2011). In this case, innate immune functions would become
effective in an attempt to control intestinal damage and systemic infection. Many invertebrate
defense mechanisms, i.e. nodulation response, prophenoloxidase cascade, encapsulation
reaction, phagocytosis, and hemocyte migration, have been shown to rely on eicosanoid
action (Stanley-Samuelson et al., 1991, Mandato et al., 1997, Stanley-Samuelson et al., 1997,
Carton et al., 2002, Garcia et al., 2004, Merchant et al., 2008, Zhao et al., 2009, Shrestha et
al., 2010) and thus can potentially be modulated by the availability of dietary precursor
PUFAs.
An alternative explanation for the increased resistance to the bacterial pathogen on ARAcontaining diets could be the bactericidal activity of PUFAs per se. In their free form, PUFAs
can impair important cell membrane properties, inhibit the activity of enzymes, and damage
bacterial cells via peroxidation or auto-oxidation products (Desbois & Smith, 2010). While
Gram-positive bacteria seem to be particularly susceptible to PUFA-induced mortality, reports
on the susceptibility of Gram-negative bacteria, such as Pseudomonas sp., are conflicting, as
are reports on the effectiveness of different PUFAs in acting as anti-bacterial agents (Kabara
et al., 1972, Knapp & Melly, 1986, Giamarellos-Bourboulis et al., 1998). In general, PUFAs
with a higher degree of desaturation tend to be more effective (Kabara et al., 1972). Thus,
assuming that the effects observed in our study can be attributed to a general bactericidal
activity of free PUFAs, one would expect equal responses on both ARA- and EPA-containing
diets. However, EPA-supplementation did not improve the resistance of D. magna, at least not
at the amount provided in our experiment via supplementation. Pure culture growth
experiments in which Pseudomonas sp. (strain DD1) was challenged with PUFA-containing
liposomes did not reveal any inhibitory effects and thus clearly argue against a direct
bactericidal activity of the PUFA-containing liposomes (supplementary information S2).
Qualitative plate diffusion tests also did not reveal any bactericidal activity of the PUFAcontaining liposomes or of free PUFAs on this Pseudomonas strain (supplementary
information S3). Moreover, a grazing-induced release of allelochemicals out of N. limnetica is
very unlikely: we did neither find evidence for growth inhibitory effects of intact or disrupted
58
CHAPTER 4
algal cells on Pseudomonas strain DD1 (supplementary information S3) nor for the release of
free PUFAs out of N. limnetica after cell damage (G. Pohnert, unpublished data).
It has been recognized that interactions between hosts and their parasites are affected by food
quality constraints both in model systems and natural populations (Frost et al., 2008, Hall et
al., 2009, Schlotz et al., 2013). Here, we provide a potential link between nutritional
constraints for the host and the outcome of pathogenic infections by showing that the
availability of a single dietary PUFA affects the ability of Daphnia to resist pathogenic
challenges. Considering the well-established positive effects of dietary PUFAs on growth and
in particular reproduction of Daphnia, this implies that dietary PUFA deficiencies severely
affect the consumer, its associated symbionts and pathogens, and in consequence population
dynamics and thus food web processes.
ACKNOWLEDGEMENT
We thank Alexander Wacker and Dieter Ebert for much appreciated advice, fruitful
discussions, and valuable comments on the manuscript. Georg Pohnert generously tested the
potential release of allelochemicals from N. limnetica following cell disruption. Bernd Kress,
Petra Merkel, Sylke Wiechmann, Antje Wiese, and Susanne Wörner provided excellent
technical assistance. This work was supported financially by the German Research
Foundation (DFG, MA 5005/1-1, PE 2147/1-1) and the Zukunftskolleg of the University of
Konstanz).
59
CHAPTER 4
SUPPLEMENTARY INFORMATION 1 – Pathogenicity of Pseudomonas sp. (DD1)
To test whether the pathogenicity of the Pseudomonas strain DD1 is connected to viable
pathogenic bacteria or simply to one of their cell constituents, D. magna were reared either on
the green alga S. obliquus alone or on dietary mixtures containing intact or heat-inactivated
bacteria.
A
B
Figure S2: Survival (A) and offspring production (B) of D. magna reared on S. obliquus (Scen), a
mixture of S. obliquus and Pseudomonas sp. (DD1) (Scen + Pseudo, 70% + 30% in terms of carbon),
or on a mixture of S. obliquus and heat-inactivated Pseudomonas sp. (DD1) (Scen + Pseudo HI, 70 %
+ 30 %). Offspring production is expressed as the cumulative number of offspring that were produced
in the first and the second clutch. Heat inactivation was achieved by incubating the bacterial
suspension in a water bath at 80°C for 30 minutes. Preliminary experiments at lower temperatures and
shorter heat-inactivation times revealed that these conditions are required to fully inactivate the
growth of Pseudomonas sp. (DD1) (data not shown).
The results of this experiment show that the pathogenicity of Pseudomonas sp. (DD1) can be
abrogated by heat-inactivating the bacterial cells. Based on this experiment one may conclude
that active cells are required to mediate the observed pathogenicity during an infection
process. However, it cannot be excluded that the pathogenicity is mediated by heat-labile
harmful secondary metabolites.
60
CHAPTER 4
SUPPLEMENTARY INFORMATION 2 – Growth response of Pseudomonas sp.
(DD1) to PUFA-containing liposomes
The Pseudomonas strain DD1 was cultured either in the absence or presence of different
PUFA-containing liposomes in order to assess potential bactericidal effects of the PUFAcontaining liposomes used in the Daphnia infection experiment.
Figure S1: Growth response curves of Pseudomonas sp. (DD1) recorded for a period of 26 h (22°C,
pH 7.2). Pseudomonas sp. (DD1) was cultured in mineral medium containing 20 mM glucose in the
absence (control) or in the presence of liposomes. Liposomes were either free of PUFAs (lipo) or were
enriched with arachidonic acid (ARA) or eicosapentaenoic acid (EPA). Liposomes were tested in two
different concentrations: low = concentration as in the experimental beakers in which Daphnia were
exposed to Pseudomonas sp. (DD1); high = concentration ten times higher than in the experimental
beakers. The experiment was conducted in test tubes containing 7 ml of medium (four replicates)
placed on a shaker; the optical density (OD) was recorded at 600 nm.
The addition of liposomes to the bacterial cultures did not affect the growth of Pseudomonas
sp. (DD1), irrespective of the concentration and of whether they contained PUFAs. This
suggests that the presence of PUFA-containing liposomes did neither impair nor improve the
growth of Pseudomonas sp. (DD1) in our infection experiments, which supports the
hypothesis that the increased resistance of the host is due to the dietary PUFA supply rather
than to a direct bactericidal activity of the supplemented PUFAs. Liposomes were used as a
vehicle to provide experimental animals with dietary PUFAs and to avoid potential harmful
effects of free PUFAs on Daphnia. It should be noted that the use of liposomes may have
prevented direct contact between bacterial cells and PUFAs and thus a potential bactericidal
activity on Pseudomonas sp. (DD1).
61
CHAPTER 4
SUPPLEMENTARY INFORMATION 3 – Agar diffusion assay
To investigate whether Pseudomonas strain DD1 is inhibited in the presence of the two algae
S. obliquus and N. limnetica, the PUFA-containing liposomes, or free PUFAs, qualitative agar
diffusion assays were conducted.
1: EtOH
2: Arachidonic acid (ARA; in EtOH)
3: Eicosapentaenoic acid (EPA; in
EtOH)
4: Liposomes (control)
5: ARA (liposomes)
6: EPA (liposomes)
7: S. obliquus (Scen; concentration as
in main experiment; not shown)
8: N. limnetica (Nanno; concentration
as in main experiment; not shown)
9: Scen (10x higher concentrated)
10: Nanno (10x higher concentrated)
Figure S3: Agar diffusion assay to test for a potential inhibition of Pseudomonas sp. (DD1) by free
PUFAs, PUFA-containing liposomes, or the two algae S. obliquus (Scen) and N. limnetica (Nanno).
Aliquots (50 µl) of a liquid overnight culture of Pseudomonas sp. (DD1) were spread evenly on plates
(5 replicates; M1 medium: 8 g nutrient broth + 15 g agar L-1). Each well was loaded with 50 µl of the
respective stock solutions and the formation of inhibitions zones was recorded after 48 h of
incubation. 2 + 3 = free PUFAs (both from stock solutions dissolved in ethanol, 2.5 mg ml -1), 5 + 6 =
PUFA-containing liposomes (from the stock solutions used in the Daphnia experiment), 9 + 10 =
algae. Ethanol (1) and PUFA-free liposomes (4) served as reference treatments.
The results show that free PUFAs dissolved in ethanol inhibit the growth of Pseudomonas sp.
(DD1). However, the zones of inhibition did not differ from the ethanol control treatment,
suggesting that inhibition is mediated by ethanol rather than by the dissolved free PUFAs. The
PUFA-free as well as the PUFA-containing liposomes led to an increased growth of
Pseudomonas sp. (DD1) at the contact zones, suggesting that the bacteria metabolized the
phospholipids that were used to prepare the liposomes. S. obliquus and N. limnetica (in 1×
and 10× concentrations) did not influence the growth of Pseudomonas sp. (DD1), suggesting
that both algae did not impose allelopathic effects on Pseudomonas sp. (DD1). Additional
agar diffusion assays, in which intact and partially disrupted (sonicated) algal cells were
tested, also did not reveal allelopathic effects on Pseudomonas sp. (DD1) (data not shown),
suggesting that wound-activated allelopathic chemicals are also not produced by these algae
(cf. Pohnert 2005, Chem Bio Chem 6: 946-959).
62
5
EFFECTS OF DIETARY POLYUNSATURATED FATTY ACIDS AND
PARASITE CHALLENGE ON EICOSANOID-RELATED GENE EXPRESSION
Nina Schlotz, Anne Roulin, Dieter Ebert, and Dominik Martin-Creuzburg
ABSTRACT — Eicosanoids play crucial roles in reproduction and immunity of both
vertebrates and invertebrates. Their precursors, C20 polyunsaturated fatty acids (PUFAs), are
essential dietary compounds sustaining optimal growth and reproductive success of
consumers. Although frequently implied, effects of dietary PUFAs on invertebrate eicosanoid
biosynthesis have not been conclusively investigated. Here, using the freshwater keystone
herbivore Daphnia, we applied a target gene expression approach to assess if differences in
PUFA-mediated food quality (i.e. precursor availability) and/or parasite challenge (i.e.
activation of the immune system) result in differential expression of genes coding for key
enzymes in the eicosanoid biosynthesis pathway. We raised juvenile D. magna on food
sources naturally differing in their PUFA content and provided arachidonic acid (ARA) or
eicosapentaenoic acid (EPA) as dietary supplements along with a PUFA-deficient diet. In
addition, animals were exposed to endospores of the castrating bacterial parasite Pasteuria
ramosa. The expression of ten target genes related to eicosanoid biosynthesis and three target
genes involved in oogenesis was recorded 12 and 24 hours post exposure. We show that Coxlike gene expression appeared to be especially responsive to both dietary C20 PUFA
availability and parasite challenge, suggesting a role for prostanoid eicosanoids in
reproduction and immunity of Daphnia. Gene expression further downstream the eicosanoid
pathway revealed only minor changes in response to food treatment and parasite exposure.
Vitellogenin expression was clearly induced upon parasite exposure, suggesting a possible
involvement in pathogen recognition. Our findings underpin the idea that PUFA-mediated
differences in food quality can modulate consumer defence mechanisms in this model system.
KEYWORDS — Daphnia magna, eicosanoids, Pasteuria ramosa, polyunsaturated fatty
acids, prostaglandins, vitellogenin
63
CHAPTER 5
INTRODUCTION
Eicosanoids modulate reproduction, immunity and ion transport physiology of both
vertebrates and invertebrates (Stanley 2000, Funk 2001). Polyunsaturated fatty acids
(PUFAs), such as arachidonic acid (ARA) and eicosapentaenoic acid (EPA), serve as
precursors for eicosanoids. Numerous studies revealed a strong impact of dietary PUFAs on
human reproduction and immunity (e.g. Calder 1998, de Pablo and de Cienfuegos 2000,
Calder 2007, Wathes et al. 2007). In invertebrates, there is only limited evidence that
eicosanoid biosynthesis is responsive to the dietary PUFA supply (Schlotz et al. 2012).
However, the physiological and ecological consequences of dietary PUFA availability are
potentially high (Burr and Burr 1930, Fraenkel and Blewett 1947, Müller-Navarra et al. 2000,
Wacker and Von Elert 2001, Martin-Creuzburg et al. 2012) and the occurrence of eicosanoids
has been thoroughly documented for many species (Stanley 2000, Rowley et al. 2005). In
Daphnia, eicosanoids have been proposed to be involved in reproduction due to the positive
effects of dietary ARA and EPA on offspring production (Martin-Creuzburg et al. 2010), and
because reproductive processes have been shown to depend on eicosanoid action in other
arthropod models systems, including some crustaceans (Loher et al. 1981, Sagi et al. 1995,
Medeiros et al. 2004, Reddy et al. 2004, Tahara and Yano 2004, Machado et al. 2007,
Hayashi et al. 2008, Tootle and Spradling 2008). Furthermore, an ever-growing amount of
literature suggests that various immune mechanisms of invertebrates are also orchestrated
through the action of prostaglandins and other eicosanoids (Stanley-Samuelson et al. 1991,
Miller et al. 1994, Mandato et al. 1997, Morishima et al. 1997, Carton et al. 2002, Dean et al.
2002, Garcia et al. 2004, Merchant et al. 2008, Shrestha et al. 2010, Hyrsl et al. 2011, Kim
and Kim 2011) and more recently it has been reported that dietary PUFAs have the potential
to influence host-parasite interactions (Schlotz et al. 2013). However, the underlying
mechanisms are unclear and subject to speculation, because the frequently implied connection
between dietary intake of precursor PUFAs and eicosanoid-mediated physiological changes
has not been conclusively investigated.
The objective of the present study was to explore whether key enzymes of the eicosanoid
biosynthesis machinery are differentially expressed in response to the dietary ARA and EPA
supply. For this purpose we used the emerging model organism Daphnia magna. This
keystone species of freshwater ecosystems has been extensively studied regarding its
nutritional ecology. Additionally, several well-established Daphnia-parasite systems are
available as well as comprehensive genomic tools (Ebert 2005, 2011, Lampert 2011). We
applied a target gene expression approach that has been used in previous studies to investigate
64
CHAPTER 5
immune system genes (Decaestecker et al. 2011) and elucidate the role of the eicosanoid
synthesis inhibitor ibuprofen (Heckmann et al. 2008a) in this system. Here, the focus was laid
on the prostanoid branch of the eicosanoid biosynthesis (Fig. 1).


^12
Figure 1 Overview of prostanoid biosynthesis (Cox-pathway) based on current knowledge from
mammalian models displaying major metabolites. Prostanoids cover prostaglandins and
thromboxanes, while leukotrienes (not shown) include leukotrienes and lipoxins. PGD and PGE may
be transformed into PGJ and PGA through either non-enzymatic rearrangement or dehydration,
respectively. Blue boxes indicate the corresponding genes measured in this study. A complete list of
target genes used in this study is provided in Table 1. Diagram modified from Heckmann et al.
(2008b).
While the prostanoid pathway of a penaeid shrimp appears to be very similar to that of
mammals (Wimuttisuk et al. 2013), the “arachidonic acid pathway” obviously has undergone
65
CHAPTER 5
substantial restructuring in Daphnia (Colbourne et al. 2011). Also included in the analysis
were two genes belonging to the leukotriene branch which were responsive to ibuprofen and
food quality in previous studies (Heckmann et al. 2008b, Schlotz et al. 2012). As reproductive
functions in other arthropods, including ovary and egg development and egg laying, have
been shown to depend to a great extent on the action of eicosanoids (Stanley 2000, Medeiros
et al. 2004, Machado et al. 2007, Tootle and Spradling 2008, Wimuttisuk et al. 2013), and as
the pronounced effect of ARA and EPA on offspring production in Daphnia is well
acknowledged (Martin-Creuzburg et al. 2009, Martin-Creuzburg et al. 2010), we included
genes directly related to oogenesis.
A previous study suggested that eicosanoid-related gene expression is responsive to different
levels of dietary C20 PUFAs (Schlotz et al. 2012). Therefore, we raised our experimental
animals on food sources naturally differing in their PUFA content and composition.
Additionally, a C20 PUFA-deficient diet was supplemented with ARA or EPA. To stimulate
defence mechanisms and thus increase the likelihood of eicosanoid production, we exposed
the animals to endospores of the parasitic bacterium P. ramosa (Ebert et al. 1996). The
susceptibility of D. magna to P. ramosa and another pathogen has been shown to vary with
food quality, i.e. a high dietary ARA and EPA content reduced the infection success (Schlotz
et al. 2013, Schlotz et al. 2014). Here, we subjected D. magna to a short-term parasiteexposure of 12 and 24 hours. On the one hand, this was intended to provoke a boost of the
immune system possibly increasing eicosanoid production in challenged hosts. On the other
hand, parasite-induced changes in gene expression could differ between food treatments and
possibly reveal how a high-PUFA diet protects the host against initial establishment of the
parasite. Nutrition and parasite effects on gene expression of ten genes involved in eicosanoid
biosynthesis and three genes related to reproduction were analyzed.
MATERIAL AND METHODS
Food organisms
Two algae differing in their lipid profiles were used to raise the experimental animals: the
green alga Chlamydomonas klinobasis (SAG 276-3a), which contains no PUFAs of more than
18C atoms, and the eustigmatophyte Nannochloropsis limnetica (SAG 18.99), which contains
considerable amounts of ARA and exceptionally high amounts of EPA (Table 2). Algae were
obtained from the culture collection of the University of Göttingen (SAG, Germany). The
algae were each cultured semi-continuously in modified Woods Hole (WC) medium (Guillard
1975) in aerated 5 L vessels (20°C; dilution rate: 0.2 d-1; illumination: 100 mmol quanta m–2
66
CHAPTER 5
s–1). Food suspensions were produced by centrifugation of the harvested algae and
resuspension in fresh medium. Carbon concentrations were estimated from photometric light
extinctions (480 nm) and from previously determined carbon-extinction equations. The
carbon – light extinction regressions were confirmed by subsequent carbon analysis of the
food suspensions.
Biochemical analyses – For the analysis of fatty acids in the food suspensions approximately
1 mg particulate organic carbon (POC) was filtered onto precombusted GF/F filters
(Whatman, 25 mm). Total lipids were extracted three times from filters with
dichloromethane/methanol (2:1, v/v). Pooled cell-free extracts were evaporated to dryness
under a nitrogen stream. The lipid extracts were transesterified with 3 M methanolic HCl
(60°C, 20 min). Subsequently, fatty acid methyl esters (FAMEs) were extracted three times
with 2 ml of iso-hexane. The FAME-containing fraction was evaporated to dryness under
nitrogen and resuspended in a volume of 20 µl iso-hexane. FAMEs were analyzed by gas
chromatography on a HP 6890 GC equipped with a flame ionization detector (FID) and a DB225 (J&W Scientific, 30 m × 0.25 mm ID × 0.25 mm film) capillary column. Details of GC
configurations are given elsewhere (Martin-Creuzburg et al., 2010). FAMEs were quantified
by comparison with an internal standard (C23:0 ME) of known concentration, considering
response factors determined previously with FAME standards (Sigma-Aldrich). FAMEs were
identified by their retention times and their mass spectra, which were recorded with a gas
chromatograph-mass spectrometer (Agilent Technologies, 5975C) equipped with a fusedsilica capillary column (DB-225MS, J&W). Spectra were recorded between 50 and 500 dalton
in the electron impact ionization mode. The limit for quantitation of fatty acids was 20 ng.
The absolute amount of each fatty acid was related to the POC.
Elemental composition – Aliquots of food suspensions were filtered onto precombusted glass
fibre filters (Whatman GF/F, 25 mm diameter) and analyzed for POC and nitrogen using an
EuroEA3000 elemental analyzer (HEKAtech GmbH, Wegberg, Germany). For the
determination of particulate phosphorus, aliquots were collected on acid-rinsed polysulphone
filters (HT-200; Pall, Ann Arbor, MI, USA) and digested with a solution of 10 per cent
potassium peroxodisulfate and 1.5 per cent sodium hydroxide for 60 min at 121°C. Soluble
reactive phosphorus was determined using the molybdate-ascorbic acid method (Greenberg et
al. 1985).
Liposome preparation
Liposomes are vesicles composed of phospholipids forming a lipid bilayer. They are used
67
CHAPTER 5
here as vehicles for the supplemented PUFAs as these are not water-soluble. Liposomes
prepared according to the described protocol are readily ingested by the non-selective filter
feeder Daphnia along with the provided food algae (Martin-Creuzburg et al. 2008). Liposome
stock suspensions were prepared from 3 mg 1-palmitoyl-2-oleoyl-phosphatidylglycerol and 7
mg 1-palmitoyl-2-oleoyl-phosphatidylcholin (Lipoid, Germany) dissolved in an aliquot of
ethanol. PUFA-containing liposomes were prepared by adding 3.33 mg PUFAs (i.e.,
arachidonic acid (20:4n-6, ARA) or eicosapentaenoic acid (EPA, 20:5n-3); both purchased
from Sigma), from lipid stock solutions in ethanol. The resulting solutions were further
processed as described in (Martin-Creuzburg et al. 2009).
Experimental design
For the experiment a clone of D. magna (HO2, originally isolated in Hungary) was used.
Stock cultures were cultivated in filtrated lake water (0.2 µm) and fed with saturating amounts
of C. klinobasis. The experiment was conducted with third-clutch neonates born within 12h at
20°C. Animals were kept individually in 80 ml lake water and randomly assigned to one of
the four food regimes: C. klinobasis + control liposomes, C. klinobasis +ARA-containing
liposomes, C. klinobasis +EPA-containing liposomes, or N. limnetica with eight replicates per
treatment each consisting of 24 individuals. Every other day, animals were transferred to fresh
medium and received algal food suspensions corresponding to 2 mg C L-1. On day 5, half of
the animals were exposed to 50,000 P. ramosa endospores; control animals were mockexposed to macerated tissue of healthy daphnids. This procedure resulted in four replicates
consisting of 24 animals in the control group and in four replicates consisting of 24 animals in
the parasite-exposed group. 12 and 24 hours after parasite exposure animals were sampled (12
individuals per sample) using a “cylindrical sieve system” (Heckmann et al. 2007) and stored
at -80°C in 400 µl RNAlater® (Ambion) for subsequent RNA extraction.
Gene expression analysis
RNA extraction and DNA synthesis — Total RNA was extracted using the RNeasyMini kit
with on-column DNase treatment (Qiagen) according to the manufacturer’s instructions. RNA
concentrations were determined using a NanoDrop™ spectrophotometer (NanoDrop
Technologies). Agarose (1.5 %) gel electrophoresis was used to verify the quality of RNA.
cDNA was synthesized from 2 µg total RNA using the First Strand cDNA Synthesis Kit
(Fermentas) following the manufacturer’s instructions. Subsequently, cDNA was diluted 25fold to a concentration equivalent to 4 ng total RNA µl-1 and stored at -20°C.
68
CHAPTER 5
Table 1. Primer information. Upper and lower sequences represent forward and reverse primers,
respectively. Primer sequences for Pxt, Ltb4h, Vtg1 and Vmo1 were taken from Heckmann et al.
(2008a); primer sequences for Vtg2 were taken from Hannas et al. (2011).
target gene
sPlA2
Phospholipase A2 (secretory)
iPlA2
Phospholipase A2 (Ca2+-independent)
Cox
Cyclooxygenase
Pxt
Chorion peroxidase
TxAs
Thromboxane A synthase
PgEs
Prostaglandin E synthase
PgDs1
Prostaglandin D synthase 1
PgDs2
Prostaglandin D synthase 2
LtA4h
Leukotriene A4 hydrolase
LtB4dh
Leukotriene B4 hydroxydehydrogenase
Vtg1
Vitellogenin 1
Vtg2
Vitellogenin 2
Vmo1
Vitelline outer layer membrane
protein 1
primer sequence
(5’-3’)
GCAATGCGATCCACTTTCCTAC
GATGGCGTCGACGGTGAG
AAGGAAAATCTGACGCCGCT
GCCACGTTGATATTTGCCCC
CACTGGGACGTGATGATGGA
AGAGTGCGGCCATATTGGATT
CCACCTCGCAAATTGTCTTT
GTCCCACGATGGATTCAACT
GCAAACTTTTGGAATTGTATGCCC
TTGACCACCGTAGATGATGAAGA
GCGTGCCTTCCTGGATTTTG
TGCAGACCAGCCAAGTTGTT
ACTCGCTATGCTCGATACGG
TGGACGAGCAGAACTTTCCC
TTTGGGCCATTCTTCTCGCT
GCTCGACTGGTCCTTCAACA
TGGCCATTGTTGTTGGAGATTTAG
ATCTAGCAAAGCGGGTTCGG
AACCTACACCGAGGGTTTCG
TCCAACATTAACGCCATTAAGC
CTGGCAAATGGGAAATCAAC
CCCAGGTGTAAGCCAAACC
CACTGCCTTCCCAAGAACAT
ATCAAGAGGACGGACGAAGA
TATTACGCGGTTCAGACGTG
GTTGTCCGCCTCACTACCAT
amplicon
size (bp)
79
95
97
77
74
85
80
72
80
70
93
66
87
Identification of gene homologues, primer design and relative expression of mRNA —
Analysis comprised 13 target genes (Table 1). To identify these gene homologues in D.
magna a tBlastx search (Altschul et al. 1990) was performed using 38 genes described as
being part of the eicosanoid biosynthesis machinery of D. pulex as a query against the genome
of D. magna (v.2.4, unpublished data). Only best BLAST hits with a score >50 and an e-value
<1*10-6 were considered for further analysis. In order to define the intron-exon structure of
each gene identified in D. magna, open reading frames were annotated with the getorf
package from EMBOSS (Rice et al. 2000), translated into a protein, and manually checked
with
a
Blastp
search
against
the
NCBI
non-redundant
database
(http://blast.ncbi.nlm.nih.gov/Blast.cgi). Primers were designed using the primer designing
tool Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/; Ye et al. 2012).
69
CHAPTER 5
Primers were synthesized by biomers.net (Ulm, Germany). Real-time quantitative polymerase
chain reactions (qPCR) were conducted on a StepOnePlusTM real-time PCR system (Applied
Biosystems) using Power SYBRGreen PCR master Mix (Applied Biosystems). Each reaction
was run in triplicate and contained 5 µl of cDNA template (equivalent to 20 ng total RNA)
along with 300 nM primers in a final volume of 20 µl. The amplification was performed
under the following conditions: 95°C for 10 min to activate the DNA polymerase, then 40
cycles of 95°C for 15 s and 60°C for 60 s. Melting curves were visually inspected to verify a
single amplification product. Primer dimers were detected for sPlA2 and iPlA2 as well as
PgDs1 and PgDs2. However, the signal to noise ratio was large and thus the error caused by
the dimer formation was assumed to be small enough not to interfere with target gene
measurement and thus are shown in the results, but should be interpreted with caution.
Data analysis and statistics
Raw qPCR data were analyzed using Data Analysis for Real-Time PCR (DART-PCR)
(Peirson et al. 2003). The calculated reaction efficiencies verified the expected amplification
of around 2-fold for all genes. The few outliers detected were removed. The resulting data set
was normalized by NORMA-Gene (Heckmann et al. 2011). Differences in relative
normalized expression of the target genes among treatments were assessed using one-way
analysis of variance (ANOVA) if assumptions of normality and homogeneity of variances
were met. If assumptions were violated, Kruskal-Wallis one-way ANOVA on ranks was
performed. For illustration, gene expressions of animals fed C. klinobasis +ARA, C.
klinobasis +EPA or N. limnetica were calibrated to those of animals fed C. klinobasis, i.e. the
relative expression for the C. klinobasis treatment was fixed to 1. All statistics were carried
out using Statistica (v 6.0, StatSoft).
RESULTS AND DISCUSSION
General observations
Nutrition effects ― The intention of this study was to establish a potential link between
dietary PUFA supply and eicosanoid biosynthesis on the transcriptomic level under
physiological conditions as well as after parasite challenge. As anticipated, the algal food
sources differed considerably in their PUFA content and composition. Only N. limnetica
contained the eicosanoid precursors ARA and EPA whereas C. klinobasis did not contain
PUFAs with more than 18 carbon atoms (Table 2).
70
CHAPTER 5
Table 2. PUFA composition of C. klinobasis, N. limnetica and PUFA-containing liposomes
(+ARA/+EPA; used for supplementation of C. klinobasis). Data are means of three replicates ± SD
expressed in µg mg C-1 (n.d. = not detectable).
C. klinobasis
+ARA
+EPA
N. limnetica
18:2n-6 (LIN)
5.6 ± 0.3
n.d.
n.d.
11.1 ± 0.2
18:3n-6 (GLA)
n.d.
n.d.
n.d.
n.d.
18:3n-3 (ALA)
152.46 ± 9.85
n.d.
n.d.
5.06 ± 1.8
18:4n-3 (STA)
8.2 ± 0.1
n.d.
n.d.
n.d.
20:3n-6 (DGLA)
n.d.
n.d.
n.d.
n.d.
20:4n-6 (ARA)
n.d.
31.3 ± 0.4
n.d.
19.8 ± 1.1
20:5n-3 (EPA)
n.d.
n.d.
31.4 ± 0.4
185.2 ± 10.6
The food treatment affected expression levels of most target genes at least at one of the two
time points examined in both control and parasite-exposed animals (except for Vtg2 in the
control; Fig. 2). Besides few exceptions these changes were within a moderate range of up to
2-fold relative to the C. klinobasis treatment. This may reflect the fine-tuned regulation of
eicosanoids as potent signalling molecules which are effective in very low concentrations.
Hence, there might be no demand for a strong increase in the expression of synthesis genes.
One would probably have to face the same fact when measuring metabolomic instead of
transcriptomic changes with the result that these small changes might not become evident. We
cannot rule out the possibility that the time points measured (12 and 24 hours post endospore
exposure) were too late as there appears to be a trend for immune responses and eicosanoid
regulation to occur very rapidly within few hours after exposure to P. ramosa or to ibuprofen
(Heckmann et al. 2008a, Decaestecker et al. 2011). However, some target genes responded
clearly to precursor availability and/or parasite exposure, in particular Cox, Pxt, and the two
vitellogenins (Vtg1, Vtg2).
In contrast to what has been seen in life history supplementation experiments (MartinCreuzburg et al. 2012, Schlotz et al. 2013), ARA and EPA did not seem to be interchangeable
per se regarding their effects on gene expression. While the expression patterns of some genes
were similar in animals raised on C20 PUFA-containing diets (ARA, EPA, N. limnetica)
diverging trends were found in other genes, particularly the prostanoid synthases (TxAs,
PgDs1, PgEs) and leukotriene hydrolases (LtA4h, LtB4h). This might indicate a distinct
function of ARA- and EPA-derived eicosanoids similar to what is known from mammals,
where e.g. prostaglandins of the series-2 and series-3 have opposing effects (Smith 2005,
Schmitz and Ecker 2008). Synergistic effects of ARA and EPA were not evident as N.
71
CHAPTER 5
limnetica, containing both ARA and EPA, was not generally inducing greater changes in gene
expression than one of the precursors alone.
Parasite effects ― Nutrition can substantially modulate immune responses and thus may
affect the outcome of infection just like genetic predisposition and environmental conditions
(Lazzaro and Little 2009, Schmid-Hempel 2011). Previous life history studies, using the same
D. magna - P. ramosa host-parasite system as well as an opportunistic pathogen, have shown
that dietary PUFAs can influence the susceptibility of the host to the parasite (Schlotz et al.
2013, Schlotz et al. 2014). In particular, the C20 PUFA-containing food N. limnetica
decreased the infection efficiency of the parasite considerably. One hypothesis was that
defence mechanisms are more potent in animals raised on N. limnetica due to higher and/or
faster eicosanoid production. However, here we did not find that the N. limnetica treatment
particularly boosted the expression of genes involved in eicosanoid biosynthesis. In general,
we found an increase in transcripts of the genes examined in response to parasite exposure,
especially after 24 hours (Fig. 3). The exception was the EPA treatment: not only was this the
treatment with the fewest genes induced after 24 hours (only Vtg1), it also displayed four
cases of significant down-regulation of gene expression (TxAs, PgEs, LtA4h, LtB4h). In
mammals, EPA can effectively decrease the formation of prostaglandins from ARA by
inhibiting the responsible cyclooxygenase (Cox-1; Smith 2005). Our results suggest that EPA
has inhibitory effects on the expression of some eicosanoid synthesis enzymes in D. magna as
well; however, an EPA-supplemented diet seems not to translate into immune-suppression as
no increases in susceptibility to the parasite was observed in a previous experiment (Schlotz et
al. 2013). Despite the high amounts of EPA found in N. limnetica, this trend is not observed
in parasite-challenged animals reared on this alga. Besides EPA, N. limnetica contains notable
amounts of ARA. Considering the higher efficiency with which ARA is metabolized in
comparison to EPA, the concomitant supply with ARA might have offset the effects mediated
by EPA (Smith 2005). Interestingly, gene expression of animals which were raised on C.
klinobasis, the alga not containing C20 PUFAs, had the highest number of genes induced
upon parasite exposure after 24 hours (8 out of 13 target genes) followed by animals raised on
C. klinobasis +ARA (6 of 13), N. limnetica (4 of 13), and C. klinobasis +EPA (1 of 13) (Fig.
3). The same order is found when comparing the extent of fold-induction, which is also
highest in animals feeding on C. klinobasis. This could reflect a higher need for eicosanoid
synthesis under parasite challenge due to lower constitutive levels of eicosanoids in animals
raised on C. klinobasis. However, without direct measurement of eicosanoid levels in animals
raised on different diets, this remains speculation.
72
CHAPTER 5
Gene-specific observations
Phospholipases A2 ― Phospholipases A2 (PLA2) are responsible for the hydrolysis of the sn2 ester of glycerophospholipids yielding free PUFAs. As such they represent the first step in
eicosanoid biosynthesis. PLA2s are grouped into cytosolic and secretory forms; these can be
further subdivided in Ca2+-dependent and -independent (Six and Dennis 2000). Both secretory
and cytosolic forms have been shown to be potent in mobilizing eicosanoid precursors and
play a role in host defence against microbial pathogens in vertebrates and invertebrates
(Balsinde and Dennis 1997, Park et al. 2005, Boyanovsky and Webb 2009, Shrestha et al.
2010). PLA2s do not discriminate between ARA and EPA for entry into the prostaglandin
biosynthetic pathway (Smith 2005). Here, we investigated the expression of a secretory PlA2
gene (sPlA2) and a Ca2+-independent, intracellular PlA2 gene (iPlA2). sPlA2 appeared to be
more dynamic over time compared to iPlA2 (Fig. 2). iPlA2, but not sPlA2, was induced upon
parasite-exposure on a C. klinobasis diet, but not on the C20 PUFA-containing diets (Fig. 3)
suggesting that a constant dietary availability of ARA and/or EPA renders the mobilization of
PUFAs from phospholipids unnecessary.
Cyclooxygenase and “chorion peroxidase” ― The cyclooxygenase (COX) is the key enzyme
in the conversion of ARA and EPA to prostanoids. Drugs like aspirin and ibuprofen exert
their analgesic functions by blocking this central enzyme (Dubois et al. 1998). Although Cox
gene homologues are missing in insect models like D. melanogaster, A. aegypti, B. mori and
others, there is evidence of their presence in other arthropods, including Daphnia (Heckmann
et al. 2008b, Varvas et al. 2009). Nonetheless, in the species obviously lacking COX,
prostaglandins have been shown to occupy important physiological roles (Vrablik and Watts
2013). Evidence suggest that another enzyme with a COX-like activity (PXT) can exert
similar functions while simultaneously being involved in follicle maturation, corroborating
the importance of prostaglandins for reproduction (Tootle and Spradling 2008).
We investigated two genes with probable COX-like functions: Cox (annotated as PgH
synthase) and Pxt (annotated as chorion peroxidase; corresponds to the enzyme studied in
Tootle and Spradling 2008). In an earlier gene expression study (Schlotz et al. 2012), the gene
here termed “Pxt” was termed “Cox” according to the publication where the primer
sequences where derived from (Heckmann et al. 2008a). In the present study, these two genes
were among the genes that were most responsive to both C20 PUFA availability and parasite
exposure (Fig. 2, Fig. 3).
73
CHAPTER 5
Figure 2 Nutrition effects on relative gene expression of the 13 target genes at 12 and 24 hours post
exposure measured by quantitative real-time PCR. Left panels show control treatments (solid lines),
right panels show exposed treatments (dashed lines). Colours indicate the food treatment: green – C.
klinobasis; red – +ARA; blue – +EPA; purple – N. limnetica. For illustration, gene expressions of all
treatments were calibrated to C. klinobasis (control) 12h or 24h, respectively (=calibrator). Data are
means of 4 replicates ± SEM. Symbols labelled with the same letter are not statistically different
(Bartlett’s test following one-way ANOVA).
74
CHAPTER 5
Figure 2 (continued) Nutrition effects on relative gene expression of the 13 target genes at 12 and 24
hours post exposure measured by quantitative real-time PCR. Left panels show control treatments
(solid lines), right panels show exposed treatments (dashed lines). Colours indicate the food treatment:
green – C. klinobasis; red – +ARA; blue – +EPA; purple – N. limnetica. For illustration, gene
expressions of all treatments were calibrated to C. klinobasis (control) 12h or 24h, respectively
(=calibrator). Data are means of 4 replicates ± SEM. Symbols labelled with the same letter are not
statistically different (Bartlett’s test following one-way ANOVA).
Although a similar function is predicted for COX and PXT, the two genes showed distinct
expression patterns under physiological conditions. The expression of Cox was about 5-fold
lower in the presence of dietary ARA or EPA (Fig. 2) whereas ARA and EPA induced the
expression of Pxt up to 10-fold, in the N. limnetica treatment even more than 15-fold (Fig. 2).
It is well acknowledged that the dietary supply with ARA and EPA can increase the
reproductive success of D. magna (Martin-Creuzburg et al. 2010, Schlotz et al. 2013) and a
75
CHAPTER 5
similar Pxt gene expression pattern in response to differences in PUFA-mediated food quality
has been found previously (Schlotz et al. 2012). Assuming a role for prostaglandins in
reproduction, with the contribution of PXT as key enzyme similar to the Drosophila PXT
(Tootle and Spradling 2008), this gene could serve as an appropriate reproductive indicator.
The expression of Cox was hardly affected by pathogen challenge except for a 2-fold
induction in the ARA treatment (Fig. 3). As mentioned earlier, the preferred substrate for
COX catalysis in mammals is ARA. This, in conjunction with a potential inhibitory effect of
EPA, is probably the reason that solely supplemented ARA sustained Cox induction under
parasite challenge. In contrast, Pxt appeared to be induced to varying extents in response to
the parasite. Although the induction relative to the unchallenged control animals of the
respective food treatment was highest on a C. klinobasis diet (~ 7-fold, Fig. 3), gene
expression was still higher in the other treatments (Fig. 2). One could suspect that the
induction of Pxt across treatments reflects immune activation and possibly an increased
requirement for prostaglandin synthesis. However, as P. ramosa is targeting reproductive
functions of its host during the infection process, probably interfering with endocrine actions,
the observed effect might also be due to a specific infection mechanism.
Prostanoid synthases ― The major prostanoids are formed from PGH by the enzymes
thromboxan A synthase (TXAS), prostaglandin D synthase (PGDS), and prostaglandin E
synthase (PGES) (Fig. 1). ARA and EPA compete for the same enzymes for metabolism
(Lands 1992). In general, there appears to be an excess of downstream PGH-metabolizing
enzymes relative to COX enzymes in humans (Smith and Murphy 2002). If this applies also
for the prostanoid synthases in D. magna, C20 PUFA availability should not induce major
changes in gene expression of the respective genes. Indeed, we found relatively small foldchanges for the encoding genes in the different food treatments (Fig. 2). Upon parasite
exposure, the expression of prostanoid synthase genes was only marginally induced (Fig. 3).
Leukotriene hydrolase and hydroxydehydrogenase ― LTA4H action results in the formation
of leukotriene B4 (LTB4), which modulates immune responses and participates in the host
defence against infections. LTB4 has also been shown to play a role in yolk formation during
oogenesis in insects (Medeiros et al. 2004). LTB4DH inactivates LTB4 and also catalyses the
degradation of PGE2 (Hori et al. 2004). The situation regarding expression of the two
leukotriene hydrolase genes (LtA4h and LtB4dh) is very similar to what has just been
described for the prostanoid synthases, i.e. differences in expression levels between the food
treatments are marginal (Fig. 2). After parasite exposure, Lta4h is slightly induced in the C.
klinobasis, C. klinobasis +ARA, and N. limnetica treatments (Fig. 3).
76
CHAPTER 5
Figure 3 Parasite effects on relative gene expression of the 13 target genes A) 12 and B) 24 hours
after parasite exposure measured by quantitative real-time PCR. Colours indicate the food treatment:
green – C. klinobasis; red – +ARA; blue – +EPA; purple – N. limnetica. Data are means of 4
replicates ± SEM. For illustration, gene expressions of exposed treatments were calibrated to the
respective control treatments. Asterisks indicate statistically significant changes in gene expression
(p≤0.05, Bartlett’s test following one-way ANOVA).
77
CHAPTER 5
Vitellogenins and vitelline outer membrane protein 1 ― Results for the reproduction related
genes (Vtg1, Vtg2, Vmo1) were surprising for two reasons. First, vitellogenins have a long
history of being used as markers for reproductive disruption and research agrees that egg
production is strongly correlated with Vtg expression (Quinitio et al. 1994, Kime et al. 1999,
Okumura and Aida 2000). Yet, both vitellogenins as well as Vmo1 did not respond clearly to
the food treatments, even though animals feeding on ARA- or EPA-containing diets reach
maturity earlier and produce more eggs than animals feeding on a diet deficient in these
PUFAs (cf. Martin-Creuzburg et al. 2010, Schlotz et al. 2012, Schlotz et al. 2013). Oogenesisrelated gene expression is following a cyclical regime of gene activation and repression
paralleling oogenesis, egg deposition, offspring release, and then starting the reproduction
cycle again (Hannas et al. 2011, Kim et al. 2011). Thus, a “snapshot” of gene expression at a
certain time might give a wrong impression of the actual reproductive success. In our data set,
vitellogenin expression is most likely already declining in animals raised on the C20 PUFAcontaining diets while in animals feeding on C. klinobasis are lagging behind in the
reproductive cycle, therefore paradoxically having a similar or even higher expression level of
oogenesis-related genes. This observation sets limitations to the use of oogenesis-related
genes as indicators for reproductive output.
Second, exposure to the parasite increased the number of one or both Vtg transcripts in all
food treatments (Fig. 3). Repeating a point raised earlier for Pxt, one could assume a very
specific targeting of reproductive functions by the parasite leading to the observed gene
induction. Another very intriguing idea on the cause for parasite-induced Vtg expression is
that VTGs possibly exert immune-related functions in addition to the well-recognized
reproduction-related ones. A connection between VTGs, immune function, and defence
against pathogens has been suggested in fish, nematodes, mosquitoes, and honeybees,
(Raikhel et al. 2002, Amdam et al. 2004, Li et al. 2008, Liu et al. 2009, Fischer et al. 2013).
Our gene expression data suggest that this apparent connection might be worth a more indepth investigation in D. magna.
CONCLUSION
Of the 13 target genes examined only the COX-like Pxt responded strongly both to ARA- and
EPA-mediated food quality (i.e. substrate availability) and immune challenge (i.e. parasite
exposure), indicating a role of the corresponding enzyme in eicosanoid biosynthesis and
corroborating the idea of eicosanoids acting in both reproduction and immunity of D. magna.
If so, PXT could be the missing link between dietary precursor intake and eicosanoid-
78
CHAPTER 5
mediated functions, with reproduction and immunity being promising candidates. Further
investigations thus should aim at elucidating the role of Pxt in Daphnia physiology and
pathophysiology. Regarding immune stimulation following parasite exposure, the Vtg genes
stood out from the other genes with the highest fold-induction across treatments. Based on
evidence from the literature we suggest that a possible role of VTGs in pathogen recognition
should be further investigated.
In general, it appears that responses of immune-related gene expression are difficult to
capture. A study on the same host-parasite system investigated candidate immune system
gene expression with an appreciable temporal resolution (Decaestecker et al. 2011); however,
no comprehensive conclusions could be drawn with respect to the genes evaluated and their
role in the response to P. ramosa-exposure. The authors’ conclusion was that other immune
system genes specific to the D. magna – P. ramosa interaction should be identified. We agree
with this and provide promising candidates for future attempts to characterize events
underlying host-parasite interactions.
ACKNOWLEDGEMENTS
We would like to thank Bernd Kress, Lisa Breithut, Tobias Schär, and Jesper Givskov
Sørensen for experimental and technical assistance and advice. DMC was supported
financially by the German Research Foundation (MA 5005/1-1); DE was supported by the
Swiss National Science Foundation.
79
6
ASSESSING HOST-PARASITE RESOURCE COMPETITION USING
NUTRIENT-LIMITED GROWTH RESPONSES
Nina Schlotz, Dieter Ebert, and Dominik Martin-Creuzburg
ABSTRACT ― An easy and comprehensive method to estimate the frequently implied
competition for resources between hosts and their parasites is lacking in the experimental
parasitology toolbox, especially regarding essential nutrients. Here, we adapted a method
which was previously used to elucidate nutrient limitations and co-limitations in food quality
research. The principle is to record growth responses of consumers along a gradient of the
nutrient of interest. Obviously, if parasites tap the host’s resources, parasitized hosts should
show decreased growth at a certain nutrient concentration if they are deprived of this nutrient
by the parasite. First, we provide the theoretical background for this approach by comparing
hypothetical nutrient limited growth responses of healthy and infected hosts. Then, we use
data from experiments with the crustacean Daphnia magna, healthy or parasitized by the
microsporidium Hamiltosporidium tvaerminnensis, raised on gradients of cholesterol or one
of the polyunsaturated fatty acids arachidonic acid (ARA) and eicosapentaenoic acid (EPA) to
investigate potential differences in the demand for essential lipids.
While somatic growth of hosts is clearly constrained by both cholesterol and ARA or EPA,
we could not detect differences in essential lipid requirements between healthy and infected
host in this particular host-parasite system, probably owing to a host-dependency that is not
very pronounced in H. tvaerminnensis. Certainly, future studies using other host-parasites
systems will obtain different results and should also include food quantity gradients along
with essential nutrient gradients to properly estimate the cost of infection for the host due to
resource competition.
KEYWORDS ― Cholesterol, Daphnia magna, Hamiltosporidium tvaerminnensis, hostparasite interaction, polyunsaturated fatty acids, resource competition
80
CHAPTER 6
INTRODUCTION
Once an infection is established, parasites grow and multiply within their hosts. To achieve
this they have to tap the hosts’ resources in order to acquire energy and essential nutrients.
This implies that host and parasite live in a constant competition for resources and that the
host’s requirements for energy and shared nutrients increase. Few approaches have been
described to measure the energetics of host-parasite interactions, i.e. the perturbations to host
energy budgets. They include comparing energy reserves in the form of protein, lipid or
glycogen content between healthy and infected hosts (Gismondi et al. 2012), measuring
changes in host metabolic rate (Careau et al. 2010, Robar et al. 2011) or the overall energy
status as indicated by “energy ratios” (Thompson and Yamada 1984). Results, however, are in
their majority inconsistent regarding to what extent parasites influence the energy demand of
their hosts. In general, literature agrees that essential micro- and macronutrients can shape
host-parasite interactions (Frost et al. 2008, Ponton et al. 2011a, Aalto and Pulkkinen 2013,
Civitello et al. 2013, Schlotz et al. 2013). However, the question if and to what degree a
parasitic infection changes the host’s nutritional demands other than a supposedly increased
energy demand has not been addressed methodologically.
In microsporidia – eukaryotic, obligate intracellular parasites of other eukaryotes (Keeling
and Fast 2002) – the reduction and compaction of most microsporidian genomes resulted in
the loss of many metabolic pathways resulting in a strong dependence on their host (Katinka
et al. 2001). The entomopathogenic microsporidium Vairimorpha sp. alters carbohydrate and
fatty acid levels of its host, indicating the costs that are associated with a microsporidial
infection. In the microsporidium Encephalitozoon cuniculi, a parasite of mammals, both fatty
acids and cholesterol are resources which host and parasite potentially are competing for
because genes encoding a fatty acid synthase complex as well as a gene for conversion of
farnesyl-PP into cholesterol are lacking in the parasite, even though cholesterol has been
detected in spore membranes (Katinka et al. 2001). In contrast, the genome of the
microsporidium Hamiltosporidium tvaerminnensis (Haag et al. 2011), parasitizing the
freshwater crustacean Daphnia magna (Corradi et al. 2009), revealed that genes involved in
lipid and fatty acid metabolism are better represented in this parasite compared to other
microsporidia.
The D. magna - H. tvaerminnensis host-parasite system has become a model system to study
the ecology, epidemiology, evolution and genomics of host-microsporidia interactions
(Vizoso and Ebert 2004, 2005, Lass and Ebert 2006, Altermatt and Ebert 2008, Ben-Ami et
81
CHAPTER 6
al. 2011, Haag et al. 2013). We used this host-parasite system to explore how a parasitic
infection changes the cholesterol or polyunsaturated fatty acid (PUFA) requirements of the
host by comparing sterol and PUFA-limited growth responses of healthy and infected hosts.
Sterols and PUFAs both are important structural components of cell membranes that confer
fluidity and permeability and are important for temperature acclimation (Clandinin et al.
1991, Guschina and Harwood 2006, van Meer et al. 2008, Martin-Creuzburg et al. 2012).
Moreover, sterols serve as precursors for the moult inducing ecdysteroids and as signalling
molecules bound to hedgehog proteins (Grieneisen 1994, Behmer and Nes 2003); PUFAs are
precursors for the hormone-like eicosanoids which are important in vertebrate and
invertebrate signal transduction systems (Stanley 2000). Furthermore, both lipid classes have
previously been shown to play pivotal roles in growth and reproduction of members of the
genus Daphnia (von Elert 2002, Martin-Creuzburg et al. 2009, Martin-Creuzburg et al. 2010,
Schlotz et al. 2012) and PUFAs have the potential to modulate host-parasite interactions
(Schlotz et al. 2013). As H. tvaerminnensis is a parasite of the fat cells and ovaries of D.
magna the impact of lipid availability on this host-parasite interaction is potentially high.
Figure 1 Hypothesized nutrient-dependent
growth responses expressed as Monod
curves. Growth is improved with increasing
concentrations of the limiting nutrient. In
green, a hypothetical response curve for a
healthy, uninfected host is shown. Red
dashed lines show two possible responses a
and b of parasite-infected hosts. In both
cases, Ks is shifted to a higher value; gmax of a
is lower than that of the healthy counterpart
whereas gmax of b surpasses it. This could be
the case for castrating parasites inducing
gigantism in their hosts (see text for details).
Describing growth responses using mathematical functions has a long tradition in
experimental ecology and resource competition theory (Tilman 1977, Rothhaupt 1988,
Bridgham et al. 1995, Huisman et al. 1999). The Monod function has been used to describe
the relationship between dietary nutrient concentrations and somatic or population growth
rates of D. magna (Martin-Creuzburg et al. 2009, Sperfeld et al. 2012) to elucidate the role of
essential lipids on these important fitness parameters by comparing the resulting growth
curves. Therefore, it is plausible to argue that the comparison of two growth response curves
82
CHAPTER 6
produced on one nutrient of interest by animals differing in their infection status would shed
light on possible shifts in nutrient demands caused by parasite infection.
In theory, there could be several different outcomes to such a growth experiment, of which
two are shown in Fig. 1. Different shapes of the Monod curves derived from the growth
experiments can be described using the parameters gmax (maximum growth rate), Ks (halfsaturation constant), and S0 (threshold for positive growth). Additionally, the incipient
limiting level (ILL) at which nutrient-saturated growth passes into nutrient-limited growth can
be employed to compare the functional responses. Assuming growth responses of healthy and
infected animals as shown in Fig. 1 (solid green and red dashed lines, respectively), infection
would result in a lower initial slope, i.e. a lower Ks, and a slightly lower gmax in case “a”. This
would indicate that at low nutrient availabilities infected animals would require more of the
respective nutrient than healthy animals to achieve the same somatic growth rate. This
scenario could apply, for example, for the D. magna - H. tvaerminnensis system if we suppose
that this parasite has to derive e.g. cholesterol from its host, because it is required but cannot
be synthesized by the parasite. Maximum growth rates might not differ greatly between
healthy and infected hosts. The red dashed line “b” also features a higher Ks, however, here
gmax is higher than in healthy animals. This could apply for parasites that increase somatic
growth of their hosts. In D. magna this is observed upon infection with Pasteuria ramosa, a
bacterial parasite that castrates its host thus redirecting resources normally allocated into
reproduction to somatic growth, eventually causing host gigantism.
To our knowledge, parasite mediated changes in essential nutrient requirements of hosts have
not been conclusively investigated. We present a tool to estimate the cost of infection due to
resource competition and to evaluate consequent changes in essential nutrient requirements of
hosts under parasite challenge.
MATERIAL AND METHODS
Cultivation of food organisms
The green alga Scenedesmus obliquus (SAG 276-3a) was used as food for Daphnia magna
stock cultures. It was grown in batch cultures in Cyano medium (Jüttner et al. 1983) and
harvested in the late exponential growth phase. For the growth experiments, S. obliquus and
the cyanobacterium Synechococcus elongatus (SAG 89.79) were cultured semi-continuously
in Cyano medium in aerated 5 L vessels at 20°C, illumination at 100 µmol quanta m-2 s-1, and
a dilution rate of 0.25 d-1.
83
CHAPTER 6
S. elongatus was used as carbon source in the growth response experiments because it is a
nontoxic, phosphorus-rich cyanobacterium that is well-assimilated by Daphnia, but lacks
sterols and long-chain PUFAs (Martin-Creuzburg et al. 2008). Stock solutions of the food
organisms were obtained by centrifugation and resuspension in fresh medium. Carbon
concentrations of the food suspensions were estimated from photometric light extinctions
(800 nm) and from previously established regressions between carbon and light extinction
determined in dilution series of each food suspension.
Liposome preparation
Liposomes are vesicles composed of phospholipids forming a lipid bilayer. They are used as
vehicles for cholesterol and PUFAs as these are not water-soluble Liposomes prepared
according to the described protocol are readily ingested by the non-selective filter feeder
Daphnia along with the provided food algae (Martin-Creuzburg et al. 2008). Liposome stock
suspensions were prepared from 3 mg 1-palmitoyl-2-oleoyl-phosphatidylglycerol and 7 mg 1palmitoyl-2-oleoyl-phosphatidylcholin (Lipoid, Germany) dissolved in an aliquot of ethanol.
Cholesterol- or PUFA-containing liposomes were prepared by adding 3.33 mg cholesterol or
PUFAs (i.e., arachidonic acid (20:4n-6, ARA) or eicosapentaenoic acid (EPA, 20:5n-3); all
purchased from Sigma), from lipid stock solutions in ethanol. The resulting solutions were
further processed as described in (Martin-Creuzburg et al. 2009).
Growth experiments and data analysis
A clone of Daphnia magna (OER3-3) raised as two separate lines, one uninfected and one
being infected with Hamiltosporidium tvaerminnensis, were cultivated in 0.2 µm-filtered lake
water with saturating concentrations of S. obliquus. Growth experiments were conducted with
third-clutch juveniles (born within 12 h) at 20°C and a 16:8 hour light-dark cycle in glass
beakers filled with 200 mL of filtered lake water. All treatments provided the same amount of
food (in terms of carbon) for the hosts, only essential nutrient concentrations were varied. We
corrected for differences in the amounts of carbon delivered in the different dietary
cholesterol or PUFA concentrations provided via liposomes by adding control liposomes not
containing additional lipids to yield a carbon content equal in all beakers.
Cholesterol gradient — The cholesterol-supplemented diets were prepared by adding 5, 10,
20, 40, 80, or 100 µL (corresponding to 2.1, 4.1, 8.2, 16.5, 33.0, 41.2 µg cholesterol mg C-1)
of the cholesterol-containing liposome stock suspension to the experimental beakers each
containing 2 mg C L-1 of S. elongatus. Additional PUFA supplementation was achieved by
simultaneously adding 30 µL of the corresponding PUFA-containing liposome stock
84
CHAPTER 6
suspension (ARA or EPA) in each beaker. Each treatment consisted of three replicates with
six juvenile D. magna per beaker. Every day, daphnids were transferred into new beakers with
freshly prepared food suspensions. On day 6, daphnids were sampled, dried for 24 h, and
weighed on an electronic balance (Mettler Toledo XP2U; ± 0.1 µg). Somatic growth rates (g)
were calculated as the increase in dry mass from day 0 (M0) to day 6 (Mt) using the equation:
g
ln M t  ln M 0
t
.
PUFA gradient — The PUFA supplemented diets were prepared by adding ARA- or EPAcontaining liposomes corresponding to 0.5, 1, 2, 4, 8, 16, or 32 µg PUFA mg C -1 to the
experimental beakers each containing 2 mg C L-1 of S. elongatus plus 60 µl cholesterolcontaining liposomes (cholesterol was added because D. magna does not grow on sterol-free
food sources). Replicates, daily procedures, and somatic growth rate determination were as
described for the cholesterol gradient.
The functional relationships between dietary sterol or PUFA concentrations and somatic
growth rates g were visualized as Monod curves (Monod 1950), modified with a threshold for
zero growth (Rothhaupt 1988):
g  g max
c  S0
,
c  S0  K S
where g max is the maximum growth rate (d–1), c is the resource concentration (µg mg C–1),
S0 is the threshold concentration for zero growth (µg mg C–1), and KS is the half saturation
constant (µg mg C–1).
The influence of the food treatment and the infection status on somatic growth rates was
assessed for each dietary concentration separately using factorial analyses of variance
(ANOVA) followed by multiple comparisons (Tukey’s HSD). ILLs can be estimated
comparing growth rates with one-way ANOVA. The nutrient concentration that leads to a
significant decrease in somatic growth rate with decreasing nutrient supply is defined as ILL
(cf. (Martin-Creuzburg et al. 2005). Assumptions for ANOVA were met. All analyses were
performed using the general linear model module of STATISTICA l.0 (StatSoft Inc.).
RESULTS AND DISCUSSION
Competition for nutrients is a central issue in parasitology and is thought to crucially
influence host-parasite interactions. Determining nutrient withdrawal by the parasite,
however, constitutes a difficult task. We propose that by measuring differences in nutrient
85
CHAPTER 6
requirements of healthy and infected hosts one can estimate the extent of nutrient
consumption by the parasite.
We compared cholesterol- and PUFA-limited growth responses of parasitized hosts to those
of uninfected hosts. Somatic growth rates of all animals were highly correlated with the
dietary cholesterol and PUFA content, which was achieved by supplementation of a steroland PUFA-free diet with increasing amounts of the respective lipid (Fig. 2). As shown
previously (Martin-Creuzburg et al. 2009, Martin-Creuzburg et al. 2010), dietary PUFAs
further increased somatic growth rates obtained in the presence of cholesterol (significant at
cholesterol concentrations >16.5 µg mg C-1) with EPA by tendency being more effective than
ARA (significant only for the highest cholesterol concentration, Fig. 2a). Somatic growth
rates responded strongly to increased PUFA availability resulting in response curves
characterized by a steep initial slope and an early arrival at maximal growth rates (Fig. 2b).
Figure 2 Nutrient-limited growth response curves for a) a dietary cholesterol gradient recorded in the
absences or presence of saturating amounts of ARA or EPA, and b) dietary ARA and EPA gradients
recorded in the presence of saturating amounts of cholesterol. Straight lines symbolize uninfected
hosts, dashed-lines parasite-infected host. Each symbol represents a replicate (N = 3) each consisting
of six animals.
The shape differences indicate the different requirements for cholesterol and PUFAs; these
are satisfied by small concentrations with regard to PUFAs (estimated ILL < 2 µg mg C-1)
compared to the requirements for cholesterol (estimated ILL < 8.2 µg mg C-1, in the presence
of ARA or EPA < 16.5 µg mg C-1). ARA and EPA are especially important for reproduction
in Daphnia (Becker and Boersma 2005, Wacker and Martin-Creuzburg 2007, Martin-
86
CHAPTER 6
Creuzburg et al. 2010) and thus may not be required to the same extent by the juveniles
investing primarily in somatic growth, which has to be sustained by sufficient amounts of
cholesterol.
These findings also imply that the genotype can influence growth responses and thus
landmarks of the Monod curves. In a study using another clone of D. magna, the addition of
PUFAs to a dietary sterol gradient increased the initial slope and thus decreased Ks (MartinCreuzburg et al. 2010); here we see a very similar initial slope in conjunction with a much
higher gmax yielding a higher Ks in the presence of PUFAs (Fig. 2a).
Surprisingly, no effect of the infection status was observed in either of the growth
experiments. We hypothesized that both the within-host localization of H. tvaerminnensis
(ovaries and fat cells, (Jirovec 1936)) and the in general strong host-dependency of
microsporidian parasites were excellent prerequisites for a high lipid demand. On the
contrary, our results rather suggest that H. tvaerminnensis is not consuming host-derived
cholesterol or PUFAs and thus the host’s requirements do not increase when parasitized. This
corroborates the assumption made by Corradi et al. (2009) saying that H. tvaerminnensis
might be less biochemically dependent on its host for its metabolism compared to its more
reduced relatives. Their results also imply that H. tvaerminnensis has a reduced capability to
derive metabolic products from its host.
Besides using growth response curves to estimate resource competition between host and
parasite regarding essential nutrients, the presented method may also be adapted to investigate
food quantity and thus energy demand. In principle, this method can be applied to a broad
range of model systems when modified accordingly and help to elucidate resource costs
arising from parasite infections.
ACKNOWLEDGEMENT
We are grateful for excellent experimental assistance by Bernd Kress and Christine Ziese.
This study was supported financially by the German Research Foundation (DFG, MA 5005/11).
87
7
CONCLUDING REMARKS AND PERSPECTIVES
The importance of nutrition for an organism’s overall performance and the role of trophic
interactions for whole ecosystems have increasingly been recognized by ecologists during the
last decades. As a consequence a whole new branch of research has been formed and termed
“nutritional ecology” (Raubenheimer and Boggs 2009). The biochemical composition of food
organisms has been identified as an important parameter that can severely affect the
performance of herbivorous consumers. From the beginning of food quality research attention
has been drawn to the role of polyunsaturated fatty acids (PUFAs) as potentially limiting
resources. More recently, controlled laboratory experiments have added to the picture painted
by correlative field studies depicting that dietary PUFAs not only act on the organismal level,
but that their importance potentially extents to ecosystem levels if keystone species are
affected (Müller-Navarra 1995, Müller-Navarra et al. 2000, Wacker et al. 2002, MartinCreuzburg et al. 2009, Martin-Creuzburg et al. 2012).
However, the understanding of the underlying mechanisms is still scarce. Surprisingly,
despite of knowing about the crucial functions mediated by PUFAs or their metabolites in
human physiology and pathophysiology, these nutrients have not been investigated in
pathogen- or parasite-challenged host in an ecological context. Given the importance of
eicosanoids in animal reproduction and immunity (Stanley 2000), this thesis aimed at
elucidating if and how PUFAs influence host-parasite interactions and demonstrating a
connection between food-derived PUFAs, parasite/pathogen defence and eicosanoid
metabolism in an invertebrate host.
Fortunately, the model organism with which the majority of ecological food quality research
was conducted (Daphnia magna) also was most suitable for the work presented in this thesis.
A number of well-described D. magna-parasite systems are available as well as genetic and
genomic tools and some basic assumptions on eicosanoid biosynthesis in this freshwater
crustacean (Ebert 2005, Heckmann et al. 2008b, Colbourne et al. 2011).
By combining classical life history, gene expression and growth response experiments I was
able to address a number of intriguing questions in this thesis:
88
CONCLUDING REMARKS AND PERSPECTIVES
 Can dietary PUFAs serve as a remedy for an infection by a pathogen? Is the interaction
between host and parasite subject to modulation by dietary PUFAs? To what extent can the
impact of dietary PUFAs be recognized in the next host generation? (Chapters 3 and 4)
The influence of host nutrition can be very substantial in host-parasite interactions. Models
predict that variation in resources supplied to hosts promotes variation in virulence in a given
host-parasite system, holding all else equal (Hall et al. 2007a). Regarding existing literature it
is clear that observed effects vary greatly between model systems and between food quantity
and quality (Krist et al. 2004, Pulkkinen and Ebert 2004, Frost et al. 2008, Sadd 2011,
Martinez-Rubio et al. 2012). In both model systems used in chapter 3 and 4 it became evident
that PUFA-mediated food quality is no exception in having profound impact on incidence and
severity of infection. Especially a natural food source rich in both ARA and EPA affected
survival in the D. magna - Pseudomonas sp. system and host susceptibility in the D. magna P. ramosa system. In the former case, this effect could largely be attributed to the availability
of ARA in the diet. As we can only guess the mechanism of pathogenesis, all attempts to
explain the importance of dietary PUFAs and especially ARA are bound to be speculative for
now. The most obvious mechanism would be to assume increased resistance through PUFAor eicosanoid-mediated defence mechanisms within the host. However, there are several
intriguing possibilities which should also be considered. Analysis of mutants of Pseudomonas
aeruginosa, another opportunistic pathogen of special importance to human health, suggests
that the bacterium uses similar mechanisms to infect Daphnia and other hosts (Le Coadic et
al. 2012). P. aeruginosa has been discovered to carry a secretable arachidonate 15lipoxygenase. This enzyme has been shown to readily convert ARA originating from
exogenous sources (e.g. from the membranes of infected tissues) into 15-HETE, a metabolite
known to have anti-inflammatory activity, therefore playing a regulatory role in the hostpathogen interaction (Vance et al. 2004). Additionally, the oral infection might also disturb
the natural microbiota in the host gut which could lead to intertwined effects of the diet, the
pathogen, the commensals and inflammatory processes (Bomba et al. 2002, Schiffrin and
Blum 2002, Stecher and Hardt 2008, Scott et al. 2013). The microbiota has proven to play a
crucial role in invertebrate models of disease (Broderick et al. 2010, Koch and SchmidHempel 2011, Koch and Schmid-Hempel 2012).
Results from the D. magna - P. ramosa system revealed that PUFA-mediated food quality can
have very different effects on the sequential steps of a parasitic infection. While the initial
establishment is less likely to be successful on a PUFA-rich diet, the very same food can
promote parasite growth later on. I did not succeed in reproducing this effect by
89
CONCLUDING REMARKS AND PERSPECTIVES
supplementing single PUFAs; this could be due to the fact, that concentrations delivered via
liposomes were clearly lower than through the natural food source. Nevertheless, effects on
the next generation were unanticipated strong and were resulting from moderate provisioning
of the eggs with PUFAs (Schlotz et al. 2013). Maternal effects on host-parasite interactions
have been reported before (Mitchell and Read 2005, Stjernman and Little 2011, Boots and
Roberts 2012). These studies agree in the finding that a poor maternal environment (in terms
of food scarcity) increases offspring resistance. I found that animals from mothers which were
fed C20 PUFA-free food were less susceptible compared to offspring from mothers fed C20
PUFA rich food. Allen and Little (2011) reported that an increased development rate results in
more infected hosts, suggesting that parasite resistance requires the allocation of resources
from a limited source and thus is costly. Trade-offs between immunity and other resourcerequiring functions have been proposed to influence outcomes of host-parasite interaction in
many systems (Zuk and Stoehr 2002, Fedorka et al. 2004, Gwynn et al. 2005, Simmons and
Roberts 2005, Tschirren and Richner 2006, Harshman and Zera 2007, Luong and Polak 2007,
Leman et al. 2009, Rono et al. 2010). The dietary PUFA- D. magna - P. ramosa system is
providing evidence that maternal PUFA supply leads to a high development/growth rate and
probably early allocation of resources into reproduction in the daughter generation, potentially
compromising immunity. Accordingly, host fecundity and host immunity were negatively
correlated (Fig. 4).
Figure 4 Fecundity (measured in
viable offspring produced by animals)
versus immunity (measured as the
inverse infection efficiency of the
parasite) of hosts in the daughter
generation (cf. chapter 4, Schlotz et al.
(2013)). Animals were all raised on
the same ARA- and EPA-deficient
diet (S. obliquus). Figure legend
describes the maternal food treatment.
90
CONCLUDING REMARKS AND PERSPECTIVES
It is now indicated to test immunocompetence of these offspring to conclusively relate the
observed effects to underlying trade-offs between physiological functions due to similar needs
for PUFAs.
 Is the expression of genes related to eicosanoid biosynthesis and reproduction responsive
to the dietary level of C20 PUFAs? Which parts of the eicosanoid biosynthesis machinery
react to the dietary precursor availability? Which of those are responsive to parasite
exposure? (Chapters 2 and 5)
Like other macro- and micronutrients, dietary PUFAs act as environmental regulators of gene
expression. This regulation is often achieved by altering the activity of transcription factors,
such as peroxisome proliferator activated receptors (PPAR), which bind fatty acids and
eicosanoids (Kliewer et al. 1997, Straus and Glass 2007). Chapter 2 represents a first
approach to link biochemical nutrient availabilities to gene expression. Therefore, D. magna
were raised on food sources differing in their PUFA composition and associated changes in
the expression of selected candidate genes were assessed. Genes examined here included
representatives of different pathways possibly influenced by changing dietary PUFA
availabilities, as indicated by their response to the eicosanoid biosynthesis inhibitor ibuprofen
(Heckmann et al. 2006, Heckmann et al. 2008a). Although yielding promising results
concerning the responsiveness of eicosanoid- and reproduction-related genes to food quality,
further studies in which the dietary PUFA supply is experimentally modified by specific
PUFA supplementation were required in order to elucidate the role of dietary PUFAs in
eicosanoid production. Additionally, boosting the immune system by exposure to infective
parasite endospores was hypothesized to increase eicosanoid-related gene expression. As
such, chapter 5 constitutes an extension of chapter 2.
We investigated gene expression of genes belonging to the prostanoid branch of eicosanoid
biosynthesis. The gene encoding the central enzyme of this pathway (Cox) did respond to the
dietary C20 PUFA availability, however, the most prominent changes – both in response to
precursor availability and parasite challenge – were found for another gene coding for an
enzyme with COX-like activity (Pxt). Annotated as “chorion peroxidase” the corresponding
enzyme has been shown to be sensitive to eicosanoid inhibitors and, presumably by forming
prostaglandin E2, to play a crucial role in oogenesis of Drosophila melanogaster (Tootle and
Spradling 2008). Our results tempt me to assume a very similar scenario for Daphnia
physiology plus a potential role in pathogen defence. I strongly suggest that this constitutes a
promising starting point for further investigations into Daphnia’s eicosanoid machinery.
91
CONCLUDING REMARKS AND PERSPECTIVES
Metabolism is frequently regulated by modulating protein activity, i.e. through activation or
inhibition, not gene expression (e.g. phosphorylation, marking for proteasomal degradation).
Thus, changes in mRNA transcript numbers are not necessarily predictive of changes in
protein level or function.
The research conducted in chapter 5 provided another observation sparking speculative ideas:
could the obvious induction of vitellogenins upon parasite-exposure be a sign of the
employment of those classical egg yolk protein precursors in a non-reproductive function like
pathogen recognition, similar to what is reported in fish and few other organisms (Hall et al.
1999, Li et al. 2008, Liu et al. 2009, Fischer et al. 2013)? Or is the induction merely an early
manifestation of P. ramosa-mediated dysregulation of reproductive parameters with the aim
to castrate the host?
Unfortunately, none of the examined target genes displayed a gene expression pattern that
could be specifically attributed to a high ARA and/or EPA supply and thus could have helped
to explain why N. limnetica seems to be a superior food source in the presence of pathogen
challenge (chapter 3 and 4, personal observations in chapter 5 (few animals raised on N.
limnetica got infected upon endospore exposure; the majority of the other treatments,
however, was infected)). Nonetheless, we should not forget that PUFAs by themselves are
potent regulators of immune functions potentially not relying on eicosanoid signalling; thus, a
missing induction of eicosanoid-related genes in no way rules out a role for PUFAs in
Daphnia immunity.
 Do host and parasite compete for host-derived essential lipids? How can we measure the
presumably increased host requirement for essential nutrients? (Chapter 6)
One of the main statements introducing studies on host-parasite interactions and the cost of
infection is that host and parasite compete for resources. However, with the exception of very
few methods regarding energy costs of infection there is no approach described to reliably
estimate increased demand for energy and especially for certain nutrients. For this purpose I
intended to adapt a system that has been frequently used to assess sterol- and PUFA- mediated
food quality effects in Daphnia (Martin-Creuzburg et al. 2009, Martin-Creuzburg et al. 2010,
Martin-Creuzburg et al. 2012, Sperfeld et al. 2012). While the method worked well and we
found expected food quality effects, we were unable to detect differences between control and
parasitized hosts. I believe that this is actually a very interesting and valid result as the
microsporidium used as parasite might not be as host-dependent as other parasites (Corradi et
al. 2009), thus tapping less into the host’s resources. Another host-parasite system would most
92
CONCLUDING REMARKS AND PERSPECTIVES
likely produce different results. A further development and improvement of this preliminary
resource competition assay should absolutely be pursued. This methodology might well be
suited for other model organisms as well. As it takes advantage of the fact that during the
juvenile phase animals invest primarily into somatic growth it will be easier to yield clear-cut
effects by using animals which contracted the infection vertically from their mothers; an
artificial horizontal infection will probably require extended experimental periods.
Consequently, depending on the host-parasite system, hosts might already invest into
reproduction which could decrease the observed effects. Also, this method will most likely
perform best with unselective feeders to guarantee ingestion of the provided food.
More and more immunologists strive to understand how an organism’s ecology influences the
immune system and in turn is influenced by it (Schulenburg et al. 2009). It is no surprise that
in recent years the gap between nutritional ecology and immunological ecology is bridged by
yet another cross-discipline field of research which is probably best described as nutritional
immunology. Early studies focused on food quantity and their effects on immune functions
followed by investigating the role of food quality (Siva-Jothy and Thompson 2002, Lee et al.
2008, Alaux et al. 2010, Cotter et al. 2011). Work based on the geometric framework concept
(Simpson and Raubenheimer 1993) showed that the role of macronutrient supply in sustaining
immune functions is highly complex and that different branches of the immune system require
different amounts or compositions of macronutrients (Cotter et al. 2011). Not only macro- but
also micronutrients can modulate the immune response (Field et al. 2002, CunninghamRundles et al. 2005). This is especially true for C20 PUFAs (de Pablo and de Cienfuegos
2000, Fritsche 2006, Calder 2007). I suggest that the essential dietary PUFAs ARA and EPA,
in their role as eicosanoid precursors, provide another link between nutrition and immunity.
Although there are pitfalls in focusing on single micronutrients (discussed in Ponton et al.
2011b), being able to conclusively relate a physiological mechanism to a specific dietary
compound will remain hard to achieve through macronutrient research.
Figure 5 Polyunsaturated fatty acids and eicosanoids as a proposed link between nutritional ecology
and ecological immunity.
93
CONCLUDING REMARKS AND PERSPECTIVES
The next step to relate the nutritional ecology of PUFAs to ecological immunology will be to
extent the concept presented here (Fig. 5). Future work should elaborate the final link from
PUFAs to consumer immunity.
Many of the invertebrate immune functions have been reported to be linked to eicosanoids
(Mandato et al. 1997, Morishima et al. 1997, Miller et al. 1999, Carton et al. 2002, Dean et al.
2002, Garcia et al. 2004, Merchant et al. 2008, Hyrsl et al. 2011, Kim and Kim 2011);
quantifying those in response to dietary PUFA supply and pathogen challenge, ideally in
conjunction with measuring eicosanoids directly, may yield valuable corroboration and
signify the logical extension to the results of this thesis.
While at the beginning of the here presented project environmental and especially nutritional
influences on host-parasite interactions in invertebrate model systems were widely neglected,
today I am witnessing a strong increase in interest and publications regarding this topic
(Cotter et al. 2011, Ponton et al. 2011a, Aalto and Pulkkinen 2013, Bernot 2013, Civitello et
al. 2013, Coopman et al. 2014, Dallas and Drake 2013, Di Pasquale et al. 2013, Hall et al.
2013, Vale et al. 2013). The same is true for the methodological approaches used to study
nutritional constraints including their physiological and ecological consequences (Afacan et
al. 2012, Wagner et al. 2013).
I am happy that this thesis is part of an early stage of what for sure will develop into a field of
research of great cross-disciplinary interest, beyond the classical notions of life history,
nutritional ecology, parasitology, and ecological immunology.
94
ABSTRACT
Polyunsaturated fatty acids (PUFAs) are essential biochemicals that evidentially have an
immense potential to modulate immune defence mechanisms. This is exploited by functional
foods to promote proper development and health. However, the role of these dietary
compounds has not been investigated in an eco-physiological context. Especially, the
interface between host, parasites, and the host’s resources has been widely neglected for a
long time despite the potential importance of dietary PUFAs in host-parasite interactions.
Two major aspects of host-parasite interactions are potentially modulated by dietary PUFA
availability: host resistance to parasite infection and resource competition between host and
parasite. Both are addressed in the chapters of this thesis using oral infection models, classical
life history experiments, target gene expression approaches and nutrient-limited growth
responses.
Investigations focused on the two PUFAs arachidonic acid (ARA) and eicosapentaenoic acid
(EPA), both precursors of the hormone-like eicosanoids, which play a role in reproduction,
immunity and ion transport physiology of both vertebrates and invertebrates. It is well known
that ARA and EPA crucially influence the fitness of Daphnia magna, a planktonic crustacean
and emerging model organism, which harbours a multitude of well-described parasites and
which, for those reasons, has been used in the presented work.
PUFA-mediated food quality clearly affects the susceptibility of hosts to and the severity of
infection both via direct consumption and via maternal effects. Feeding on Nannochloropsis
limnetica, an alga containing high amounts of both ARA and EPA, decreased the
susceptibility to an infection with the parasite Pasteuria ramosa and provided protection
against the opportunistic pathogen Pseudomonas sp. In the latter case, the protective effect
can in part be attributed to the dietary ARA availability. In the daughter generation maternal
provisioning with PUFAs was a disadvantage regarding parasite resistance, thereby providing
evidence for a fecundity-immunity trade-off.
The intention of the next steps was to investigate to what extent the dietary intake of PUFAs
can impact eicosanoid- and reproduction-related gene expression. Algal food organisms
naturally differing in their PUFA content and composition as well as targeted ARA and EPA
supplementation proved to influence gene expression. The genes coding for the central
prostanoid biosynthesis enzymes (Cox, Pxt) were among the most responsive ones. Parasite
95
ABSTRACT
exposure further induced Pxt expression. From these results, a crucial role of prostanoid
eicosanoids in reproduction and host defence can be hypothesized. The immune stimulus by
the parasite also resulted in increased numbers of vitellogenin transcripts. Intriguingly,
vitellogenins have been described in the literature to potentially play a role in pathogen
recognition thus giving rise to speculations about similar events in Daphnia.
Finally, the frequently implied competition for resource between host and parasite has been
assessed. By comparing nutrient-limited growth responses, a method that has extensively been
used in food quality research, shifts in the requirements for essential lipids caused by parasite
infection can be detected and estimated. The first host-parasite system examined suggested
that the host-dependency of the microsporidian parasite Hamiltosporidium tvaerminnensis,
regarding sterols and PUFAs, is not very pronounced. The theory behind the suggested
methodology is discussed and the adaptability for other model systems pointed out.
This thesis highlights several aspects of eco-physiological consequences of dietary PUFA
availability for host-parasite interactions and provides promising starting points for future
research on the nutritional ecology of PUFAs and their probable link to nutritional
immunology.
96
ZUSAMMENFASSUNG
Mehrfach ungesättigte Fettsäuren (polyunsaturated fatty acids, PUFAs) bilden eine Klasse
essentieller biochemischer Nährstoffe, die bekannterweise ein immenses Potential zur
Modulierung der Immunabwehr besitzt. Das wird von „Functional Foods“ genutzt, um eine
optimale Entwicklung zu unterstützen und die Gesundheit zu fördern. Die Rolle dieser
Nahrungsbestandteile wurde jedoch bislang nicht in einem ökophysiologischen Kontext
untersucht. Im Besonderen die Schnittstelle zwischen Wirt, Parasit und den Ressourcen des
Wirts wurde für lange Zeit trotz der potentiellen Bedeutung von PUFAs aus der Nahrung für
Wirt-Parasit-Interaktionen weitgehend vernächlässigt.
Zwei Hauptaspekte von Wirt-Parasit-Interaktionen werden möglicherweise durch PUFAs aus
der Nahrung moduliert: die Wirtsresistenz gegenüber einer parasitären Infektion und die
Ressourcenkonkurrenz zwischen Wirt und Parasit. Beide wurden in den Kapiteln dieser
Arbeit mit Hilfe von oralen Infektionsmodellen, klassischen „Life History“-Experimenten,
Genexpressionsstudien und nährstofflimitierten Wachstumsversuchen aufgegriffen.
Die Untersuchungen beschäftigten sich schwerpunktmäßig mit den beiden PUFAs
Arachidonsäure
(ARA)
und
Eicosapentaensäure
(EPA),
die
Vorstufen
für
die
hormonähnlichen Eicosanoide sind und damit eine Rolle bei der Reproduktion, Immuniät und
Ionentransportphysiologie von Vertebraten als auch Invertebraten spielen. Bekanntlich
beeinflussen ARA und EPA ausschlaggebend die Fitness von Daphnia magna, einem zu den
Krebstieren gehörenden Vertreter des Zooplanktons, der immer mehr zum Modellorganismus
wird. Aus diesen Gründen sowie auf Grund der Tatsache, dass es zahlreiche gut beschriebene
Daphnia-Parasiten-Systeme gibt, wurde D. magna für die Experimente dieser Arbeit
verwendet.
Die durch PUFAs vermittelte Futterqualität beeinflusst sowohl die Infektionsanfälligkeit des
Wirts als auch das Ausmaß des Infektionsverlaufs. Dies kann durch direkte Aufnahme als
auch durch maternale Effekte bewirkt werden. Nannochloropsis limnetica, eine Alge, die
große Mengen an ARA und EPA enthält, verringerte die Anfälligkeit bezüglich einer
Infektion mit dem Parasiten Pasteuria ramosa und hatte eine schützende Funktion gegen den
opportunistischen Krankheitserreger Pseudomonas sp. Im zweitgenannten Fall konnte der
schützende Effekt teilweise der mit der Nahrung aufgenommenen ARA zugeschrieben
werden. Für die Tochtergeneration brachte die maternale Versorgung mit PUFAs einen
97
ZUSAMMENFASSUNG
Nachteil bezüglich der Resistenz mit sich. Dies belegt einen möglichen „Trade-off“ zwischen
Fekundität und Immunität.
Die Intention der nächsten Schritte war zu untersuchen, in welchem Ausmaß die Aufnahme
von PUFAs mit der Nahrung die Expression von Genen, die mit der Eicosanoidbiosynthese
oder der Reproduktion zusammenhängen, beeinflussen kann. Futteralgen, die sich
natürlicherweise in ihrem PUFA-Gehalt und ihrer PUFA-Zusammensetzung unterscheiden,
hatten einen deutlichen Einfluss auf die Genexpression, ebenso die gezielte Supplementierung
der Nahrung mit
ARA und EPA.
Die
Gene,
die für zentrale Enzyme der
Prostanoidbiosynthese codieren (Cox, Pxt), zeigten unter anderen die deutlichste Reaktion.
Die Parasitenexposition erhöhte die Expression von Pxt noch weiter. Diese Ergebnisse lassen
vermuten, dass die Eicosanoide des Prostanoidzweigs eine wesentliche Rolle bei der
Reproduktion und den Abwehrmechanismen spielen. Der durch den Parasiten verursachte
Immunstimulus führte außerdem zu einer höheren Anzahl von Vitellogenin-Gentranskripten.
Interessanterweise beschreibt die wissenschaftliche Literatur Fälle, in denen Vitellogenine
eine Rolle bei der Pathogenerkennung einnehmen. Dies gibt Anlass für Spekulationen
hinsichtlich ähnlicher Vorgänge in Daphnia.
Schließlich wurde die häufig angenommene Ressourcenkonkurrenz zwischen Wirt und Parasit
näher untersucht, indem nährstofflimitierte Wachstumskurven von gesunden und infizierten
Wirten miteinander verglichen wurden, um Veränderungen im Bedarf an essentiellen Lipiden
verursacht durch die parasitäre Infektion zu detektieren und abzuschätzen. Ein erstes WirtParasit-System wurde hier so getestet. Es zeigte sich, dass die Wirtsabhängigkeit von
Hamiltosporidium tvaerminnensis bezüglich Cholesterol und PUFAs nicht stark ausgeprägt
ist. Theoretische Grundlagen der Methodik werden diskutiert und die Übertragbarkeit auf
andere Modellsysteme aufgezeigt.
Diese Arbeit hebt mehrere Aspekte ökophysiologischer Konsequenzen der PUFAVerfügbarkeit
in
vielversprechende
Ernährungsökologie
der
Nahrung
für
Ausgangspunkte
von
PUFAs
Wirt-Parasit-Interaktionen
für
und
zukünftige
deren
Forschung
mögliche
hervor
und
liefert
hinsichtlich
der
Verbindung
zur
Ernährungsimmunologie.
98
CITED LITERATURE
Aalto, S. L., and K. Pulkkinen. 2013. Food stoichiometry affects the outcome of Daphnia-parasite
interaction. Ecology and Evolution 3:1266-1275.
Afacan, N. J., C. D. Fjell, and R. E. W. Hancock. 2012. A systems biology approach to nutritional
immunology - Focus on innate immunity. Molecular Aspects of Medicine 33:14-25.
Alaux, C., F. Ducloz, D. Crauser, and Y. Le Conte. 2010. Diet effects on honeybee
immunocompetence. Biology Letters 6:562-565.
Alcock, J., M. L. Franklin, and C. W. Kuzawa. 2012. Nutrient signaling: evolutionary origins of the
immune-modulating effects of dietary fat. Quarterly Review of Biology 87:187-223.
Allen, D. E., and T. J. Little. 2011. Identifying energy constraints to parasite resistance. Journal of
Evolutionary Biology 24:224-229.
Altermatt, F., and D. Ebert. 2008. Genetic diversity of Daphnia magna populations enhances
resistance to parasites. Ecology Letters 11:918-928.
Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment
search tool. Journal of Molecular Biology 215:403-410.
Amdam, G. V., Z. L. P. Simoes, A. Hagen, K. Norberg, K. Schroder, O. Mikkelsen, T. B. L.
Kirkwood, and S. W. Omholt. 2004. Hormonal control of the yolk precursor vitellogenin
regulates immune function and longevity in honeybees. Experimental Gerontology 39:767773.
Arthur, J. R. 2000. The glutathione peroxidases. Cellular and Molecular Life Sciences 57:1825-1835.
Auld, S. K. J. R., J. A. Scholefield, and T. J. Little. 2010. Genetic variation in the cellular response of
Daphnia magna (Crustacea: Cladocera) to its bacterial parasite. Proceedings of the Royal
Society B - Biological Sciences 277:3291-3297.
Balsinde, J., and E. A. Dennis. 1997. Function and Inhibition of Intracellular Calcium-independent
Phospholipase A2. Journal of Biological Chemistry 272:16069-16072.
Basen, T., K.-O. Rothhaupt, and D. Martin-Creuzburg. 2012. Absence of sterols constrains food
quality of cyanobacteria for an invasive freshwater bivalve. Oecologia 170:57-64.
Becker, C., and M. Boersma. 2003. Resource quality effects on life histories of Daphnia. Limnology
and Oceanography 48:700-706.
Becker, C., and M. Boersma. 2005. Differential effects of phosphorus and fatty acids on Daphnia
magna growth and reproduction. Limnology and Oceanography 50:388-397.
Bedhomme, S., P. Agnew, C. Sidobre, and Y. Michalakis. 2004. Virulence reaction norms across a
food gradient. Proceedings of the Royal Society B - Biological Sciences 271:739-744.
Behmer, S. T., and W. D. Nes. 2003. Insect sterol nutrition and physiology: A global overview.
Advances in Insect Physiology 31:1-72.
Ben-Ami, F., D. Ebert, and R. R. Regoes. 2010. Pathogen dose infectivity curves as a method to
analyze the distribution of host susceptibility: a quantitative assessment of maternal effects
after food stress and pathogen exposure. American Naturalist 175:106-115.
.
99
CITED LITERATURE
Ben-Ami, F., T. Rigaud, and D. Ebert. 2011. The expression of virulence during double infections by
different parasites with conflicting host exploitation and transmission strategies. Journal of
Evolutionary Biology 24:1307-1316.
Berger, J., and D. E. Moller. 2002. The mechanisms of action of PPARs. Annual Review of Medicine
53:409-435Bergstrom, S., and B. Samuelsson. 1962. Isolation of prostaglandin E1 from
human seminal plasma - prostaglandins and related factors 11. Journal of Biological
Chemistry 237:3005-&.
Bernardo, J. 1996. Maternal effects in animal ecology. American Zoologist 36:83-105.
Bernot, R. J. 2013. Parasite-host elemental content and the effects of a parasite on host-consumerdriven nutrient recycling. Freshwater Science 32:299-308.
Blaul, B., and J. Ruther. 2011. How parasitoid females produce sexy sons: a causal link between
oviposition preference, dietary lipids and mate choice in Nasonia. Proceedings of the Royal
Society B - Biological Sciences 278:3286-3293.
Bomba, A., R. Nemcova, S. Gancarcikova, R. Herich, P. Guba, and D. Mudronova. 2002.
Improvement of the probiotic effect of microorganisms by their combination with
maltodextrins, fructo-oligosaccharides and polyunsaturated fatty acids. British Journal of
Nutrition 88:S95-S99.
Boots, M., and K. E. Roberts. 2012. Maternal effects in disease resistance: poor maternal environment
increases offspring resistance to an insect virus. Proceedings of the Royal Society B Biological Sciences 279:4009-4014.
Bownes, M. 1986. Expression of the genes coding for vitellogenin (yolk protein). Annual Review of
Entomology 31:507-531.
Boyanovsky, B. B., and N. R. Webb. 2009. Biology of secretory phospholipase A2. Cardiovascular
Drugs and Therapy 23:61-72.
Bridgham, S. D., J. Pastor, C. A. McClaugherty, and C. J. Richardson. 1995. Nutrient-use efficiency a litterfall index, a model, and a test along a nutrient-availability gradient in North Carolina
peatlands. American Naturalist 145:1-21.
Broderick, N. A., K. F. Raffa, and J. Handelsman. 2010. Chemical modulators of the innate immune
response alter gypsy moth larval susceptibility to Bacillus thuringiensis. BMC Microbiology
10:13.
Burr, G. O., and M. M. Burr. 1930. On the nature and role of the fatty acids essential in nutrition.
Journal of Biological Chemistry 86:0587-0621.
Calder, P. C. 1998. Dietary fatty acids and the immune system. Nutrition Reviews 56:70-83.
Calder, P. C. 2007. Immunomodulation by omega-3 fatty acids. Prostaglandins, Leukotrienes and
Essential Fatty Acids 77:327-335.
Calder, P. C., and S. Kew. 2002. The immune system: a target for functional foods? British Journal of
Nutrition 88:165-176.
Careau, V., D. W. Thomas, and M. M. Humphries. 2010. Energetic cost of bot fly parasitism in freeranging eastern chipmunks. Oecologia 162:303-312.
Carmichael, W. W. 1994. Toxins of Cyanobacteria. Scientific American 270:78-86.
100
CITED LITERATURE
Carton, Y., F. Frey, D. W. Stanley, E. Vass, and A. J. Nappi. 2002. Dexamethasone inhibition of the
cellular immune response of Drosophila melanogaster against a parasitoid. Journal of
Parasitology 88:405-407.
Chandra, R. K. 1997. Nutrition and the immune system: An introduction. American Journal of Clinical
Nutrition 66:S460-S463.
Civitello, D. J., R. M. Penczykowski, J. L. Hite, M. A. Duffy, and S. R. Hall. 2013. Potassium
stimulates fungal epidemics in Daphnia by increasing host and parasite reproduction. Ecology
94:380-388.
Clandinin, M. T., S. Cheema, C. J. Field, M. L. Garg, J. Venkatraman, and T. R. Clandinin. 1991.
Dietary fat - exogenous determination of membrane structure and cell function. FASEB
Journal 5:2761-2769.
Clare, A. S., G. Walker, D. L. Holland, and D. J. Crisp. 1985. The hatching substance of the barnacle,
Balanus balanoides (L.). Proceedings of the Royal Society of London Series B - Biological
Sciences 224:131-147.
Colbourne, J. K., M. E. Pfrender, D. Gilbert, W. K. Thomas, A. Tucker, T. H. Oakley, S. Tokishita, A.
Aerts, G. J. Arnold, M. K. Basu, D. J. Bauer, C. E. Caceres, L. Carmel, C. Casola, J. H. Choi,
J. C. Detter, Q. F. Dong, S. Dusheyko, B. D. Eads, T. Frohlich, K. A. Geiler-Samerotte, D.
Gerlach, P. Hatcher, S. Jogdeo, J. Krijgsveld, E. V. Kriventseva, D. Kultz, C. Laforsch, E.
Lindquist, J. Lopez, J. R. Manak, J. Muller, J. Pangilinan, R. P. Patwardhan, S. Pitluck, E. J.
Pritham, A. Rechtsteiner, M. Rho, I. B. Rogozin, O. Sakarya, A. Salamov, S. Schaack, H.
Shapiro, Y. Shiga, C. Skalitzky, Z. Smith, A. Souvorov, W. Sung, Z. J. Tang, D. Tsuchiya, H.
Tu, H. Vos, M. Wang, Y. I. Wolf, H. Yamagata, T. Yamada, Y. Z. Ye, J. R. Shaw, J.
Andrews, T. J. Crease, H. X. Tang, S. M. Lucas, H. M. Robertson, P. Bork, E. V. Koonin, E.
M. Zdobnov, I. V. Grigoriev, M. Lynch, and J. L. Boore. 2011. The Ecoresponsive Genome of
Daphnia pulex. Science 331:555-561.
Coopman, M., K. Muylaert, B. Lange, L. Reyserhove, and E. Decaestecker. 2014. Context
dependency of infectious disease: the cyanobacterium Microcystis aeruginosa decreases white
bacterial disease in Daphnia magna. Freshwater Biology 59:714-723.
Corradi, N., K. L. Haag, J. F. Pombert, D. Ebert, and P. J. Keeling. 2009. Draft genome sequence of
the Daphnia pathogen Octosporea bayeri: insights into the gene content of a large
microsporidian genome and a model for host-parasite interactions. Genome Biology 10:12.
Cory, J. S., and K. Hoover. 2006. Plant-mediated effects in insect-pathogen interactions. Trends in
Ecology & Evolution 21:278-286.
Cotter, S. C., S. J. Simpson, D. Raubenheimer, and K. Wilson. 2011. Macronutrient balance mediates
trade-offs between immune function and life history traits. Functional Ecology 25:186-198.
Crawley, M. J. 2002. Statistical computing: an introduction to data analysis using S-Plus. John Wiley
& Sons, Chichester.
Cunnane, S. C. 2000. The conditional nature of the dietary need for polyunsaturates: a proposal to
reclassify 'essential fatty acids' as 'conditionally-indispensable' or conditionally-dispensable'
fatty acids. British Journal of Nutrition 84:803-812.
Cunningham-Rundles, S., D. F. McNeeley, and A. Moon. 2005. Mechanisms of nutrient modulation of
the immune response. Journal of Allergy and Clinical Immunology 115:1119-1128.
101
CITED LITERATURE
Dadd, R. H., and J. E. Kleinjan. 1979. Essential fatty acid for the mosquito Culex pipiens: arachidonic
acid. Journal of Insect Physiology 25:495-502.
Dallas, T., and J. M. Drake. 2013. Nitrate enrichment alters a Daphnia–microparasite interaction
through multiple pathways. Ecology and Evolution 4:243-250.
de Pablo, M. A., and G. A. de Cienfuegos. 2000. Modulatory effects of dietary lipids on immune
system functions. Immunology and Cell Biology 78:31-39.
Dean, P., J. C. Gadsden, E. H. Richards, J. P. Edwards, A. K. Charnley, and S. E. Reynolds. 2002.
Modulation by eicosanoid biosynthesis inhibitors of immune responses by the insect Manduca
sexta to the pathogenic fungus Metarhizium anisopliae. Journal of Invertebrate Pathology
79:93-101.
Decaestecker, E., P. Labbe, K. Ellegaard, J. E. Allen, and T. J. Little. 2011. Candidate innate immune
system gene expression in the ecological model Daphnia. Developmental and Comparative
Immunology 35:1066-1075.
Deines, P., C. Matz, and K. Juergens. 2009. Toxicity of violacein-producing bacteria fed to
bacterivorous freshwater plankton. Limnology and Oceanography 54:1343-1352.
DeMott, W. R. 1986. The role of taste in food selection by freshwater zooplankton. Oecologia 69:334340.
Desbois, A. P., and V. J. Smith. 2010. Antibacterial free fatty acids: activities, mechanisms of action
and biotechnological potential. Applied Microbiology and Biotechnology 85:1629-1642.
Di Pasquale, G., M. Salignon, Y. Le Conte, L. P. Belzunces, A. Decourtye, A. Kretzschmar, S.
Suchail, J. L. Brunet, and C. Alaux. 2013. Influence of pollen nutrition on honey bee health:
do pollen quality and diversity matter? PLOS ONE 8:13.
Dillon, R. J., C. T. Vennard, A. Buckling, and A. K. Charnley. 2005. Diversity of locust gut bacteria
protects against pathogen invasion. Ecology Letters 8:1291-1298.
Dubois, R. N., S. B. Abramson, L. Crofford, R. A. Gupta, L. S. Simon, L. B. A. Van De Putte, and P.
E. Lipsky. 1998. Cyclooxygenase in biology and disease. The FASEB Journal 12:1063-1073.
Duneau, D., P. Luijckx, F. Ben-Ami, C. Laforsch, and D. Ebert. 2011. Resolving the infection process
reveals striking differences in the contribution of environment, genetics and phylogeny to
host-parasite interactions. BMC Biology 9:11.
Ebert, D. 2005. Ecology, Epidemiology, and Evolution of Parasitism in Daphnia. National Library of
Medicine (US), National Center for Biotechnology Information, Bethesda (MD).
Ebert, D. 2011. A Genome for the Environment. Science 331:539-540.
Ebert, D., H. J. Carius, T. Little, and E. Decaestecker. 2004. The evolution of virulence when parasites
cause host castration and gigantism. American Naturalist 164:S19-S32.
Ebert, D., M. Lipsitch, and K. L. Mangin. 2000. The effect of parasites on host population density and
extinction: Experimental epidemiology with Daphnia and six microparasites. American
Naturalist 156:459-477.
Ebert, D., P. Rainey, T. M. Embley, and D. Scholz. 1996. Development, life cycle, ultrastructure and
phylogenetic position of Pasteuria ramosa Metchnikoff 1888: Rediscovery of an obligate
endoparasite of Daphnia magna Straus. Philosophical Transactions of the Royal Society of
London Series B - Biological Sciences 351:1689-1701.
102
CITED LITERATURE
Esteves, A., and R. Ehrlich. 2006. Invertebrate intracellular fatty acid binding proteins. Comparative
Biochemistry and Physiology C - Toxicology & Pharmacology 142:262-274.
Fedorka, K. M., M. Zuk, and T. A. Mousseau. 2004. Immune suppression and the cost of reproduction
in the ground cricket, Allonemobius socius. Evolution 58:2478-2485.
Field, C. J., I. R. Johnson, and P. D. Schley. 2002. Nutrients and their role in host resistance to
infection. Journal of Leukocyte Biology 71:16-32.
Fischer, M., C. Regitz, R. Kull, M. Boll, and U. Wenzel. 2013. Vitellogenins increase stress resistance
of Caenorhabditis elegans after Photorhabdus luminescens infection depending on the
steroid-signaling pathway. Microbes and Infection 15:569-578.
Fraenkel, G., and M. Blewett. 1947. Linoleic acid and arachidonic acid in the metabolism of two
insects, Ephestia kuehniella (Lep) and Tenebrio molitor (Col). Biochemical Journal 41:475478.
Freese, H., and B. Schink. 2011. Composition and stability of the microbial community inside the
digestive tract of the aquatic crustacean Daphnia magna. Microbial Ecology 62:882-894.
Freese, H., and D. Martin-Creuzburg. 2013. Food quality of mixed bacteria–algae diets for Daphnia
magna. Hydrobiologia 715:63-76.
Fritsche, K. 2006. Fatty acids as modulators of the immune response. Annual Review of Nutrition
26:45-73.
Frost, P. C., D. Ebert, J. H. Larson, M. A. Marcus, N. D. Wagner, and A. Zalewski. 2010.
Transgenerational effects of poor elemental food quality on Daphnia magna. Oecologia
162:865-872.
Frost, P. C., D. Ebert, and V. H. Smith. 2008. Responses of a bacterial pathogen to phosphorus
limitation of its aquatic invertebrate host. Ecology 89:313-318.
Funk, C. D. 2001. Prostaglandins and leukotrienes: Advances in eicosanoid biology. Science
294:1871-1875.
Garber, E. D. 1960. The host as a growth medium. Annals of the New York Academy of Sciences
88:1187-1194.
Garcia, E. S., E. M. M. Machado, and P. Azambuja. 2004. Effects of eicosanoid biosynthesis
inhibitors on the prophenoloxidase-activating system and microaggregation reactions in the
hemolymph of Rhodnius prolixus infected with Trypanosoma rangeli. Journal of Insect
Physiology 50:157-165.
Giamarellos-Bourboulis, E. J., P. Grecka, A. Dionyssiou-Asteriou, and H. Giamarellou. 1998. In vitro
activity of polyunsaturated fatty acids on Pseudomonas aeruginosa: relationship to lipid
peroxidation. Prostaglandins Leukotrienes and Essential Fatty Acids 58:283-287.
Gibbs, M., C. J. Breuker, H. Hesketh, R. S. Hails, and H. Van Dyck. 2010. Maternal effects, flight
versus fecundity trade-offs, and offspring immune defence in the Speckled Wood butterfly,
Pararge aegeria. BMC Evolutionary Biology 10.
Gismondi, E., C. Cossu-Leguille, and J. N. Beisel. 2012. Does the acanthocephalan parasite
Polymorphus minutus modify the energy reserves and antitoxic defences of its intermediate
host Gammarus roeseli? Parasitology 139:1054-1061.
103
CITED LITERATURE
Gladyshev, M. I., M. T. Arts, and N. N. Sushchik. 2009. Preliminary estimates of the export of
omega3 highly unsaturated fatty acids (EPA + DHA) from aquatic to terrestrial ecosystems.
Springer, New York, Ny 10013, United States.
Green, J. 1974. Parasites and epibionts of Cladocera. Transactions of the Zoological Society of
London 32:417-516.
Greenberg, A. E., R. R. Trussell, and L. S. Clesceri. 1985. Standard methods for the examination of
water and wastewater. American Public Health Association, Washington, DC.
Grieneisen, M. L. 1994. Recent advances in our knowledge of ecdysteroid biosynthesis in insects and
crustaceans. Insect Biochemistry and Molecular Biology 24:115-132.
Grover, J. P. 1997. Resource Competition. Springer US.
Guillard, R. R. L. 1975. Cultures of phytoplankton for feeding of marine invertebrates.in W. L. Smith
and M. H. Chanley, editors. Culture of marine invertebrate animals. Plenum.
Guschina, I. A., and J. L. Harwood. 2006. Mechanisms of temperature adaptation in poikilotherms.
FEBS Letters 580:5477-5483.
Gwynn, D. M., A. Callaghan, J. Gorham, K. F. A. Walters, and M. D. E. Fellowes. 2005. Resistance is
costly: trade-offs between immunity, fecundity and survival in the pea aphid. Proceedings of
the Royal Society B - Biological Sciences 272:1803-1808.
Haag, K. L., J. I. R. Larsson, D. Refardt, and D. Ebert. 2011. Cytological and molecular description of
Hamiltosporidium tvaerminnensis gen. et sp nov., a microsporidian parasite of Daphnia
magna, and establishment of Hamiltosporidium magnivora comb. nov. Parasitology 138:447462.
Haag, K. L., E. Sheikh-Jabbari, F. Ben-Ami, and D. Ebert. 2013. Microsatellite and single-nucleotide
polymorphisms indicate recurrent transitions to asexuality in a microsporidian parasite.
Journal of Evolutionary Biology 26:1117-1128.
Hall, M., R. G. Wang, R. van Antwerpen, L. Sottrup-Jensen, and K. Soderhall. 1999. The crayfish
plasma clotting protein: a vitellogenin-related protein responsible for clot formation in
crustacean blood. Proceedings of the National Academy of Sciences of the United States of
America 96:1965-1970.
Hall, M. D., and D. Ebert. 2012. Disentangling the influence of parasite genotype, host genotype and
maternal environment on different stages of bacterial infection in Daphnia magna.
Proceedings of the Royal Society B - Biological Sciences 279:3176-3183.
Hall, M. D., A. Vettiger, and D. Ebert. 2013. Interactions between environmental stressors: the
influence of salinity on host-parasite interactions between Daphnia magna and Pasteuria
ramosa. Oecologia 171:789-796.
Hall, S. R., C. Becker, and C. E. Caceres. 2007a. Parasitic castration: a perspective from a model of
dynamic energy budgets. Integrative and Comparative Biology 47:295-309.
Hall, S. R., C. J. Knight, C. R. Becker, M. A. Duffy, A. J. Tessier, and C. E. Caceres. 2009. Quality
matters: resource quality for hosts and the timing of epidemics. Ecology Letters 12:118-128.
Hall, S. R., L. Sivars-Becker, C. Becker, M. A. Duffy, A. J. Tessier, and C. E. Caceres. 2007b. Eating
yourself sick: transmission of disease as a function of foraging ecology. Ecology Letters
10:207-218.
104
CITED LITERATURE
Hannas, B. R., Y. H. Wang, S. Thomson, G. Kwon, H. Li, and G. A. LeBlanc. 2011. Regulation and
dysregulation of vitellogenin mRNA accumulation in daphnids (Daphnia magna). Aquatic
Toxicology 101:351-357.
Hardalo, C., and S. C. Edberg. 1997. Pseudomonas aeruginosa: Assessment of risk from drinking
water. Critical Reviews in Microbiology 23:47-75.
Harshman, L. G., and A. J. Zera. 2007. The cost of reproduction: the devil in the details. Trends in
Ecology & Evolution 22:80-86.
Hartwich, M., D. Martin-Creuzburg, K.-O. Rothhaupt, and A. Wacker. 2012. Oligotrophication of a
large, deep lake alters food quantity and quality constraints at the primary producer-consumer
interface. Oikos 121:1702-1712.
Hayashi, Y., L. H. Heckmann, A. Callaghan, and R. M. Sibly. 2008. Reproduction recovery of the
crustacean Daphnia magna after chronic exposure to ibuprofen. Ecotoxicology 17:246-251.
Heckmann, L. H., A. Bouetard, C. J. Hill, R. M. Sibly, and A. Callaghan. 2007. A simple and rapid
method for preserving RNA of aquatic invertebrates for ecotoxicogenomics. Ecotoxicology
16:445-447.
Heckmann, L. H., R. Connon, T. H. Hutchinson, S. J. Maund, R. M. Sibly, and A. Callaghan. 2006.
Expression of target and reference genes in Daphnia magna exposed to ibuprofen. BMC
Genomics 7:8.
Heckmann, L. H., R. M. Sibly, R. Connon, H. L. Hooper, T. H. Hutchinson, S. J. Maund, C. J. Hill, A.
Bouetard, and A. Callaghan. 2008a. Systems biology meets stress ecology: linking molecular
and organismal stress responses in Daphnia magna. Genome Biology 9.
Heckmann, L. H., R. M. Sibly, M. Timmermans, and A. Callaghan. 2008b. Outlining eicosanoid
biosynthesis in the crustacean Daphnia. Frontiers in Zoology 5.
Heckmann, L. H., P. B. Sorensen, P. H. Krogh, and J. G. Sorensen. 2011. NORMA-Gene: A simple
and robust method for qPCR normalization based on target gene data. BMC Bioinformatics
12:7.
Hori, T., T. Yokomizo, H. Ago, M. Sugahara, G. Ueno, M. Yamamoto, T. Kumasaka, T. Shimizu, and
M. Miyano. 2004. Structural basis of leukotriene B4 12-hydroxydehydrogenase/15-oxoprostaglandin 13-reductase catalytic mechanism and a possible Src homology 3 domain
binding loop. Journal of Biological Chemistry 279:22615-22623.
Hothorn, T., F. Bretz, and P. Westfall. 2008. Simultaneous inference in general parametric models.
Biometrical Journal 50:346-363.
Huisman, J., R. R. Jonker, C. Zonneveld, and F. J. Weissing. 1999. Competition for light between
phytoplankton species: Experimental tests of mechanistic theory. Ecology 80:211-222.
Hyrsl, P., P. Dobes, Z. Wang, T. Hauling, C. Wilhelmsson, and U. Theopold. 2011. Clotting factors
and eicosanoids protect against nematode infections. Journal of Innate Immunity 3:65-70.
James, M. J., R. A. Gibson, and L. G. Cleland. 2000. Dietary polyunsaturated fatty acids and
inflammatory mediator production. American Journal of Clinical Nutrition 71:343S-348S.
Jirovec, O. 1936. Über einige in Daphnia magna parasitierende Mikrosporidien. Zoologischer
Anzeiger 116:136-142.
105
CITED LITERATURE
Jüttner, F., J. Leonhardt, and S. Möhren. 1983. Environmental factors affecting the formation of
mesityloxid, dimethylallylic alcohol and other volatile compounds excreted by Anabaena
cylindrica. Journal of General Microbiology 129:407-412.
Kabara, J. J., D. M. Swieczkowski, A. J. Conley, and J. P. Truant. 1972. Fatty acids and derivatives as
antimicrobial agents. Antimicrobial Agents and Chemotherapy 2:23-28.
Katinka, M. D., S. Duprat, E. Cornillot, G. Metenier, F. Thomarat, G. Prensier, V. Barbe, E.
Peyretaillade, P. Brottier, P. Wincker, F. Delbac, H. El Alaoui, P. Peyret, W. Saurin, M. Gouy,
J. Weissenbach, and C. P. Vivares. 2001. Genome sequence and gene compaction of the
eukaryote parasite Encephalitozoon cuniculi. Nature 414:450-453.
Keeling, P. J., and N. M. Fast. 2002. Microsporidia: Biology and evolution of highly reduced
intracellular parasites. Annual Review of Microbiology 56:93-116.
Kilpatrick, D. C. 2002. Animal lectins: a historical introduction and overview. Biochimica et
Biophysica Acta - General Subjects 1572:187-197.
Kim, J., and Y. Kim. 2011. Benzylideneacetone, an eicosanoid biosynthesis inhibitor enhances
baculovirus pathogenicity in the diamondback moth, Plutella xylostella. Journal of
Invertebrate Pathology 106:308-313.
Kim, J., Y. Kim, S. Lee, K. Kwak, W. J. Chung, and K. Choi. 2011. Determination of mRNA
expression of DMRT93B, vitellogenin, and cuticle 12 in Daphnia magna and their biomarker
potential for endocrine disruption. Ecotoxicology 20:1741-1748.
Kime, D. E., J. P. Nash, and A. P. Scott. 1999. Vitellogenesis as a biomarker of reproductive
disruption by xenobiotics. Aquaculture 177:345-352.
Kliewer, S. A., S. S. Sundseth, S. A. Jones, P. J. Brown, G. B. Wisely, C. S. Koble, P. Devchand, W.
Wahli, T. M. Willson, J. M. Lenhard, and J. M. Lehmann. 1997. Fatty acids and eicosanoids
regulate gene expression through direct interactions with peroxisome proliferator-activated
receptors alpha and gamma. Proceedings of the National Academy of Sciences of the United
States of America 94:4318-4323.
Klüttgen, B., U. Dülmer, M. Engels, and H. T. Ratte. 1994. ADaM, an artificial freshwater for the
culture of zooplankton. Water Research 28:743-746.
Knapp, H. R., and M. A. Melly. 1986. Bactericidal effects of polyunsaturated fatty acids. Journal of
Infectious Diseases 154:84-94.
Koch, H., and P. Schmid-Hempel. 2011. Socially transmitted gut microbiota protect bumble bees
against an intestinal parasite. Proceedings of the National Academy of Sciences of the United
States of America 108:19288-19292.
Koch, H., and P. Schmid-Hempel. 2012. Gut microbiota instead of host genotype drive the specificity
in the interaction of a natural host-parasite system. Ecology Letters 15:1095-1103.
Koch, U., D. Martin-Creuzburg, H.-P. Grossart, and D. Straile. 2011. Single dietary amino acids
control resting egg production and affect population growth of a key freshwater herbivore.
Oecologia 167:981-989.
Krist, A. C., J. Jokela, J. Wiehn, and C. M. Lively. 2004. Effects of host condition on susceptibility to
infection, parasite developmental rate, and parasite transmission in a snail-trematode
interaction. Journal of Evolutionary Biology 17:33-40.
Kuris, A. M. 1974. Trophic interactions: similarity of parasitic castrators to parasitoids. Quarterly
Review of Biology 49:129-148.
106
CITED LITERATURE
Lafferty, K. D. 1999. The evolution of trophic transmission. Parasitology Today 15:111-115.
Lampert, W. 1977. Studies on the carbon balance of Daphnia pulex as related to environmental
conditions Part 1: Methodological problems of the use of 14C for the measurement of carbon
assimilation. Archiv für Hydrobiologie Supplement 48:287-309.
Lampert, W. 1981. Inhibitory and toxic effects of blue-green algae on Daphnia. Internationale Revue
der gesamten Hydrobiologie 66:285-298.
Lampert, W. 1991. The dynamics of Daphnia magna in a shallow lake. Verhandlungen der
internationalen Vereinigung für theoretische und angewandte Limnologie 24:795-798.
Lampert, W. 2011. Daphnia: Development of a model organism in ecology and evolution.
International Ecology Institute, Oldendorf/Luhe.
Lands, W. E. M. 1992. Biochemistry and physiology of n-3 fatty acids. FASEB Journal 6:2530-2536.
Lass, A., R. Zimmermann, M. Oberer, and R. Zechner. 2011. Lipolysis - A highly regulated multienzyme complex mediates the catabolism of cellular fat stores. Progress in Lipid Research
50:14-27.
Lass, S., and D. Ebert. 2006. Apparent seasonality of parasite dynamics: analysis of cyclic prevalence
patterns. Proceedings of the Royal Society B - Biological Sciences 273:199-206.
Lazzaro, B. P., and T. J. Little. 2009. Immunity in a variable world. Philosophical Transactions of the
Royal Society B - Biological Sciences 364:15-26.
Le Coadic, M., M. Simon, A. Marchetti, D. Ebert, and P. Cosson. 2012. Daphnia magna, a host for
evaluation of bacterial virulence. Applied and Environmental Microbiology 78:593-595.
Lee, K. P., S. J. Simpson, and K. Wilson. 2008. Dietary protein-quality influences melanization and
immune function in an insect. Functional Ecology 22:1052-1061.
Leman, J. C., C. B. Weddle, S. N. Gershman, A. M. Kerr, G. D. Ower, J. M. St John, L. A. Vogel, and
S. K. Sakaluk. 2009. Lovesick: immunological costs of mating to male sagebrush crickets.
Journal of Evolutionary Biology 22:163-171.
Li, Z. J., S. C. Zhang, and Q. H. Liu. 2008. Vitellogenin functions as a multivalent pattern recognition
receptor with an opsonic activity. PLOS ONE 3:7.
Limmer, S., S. Haller, E. Drenkard, J. Lee, S. Yu, C. Kocks, F. M. Ausubel, and D. Ferrandon. 2011.
Pseudomonas aeruginosa RhlR is required to neutralize the cellular immune response in a
Drosophila melanogaster oral infection model. Proceedings of the National Academy of
Sciences of the United States of America 108:17378-17383.
Liu, Q. H., S. C. Zhang, Z. J. Li, and C. R. Gao. 2009. Characterization of a pattern recognition
molecule vitellogenin from carp (Cyprinus carpio). Immunobiology 214:257-267.
Loher, W., I. Ganjian, I. Kubo, D. Stanley-Samuelson, and S. S. Tobe. 1981. Prostaglandins: Their
role in egg-laying of the cricket Teleogryllus commodus. Proceedings of the National
Academy of Sciences of the United States of America - Biological Sciences 78:7835-7838.
Luijckx, P., F. Ben-Ami, L. Mouton, L. Du Pasquier, and D. Ebert. 2011a. Cloning of the unculturable
parasite Pasteuria ramosa and its Daphnia host reveals extreme genotype-genotype
interactions. Ecology Letters 14:125-131.
Luijckx, P., H. Fienberg, D. Duneau, and D. Ebert. 2011b. Resistance to a bacterial parasite in the
crustacean Daphnia magna shows Mendelian segregation with dominance. Heredity 108:547551.
107
CITED LITERATURE
Luong, L. T., and M. Polak. 2007. Costs of resistance in the Drosophila macrocheles system: A
negative genetic correlation between ectoparasite resistance and reproduction. Evolution
61:1391-1402.
Machado, E., L. Swevers, N. Sdralia, M. N. Medeiros, F. G. Mello, and K. Iatrou. 2007. Prostaglandin
signaling and ovarian follicle development in the silkmoth, Bombyx mori. Insect Biochemistry
and Molecular Biology 37:876-885.
Mandato, C. A., W. L. Diehl-Jones, S. J. Moore, and R. G. H. Downer. 1997. The effects of
eicosanoid biosynthesis inhibitors on prophenoloxidase activation, phagocytosis and cell
spreading in Galleria mellonella. Journal of Insect Physiology 43:1-8.
Martin-Creuzburg, D., B. Beck, and H. M. Freese. 2011a. Food quality of heterotrophic bacteria for
Daphnia magna: evidence for a limitation by sterols. FEMS Microbiology Ecology 76:592601.
Martin-Creuzburg, D., E. Sperfeld, and A. Wacker. 2009. Colimitation of a freshwater herbivore by
sterols and polyunsaturated fatty acids. Proceedings of the Royal Society B - Biological
Sciences 276:1805-1814.
Martin-Creuzburg, D., E. von Elert, and K. H. Hoffmann. 2008. Nutritional constraints at the
cyanobacteria-Daphnia magna interface: The role of sterols. Limnology and Oceanography
53:456-468.
Martin-Creuzburg, D., A. Wacker, and T. Basen. 2010. Interactions between limiting nutrients:
Consequences for somatic and population growth of Daphnia magna. Limnology and
Oceanography 55:2597-2607.
Martin-Creuzburg, D., A. Wacker, and E. von Elert. 2005. Life history consequences of sterol
availability in the aquatic keystone species Daphnia. Oecologia 144:362-372.
Martin-Creuzburg, D., A. Wacker, C. Ziese, and M. Kainz. 2012. Dietary lipid quality affects
temperature-mediated reaction norms of a freshwater key herbivore. Oecologia 168:901-912.
Martinez-Rubio, L., S. Morais, O. Evensen, S. Wadsworth, K. Ruohonen, J. L. G. Vecino, J. G. Bell,
and D. R. Tocher. 2012. Functional feeds reduce heart inflammation and pathology in atlantic
salmon (Salmo salar L.) following experimental challenge with atlantic salmon reovirus
(ASRV). PLOS ONE 7:17.
Masclaux, H., A. Bec, M. J. Kainz, C. Desvilettes, L. Jouve, and G. Bourdier. 2009. Combined effects
of food quality and temperature on somatic growth and reproduction of two freshwater
cladocerans. Limnology and Oceanography 54:1323-1332.
McTaggart, S. J., C. Conlon, J. K. Colbourne, M. L. Blaxter, and T. J. Little. 2009. The components of
the Daphnia pulex immune system as revealed by complete genome sequencing. BMC
Genomics 10:19.
Medeiros, M. N., L. H. Mendonca, A. L. Hunter, G. O. Paiva-Silva, F. G. Mello, I. P. Henze, H.
Masuda, C. M. Maya-Monteiro, and E. A. Machado. 2004. The role of lipoxygenase products
on the endocytosis of yolk proteins in insects: Participation of cAMP. Archives of Insect
Biochemistry and Physiology 55:178-187.
Mercado-Blanco, J., and P. H. M. Bakker. 2007. Interactions between plants and beneficial
Pseudomonas spp.: exploiting bacterial traits for crop protection. Antonie van Leeuwenhoek
92:367-389.
108
CITED LITERATURE
Merchant, D., R. L. Ertl, S. I. Rennard, D. W. Stanley, and J. S. Miller. 2008. Eicosanoids mediate
insect hemocyte migration. Journal of Insect Physiology 54:215-221.
Metchnikoff, I. 1884. A disease of Daphnia caused by a yeast. A contribution to the theory of
phagocytes as agents for attack on disease-causing organisms. Pages 132-138 in T. Brock,
editor. Milestones in microbiology. American Society for Microbiology, Washington, DC.
Miller, J. S., R. W. Howard, R. L. Rana, H. Tunaz, and D. W. Stanley. 1999. Eicosanoids mediate
nodulation reactions to bacterial infections in adults of the cricket, Gryllus assimilis. Journal
of Insect Physiology 45:75-83.
Miller, J. S., T. Nguyen, and D. W. Stanleysamuelson. 1994. Eicosanoids mediate insect nodulation
responses to bacterial infections. Proceedings of the National Academy of Sciences of the
United States of America 91:12418-12422.
Mitchell, S. E., and A. F. Read. 2005. Poor maternal environment enhances offspring disease
resistance in an invertebrate. Proceedings of the Royal Society B - Biological Sciences
272:2601-2607.
Monod, J. 1950. La technique de culture continue. Theorie et applications. Annales De L'Institut
Pasteur 79:390-410.
Morishima, I., Y. Yamano, K. Inoue, and N. Matsuo. 1997. Eicosanoids mediate induction of immune
genes in the fat body of the silkworm, Bombyx mori. FEBS Letters 419:83-86.
Mouritsen, O. G., and M. J. Zuckermann. 2004. What's so special about cholesterol? Lipids 39:11011113.
Mousseau, T. A., and H. Dingle. 1991. Maternal effects in insect life histories. Annual Review of
Entomology 36:511-534.
Mu, H. L., and C. E. Hoy. 2004. The digestion of dietary triacylglycerols. Progress in Lipid Research
43:105-133.
Mucklow, P. T., D. B. Vizoso, K. H. Jensen, D. Refardt, and D. Ebert. 2004. Variation in
phenoloxidase activity and its relation to parasite resistance within and between populations of
Daphnia magna. Proceedings of the Royal Society B - Biological Sciences 271:1175-1183.
Müller-Navarra, D. C. 1995. Evidence that a highly unsaturated fatty acid limits Daphnia growth in
nature. Archiv für Hydrobiologie 132:297-307.
Müller-Navarra, D. C., M. T. Brett, A. M. Liston, and C. R. Goldman. 2000. A highly unsaturated
fatty acid predicts carbon transfer between primary producers and consumers. Nature 403:7477.
Mykles, D. L. 2011. Ecdysteroid metabolism in crustaceans. Journal of Steroid Biochemistry and
Molecular Biology 127:196-203.
Napolitano, G. E. 1998. Fatty acids as trophic and chemical markers. Pages 21-44 in M. T. Arts and B.
C. Wainmann, editors. Lipids in Freshwater Ecosystems. Springer, New York.
Okumura, T., and K. Aida. 2000. Hemolymph vitellogenin levels and ovarian development during the
reproductive and non reproductive molt cycles in the giant freshwater prawn Macrobrachium
rosenbergii. Fisheries Science 66:678-685.
Olmstead, A. W., and G. A. Leblanc. 2002. Juvenoid hormone methyl farnesoate is a sex determinant
in the crustacean Daphnia magna. Journal of Experimental Zoology 293:736-739.
Paerl, H. W., and J. Huisman. 2008. Climate - Blooms like it hot. Science 320:57-58.
109
CITED LITERATURE
Park, Y., A. R. N. Aliza, and D. Stanley. 2005. A secretory PLA2 associated with tobacco hornworm
hemocyte membrane preparations acts in cellular immune reactions. Archives of Insect
Biochemistry and Physiology 60:105-115.
Pearce, D. A., C. J. van der Gast, K. Woodward, and K. K. Newsham. 2005. Significant changes in the
bacterioplankton community structure of a maritime Antarctic freshwater lake following
nutrient enrichment. Microbiology 151:3237-3248.
Peirson, S. N., J. N. Butler, and R. G. Foster. 2003. Experimental validation of novel and conventional
approaches to quantitative real-time PCR data analysis. Nucleic Acids Research 31:7.
Perkins, M. C., H. A. Woods, J. F. Harrison, and J. J. Elser. 2004. Dietary phosphorus affects the
growth of larval Manduca sexta. Archives of Insect Biochemistry and Physiology 55:153-168.
Pester, M., and A. Brune. 2007. Hydrogen is the central free intermediate during lignocellulose
degradation by termite gut symbionts. ISME Journal 1:551-565.
Pietrzak, B., M. Grzesiuk, and A. Bednarska. 2010. Food quantity shapes life history and survival
strategies in Daphnia magna (Cladocera). Hydrobiologia 643:51-54.
Ponton, F., F. Lalubin, C. Fromont, K. Wilson, C. Behm, and S. J. Simpson. 2011a. Hosts use altered
macronutrient intake to circumvent parasite-induced reduction in fecundity. International
Journal for Parasitology 41:43-50.
Ponton, F., K. Wilson, S. C. Cotter, D. Raubenheimer, and S. J. Simpson. 2011b. Nutritional
immunology: a multi-dimensional approach.PLOS Pathogens 7:4.
Prentki, M., and S. R. M. Madiraju. 2008. Glycerolipid metabolism and signaling in health and
disease. Endocrine Reviews 29:647-676.
Pulkkinen, K., and D. Ebert. 2004. Host starvation decreases parasite load and mean host size in
experimental populations. Ecology 85:823-833.
Qi, W., G. Nong, J. F. Preston, F. Ben-Ami, and D. Ebert. 2009. Comparative metagenomics of
Daphnia symbionts. BMC Genomics 10.
Quinitio, E. T., A. Hara, K. Yamauchi, and S. Nakao. 1994. Changes in the steroid hormone and
vitellogenin levels during the gametogenic cycle of the giant tiger shrimp, Penaeus monodon.
Comparative Biochemistry and Physiology C - Pharmacology Toxicology & Endocrinology
109:21-26.
Raikhel, A. S., V. A. Kokoza, J. S. Zhu, D. Martin, S. F. Wang, C. Li, G. Q. Sun, A. Ahmed, N.
Dittmer, and G. Attardo. 2002. Molecular biology of mosquito vitellogenesis: from basic
studies to genetic engineering of antipathogen immunity. Insect Biochemistry and Molecular
Biology 32:1275-1286.
Ramos, J.-L. 2004a. Pseudomonas, Vol 1: Genomics, Life Style and Molecular Architecture. Springer,
233 Spring Street, New York, Ny 10013, United States.
Ramos, J.-L. 2004b. Pseudomonas, Vol 2: Virulence and Gene Regulation. Springer, 233 Spring
Street, New York, Ny 10013, United States.
Ramos, J.-L. 2004c. Pseudomonas, Vol 3: Biosynthesis of Macromolecules and Molecular
Metabolism. Springer, 233 Spring Street, New York, Ny 10013, United States.
Raubenheimer, D., and C. Boggs. 2009. Nutritional ecology, functional ecology and Functional
Ecology. Functional Ecology 23:1-3.
110
CITED LITERATURE
Reddy, M. K., R. L. Alexander-Lindo, and M. G. Nair. 2005. Relative inhibition of lipid peroxidation,
cyclooxygenase enzymes, and human tumor cell proliferation by natural food colors. Journal
of Agricultural and Food Chemistry 53:9268-9273.
Reddy, P. S., P. R. Reddy, and G. P. C. Nagaraju. 2004. The synthesis and effects of prostaglandins on
the ovary of the crab Oziotelphusa senex senex. General and Comparative Endocrinology
135:35-41.
Rice, P., I. Longden, and A. Bleasby. 2000. EMBOSS: The European molecular biology open
software suite. Trends in Genetics 16:276-277.
Robar, N., D. L. Murray, and G. Burness. 2011. Effects of parasites on host energy expenditure: the
resting metabolic rate stalemate. Canadian Journal of Zoology - Revue Canadienne De
Zoologie 89:1146-1155.
Rono, M. K., M. M. A. Whitten, M. Oulad-Abdelghani, E. A. Levashina, and E. Marois. 2010. The
Major Yolk Protein Vitellogenin Interferes with the Anti-Plasmodium Response in the
Malaria Mosquito Anopheles gambiae. PLOS Biology 8.
Rothhaupt, K. O. 1988. Mechanistic resource competition theory applied to laboratory experiments
with zooplankton. Nature 333:660-662.
Rowley, A. F., C. L. Vogan, G. W. Taylor, and A. S. Clare. 2005. Prostaglandins in non-insectan
invertebrates: recent insights and unsolved problems. Journal of Experimental Biology 208:314.
Ryder, J. J., J. Hathway, and R. J. Knell. 2007. Constraints on parasite fecundity and transmission in
an insect-STD system. Oikos 116:578-584.
Sadd, B. M. 2011. Food-environment mediates the outcome of specific interactions between a
bumblebee and its trypanosome parasite. Evolution 65:2995-3001.
Sagi, A., J. Silkovsky, S. FleisherBerkovich, A. Danon, and R. Chayoth. 1995. Prostaglandin E2 in
previtellogenic ovaries of the prawn Macrobrachium rosenbergii: Synthesis and effect on the
level of cAMP. General and Comparative Endocrinology 100:308-313.
Schiffrin, E. J., and S. Blum. 2002. Interactions between the microbiota and the intestinal mucosa.
European Journal of Clinical Nutrition 56:S60-S64.
Schlotz, N., D. Ebert, and D. Martin-Creuzburg. 2013. Dietary supply with polyunsaturated fatty acids
and resulting maternal effects influence host-parasite interactions. BMC Ecology 13:41.
Schlotz, N., M. Pester, H. M. Freese, and D. Martin-Creuzburg. 2014. A dietary polyunsaturated fatty
acid improves consumer performance during challenge with an opportunistic bacterial
pathogen. FEMS Microbiology Ecology 90:467-477.
Schlotz, N., J. G. Sørensen, and D. Martin-Creuzburg. 2012. The potential of dietary polyunsaturated
fatty acids to modulate eicosanoid synthesis and reproduction in Daphnia magna: A gene
expression approach. Comparative Biochemistry and Physiology A - Molecular & Integrative
Physiology 162:449-454.
Schmid-Hempel, P. 2011. Evolutionary Parasitology. Oxford University Press, New York.
Schmitz, G., and J. Ecker. 2008. The opposing effects of n-3 and n-6 fatty acids. Progress in Lipid
Research 47:147-155.
111
CITED LITERATURE
Schoene, N. W. 1985. Selenium-dependent glutathione peroxidase and eicosanoid production.in E. M.
Lands, editor. Biochemistry of Arachidonic Acid Metabolism. Martinus Nijhoff Publishing,
Boston.
Schulenburg, H., J. Kurtz, Y. Moret, and M. T. Siva-Jothy. 2009. Ecological immunology.
Philosophical Transactions of the Royal Society B-Biological Sciences 364:3-14.
Scott, K. P., S. W. Gratz, P. O. Sheridan, H. J. Flint, and S. H. Duncan. 2013. The influence of diet on
the gut microbiota. Pharmacological Research 69:52-60.
Seppala, O., K. Liljeroos, A. Karvonen, and J. Jokela. 2008. Host condition as a constraint for parasite
reproduction. Oikos 117:749-753.
Shahidi, F. 2004. Functional foods: Their role in health promotion and disease prevention. Journal of
Food Science 69:146-149.
Shrestha, S., and Y. Kim. 2010. Activation of immune-associated phospholipase A2 is functionally
linked to Toll/Imd signal pathways in the red flour beetle, Tribolium castaneum.
Developmental and Comparative Immunology 34:530-537.
Shrestha, S., Y. Park, D. Stanley, and Y. Kim. 2010. Genes encoding phospholipases A2 mediate
insect nodulation reactions to bacterial challenge. Journal of Insect Physiology 56:324-332.
Simmons, L. W., and B. Roberts. 2005. Bacterial immunity traded for sperm viability in male crickets.
Science 309:2031-2031.
Simon, M., B. C. Cho, and F. Azam. 1992. Significance of bacterial biomass in lakes and the ocean:
comparison to phytoplankton biomass and biogeochemical implications. Marine Ecology Progress Series 86:103-110.
Simpson, S. J., and D. Raubenheimer. 1993. A multilevel analysis of feeding behavior - the geometry
of nutritional decisions. Philosophical Transactions of the Royal Society of London Series BBiological Sciences 342:381-402.
Siro, I., E. Kapolna, B. Kapolna, and A. Lugasi. 2008. Functional food. Product development,
marketing and consumer acceptance - A review. Appetite 51:456-467.
Siva-Jothy, M. T., and J. J. W. Thompson. 2002. Short-term nutrient deprivation affects immune
function. Physiological Entomology 27:206-212.
Six, D. A., and E. A. Dennis. 2000. The expanding superfamily of phospholipase A2 enzymes:
classification and characterization. Biochimica et Biophysica Acta (BBA) - Molecular and
Cell Biology of Lipids 1488:1-19.
Smith, V. 2007. Host resource supplies influence the dynamics and outcome of infectious disease.
Integrative and Comparative Biology 47:310-316.
Smith, V. H., T. P. Jones, and M. S. Smith. 2005. Host nutrition and infectious disease: an ecological
view. Frontiers in Ecology and the Environment 3:268-274.
Smith, W. L. 2005. Cyclooxygenases, peroxide tone and the allure of fish oil. Current Opinion in Cell
Biology 17:174-182.
Smith, W. L., and R. C. Murphy. 2002. The eicosanoids: cyclooxygenase, lipoxygenase, and
epoxygenase pathways.in D. E. Vance and J. E. Vance, editors. Biochemistry of Lipids,
Lipoproteins and Membranes. Elsevier
112
CITED LITERATURE
Spaziani, E. P., G. W. Hinsch, and S. C. Edwards. 1993. Changes in prostaglandin E2 and F2 during
vitellogenesis in the Florida crayfish Procambarus paeninsulanus. Journal of Comparative
Physiology B - Biochemical, Systemic, and Environmental Physiology 163:541-545.
Sperfeld, E., D. Martin-Creuzburg, and A. Wacker. 2012. Multiple resource limitation theory applied
to herbivorous consumers: Liebig's minimum rule vs. interactive co-limitation. Ecology
Letters 15:142-150.
Stanley-Samuelson, D. W., E. Jensen, K. W. Nickerson, K. Tiebel, C. L. Ogg, and R. W. Howard.
1991. Insect immune response to bacterial infection is mediated by eicosanoids. Proceedings
of the National Academy of Sciences of the United States of America 88:1064-1068.
Stanley-Samuelson, D. W., V. K. Pedibhotla, R. L. Rana, N. A. A. Rahim, W. W. Hoback, and J. S.
Miller. 1997. Eicosanoids mediate nodulation responses to bacterial infections in larvae of the
silkmoth, Bombyx mori. Comparative Biochemistry and Physiology A - Physiology 118:93100.
Stanley, D. 2010. Eicosanoids: progress towards manipulating insect immunity. Journal of Applied
Entomology 135:534-545.
Stanley, D. W. 2000. Eicosanoids in invertebrate signal transduction systems. Princeton University
Press, Princeton, NJ.
Stearns, S. C. 1992. The Evolution of Life Histories. Oxford University Press.
Stecher, B., and W. D. Hardt. 2008. The role of microbiota in infectious disease. Trends in
Microbiology 16:107-114.
Sterner, R. W., and J. J. Elser. 2002. Ecological stoichiometry: the biology of elements from
molecules to the biosphere. Princeton University Press, Princeton, NJ.
Sterner, R. W., and K. L. Schulz. 1998. Zooplankton nutrition: Recent progress and a reality check.
Aquatic Ecology 32:261-279.
Stjernman, M., and T. J. Little. 2011. Genetic variation for maternal effects on parasite susceptibility.
Journal of Evolutionary Biology 24:2357-2363.
Straus, D. S., and C. K. Glass. 2007. Anti-inflammatory actions of PPAR ligands: new insights on
cellular and molecular mechanisms. Trends in Immunology 28:551-558.
Tahara, D., and I. Yano. 2004. Maturation-related variations in prostaglandin and fatty acid content of
ovary in the kuruma prawn (Marsupenaeus japonicus). Comparative Biochemistry and
Physiology A - Molecular & Integrative Physiology 137:631-637.
Taipale, S. J., M. J. Kainz, and M. T. Brett. 2011. Diet-switching experiments show rapid
accumulation and preferential retention of highly unsaturated fatty acids in Daphnia. Oikos
120:1674-1682.
Taipale, S. J., M. T. Brett, K. Pulkkinen, and M. J. Kainz. 2012. The influence of bacteria-dominated
diets on Daphnia magna somatic growth, reproduction, and lipid composition. FEMS
Microbiology Ecology 82:50-62.
Tan, M. W., S. Mahajan-Miklos, and F. M. Ausubel. 1999. Killing of Caenorhabditis elegans by
Pseudomonas aeruginosa used to model mammalian bacterial pathogenesis. Proceedings of
the National Academy of Sciences of the United States of America 96:715-720.
113
CITED LITERATURE
Thompson, S. N., R. A. Redak, and L. W. Wang. 2005. Nutrition interacts with parasitism to influence
growth and physiology of the insect Manduca sexta L. Journal of Experimental Biology
208:611-623.
Thompson, S. N., and K. A. Yamada. 1984. Energy status in the fatbody of Trichoplusia ni parasitized
by the insect parasite Hyposoter exiguae. Journal of Invertebrate Pathology 44:46-51.
Tilman, D. 1977. Resource Competition between Plankton Algae: An Experimental and Theoretical
Approach. Ecology 58:338-348.
Tocher, D. R. 2010. Fatty acid requirements in ontogeny of marine and freshwater fish. Aquaculture
Research 41:717-732.
Tocher, D. R., M. J. Leaver, and P. A. Hodgson. 1998. Recent advances in the biochemistry and
molecular biology of fatty acyl desaturases. Progress in Lipid Research 37:73-117.
Tokishita, S., Y. Kato, T. Kobayashi, S. Nakamura, T. Ohta, and H. Yamagata. 2006. Organization
and repression by juvenile hormone of a vitellogenin gene cluster in the crustacean, Daphnia
magna. Biochemical and Biophysical Research Communications 345:362-370.
Tootle, T. L., and A. C. Spradling. 2008. Drosophila Pxt: a cyclooxygenase-like facilitator of follicle
maturation. Development 135:839-847.
Tschirren, B., and H. Richner. 2006. Parasites shape the optimal investment in immunity. Proceedings
of the Royal Society B - Biological Sciences 273:1773-1777.
Underwood, A. J. 2006. Experiments in ecology. Cambridge University Press.
Vale, P. F., M. Choisy, and T. J. Little. 2013. Host nutrition alters the variance in parasite transmission
potential. Biology Letters 9:20121145.
van Meer, G., D. R. Voelker, and G. W. Feigenson. 2008. Membrane lipids: where they are and how
they behave. Nature Reviews Molecular Cell Biology 9:112-124.
Vance, R. E., S. Hong, K. Gronert, C. N. Serhan, and J. J. Mekalanos. 2004. The opportunistic
pathogen Pseudomonas aeruginosa carries a secretable arachidonate 15-lipoxygenase.
Proceedings of the National Academy of Sciences of the United States of America 101:21352139.
Varvas, K., R. Kurg, K. Hansen, R. Jarving, I. Jarving, K. Valmsen, H. Lohelaid, and N. Samel. 2009.
Direct evidence of the cyclooxygenase pathway of prostaglandin synthesis in arthropods:
Genetic and biochemical characterization of two crustacean cyclooxygenases. Insect
Biochemistry and Molecular Biology 39:851-860.
Vizoso, D. B., and D. Ebert. 2004. Within-host dynamics of a microsporidium with horizontal and
vertical transmission: Octosporea bayeri in Daphnia magna. Parasitology 128:31-38.
Vizoso, D. B., and D. Ebert. 2005. Phenotypic plasticity of host-parasite interactions in response to the
route of infection. Journal of Evolutionary Biology 18:911-921.
Vizoso, D. B., S. Lass, and D. Ebert. 2005. Different mechanisms of transmission of the
microsporidium Octosporea bayeri: a cocktail of solutions for the problem of parasite
permanence. Parasitology 130:501-509.
Vodovar, N., M. Vinals, P. Liehl, A. Basset, J. Degrouard, P. Spellman, F. Boccard, and B. Lemaitre.
2005. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas
species. Proceedings of the National Academy of Sciences of the United States of America
102:11414-11419.
114
CITED LITERATURE
Volkman, J. K. 2003. Sterols in microorganisms. Applied Microbiology and Biotechnology 60:495506.
von Elert, E. 2002. Determination of limiting polyunsaturated fatty acids in Daphnia galeata using a
new method to enrich food algae with single fatty acids. Limnology and Oceanography
47:1764-1773.
von Euler, U. S. 1936. On the specific vaso-dilating and plain muscle stimulating substances from
accessory genital glands in man and certain animals (prostaglandin and vesiglandin). Journal
of Physiology-London 88:213-234.
Vrablik, T. L., and J. L. Watts. 2013. Polyunsaturated fatty acid derived signaling in reproduction and
development: Insights from Caenorhabditis elegans and Drosophila melanogaster. Molecular
Reproduction and Development 80:244-259.
Wacker, A., P. Becher, and E. von Elert. 2002. Food quality effects of unsaturated fatty acids on larvae
of the zebra mussel Dreissena polymorpha. Limnology and Oceanography 47:1242-1248.
Wacker, A., and D. Martin-Creuzburg. 2007. Allocation of essential lipids in Daphnia magna during
exposure to poor food quality. Functional Ecology 21:738-747.
Wacker, A., and E. Von Elert. 2001. Polyunsaturated fatty acids: Evidence for non-substitutable
biochemical resources in Daphnia galeata. Ecology 82:2507-2520.
Wagner, N. D., H. Hillebrand, A. Wacker, and P. C. Frost. 2013. Nutritional indicators and their uses
in ecology. Ecology Letters 16:535-544.
Wathes, D. C., D. R. E. Abayasekara, and R. J. Aitken. 2007. Polyunsaturated fatty acids in male and
female reproduction. Biology of Reproduction 77:190-201.
Watson, S. B., G. Caldwell, and G. Pohnert. 2009. Fatty Acids and Oxylipins as Semiochemicals.
Pages 65-91 in M. T. Arts, M. T. Brett, and M. J. Kainz, editors. Lipids in Aquatic
Ecosystems. Springer.
Wenzel, A., A.-K. Bergstrom, M. Jansson, and T. Vrede. 2012. Survival, growth and reproduction of
Daphnia galeata feeding on single and mixed Pseudomonas and Rhodomonas diets.
Freshwater Biology 57:835-846.
Wimuttisuk, W., P. Tobwor, P. Deenarn, K. Danwisetkanjana, D. Pinkaew, K. Kirtikara, and V.
Vichai. 2013. Insights into the prostanoid pathway in the ovary development of the penaeid
shrimp Penaeus monodon. PLOS ONE 8:15.
Ye, J., G. Coulouris, I. Zaretskaya, I. Cutcutache, S. Rozen, and T. L. Madden. 2012. Primer-BLAST:
A tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics
13:11.
Zhao, F., D. Stanley, Y. Wang, F. Zhu, and C.-L. Lei. 2009. Eicosanoids mediate nodulation reactions
to a mollicute bacterium in larvae of the blowfly, Chrysomya megacephala. Journal of Insect
Physiology 55:192-196.
Zimmerman, A. W., and J. H. Veerkamp. 2002. New insights into the structure and function of fatty
acid-binding proteins. Cellular and Molecular Life Sciences 59:1096-1116.
Zuk, M., and A. M. Stoehr. 2002. Immune defense and host life history. American Naturalist 160:S9S22.
115
RECORD OF ACHIEVEMENT
ABGRENZUNG DER EIGENLEISTUNG
All experiments described in the chapters of this thesis were exclusively performed by me or
under my direct supervision. I appreciate the support I received from my supervisors and
collaborators during data processing and manuscript writing which both were primarily my
responsibility.
116
CLOSING CREDITS
IN ORDER OF APPEARANCE
SCIENTIFIC SUPERVISION & COLLABORATION
PERSONAL SUPPORT
Dr. Dominik Martin-Creuzburg
Prof. Karl-Otto Rothhaupt
Mama
Prof. Dieter Ebert
Oma
Petra Merkel
Uwe
Bernd Kress
Wolfgang
Jürgen Hottinger
Maren
Prof. Alexander Wacker
Karin
Dr. Lars-Henrik-Heckmann
Moni
Dr. Jesper Givskov Sørensen
Anja
Prof. John Colbourne
Timo
Rebecca Fies
Birgit
Christine Ziese
Emília
Daniela Hermert
Maggi
Dr. Anne Roulin
Prof. Bernhard Schink
SPECIAL THANKS TO
Colleagues and friends from the Limnological Institute, University of Konstanz
Colleagues and friends from the Zoological Institute (Ebert & Salzburger Group), University of Basel
Numerous students and HiWis
Thousands of beautiful Daphnia magna
117
CURRICULUM VITAE
NAME
Nina Schlotz
DAY OF BIRTH
April 16, 1984
PLACE OF BIRTH
Stuttgart, Germany
NATIONALITY
German
ACADEMIC CAREER
12/2013 - present
Research fellow at the Institute for Environmental Health Sciences and
Hospital Infection Control, Medical Center, University of Freiburg
05/2010 - 06/2014 Doctoral studies at the Limnological Institute, University of Konstanz
Thesis entitled “Eco-physiological consequences of dietary
polyunsaturated fatty acids for host-parasite interactions”
Supervision by PD Dr. Dominik Martin-Creuzburg, Prof. Dr. Dieter
Ebert (University of Basel), and Prof. Dr. Karl-Otto Rothhaupt
04/2011 Research stay at the National Environmental Research Institute, Aarhus
University, Denmark
10/2009 Master of Science (Biological Sciences)
Thesis entitled “Influence of food quality on the susceptibility of Daphnia
to pathogenic infections”
Supervision by PD Dr. Dominik Martin-Creuzburg at the Limnological
Institute, University of Konstanz (in collaboration with Prof. Dr. Dieter
Ebert, University of Basel)
03/2007 Bachelor of Science (Biological Sciences)
Thesis entitled “Charakterisierung der artifiziellen HPV18-Gene E6 und
E7 SH: Untersuchungen zur Expression und den transformierenden
Eigenschaften”
Supervision by PD Dr. Peter Öhlschläger at the Chair of Immunology,
University of Konstanz
118
LIST OF PUBLICATIONS
 SCHLOTZ, N., Pester, M., Freese, H. M., and Martin-Creuzburg, D. (2014). A
dietary polyunsaturated fatty acid improves consumer performance during
challenge with an opportunistic bacterial pathogen. FEMS Microbiology Ecology
90:467-477 (doi: 10.1111/1574-6941.12407)
 SCHLOTZ, N., Ebert, D., and Martin-Creuzburg, D. (2013). Dietary supply with
polyunsaturated fatty acids and resulting maternal effects influence host-parasite
interactions. BMC Ecology 13:41 (doi:10.1186/1472-6785-13-41)
 SCHLOTZ, N., Sørensen, J. G., and Martin-Creuzburg, D. (2012). The potential of
dietary polyunsaturated fatty acids to modulate eicosanoid synthesis and
reproduction in Daphnia: a gene expression approach. Comparative Biochemistry
and Physiology, Part A 162:449-454 (doi:10.1016/j.cbpa.2012.05.004)
 SCHLOTZ, N., Roulin, A., Ebert, D., and Martin-Creuzburg, D. Effects of dietary
polyunsaturated fatty acids and parasite exposure on eicosanoid-related gene
expression – in prep.
119