Article
DCC
YJMBI-65105; No. of pages: 11; 4C: 3, 4, 5, 6, 8
The Termination Phase in Protein Synthesis is
not Obligatorily Followed by the RRF/EF-GDependent Recycling Phase
Bo Qin 1, 2, † , Hiroshi Yamamoto 1, 2, † , Takuya Ueda 3 ,
Umesh Varshney 4 and Knud H. Nierhaus 1, 2
1 - Max-Planck-Institut für molekulare Genetik, Ihnestrasse 73, D-14195 Berlin, Germany
2 - Institut für Medizinische Physik und Biophysik, Charité, Charitéplatz 1, 10117 Berlin, Germany
3 - Department of Medical Genome Sciences, Graduate School of Frontier Sciences, The University of Tokyo, Kashiwa, Chiba
Prefecture 277-8562, Japan
4 - Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore, 560012, India
Correspondence to Hiroshi Yamamoto and Knud H. Nierhaus: [email protected]
http://dx.doi.org/10.1016/j.jmb.2016.05.019
Edited by Ruben L. Gonzalez
Abstract
It is general wisdom that termination of bacterial protein synthesis is obligatorily followed by recycling
governed by the factors ribosomal recycling factor (RRF), EF-G, and IF3, where the ribosome dissociates into
its subunits. In contrast, a recently described 70S-scanning mode of initiation holds that after termination,
scanning of 70S can be triggered by fMet-tRNA to the initiation site of a downstream cistron. Here, we analyze
the apparent conflict. We constructed a bicistronic mRNA coding for luciferases and showed with a highly
resolved in vitro system that the expression of the second cistron did not at all depend on the presence of
active RRF. An in vivo analysis cannot be performed in a straightforward way, since RRF is essential for
viability and therefore, the RRF gene cannot be knocked out. However, we found an experimental window,
where the RRF amount could be reduced to below 2.5%, and in this situation, the expression of the second
cistron of a bicistronic luciferase mRNA was only moderately reduced. Both in vitro and in vivo results
suggested that RRF-dependent recycling is not an obligatory step after termination, in agreement with
the previous findings concerning 70S-scanning initiation. In this view, recycling after termination is a special
case of the general RRF function, which happens whenever fMet-tRNA is not available for triggering 70S
scanning.
© 2016 Published by Elsevier Ltd.
Introduction
It is generally accepted that in eubacteria, termination of translation of a cistron is followed by a
ribosomal recycling factor (RRF)- and EF-G-mediated
dissociation of ribosomes from mRNA termed as the
recycling phase of protein synthesis, a process
supported by IF3 [1–5]. RRF is an essential factor
[6], universal in Eubacteria but absent in Achaea and
Eukaryota [7]. X-ray and cryo-electron microscopic
studies have shed light on the mechanism of
dissociation of post-termination complexes [8–13]. It
is thought that the recycling phase is an obligatory
step following the termination phase in eubacteria and
is required for providing 30S subunits for initiating the
next round of translation of a cistron.
0022-2836/© 2016 Published by Elsevier Ltd.
An obligatory recycling phase after termination
cannot easily be reconciled with numerous hints
over the last decades for a re-initiation, where 70S
ribosomes rather than 30S subunits were conjectured
to be involved [14–17], although no mechanistic
features of a 70S re-initiation were reported. Recently,
we have demonstrated a frequent initiation mode in
bacteria, the so-called 70S-scanning initiation, according to which 70S ribosomes do not dissociate
after termination but rather scan along the mRNA until
reaching the initiation site of the downstream cistron of
the same mRNA. 30S scanning was not observed;
binding of fMet-tRNA triggers 70S scanning, which
occurs in the absence of energy-rich compounds
(e.g., GTP) and seems to be driven by unidimensional
diffusion [18]. A recent report about 70S ribosomes
J Mol Biol (2016) xx, xxx–xxx
Please cite this article as: B. Qin, et al., The Termination Phase in Protein Synthesis is not Obligatorily Followed by the RRF/EF-GDependent Recycling Phase, J. Mol. Biol. (2016), http://dx.doi.org/10.1016/j.jmb.2016.05.019
2
Termination Phase in Protein Synthesis
with tethered subunits preventing full dissociation into
ribosomal subunits demonstrated that these ribosomes were able to synthesize active proteins [19].
The apparent conflict between these two mechanisms, RRF-dependent recycling versus 70S-scanning
initiation, is analyzed here. If the recycling phase is an
essential prerequisite for the subsequent initiation
event, depleting the RRF pool should result in a
collapse of protein synthesis. Here, we show in vitro
and in vivo with suitable bicistronic mRNA constructs
that RRF is not essential for the expression of a
downstream cistron.
Results
The RRF/EF-G-dependent recycling phase is
thought to be an obligatory and essential step after
translation termination [20]. First, we tested whether
the RRF—used in the following in vitro experiments—is active. To this end, we applied a test reported by
Zavialov et al. [3], who used a 7-, 22-, and 75-fold
excess of RRF in the presence of IF3 and EF-G. We
incubated a 70S complex containing a deacylated
tRNA in the P site with EF-G•GTP, IF3, and different
amounts of RRF (5- and 15-fold excess of 70S
ribosomes; Fig. 1). The addition of RRF triggered a
clear dissociation effect, viz. the RRF preparation we
used is active.
In the next experiment, we asked whether or not
the translation of the second cistron in a bicistronic
mRNA depends on the presence of RRF. A modified
PURE system was applied [21], which allows protein
synthesis in the presence or complete absence of
the factors IF1, IF3, and RRF. Our PURE system is
further characterized by a lowered total Mg 2 +
concentration (8.5 instead of 13 mM), which yields
a free Mg 2 + concentration of 2.3 mM Mg 2 +. The low
Mg 2 + concentration is responsible for an extremely
slow equilibrium rate between 70S ribosomes and
the subunits during the incubation of the translation
assay (Fig. S4 in Ref. [18]); during the first 15 min of
incubation, no equilibrium is observed between 70S
and subunits.
We designed a bicistronic mRNA coding for
luciferases from Renilla (Rluc) and firefly (Fluc),
respectively (Fig. 2, top). The mRNA is similar to that
used in Ref. [18], where we have shown that
blocking either the expression of the first cistron or
the intercistronic runway for scanning 70S ribosomes by hybridizing antisense oligo-DNAs strongly
reduces the expression of the second cistron (Fig. 1
in Ref. [18]). Furthermore, we introduced a secondary structure hiding the Shine–Dalgarno (SD) sequence in front of the second cistron (Fig. 2). Such a
secondary structure prevents 30S binding but can be
resolved by scanning 70S ribosomes (see Fig. 2C of
Ref. [18]). Another feature of the mRNA shown in
Fig. 2 is a fusion of the second cistron Fluc with a
part of the sequence of the regulatory protein SecM
(SecM125–170), which blocks translating ribosomes
on the mRNA [22]. Therefore, each ribosome will
Fig. 1. Post-termination complexes containing a deacylated tRNA in programmed 70S ribosomes were incubated with
the indicated components. When RRF was added (lanes 4 and 5) in 5 or 15 fold excess over the 70S ribosomes,
dissociation occurs.
Please cite this article as: B. Qin, et al., The Termination Phase in Protein Synthesis is not Obligatorily Followed by the RRF/EF-GDependent Recycling Phase, J. Mol. Biol. (2016), http://dx.doi.org/10.1016/j.jmb.2016.05.019
3
Termination Phase in Protein Synthesis
translate the Fluc cistron only once; afterwards, a
recycling phase cannot take place (see Fig. 2B in
Ref. [18], where the same Fluc construct was used;
the control in Fig. S3B demonstrated that Fluc was
present exclusively as peptidyl–tRNA). The SecM
sequence is long enough to ensure that the entire
Fluc protein can pass through the ribosome exit
tunnel before stalling occurs, allowing an undisturbed Fluc folding.
Before we consider the expected outcome of the
experiments using the mRNA shown in Fig. 2, we
should consider an important difference between
30S and 70S initiation. In 70S ribosomes, mRNA is
not located in an open cleft as in free 30S subunits
but rather in a tunnel; therefore, free 70S ribosomes
cannot directly initiate at internal initiation sites of an
mRNA (like the Fluc initiation site) but must thread
the mRNA from the 5′-end (see Fig. 2B of Ref. [18]).
[23,24,18,25,26].
When we add 70S ribosomes to our modified
PURE system in the presence of the mRNA shown
in Fig. 2, ribosomes will scan down to the initiation
site of the first cistron and translate Rluc. If the RRF/
EF-G/IF3-dependent recycling phase compulsorily
follows the translation termination of the first Rluc
cistron, all ribosomes will leave the mRNA and
dissociate into subunits, resulting in a block of Fluc
synthesis, because 30S-binding initiation is prevented
by the secondary structure hiding the SD sequence. In
contrast, if 70S scanning occurs after termination of
the Rluc synthesis, 70S ribosomes will scan down the
intercistronic region of the mRNA, resolve the
secondary structure with the SD sequence, and
translate the Fluc cistron, regardless of whether or
not RRF is present.
Translation assays were performed with 70S
ribosomes. Rluc and Fluc synthesis was monitored
in the presence and absence of RRF, IF1, and IF3. In
the absence of both initiation factors, negligible
amounts of luciferases were synthesized (Fig. 2); in
their presence, the yield of both luciferases was
independent of the presence of RRF. The clear-cut
results indicate that the RRF/EF-G recycling phase
is not an obligatory step after translation of a cistron
in our in vitro system.
To seek more evidence, we turned to in vivo
systems and tried to manipulate the RRF amounts in
the cells; due to its essential nature, the gene cannot
be knocked out. By chance, we found an experimental window, through which this problem could be
tackled. We worked with an Escherichia coli strain
carrying a temperature-sensitive RRF. Originally
isolated by the Kaji group (LJ14 strain; [27]), the
strain used here was modified; it carries Tn10
conferring tetracycline resistance with ~ 25% linkage
to the frr locus as selection marker [28].
Fig. 2. Expression of the bicistronic mRNA coding for Rluc and
Fluc in the PURE system containing
70S ribosomes and all necessary
components, and IF1/IF3 and the
ribosomal recycling factor RRF
when indicated (molar ratio of
RRF:70S = 1:1). IR, intercistronic
region; the blue stretch of the IR
contains a heteropolymeric sequence of 20 nt that is 21 nt away
from the upstream Rluc stop-codon
and 40 nt from the downstream Fluc
initiation AUG codon [18].
Please cite this article as: B. Qin, et al., The Termination Phase in Protein Synthesis is not Obligatorily Followed by the RRF/EF-GDependent Recycling Phase, J. Mol. Biol. (2016), http://dx.doi.org/10.1016/j.jmb.2016.05.019
4
Termination Phase in Protein Synthesis
We confirmed the observation of Hirokawa et al.
[29] that after a shift from permissive (30 °C) to
non-permissive temperatures (43 °C), temperaturesensitive RRF (RRF ts ) was strongly diminished
within 2 h as demonstrated by Western blotting
using antibodies against RRF (Fig. 3a, lane 2). The
wild-type (WT) strain showed normal levels of RRF.
Most surprisingly, after an overnight incubation even
at the permissive temperature of 30 °C, the mutant
frr ts strain has lost its RRF in contrast to the WT
strain (Fig. 2A, lanes 7 and 8 versus 5 and 6). A
possible explanation is that the active conformer of
RRF ts requires transient interactions with the ribosome to maintain its active state. If so, it might lose
both its active conformation and compact structure in
the absence of significant protein synthesis during
the stationary phase and is thus degraded.
Fig. 3. Western blots analyzing the amounts of RRF
normalized via the L2 band. (a) RRF ts disappears when
incubated at the non-permissive temperature of 43 °C for
120 min (lane 2) or overnight (16 h) at the permissive
temperature of 30 °C (lanes 7 and 8). Lane 3, control L2;
lane 4, control RRF, the isolated RRF contains a His-tag
and therefore bands a bit higher than the cellular RRF.
(b) Western blot from kinetics at 25 °C (permissive
temperature) from 15 to 240 min after an overnight incubation (16 h) at permissive temperature (30 °C). (c) Relative
amounts of RRF (RRF ts/RRF WT) derived from the band
intensities of (B) and normalized via the intensities of the
corresponding L2 bands (green columns). In addition, the
corresponding OD600 values from the cell suspensions of WT
and RRF ts strains are shown.
In the next experiment, we tested how much time
the RRF ts strain needs to replenish the RRF factor
pool again after a 30 °C overnight incubation. After
diluting the overnight culture 100-fold in fresh LB
medium, the incubation was continued at the
permissive temperature of 25 °C. The density of
the culture was measured at distinct time points and
the amount of RRF assessed by Western blotting.
The first faint RRF band begins to appear after
60 min, and only after 240 min, it reaches a level
similar to that in the strain WT for frr (Fig. 3b and c).
The onset of growth after the lag phase is observed
only after 60 min, when the RRF levels exceed 20%
of the WT levels, and after 240 min, the RRF ts strain
has reached the growth rate of the WT cells (Fig. 3c).
The results indicate that RRF is virtually absent
during the first 30 min, thus providing a time window
of at least 25 min at 25 °C for testing protein
synthesis under negligible concentrations of RRF
in vivo.
We transformed both WT and RRF ts strains with a
bicistronic Rluc/Fluc reporter plasmid (sequence in
Fig. 4, top), but this time lacking both the secondary
structure hiding the SD sequence and the Fluc–SecM
fusion used in the experiment shown in Fig. 2. After an
overnight incubation at 30 °C, cells were diluted in
fresh LB medium. IPTG was added immediately to
induce expression of the luciferases, and incubation
was continued at 25 °C for 25 min. At this time point,
the RRF levels were at least 40-fold lower in the RRF ts
strain than in the WT strain (Fig. 4a, green bars).
Despite a negligible amount of RRF, an arrest of
protein synthesis was not observed in the RRF ts strain.
The expression ratio Fluc/Rluc was only moderately
reduced by less than 30% (yellow-red bars in Fig. 4a,
see the measured values in Fig. 4b). It is clear that an
RRF-dependent recycling phase after translation of
the first cistron is not a prerequisite for translating the
downstream cistron.
One important aspect of the RRF-dependent
recycling phase was thought to provide 30S subunits
for the 30S mode of initiation [4,30]. If so, such a
dramatic RRF reduction as that seen in Fig. 4a
should deprive the cells for free ribosomal subunits.
To test this point, we analyzed sister aliquots of
mutant and WT cell lysates from the experiment
shown in Fig. 4 in a sucrose gradient under
conditions that hardly change the equilibrium between ribosomal subunits and 70S ribosomes at
0 °C [20 mM Hepes (pH 7.6) at 0 °C, 6 mM Mg 2 +,
and 30 mM K +] [31]. The relative molar ratios of
(70S plus polysomes):50S:30S are practically constant in WT cells (normal RRF amounts, Fig. 5a) and
in cells deprived of RRF (Fig. 5b; see the comparison
in Fig. 5c). Although protein expression is damped
after stationary phase, these results do not support
the view that the RRF-mediated recycling phase is
an essential source for providing ribosomal subunits
for the 30S mode of initiation.
Please cite this article as: B. Qin, et al., The Termination Phase in Protein Synthesis is not Obligatorily Followed by the RRF/EF-GDependent Recycling Phase, J. Mol. Biol. (2016), http://dx.doi.org/10.1016/j.jmb.2016.05.019
5
Termination Phase in Protein Synthesis
Fig. 4. In vivo expression of the
bicistronic mRNA shown above
(a) in the WT and RRF ts strains.
After an overnight incubation of
30 °C for 19 h, the cell suspensions
were diluted in fresh LB medium
containing 1 mM IPTG for triggering
the expression of the luciferases
during an incubation of 25 °C for
25 min. (a) Comparison of the RRF
amounts (green bars) with the luciferase ratio Fluc/Rluc (yellow-red
bars). (b) Absolute values of the
luciferases in WT and RRF ts cells
normalized via the input of A260 units
of the S30 lysate (for details, see
Materials and Methods).
Discussion
The RRF-dependent recycling phase does not
obligatorily follow termination
RRF can increase oligopeptide synthesis two- to
threefold as shown in highly resolved in vitro tests
using mRNAs coding for oligo-peptides with six or less
residues [32–34]. Translation experiments with short
peptides are designed for an extreme recycling
activity and may not reflect physiological synthesis
of proteins with an average length of 300 to 400 aa in
bacteria. Concerning the synthesis of larger proteins,
two different types of RRF effects were reported:
(i) in vitro synthesis of the coat protein from the RNA
phage R17 performed with fractions of S100 enzymes
was stimulated up to 1.5-fold by addition of RRF
fractions [32], a result not arguing for an essential role
of the RRF recycling phase. However, these
results might not be conclusive because the system
was rather crude. Similar results were reported,
when unaffected expression of β-galactosidase was
observed in a strain harboring RRF ts under semipermissive conditions (39 °C), depriving the pool of
active RRF and also arguing against an essential role
of the RRF-dependent recycling phase. However, the
residual RRF amounts in the cells were not checked
[35]. (ii) It was reported that after termination, a
re-initiation of protein synthesis might occur directly
after the stop codon [32] or in any reading frame [27]
under conditions of RRF deprivation (“unscheduled
translation”). The observed effects were very weak;
for example, expression of β-galactosidase lacking
some N-terminal amino acids revealed a signalto-noise ratio of 4 (Fig. 6 in Ref. [27]), whereas normal
Please cite this article as: B. Qin, et al., The Termination Phase in Protein Synthesis is not Obligatorily Followed by the RRF/EF-GDependent Recycling Phase, J. Mol. Biol. (2016), http://dx.doi.org/10.1016/j.jmb.2016.05.019
6
Termination Phase in Protein Synthesis
Fig. 5. Sucrose gradient patterns from the samples
analyzed for luciferase expression shown in Fig. 4. (a) WT
strain; (b) RRF ts strain; (c) Relative amounts of ribosomes
and ribosomal subunits. The areas above the red lines
were determined; all areas of one A260 profile were taken
as 100%.
β-galactosidase expression can achieve a 1000-fold
ratio. Therefore, only a minority of ribosomes undergo
“unscheduled translation”.
These interesting but inconclusive indications
prompted us to analyze the effects of RRF on protein
synthesis under highly controlled in vitro conditions.
We designed a bicistronic mRNA coding for Rluc and
Fluc with the features described in the Results section.
The features assure that the translation of the second
Fluc cistron depends on the translation of the first Rluc
cistron, because direct 30S-binding initiation of the
Fluc cistron was prevented by hiding the SD sequence
in the secondary structure that, however, could be
resolved by scanning 70S ribosomes [18]. Consequently, Fluc expression would depend exclusively on
70S-scanning initiation.
At least three scenarios could be considered: (i) If
the RRF/EF-G-dependent recycling phase were an
obligatory and essential step after translation of a
cistron (here Rluc), forcing all ribosomes to leave the
mRNA and to dissociate into subunits, there would be
no expression of the downstream cistron Fluc. (ii) If
recycling would not be obligatory but at least would be
able to efficiently compete with 70S scanning, Fluc
expression would be sharply reduced in the presence
of RRF. (iii) Finally, the mRNA construct is also a
highly sensitive test of the “unscheduled translation”: if
in the absence of RRF the ribosomes would be
quantitatively subjected to “unscheduled translation”
in any frame as proposed, the fraction of scanning 70S
ribosomes initiating the second Fluc cistron in a
defined frame would be strongly reduced, thus also
strongly impairing the amount of synthesized Fluc.
None of the predictions could be confirmed: in vitro
translation in the highly defined PURE system
demonstrated that the yield of both luciferases was
practically the same, independent of presence or
absence of RRF (Fig. 2).
The following conclusions can be drawn from
these results: (i) an RRF-dependent recycling is not
an obligatory step after translation termination of a
cistron. (ii) “Unscheduled translation” does not play
an important role in the absence of RRF. (iii) 70S
scanning is majority after termination of Rluc–cistron
translation. (iv) Assuming a frequent RRF/EF-G
recycling of 70S ribosomes after the synthesis of
Rluc, 70S ribosomes will dissociate into subunits,
and thus, less 70S ribosome will be available for the
scanning process and the translation of the downstream Fluc cistron. Observing identical amounts of
both Rluc and Fluc in the presence or absence of
RRF means that 70S scanning is the prevailing
event after translation of the Rluc cistron under our
experimental conditions. These surprising results
prompted us to check again the effects of RRF on
protein synthesis in vivo in virtual absence of RRF.
It has been reported that RRF ts is degraded at
non-permissive temperature and is present at
permissive temperature at lower amounts than
RRF in the WT strain [29]. In extending these
observations, we found that RRF ts was practically
absent after an overnight incubation at permissive
temperature (stationary-phase cells, Fig. 3a). After
diluting the overnight cell suspension in fresh LB
medium and continuing incubation at permissive
temperature, RRF ts did not recover for more than
30 min (Fig. 3b), which opened an experimental
window for an analysis in vivo. The essential
outcome of our analysis was that at least 40-fold
reduction of the cellular RRF amount severely
blocked growth (Fig. 3c) but impaired protein
synthesis only moderately by about 30% (Fig. 4a
and b). Forcing the RRF level down to 2.5% of the
WT amounts did not affect the relative amounts of
ribosomal subunits in vivo (Fig. 5).
Please cite this article as: B. Qin, et al., The Termination Phase in Protein Synthesis is not Obligatorily Followed by the RRF/EF-GDependent Recycling Phase, J. Mol. Biol. (2016), http://dx.doi.org/10.1016/j.jmb.2016.05.019
7
Termination Phase in Protein Synthesis
We observed in vitro and in vivo that the absence of
RRF only slightly affects protein synthesis. These
results suggest that the RRF-dependent recycling
phase does not necessarily follow translation termination in bacteria. A recent report [18] indicates
that—instead of recycling—70S ribosomes stay on
the mRNA and scan to the initiation site of the
downstream cistron.
Which RRF activity might be responsible for the
factors' essential feature?
An extensive literature about RRF has been
accumulated over the last five decades. Revisiting
the published RRF data in depth will be presented
elsewhere. Here, we will give only few arguments
suggesting a broader, functional spectrum of RRF,
where a possible RRF-depending recycling of
post-termination ribosomes is not obligatorily.
The first hint comes from an assay testing the
activity of RRF. In this assay, the conversion of
polysomes to monosomes/70S ribosomes is monitored [1]. Efficient conversion required the removal of
the peptidyl group from the ribosome-bound tRNA by
puromycin [36]. Therefore, the RRF assay includes a
treatment with puromycin before the conversion is
triggered by RRF and EF-G. The resulting 70S
complexes carrying deacylated tRNAs are considered to be models for post-termination ribosomes
ready for the recycling phase. This assumption is not
valid for most ribosomes, because either they are
vacant ribosomes or will have a sense codon at the A
site in contrast to post-termination ribosomes, which
have a stop codon at the A site. Therefore, 70S
ribosomes carrying a deacylated tRNA at the P site
(P-tRNA) are a target for RRF and EF-G.
A genetic screen gathered further evidence; it
revealed a suppressor mutation of the temperaturesensitive phenotype of the peptidylhydrolase (Pth ts).
The mutation was located in the promoter region of
the RRF gene frr [37] and caused low amounts of
RRF. Pth is another essential gene in bacteria [38]
and hydrolyses peptidyl-tRNAs rather than
fMet-tRNA, which had accidentally fallen from the
ribosome [39,40] or are still present on stalled
ribosomes (see next paragraph). It follows that low
amounts of RRF can prevent the accumulation of
peptidyl-tRNA in the cytosol in a Pth ts background.
This observation suggests that RRF—directly or
indirectly—is involved in peptidyl-tRNA release from
the ribosome in cooperation with EF-G and Pth.
Targeting stalled ribosomes would be an important if
not an essential RRF function.
In fact, it has been reported that RRF participates
in the release of peptidyl-tRNAs from stalled
ribosomes in the elongation phase [41]. Another
report directly demonstrated a peptidyl-tRNA release
in vivo [42] carrying long peptides (about 350
residues) on stalled ribosomes. The authors also
demonstrated that Pth can hydrolyze peptidyl-tRNA
on stalled ribosomes, when a sense codon is at the A
site. Possibly, Pth can also hydrolyze peptidyl-tRNA
on the ribosome, when a peptidyl-tRNA resides at
the A site.
IF3 and RF3 seem to cooperate with RRF as
indicated in the following observations. Growth
defects of a Pth ts strain at non-permissive temperature could be healed not only by a reduced RRF
synthesis as expected but also to a lesser extent with
a deleted RF3 gene; restoration of viability of the
Pth ts strain was optimal with both reduced RRF
synthesis and deletion of the RF3 gene [37]. A
similar full restoration of the Pth ts phenotype was
reported from a strain containing a functionally
compromised IF3 together with the mentioned
insertion in the promoter of the RRF gene, causing
low cellular levels of RRF [43]. Furthermore, the
same authors demonstrated that overexpression of
IF3 could heal the temperature-sensitive phenotype
of RRF ts [43]. Curing the temperature-sensitive
feature of RRF ts indicates that IF3 is linked to an
essential RRF function in addition to its involvement
in the RRF post-termination recycling activity. It
follows that the RRF-dependent rescue of stalled
ribosomes consists of the triad RRF, EF-G•GTP, and
IF3.
There are two more systems, which can hydrolyze
peptidyl-tRNA on the ribosome preferentially on
stalled ribosomes. The factor ArfB (YaeJ) is able to
hydrolyze peptidyl-tRNAs at the P site codon
independently [44,45]. The same is true for the
cooperative action of ArfA (YdhL) and RF2, which
however preferentially cleave peptidyl-tRNA, when
the A site does not contain a codon [45,46].
Therefore, ArfA and RF2 are an alternative for the
tmRNA/SmB rescue system, which requires a
peptidyl-tRNA at the P site and a codon-free A site
[47].
All three systems, viz. PtH, ArfB, and ArfA/RF2,
are targeting stalled ribosomes and generating 70S
complexes with a deacylated P-tRNA and a sense
codon at the A site, which are ready targets for the
suggested RRF/EF-G/IF3 rescue system possibly
essential for the viability of the bacterial cell. The
post-termination complex is similar, because it also
carries a deacylated P-tRNA but rather a stop codon
at the A site. We suggest that the apparent conflict
between recycling and 70S scanning can be
reconciled in the following way. If an fMet-tRNA for
any reason is not available to chase the deacylated
P-tRNA of a post-termination complex and trigger
70S scanning, the stalled post-termination complex
will be recycled (Fig. 6). Even if fMet-tRNA is
available for 70S scanning, there is a case for
RRF/EF-G recycling. We have seen 70S scanning
on intercistronic regions with a length of up to ~ 60 nt,
and more than 70% of the intercistronic regions are
shorter than 30 nt [18]. It seems that 70S scanning
Please cite this article as: B. Qin, et al., The Termination Phase in Protein Synthesis is not Obligatorily Followed by the RRF/EF-GDependent Recycling Phase, J. Mol. Biol. (2016), http://dx.doi.org/10.1016/j.jmb.2016.05.019
8
Termination Phase in Protein Synthesis
Fig. 6. Simplified picture of the general role of RRF reconciling recycling and 70S scanning after termination. We
hypothesize that the general role of RRF is resolving stalled ribosomes regardless whether a sense or a stop codon is
present at the A site. A ribosome stalled in translation can be recognized by numerous factors mentioned in the text. These
factors trigger the release or hydrolysis of the peptidyl-tRNA at the P site and somehow also the release of the E-tRNA. The
product is a complex of programmed 70S ribosome with a deacylated P-tRNA, which is recognized by the triad RRF/
EF-G•GTP/ IF3 and released from the mRNA and thus ready to enter a new initiation phase again. It is not yet clear,
whether the released 70S has to dissociate first before entering the initiation phase or straight initiates as a 70S ribosome.
If a stop codon is at the A site, the post-termination complex binds an fMet-tRNA, which triggers 70S scanning to the
initiation site of the downstream cistron. In case fMet-tRNA is not available, RRF, EF-G•GTP, and IF3 provoke the known
recycling reactions.
may work for the most of genes. However, the
successful 70S scanning depends on optimal SD
sequence in front of AUG codon (see Fig. S7 of Ref.
[18]). This result indicates that 70S scanning is
difficult to manage without SD sequence even if the
intercistronic region is below ~ 60 nt. Moreover, we
have not yet analyzed the maximum distance of 70S
scanning. How 70S scanning and the RRF/
EF-G•GTP-dependent recycling compete after the
termination event still remains to be elucidated.
Materials and Methods
Buffers, ribosomes, mRNAs
H20M6N30SH4, 20 mM Hepes-KOH (pH 7.6) at 0 °C,
6 mM Mg(Ac)2, 30 mM NH4(Ac), and 4 mM
β-mercaptoethanol; H20M4.5K150SH4Spd2Spm0.05, 20 mM
Hepes-KOH (pH 7.6) at 0 °C, 4.5 mM Mg(Ac)2, 150 mM
KAc, 4 mM β-mercaptoethanol, 2 mM spermidine,
and 0.05 mM spermine; SDS sample buffer, 60 mM
Tris–HCl (pH 6.8), 2% SDS, 10% glycerol, 200 mM βmercaptoethanol, and 0.05% bromophenol blue.
The isolation of ribosomes, the use of the highly
resolved PURE system, and the construction of the
bicistronic mRNAs coding for Rluc and Fluc used in vitro
(Fig. 2) have been constructed in the following way: Rluc
and Fluc-SecM were amplified from plasmids “pET23c
R-IR-F” and “pET23c Fluc-SecM” using the primers “T7
promoter” and “Rluc-rev” or “Fluc-fw” and “T7 terminator”
(see Ref. [18]). Primers Rluc-rev and Fluc-fw were
5′-phosphorylated prior to amplification. The two genes
were ligated and cloned using BglII and EcoRI into pET23c
(Novagen); the resulting plasmid was named pET23c
R-Fluc-SecM. The intercistronic region with the hidden SD
sequence (IR-HSD) was introduced as double-stranded
oligonucleotides providing 5′ overhangs compatible to
Please cite this article as: B. Qin, et al., The Termination Phase in Protein Synthesis is not Obligatorily Followed by the RRF/EF-GDependent Recycling Phase, J. Mol. Biol. (2016), http://dx.doi.org/10.1016/j.jmb.2016.05.019
9
Termination Phase in Protein Synthesis
BamHI and NcoI restriction sites via ligation into pET23c
R-Fluc-SecM. Oligonucleotides used:
IR-HSD sense (5′-GATCCACCCCACCCCACCCCGCAG
GATCGAGCGCAGACTGAC
CCCACCCCACCCCACCCCTCTCCATTAGGA
GAACTAC-3′) and IR-HSD antisence (5′-CATGGTAGTT
CTCCTAATGGAGAGGGGTGGGGTGGGGTG
GGGTCAGTCTGCGCTCGATCCTGCGGGGTG
GGGTGGGGTG-3′).
The plasmid construction for the expression of the
luciferases from the bicistronic mRNA used in vivo (Fig. 4)
has been described [18].
Testing the activity of RRF
We incubated 10 pmol 70S with 20 pmol tRNA Phe in the
presence of poly(U) (final concentration 8 mg/ml) in buffer
H20M4.5K150Me4Spd2Sp0.05 at 37 °C for 15 min in a
reaction volume of 10 μl (post-termination state). Then,
40 pmol EF-G, 150 pmol IF3, 0.5 mM GTP, and RRF at
different amounts (0 or 50 or 150 pmol) were added,
increasing the reaction volume to 100 μl of the same buffer;
an incubation at 37 °C for 20 min followed. The reaction
mixtures were loaded on 10–30% sucrose gradients in
binding buffer and centrifuged at 24,000 rpm for 20 h in a
SW40 rotor. The ribosome profiles were monitored at A260.
Experiments with a strain harboring a RRF ts
Generation of E. coli LJ14.1 (Tn10) and LJ14.2 (Tn10 frr ts)
was described earlier [28]. E. coli LJ14.1 and LJ14.2 (WT
and RRF ts strains, respectively) were grown overnight in LB
medium (ampicillin 25 mg/L and tetracycline 12.5 mg/L) at
30 °C. After determining the OD600, the suspension was
diluted (starting OD600 = 0.05) with 400 ml LB medium with
LB medium (ampicillin 25 mg/L and tetracycline 12.5 mg/L),
and incubation continued at 25 °C. At various time points
(Fig. 3B and C), aliquots were taken (100 ml at the
beginning, later 50 ml) and the cells harvested.
SDS-sample buffer was added and proteins were denatured
at 95 °C for 5 min. The samples (corresponding to 0.1
OD600) were loaded onto 15% polyacrylamide gels for
assessment of the RRF amounts by Western blot. The
Western blot was performed as described [18] using
polyclonal antibodies against RRF and the ribosomal protein
L2 as input control and for normalizing the RRF bands.
translation factors was accordingly reduced; our modified
PURE system lacked IF1, IF3, and RRF, if not indicated. T7
polymerase, as well as CTP and UTP were omitted from the
reaction mixture; GTP and ATP were present in 2 mM each.
The final Mg2+ concentration was decreased to 8.5 mM.
Note that the free Mg2+ concentration in our PURE system
was about 2.5 mM in the presence of ATP and GTP (each
2 mM), which binds about 1 to 1.5 mM Mg2+ per mM NTP
[49]. This is near to the in vivo conditions [50]. The reaction
was incubated for 2 h at 30 °C.
Expressing Renilla and firefly luciferases in WT and
RRF ts strains
We thawed 60 μl competent E. coli cells (WT and RRF ts)
on ice and then transformed them with the plasmids carrying
the bicistronic mRNA coding for Rluc and Fluc (1 μl with
approximately 10 ng of DNA); then, these cells were mixed
and well kept on ice for 5 min. Electroporation was
performed with 1.5 kV, 200 Ω resistance, and C = 25 μF
capacity by applying pulsed electrical field for about 4–5 ms,
which causes pore formation and enables foreign plasmid to
enter into the cells. Then, 0.5 ml fresh LB medium were
added into the cuvettes and incubated at 30 °C for 1 h in
1.5 ml Eppendorf tubes. We plated 0.1 ml culture on LB
plates with ampicillin 25 mg/L and tetracycline 12.5 mg/L
and incubated it overnight for single colonies to grow.
E. coli cells (WT and the RRF ts strain) were grown
overnight in 30 ml LB medium containing ampicillin
(25 mg/L) and tetracycline (12.5 mg/L) at 30 °C. After
determining the OD600, the suspension was diluted with
200 ml LB medium (0.2 OD600) containing ampicillin
(25 mg/L), tetracycline (12.5 mg /L), and IPTG (1 mM)
and incubated at 25 °C for 25 min. The cells were
harvested, resuspended in H20M4.5K150SH4Spd2Spm0.05,
supplemented with lysozyme (0.4 mg/ml) and 10 μl
DNase (RNase free), and subjected to three freeze–thaw
cycles to lyse the cells. The membranes were removed by
two low-speed centrifugation steps (9000 g for 5 min and
9.000 g for 30 min). Then, 5 μl of the resulting S30 (diluted
100-times) was taken for measuring dual luciferase activity
by Dual-Glo Luciferase Assay System (Promega); the
chemiluminescence was measured in a Centro
Microplate-Luminometer LB 960 (Berthold Technologies).
Expression values of Rluc and Fluc in WT and the RRF ts
strain were normalized via the A260 input into the reaction
mixture. The RRF amount was determined by a Western
blot as described [18] using polyclonal antibodies against
RRF and the ribosomal protein L2 as input control and for
normalizing the RRF bands.
Expressing Renilla and firefly luciferases in vitro
Sucrose gradients of the cell lysates (S 30)
Construction of the bicistronic mRNA coding for Rluc
and Fluc (shown in Fig. 2, top) and in vitro expression in a
modified PURE system have been described in Ref. [18].
The modified PURE system
The system, as well as the purified His-tagged IF1 and
IF3, was provided by Dr. T. Ueda, Tokyo. The expression in
the PURE system was performed according to Ref. [48] with
the following modifications. The final concentration of
ribosomes in the reaction was 0.5 μM. The amount of
We loaded 1 A260 unit of S30 of E. coli cells (WT and
RRF ts ) onto 10–30% sucrose gradient made in
H20M6K30SH4 buffer. A centrifugation with the swing-out
rotor SW55 was performed (at 39,000 rpm for 135 min),
and the gradient was recorded by gradient runner (LKB).
Gradient runner is an instrument that measures the
absorbance of samples at A260, while the sucrose gradient
is pumped out. Based on the absorbance value, the curve
was plotted and the peak areas were analyzed with the
software Origin8 (OriginLab)
Please cite this article as: B. Qin, et al., The Termination Phase in Protein Synthesis is not Obligatorily Followed by the RRF/EF-GDependent Recycling Phase, J. Mol. Biol. (2016), http://dx.doi.org/10.1016/j.jmb.2016.05.019
10
Termination Phase in Protein Synthesis
Acknowledgments
We thank Drs. Akira and Hideko Kaji for both
supplying us with RRF antibodies and intensive
discussions, and Drs. Markus Pech, Gene Center,
University of Munich, Germany, and John Achenbach,
NOXXON Pharma AG, Berlin, Germany, for help
and discussions. We thank Profs. M. Vingron,
Max-Planck-Institut für Molekulare Genetik in
Berlin-Dahlem, and C.M.T. Spahn, Institute of Medical
Physics and Biophysics at the Charité, Berlin, for
generous support. This work was supported by the
China Scholarship Council (File No. 20114911234) to
B.Q., the HFSPO Research Grant Funds (HFSP-Ref.
RGP0008/2014) to K.H.N. and T.U., and the
Alexander-von-Humboldt Foundation (grant GAN
1127366 STP-2) to H.Y., the Max-Planck-Gesellschaft
and the Verein zur Förderung junger Wissenschaftler
(Berlin).
Financial Disclosure: This work was supported by
the Max-Planck-Gesellschaft and the Verein zur
Förderung junger Wissenschaftler (Berlin). The funders
had no role in study design, data collection and
analysis, decision to publish, or preparation of the
manuscript.
Received 27 November 2015;
Received in revised form 18 May 2016;
Accepted 22 May 2016
Available online xxxx
Keywords:
protein synthesis;
termination of protein synthesis;
ribosome recycling;
RRF function;
recycling phase not obligatory
†B.Q. and H.Y. contributed equally to this work.
Abbreviations used:
RRF, ribosomal recycling factor; Rluc, Renilla luciferase; Fluc, firefly luciferase; SD, Shine–Dalgarno; RRF ts,
temperature-sensitive RRF; WT, wild-type; Pth, peptidylhydrolase; Pth ts, temperature-sensitive Pth.
References
[1] A. Hirashima, A. Kaji, Role of elongation factor G and a
protein factor on the release of ribosomes from messenger
ribonucleic acid, J. Biol. Chem. 248 (1973) 7580–7587.
[2] A. Rao, U. Varshney, Specific interaction between the
ribosome recycling factor and the elongation factor G from
Mycobacterium tuberculosis mediates peptidyl-tRNA release
and ribosome recycling in Escherichia coli, EMBO J. 20
(2001) 2977–2986.
[3] A.V. Zavialov, V.V. Hauryliuk, M. Ehrenberg, Splitting of the
posttermination ribosome into subunits by the concerted
action of RRF and EF-G, Mol. Cell. 18 (2005) 675–686.
[4] G. Hirokawa, R.M. Nijman, V.S. Raj, H. Kaji, K. Igarashi, A.
Kaji, The role of ribosome recycling factor in dissociation of
70S ribosomes into subunits, RNA. 11 (2005) 1317–1328.
[5] G. Hirokawa, N. Iwakura, A. Kaji, H. Kaji, The role of GTP in
transient splitting of 70S ribosomes by RRF (ribosome
recycling factor) and EF-G (elongation factor G), Nucleic
Acids Res. 36 (2008) 6676–6687.
[6] L. Janosi, I. Shimizu, A. Kaji, Ribosome recycling factor
(ribosome releasing factor) is essential for bacterial growth,
Proc. Natl. Acad. Sci. U. S. A. 91 (1994) 4249–4253.
[7] L. Janosi, R. Ricker, A. Kaji, Dual functions of ribosome
recycling factor in protein biosynthesis: disassembling the
termination complex and preventing translational errors,
Biochimie 78 (1996) 959–969.
[8] M. Selmer, S. Al-Karadaghi, G. Hirokawa, A. Kaji, A. Liljas,
Crystal structure of Thermotoga maritima ribosome recycling
factor: a tRNA mimic, Science. 286 (1999) 2349–2352.
[9] R.K. Agrawal, M.R. Sharma, M.C. Kiel, G. Hirokawa, T.M. Booth,
C.M. Spahn, et al., Visualization of ribosome-recycling factor on
the Escherichia coli 70S ribosome: functional implications, Proc.
Natl. Acad. Sci. U. S. A. 101 (2004) 8900–8905.
[10] N. Gao, A.V. Zavialov, W. Li, J. Sengupta, M. Valle, R.P.
Gursky, et al., Mechanism for the disassembly of the
posttermination complex inferred from cryo-EM studies,
Mol. Cell 18 (2005) 663–674.
[11] A. Weixlbaumer, S. Petry, C.M. Dunham, M. Selmer, A.C.
Kelley, V. Ramakrishnan, Crystal structure of the ribosome
recycling factor bound to the ribosome, Nat. Struct. Mol. Biol.
14 (2007) 733–737.
[12] R.D. Pai, W. Zhang, B.S. Schuwirth, G. Hirokawa, H. Kaji, A.
Kaji, J.H. Cate, Structural insights into ribosome recycling
factor interactions with the 70S ribosome, J. Mol. Biol. 376
(2008) 1334–1347.
[13] T. Yokoyama, T.R. Shaikh, N. Iwakura, H. Kaji, A. Kaji, R.K.
Agrawal, Structural insights into initial and intermediate steps of
the ribosome-recycling process, EMBO J. 31 (2012) 1836–1846.
[14] A. Sarabhai, S. Brenner, A mutant which reinitiates the
polypeptide chain after chain termination, J. Mol. Biol. 27
(1967) 145–162.
[15] M.R. Adhin, J. van Duin, Scanning model for translational
reinitiation in eubacteria, J. Mol. Biol. 213 (1990) 811–818.
[16] H.U. Petersen, A. Danchin, M. Grunberg-Manago, Toward an
understanding of the formylation of initiator tRNA methionine
in prokaryotic protein synthesis. II. A two-state model for the
70S ribosome, Biochemistry 15 (1976) 1362–1369.
[17] K. Saito, L.C. Mattheakis, M. Nomura, Post-transcriptional
regulation of the str operon in Escherichia coli. Ribosomal
protein S7 inhibits coupled translation of S7 but not its
independent translation, J. Mol. Biol. 235 (1994) 111–124.
[18] H. Yamamoto, D. Wittek, R. Gupta, B. Qin, T. Ueda, R.
Krause, et al., 70S-scanning initiation is a novel and frequent
initiation mode of ribosomal translation in bacteria, Proc. Natl.
Acad. Sci. U. S. A. 113 (2016) E1180–E1189.
[19] C. Orelle, E.D. Carlson, T. Szal, T. Florin, M.C. Jewett, A.S.
Mankin, Protein synthesis by ribosomes with tethered
subunits, Nature (2015) 119–124.
[20] G. Hirokawa, N. Demeshkina, N. Iwakura, H. Kaji, A. Kaji,
The ribosome-recycling step: consensus or controversy?
Trends Biochem. Sci. 31 (2006) 143–149.
[21] Y. Shimizu, T. Ueda, PURE technology, Methods Mol. Biol.
607 (2010) 11–21.
Please cite this article as: B. Qin, et al., The Termination Phase in Protein Synthesis is not Obligatorily Followed by the RRF/EF-GDependent Recycling Phase, J. Mol. Biol. (2016), http://dx.doi.org/10.1016/j.jmb.2016.05.019
Termination Phase in Protein Synthesis
[22] S. Bhushan, T. Hoffmann, B. Seidelt, J. Frauenfeld, T.
Mielke, O. Berninghausen, et al., SecM-stalled ribosomes
adopt an altered geometry at the peptidyl transferase center,
PLoS Biol. 9 (2011), e1000581.
[23] A.G. Balakin, E.A. Skripkin, I.N. Shatsky, A.A. Bogdanov,
Unusual ribosome binding properties of messenger RNA
encoding bacteriophage lambda repressor, Nucleic Acids
Res. 20 (1992) 563–571.
[24] I. Moll, G. Hirokawa, M.C. Kiel, A. Kaji, U. Blasi, Translation
initiation with 70S ribosomes: an alternative pathway for
leaderless mRNAs, Nucleic Acids Res. 32 (2004)
3354–3363.
[25] A. Simonetti, S. Marzi, L. Jenner, A. Myasnikov, P. Romby,
G. Yusupova, et al., A structural view of translation initiation
in bacteria, Cell. Mol. Life Sci. 66 (2009) 423–436.
[26] S. Mohan, J.P. Donohue, H.F. Noller, Molecular mechanics
of 30S subunit head rotation, Proc. Natl. Acad. Sci. U. S. A.
111 (2014) 13,325–13,330.
[27] L. Janosi, S. Mottagui-Tabar, L. Isaksson, Y. Sekine, E.
Ohtsubo, S. Zhang, et al., Evidence for in vivo ribosome
recycling, the fourth step in protein biosynthesis, EMBO J. 17
(1998) 1141–1151.
[28] A. Seshadri, B. Dubey, M.H. Weber, U. Varshney, Impact of
rRNA methylations on ribosome recycling and fidelity of
initiation in Escherichia coli, Mol. Microbiol. 72 (2009)
795–808.
[29] G. Hirokawa, H. Inokuchi, H. Kaji, K. Igarashi, A. Kaji, In vivo
effect of inactivation of ribosome recycling factor—fate of
ribosomes after unscheduled translation downstream of open
reading frame, Mol. Microbiol. 54 (2004) 1011–1021.
[30] R. Karimi, M. Pavlov, R. Buckingham, M. Ehrenberg, Novel
roles for classical factors at the interface between translation
termination and initiation, Mol. Cell. 3 (1999) 601–609.
[31] G. Blaha, N. Burkhardt, K.H. Nierhaus, Formation of 70S
ribosomes: large activation energy is required for the
adaptation of exclusively the small ribosomal subunit,
Biophys. Chem. 96 (2002) 153–161.
[32] M. Ryoji, J.W. Karpen, A. Kaji, Further characterization of
ribosome releasing factor and evidence that it prevents
ribosomes from reading through a termination codon, J. Biol.
Chem. 256 (1981) 5798–5801.
[33] M.Y. Pavlov, D.V. Freistroffer, J. MacDougall, R.H.
Buckingham, M. Ehrenberg, Fast recycling of Escherichia
coli ribosomes requires both ribosome recycling factor
(RRF) and release factor RF3, EMBO J. 16 (1997)
4134–4141.
[34] Y. Shimizu, A. Inoue, Y. Tomari, T. Suzuki, T. Yokogawa, K.
Nishikawa, T. Ueda, Cell-free translation reconstituted with
purified components, Nat. Biotechnol. 19 (2001) 751–755.
[35] Y. Inokuchi, A. Hirashima, Y. Sekine, L. Janosi, A. Kaji, Role
of ribosome recycling factor (RRF) in translational coupling,
EMBO J. 19 (2000) 3788–3798.
11
[36] A. Hirashima, A. Kaji, Factor-dependent release of ribosomes from mRNA. Requirement for 2 heat-stable factors, J.
Mol. Biol. 65 (1972) 43–58.
[37] V. Heurgue-Hamard, R. Karimi, L. Mora, J. MacDougall, C.
Leboeuf, G. Grentzmann, et al., Ribosome release factor
RF4 and termination factor RF3 are involved in dissociation
of peptidyl-tRNA from the ribosome, EMBO J. 17 (1998)
808–816.
[38] J.R. Menninger, Accumulation of peptidyl tRNA is lethal in
Escherichia coli, J. Bacteriol. 137 (1979) 694–696.
[39] H. Kössel, U.L. RajBhandary, Studies on polynucleotides.
LXXXVI. Enzymic hydrolysis of N-acylaminoacyl-transfer
RNA, J. Mol. Biol. 35 (1968) 539–560.
[40] H. Kössel, Purification and properties of peptidyl-tRNA
hydrolase from Escherichia coli, Biochim. Biophys. Acta
204 (1970) 191–202.
[41] N.S. Singh, R. Ahmad, R. Sangeetha, U. Varshney,
Recycling of ribosomal complexes stalled at the step of
elongation in Escherichia coli, J. Mol. Biol. 380 (2008)
451–464.
[42] S. Vivanco-Dominguez, J. Bueno-Martinez, G. Leon-Avila, N.
Iwakura, A. Kaji, H. Kaji, G. Guarneros, Protein synthesis
factors (RF1, RF2, RF3, RRF, and tmRNA) and peptidyltRNA hydrolase rescue stalled ribosomes at sense codons,
J. Mol. Biol. 417 (2012) 425–439.
[43] N. Singh, G. Das, A. Seshadri, R. Sangeetha, U. Varshney,
Evidence for a role of initiation factor 3 in recycling of
ribosomal complexes stalled on mRNAs in Escherichia coli,
Nucleic Acids Res. 33 (2005) 5591–5601.
[44] Y. Handa, N. Inaho, N. Nameki, YaeJ is a novel ribosomeassociated protein in Escherichia coli that can hydrolyze
peptidyl-tRNA on stalled ribosomes, Nucleic Acids Res. 39
(2011) 1739–1748.
[45] Y. Shimizu, ArfA recruits RF2 into stalled ribosomes, J. Mol.
Biol. 423 (2012) 624–631.
[46] Y. Chadani, K. Ito, K. Kutsukake, T. Abo, ArfA recruits
release factor 2 to rescue stalled ribosomes by peptidyl-tRNA
hydrolysis in Escherichia coli, Mol. Microbiol. 86 (2012)
37–50.
[47] D.J. Ramrath, H. Yamamoto, K. Rother, D. Wittek, M. Pech,
T. Mielke, et al., The complex of tmRNA–SmpB and EF-G on
translocating ribosomes, Nature 485 (2012) 526–529.
[48] Y. Shimizu, T. Kanamori, T. Ueda, Protein synthesis by pure
translation systems, Methods 36 (2005) 299–304.
[49] K.L. Manchester, Resolution with a protein synthesising
system of conflicting estimates for the stability constant for
KATP3- formation, Biochim. Biophys. Acta 630 (1980)
232–237.
[50] E.M. Froschauer, M. Kolisek, F. Dieterich, M. Schweigel, R.J.
Schweyen, Fluorescence measurements of free [Mg2 +] by
use of mag-fura 2 in Salmonella enterica, FEMS Microbiol.
Lett. 237 (2004) 49–55.
Please cite this article as: B. Qin, et al., The Termination Phase in Protein Synthesis is not Obligatorily Followed by the RRF/EF-GDependent Recycling Phase, J. Mol. Biol. (2016), http://dx.doi.org/10.1016/j.jmb.2016.05.019