NEUROENDOCRINOLOGY
Adiponectin Depolarizes Parvocellular Paraventricular
Nucleus Neurons Controlling Neuroendocrine and
Autonomic Function
Ted Donald Hoyda, Willis Kendrick Samson, and Alastair Victor Ferguson
Department of Physiology (T.D.H., A.V.F.), Queen’s University, Kingston, Ontario, Canada K7L 3N6; and
Pharmacological and Physiological Science (W.K.S.), St. Louis School of Medicine, St. Louis, Missouri 63104
Adiponectin plays important roles in the control of energy homeostasis and autonomic function
through peripheral and central nervous system actions. The paraventricular nucleus (PVN) of the
hypothalamus is a primary site of neuroendocrine (NE) and autonomic integration, and, thus, a
potential target for adiponectin actions. Here, we investigate actions of adiponectin on parvocellular PVN neurons. Adiponectin influenced the majority (65%) of parvocellular PVN neurons,
depolarizing 47%, whereas hyperpolarizing 18% of neurons tested. Post hoc identification (singlecell RT-PCR) after recordings revealed that adiponectin depolarizes NE-CRH neurons, whereas
intracerebroventricular injections of adiponectin in vivo caused increased plasma ACTH concentrations. Adiponectin also depolarized the majority of TRH neurons, however, NE-TRH neurons
were unaffected, in accordance with in vivo experiments showing that intracerebroventricular
adiponectin was without effect on plasma TSH. In addition, bath administration of adiponectin also
depolarized both preautonomic TRH and oxytocin neurons. These results show that adiponectin
acts in the central nervous system to coordinate NE and autonomic function through actions on
specific functional groups of PVN neurons. (Endocrinology 150: 832– 840, 2009)
nergy homeostasis is coordinated in large part through peripherally produced hormones that interact with the central
nervous system (CNS) (1). Adipose tissues produce a number of
these signaling molecules that function in the CNS to dictate
feeding patterns and responses to stress, and maintain dynamic
equilibrium. Adiponectin is one such protein that, like leptin and
resistin, is produced by adipocytes, circulates in the plasma, and
controls network excitability in important autonomic nuclei (2–
6). However, unlike leptin and resistin, adiponectin circulates at
extremely high concentrations that vary inversely with adiposity
(7, 8). Adiponectin knockout mice show impaired responses to
glucose challenges, and have compromised insulin and metabolic
function among other pathologies (9). When injected into the
brain, adiponectin has a marked effect on autonomic function.
Mice show a substantial decrease in body weight, increased thermogenesis, increased oxygen consumption, and increased CRH
mRNA production in the paraventricular nucleus (PVN) (10).
E
This evidence suggests that adiponectin plays a critical role in
controlling energy homeostasis.
Adiponectin signals through two known receptors: adiponectin receptors (AdipoRs) 1 and 2 (11). AdipoRs are located
throughout the CNS, notably in regions of the hypothalamus and
brainstem, important in controlling autonomic function and
feeding behavior, including the area postrema (12), arcuate nucleus (13), and the PVN (3).
The PVN contains neurons that play important roles in controlling autonomic state (14, 15). Electrophysiologically, the
PVN can be divided into three populations of neurons (16, 17):
magnocellular (MNC), preautonomic (PA) parvocellular, and
neuroendocrine (NE) parvocellular. Distinct groups of PA and
NE neurons contain CRH, TRH, and oxytocin (OT) that participate as neuromodulators (PA) or hormones (NE) translating
output information from the PVN to its targets (15).
We recently reported that adiponectin controls the excitability of PVN MNC neurons; hyperpolarizing OT neurons, having
ISSN Print 0013-7227 ISSN Online 1945-7170
Printed in U.S.A.
Copyright © 2009 by The Endocrine Society
doi: 10.1210/en.2008-1179 Received August 7, 2008. Accepted October 8, 2008.
First Published Online October 23, 2008
Abbreviations: aCSF, Artificial cerebral spinal fluid; AdipoR, adiponectin receptor; CNS,
central nervous system; CSF, cerebral spinal fluid; DNase, deoxyribonuclease; icv, intracerebroventricular; LTS, low-threshold spike; MNC, magnocellular; NE, neuroendocrine; NTS,
nucleus of the solitary tract; OT, oxytocin; PA, preautonomic; PVN, paraventricular nucleus;
TTX, tetrodotoxin.
For editorial see page 559
832
endo.endojournals.org
Endocrinology, February 2009, 150(2):832– 840
Endocrinology, February 2009, 150(2):832– 840
varying effects on vasopressin neurons and having no effect on
neurons that expressed both peptides (3). Here, we examine the
effects of adiponectin on the parvocellular neurons in the PVN
(PA and NE), specifically investigating three chemically distinct
types of neurons within this group: CRH-, TRH- and OT-expressing cells, while also correlating electrophysiological effects
with integrated NE function in conscious freely moving animals.
Materials and Methods
All procedures involving the use of animals conformed to the standards
of the Canadian Counsel on Animal Care and were approved by the
Queen’s University Animal Care Committee. All chemicals used in making solutions were obtained from Sigma Pharmaceuticals (Oakville, Ontario, Canada). Tetrodotoxin (TTX) citrate was obtained from Alomone
Laboratories (Jerusalem, Israel), made into working aliquots, and stored
at ⫺80 C. Globular adiponectin was obtained from Phoenix Pharmaceuticals (Belmont, CA), made into working aliquots, and stored at ⫺20
C until experimentation.
Electrophysiology
Coronal hypothalamic slices (300 ␮M) containing the PVN were
taken daily from male Sprague Dawley rats (Charles River, Quebec,
Canada) between postnatal d 19 and 26 that were maintained on a 12-h
light, 12-h dark cycle, and provided with food and water ad libitum. Rats
were decapitated, and brains were removed and placed in ice-cold slicing
solution consisting of (in mM) 87 NaCl, 2.5 KCl, 25 NaHCO3, 0.5 CaCl2,
7 MgCl2, 1.25 NaH2PO4, 25 glucose, and 75 sucrose bubbled with 95%
O2/5% CO2 for 3–5 min. Brains were then trimmed to size, mounted,
immersed with slicing solutions, and 300 ␮M hypothalamic slices containing PVN (typically three) were cut using a vibratome (Leica, Nussloch, Germany). Slices were then bisected and incubated at 32.5 C in
artificial cerebral spinal fluid (aCSF) containing (in mM) 126 NaCl, 2.5
KCl, 26 NaHCO3, 2 CaCl2, 2 MgCl2, 1.25 NaH2PO4, and 10 glucose
saturated with 95% O2/5% CO2 for at least 1 h before recording. aCSF
was used as external recording solution for all electrophysiological experiments unless otherwise indicated.
Parvocellular PVN neurons were visualized using a ⫻40 water-immersion objective mounted to an upright Nikon E600FN microscope
fitted with differential interference contrast/infrared optics (Nikon
Corp., Tokyo, Japan). Borosilicate glass (World Precision Instruments,
Sarasota, FL) was pulled by a flaming micropipette puller (Sutter Instruments Co., Novato, CA), and when filled with internal recording solution containing (in mM) 130 K⫹-gluconate, 10 KCl, 2 MgCl2, 0.1 CaCl2,
5.5 EGTA, 10 HEPES, 2 NaATP, adjusted to pH 7.2 with KOH, had
resistances of between 2 and 5 M⍀. Whole cell configuration was obtained following the formation of a G⍀ seal by applying negative pressure to the pipette and monitoring resistance changes on an oscilloscope.
Current clamp recordings from parvocellular PVN neurons were obtained with a Multiclamp 700B (Molecular Devices, Palo Alto, CA)
patch clamp amplifier. Previous reports have shown that PVN parvocellular neurons can be divided into two main groups based on anatomical projection patterns and electrophysiological profile (16, 18). Parvocellular PVN neurons were classified as either PA (type 2) or NE (type
3) neurons using a current pulse protocol designed to identify the presence of a low-threshold spike (LTS), or nonaccommodating spike firing,
identifying electrophysiological features unique to PA and NE neurons
in the PVN. The pulse protocol consisted of an initial 250-msec step of
⫺60 pA from baseline membrane potential followed by sweeps of 10 pA
(from ⫺60 to 40 pA) steps for 250 msec until action potential threshold
was reached. Neurons that displayed an LTS were classified as PA (see
example in Fig. 4A, inset), whereas parvocellular neurons that showed no
discernable LTS and no accommodation of spike frequency during depolarization were classified as NE (example Fig. 3A, inset). Neurons that
endo.endojournals.org
833
had an ambiguous electrophysiological fingerprint were removed from
the study. Experiments were recorded in real-time using acquisition software Spike 2 (Cambridge Electronic Devices, Cambridge, UK).Capacitance transients and series resistance error was minimized at the start of
all recordings.
After establishing a stable control membrane potential for at least
100 sec, adiponectin, dissolved in aCSF to a concentration of 10 nM
关previous studies indicate that 1 nM is the minimum effective dose (3)兴
was bath applied to the slice at a rate of 1–2 ml/min. Responsiveness of
neurons to adiponectin was assessed by averaging all membrane potential points in 100-sec units starting from the time of application of peptide
measuring 10 U. The peak mean voltage change in a 100-sec unit was
compared with the mean membrane potential of points in the control
unit. Neurons were categorized as responsive if the peak mean within the
10 U exceeded two times the SD value of the control membrane potential.
Membrane potential was recorded until values returned to control levels,
and only one recording was obtained from each hypothalamic slice.
Neurons were eliminated from the data set if they did not show at least
partial recovery to baseline.
Single-cell RT-PCR
After experimentation a post hoc single-cell RT-PCR was performed
to detect mRNA for prominent neuropeptides expressed in parvocellular
neurons (Table 1). Gentle suction was applied to the recording pipette to
aspirate cytoplasm. Membrane resistance was continuously monitored
as an outside-out patch was pulled, sealing the cytoplasmic contents
within the pipette. Cells that failed to form outside-out patches were
eliminated from sense-specific RT-PCR analysis but were included in the
analysis of changes in membrane potential. After pipette withdrawal
from the bath, the electrode tip was broken, and its contents were expelled into a 0.5-ml PCR tube. The following were added to the tube to
set up the deoxyribonuclease (DNase) reaction: (approximate concentrations) 10 U DNase I and 10 mM 10⫻ reaction buffer with MgCl2
(Fermentas Life Sciences, Burlington, Ontario, Canada) and incubated at
37 C for 30 min. After incubation, 2.5 mM EDTA was added and incubated at 65 C for 10 min to stop the DNase reaction. Reverse transcriptase reaction proceeded immediately after by adding dithiothreitol
(26 mM), deoxynucleotide triphosphates (3 mM), random hexamers (3
␮M), MgCl2 (4 mM), ribonuclease inhibitor (20 U), and SuperScript II
(100 U) (Invitrogen Canada, Burlington, Ontario, Canada), and allowed
to incubate overnight at 37 C to allow the reaction to proceed. A negative
control reaction in which SuperScript II was omitted from the reaction
mixture was also performed. Samples were stored at ⫺80 C until the
multiplex reaction.
A multiplex PCR strategy was used to amplify the cDNA produced
in the reverse transcriptase reaction. This protocol consisted of two different amplification steps: outside and nested. First, primer sets (0.2 ␮M)
specific for all genes of interest (outside) were added to the cDNA from
the single cell, which then underwent an amplification protocol. Reactions were performed in 100-␮l volumes with reagents provided in the
QIAGEN Multiplex kit (QIAGEN, Mississauga, Ontario, Canada). The
reaction mixture was denatured at 95 C for 15 min, then cycled 20 times
through a temperature protocol of 94 C for 30 sec, 60 C for 90 sec, and
72 C for 90 sec. The second step consisted of individual reactions for each
gene of interest using “nested” primer sets. Reactions were performed in
50-␮l volumes consisting of QIAGEN Multiplex reaction reagents, 0.2
␮M primers and 2 ␮l solution from the multiplex reaction to act as
template. The reaction mixture was subject to 35 cycles of the same
amplification protocol. Two control reactions were performed during
the multiplex protocol: 1) 1 reaction was run with PCR H2O instead of
cDNA to detect for genomic contamination, and 2) a second reaction was
run with cDNA from whole PVN to assess primer integrity and eliminate
false negatives. PCR products from the nested reaction were run on a 2%
(wt/vol) agarose gel containing ethidium bromide and sequenced to confirm their identity (Robarts Research Institute, London, Ontario, Canada). PCRs that failed to pass any of the control tests were eliminated
from the study.
834
Hoyda et al.
Adiponectin Influences Parvocellular PVN Neurons
Endocrinology, February 2009, 150(2):832– 840
TABLE 1. Primer sets used in the detection of mRNA from single cells
Gene
Primer
Position
Glyceraldehyde-3-phosphate
dehydrogenase
GAPDH
␥-Amino butyric acid
GAD67
Tyrosine hydroxylase
TH
Vasopressin
VP
Oxytocin
OT
Corticotropin-releasing
hormone
CRH
Thyrotropin-releasing
hormone
TRH
Vesicular glutamate
transporter-2
VGLUT2
Adiponectin receptor 1
AdipoRl
Adiponectin receptor 2
AdipoR2
F (outside)
R
F (nested)
R
F (outside)
R
F (nested)
R
F (outside)
R
F (nested)
F.
F (outside)
R
F (nested)
R
F (outside)
R
F (nested)
F
F (outside)
R
F (nested)
R
F (outside)
R
F (nested)
R
F (outside)
R
F (nested)
R
F (outside)
R
F (nested)
R
F (outside)
R
F (nested)
R
Sequence
Product
size (bp)
gatggtgaaggtcggtgtg
469
gggctaagcagttggtggt
taccaggctgccttctct
360
ctcgtggttcacacccatc
cacaaactcagcggcataga
550
gagatgaccatccggaagaa
cacaaactcagcggcataga
149
ctggaagaggtagcctgcac
cacctggagtattttgtgcg
1138
cctgtgggtggtaccctatg
tcgacccagtatatccgcca
376
tcggacacaaagtacacagg
cctcacctctgcctgctactt
237
agccagctgtaccagcctaa
acctctgcctgctacttcca
216
agccagctgtaccagcctaa
ctgccccagtctcgcttg
281
cctccgcttccgcaaggcttctggc
ctgccccagtctcgcttg
244
gcgagggcaggtagttctcc
ggggaaaggcaaagaaaagg
184
gacagagccaccagcagcat
ggagaagagaaaggagaagaggaa
140
ggacaccagcagccgcag
agaggggagacttgggagaa
44?
ctttgcttcaccagggtctc
attcatgggcagatgaggag
245
ggcgtttctcaggcattaag
aggttggctaccacctcct
583
tgagagtagccaacaaccagaagca
cccgcaaagcatccaacca
164
cctgcagaagtttgcaacaa
gtcccctggctctattctcct
509
agcacttggctgtgatgt
tcttcctcatggctgtgatgt
223
ggctcagagaagggagtcatc
ggagccattctctgcctttc
464
ccagatgtcacatttgcca
actgtaacccacaaccttgcttc
191
tcaggaacccttctgagatgac
Accession no.
NM_017008
NM_017007
NM_012740
NM_016992
NM_012996
X03036
M23632
AF271235
BC061839
NM_001037979
F, Forward; R, reverse.
In vivo experiments
lp;&-2qUnder ketamine (Ketaset; Fort Dodge Animal Health, Fort
Dodge, IA)/xylazine (TranquiVed; Vedco Inc., St. Joseph, MO) anesthesia (60 mg/8 mg mixture/ml, 0.1 ml/100 g body weight, ip injection), rats
were placed in a stereotaxic device, and a 23-gauge, stainless steel cannula (17 mm) was implanted into the right lateral cerebroventricle as
previously described (19). Minimally, 5 d later, after the animals had
returned to preimplantation body weights, an indwelling jugular vein
cannula was implanted as previously described (20) under isofluraneinduced anesthesia (3% in O2 for induction, 2% in O2 for maintenance
of anesthesia; IsoSol; Vedco). The jugular cannula was exteriorized at the
back of the neck and sealed with heparinized saline (200 U/ml 0.9%
NaCl). On the following day, an extension tubing (PE-50) was attached
to the jugular cannula to facilitate blood sampling, and rats were left
undisturbed for minimally 120 min. An initial blood sample was then
withdrawn from the jugular vein without disturbing the animal. All
blood samples (0.3 ml) were removed from conscious, unrestrained rats
into heparinized syringes and replaced with an equal volume of 0.9%
NaCl (37 C). Sampling was conducted between 0900 and 1100 h (lights
on 0600 h). Blood samples were stored on ice before plasma was separated (10,000 ⫻ g, 5 min) and stored at ⫺20 C until hormone assays were
conducted. Immediately after the removal of the initial (zero time) blood
sample, a 2-␮l injection of isotonic saline vehicle alone or vehicle containing 0.1, 0.3, or 1.0 nmol adiponectin was conducted via the indwelling cerebroventricular cannula. Subsequent blood samples were removed 5, 15, 30, and 60 min after intracerebroventricular (icv)
injections.
Plasma TSH levels were measured (20 ␮l aliquots) using the materials obtained from the National Peptide and Pituitary Program
(National Institutes of Health (rTSH-RP-2 standard, minimum detectable level: 0.5 ng/ml; interassay and intraassay coefficients of variability were less than 8%). ACTH concentrations in plasma (33 ␮l
aliquots) were determined by RIA using the unextracted plasma protocol described by the supplier (Peninsula Laboratories, Inc., San Carlos,
Endocrinology, February 2009, 150(2):832– 840
CA). Minimum detectable ACTH levels were 1 pg/ml, and interassay and
intraassay coefficients of variability were less than 8%.
Data from the RIAs were analyzed by one-way ANOVA both within
treatment groups across time and between treatment groups at any sampling time point, followed by Scheffé’s multiple comparison testing. Homogeneity of variance was established using the S test. Significance was
assigned to results that occurred with less than 5% probability.
endo.endojournals.org
835
Results
Adiponectin influences the excitability of parvocellular
neurons in the PVN
Current clamp recordings were obtained from 122 identified
(58 PA and 64 NE) parvocellular PVN neurons, and the effects
FIG. 1. Adiponectin effects on the membrane potential of NE and PA neurons in the PVN. A, Bath administration of 10 nM adiponectin (black bar) induces both
depolarizing (i) and hyperpolarizing (ii) effects on membrane potential in different populations of type 3 NE neurons. Membrane potential routinely recovered to near
control membrane potential (red line) after removal of adiponectin from the bath. B, Similar effects of adiponectin on membrane potential were seen in type 2 PA
neurons, depolarizing (i) a population of cells while hyperpolarizing (ii) a separate group of neurons.
836
Hoyda et al.
Adiponectin Influences Parvocellular PVN Neurons
FIG. 2. The effects of adiponectin are direct and proportionally similar across
parvocellular PVN neurons. A, Histogram showing percentage of each cell
type; NE, PA, total combined and when action potential induced
neurotransmitter release was inhibited through the application of 1 ␮M TTX
of neurons depolarizing (blue) or hyperpolarizing (red) in the presence of 10
nM adiponectin. B, Summary box and whisker plot indicating for both
depolarization and hyperpolarization the smallest observation, the lowest
quartile, median, upper quartile, and the largest observation in each data set.
The median depolarization was 5.5 mV, whereas the median
hyperpolarization was ⫺5.7 mV.
of bath administration of 10 nM adiponectin on membrane potential were examined.
Adiponectin influenced the membrane potential of the majority of both NE and PA neurons with depolarizing and hyperpolarizing effects observed in different cells in each group (Fig.
1). The majority of cells influenced by adiponectin in each group
depolarized (7.0 ⫾ 0.5 mV, n ⫽ 59) (PA 50%, NE 40%, total
48%), whereas a smaller proportion of cells hyperpolarized
(⫺6.7 ⫾ 0.7 mV, n ⫽ 23) (PA 17%, NE 23%, total 20%) (Fig.
2). A third population of parvocellular neurons did not respond
to 10 nM adiponectin. Both depolarizing (8.4 ⫾ 1.3 mV, n ⫽ 15)
and hyperpolarizing (⫺5.9 ⫾ 0.9 mV, n ⫽ 11) effects of adiponectin were maintained in the presence of 1 ␮M TTX (n ⫽ 39),
and were observed in similar proportions of neurons (Fig. 2A),
suggesting that mechanistically, adiponectin acts directly at the
cell membrane of parvocellular neurons to modulate their electrical excitability.
Adiponectin depolarizes NE CRH neurons
To assess adiponectin’s effects on specific groups of neurons
in the PVN after membrane potential recordings, we performed
post hoc single-cell RT-PCR analysis for markers of interest (Table 1). Of the 122 neurons recorded from, 13 were positively
Endocrinology, February 2009, 150(2):832– 840
identified as CRH mRNA expressing neurons. Of 13 CRH neurons, 10 were NE neurons, and 70% of those neurons showed a
depolarizing shift in membrane potential in response to 10 nM
adiponectin (5.2 ⫾ 1.1 mV) (Fig. 3, A and B). In addition, three
PA CRH neurons responded to 10 nM adiponectin (two depolarized, one hyperpolarized).
AdipoR profile in CRH NE neurons was also assessed by
single-cell RT-PCR, and all seven of the responding CRH neurons
expressed mRNA for at least one AdipoR (R1, n ⫽ 3; R2, n ⫽ 1; and
R1/R2, n ⫽ 3). NE CRH neurons that did not express either receptor did not respond to adiponectin (0.7 ⫾ 0.9 mV, n ⫽ 3).
We next examined the effect of adiponectin on the hypothalamic-pituitary-adrenal axis by measuring the effects of adiponectin injected into the lateral cerebroventricle (icv) on plasma
ACTH concentrations. Injections (icv) of adiponectin caused a
dose-related increase in plasma ACTH concentrations 15 and 30
min after injections when compared with saline-injected controls
(Fig. 3C). The injection of 1.0 nmole adiponectin showed the
largest increase in plasma ACTH concentration compared with
vehicle at 15 min 关22.3 ⫾ 3.7 pg/ml (1.0 nmole adiponectin) vs.
8.6 ⫾ 1.0 pg/ml (vehicle); P ⫽ 0.014), (ANOVA, Scheffé multiple
comparisons)兴. Plasma ACTH concentrations had returned to
baseline at the 60-min time point, suggesting that the actions of
adiponectin are transient and reversible. These results indicate
that adiponectin acts on CRH neurons in the PVN to control
CRH release from the median eminence, and subsequent ACTH
release from the anterior pituitary gland.
Adiponectin depolarizes PA TRH neurons
We also obtained current clamp recordings from a total of 10
neurons that were identified post hoc as TRH mRNA expressing
neurons in which we were able to assess the effects of bath administration of 10 nM adiponectin. The majority of TRH neurons (six of 10) depolarized in response to 10 nM adiponectin
(7.6 ⫾ 1.9 mV) (Fig. 4A). More interestingly, classification of
TRH neurons as NE or PA revealed that a majority of the TRH
neurons depolarized by adiponectin were PA cells (six of seven),
whereas zero of three NE TRH neurons were affected by adiponectin (Fig. 4B). Analysis of the expression patterns of AdipoRs in TRH neurons showed that one of six responsive PA TRH
neurons expressed receptors (R1, n ⫽ 0; R2, n ⫽ 0; and R1/R2,
n ⫽ 1), whereas a significant number that responded to adiponectin (4.0 ⫾ 2.9 mV, n ⫽ 5) did not. We hypothesized that
this may be due to the effect of adiponectin on a presynaptic
interneuron and, therefore, performed additional current clamp
recordings from a total of four identified PA TRH neurons that
did not express either AdipoR in the presence of 1 ␮M TTX. We
observed clear effects of adiponectin in all of these neurons (depolarization in two and hyperpolarization in two), as shown in
Fig. 4B, suggesting that adiponectin may influence PA TRH neurons, at least in part, through an indirect sodium channel-independent mechanism. The mechanisms underlying such indirect
effects are not known at the current time.
In addition to measuring plasma ACTH concentrations after
lateral ventricle icv injections of adiponectin, plasma TSH concentrations were measured. TSH concentrations showed no significant change compared with vehicle control at any concen-
Endocrinology, February 2009, 150(2):832– 840
endo.endojournals.org
837
FIG. 3. Adiponectin activates the hypothalamic-pituitary stress axis through excitatory actions on NE CRH neurons in the PVN. A, The electrophysiological trace on the
bottom (ii) is a current clamp recording from an electrophysiologically identified NE neuron (inset) whose post hoc single-cell RT-PCR profile (gel inset) identifies it as
expressing CRH, depolarizing after bath application of 10 nM adiponectin (black bar). The red line in this and following figures indicates the control period membrane
potential of the neuron. This neuron had a robust increase in action potential frequency as illustrated in a rate meter recording above the trace (i) showing a change in
spike frequency before and after adiponectin administration. Scale bars, 30 mV and 100 msec (inset), 10 mV and 50 sec. B, A series of box and whisker plots showing
the response of cells that expressed CRH as detected by single-cell RT-PCR to adiponectin administration. All but one NE CRH cell favored depolarization, whereas PA
CRH neurons were mixed in their response to adiponectin. C, Plasma ACTH levels after icv injection of vehicle or adiponectin at three different doses, measured at
different time points up to 1 h after injection (*, P ⬍ 0.05, between groups ANOVA, Scheffé multiple comparisons). GAD, ␥-Amino butyric acid; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase; R1, receptor 1; R2, receptor 2; GENO, genomic.
tration or time point (15 min, vehicle: 8.8 ⫾ 1.2 ng/ml vs. 1.0
nmole: 7.8 ⫾ 0.9 ng/ml, ANOVA, Scheffé multiple comparisons)
after adiponectin administration. These data suggest that adiponectin selectively regulates ACTH secretion in the hypothalamic-pituitary axis but has no effect on TRH/TSH secretion.
Adiponectin depolarizes PA OT neurons
A significant proportion of PA neurons that express OT send
axonal projections to the nucleus of the solitary tract (NTS), and
have been suggested to modify feeding by sensitizing NTS neurons to satiety signals such as cholecystokinin (21). We recorded
from 15 PA neurons that were positively identified as OT expressing neurons. The majority of these PA OT neurons (11/15)
depolarized in response to 10 nM adiponectin (4.1 ⫾ 0.4 mV)
(Fig. 5), whereas one of the remaining four cells tested was hyperpolarized by peptide administration. The majority of adiponectin responsive PA OT neurons expressed AdipoRs 关R1, n ⫽
2; R2, n ⫽ 2; and R1/R2, n ⫽ 3 (seven of 11)兴, whereas in accordance
with our recordings from PA TRH neurons, a proportion of these
adiponectin responsive OT PA neurons (four of 11) did not express
mRNA for either of these receptors. These data suggest that adiponectin may interact with OT PA neurons, and importantly highlight opposite actions of this adipokine of functionally distinct subpopulations of OT expressing neurons in the PVN.
Discussion
These data show both endocrine and autonomic effects of adiponectin acting upon specific groups of neurons in the PVN,
confirming and identifying new and potentially critical roles
played by this peptide in regulating energy and autonomic homeostasis. We have shown that adiponectin is primarily an excitatory peptide in the parvocellular regions of the PVN, depolarizing a majority of identified parvocellular neurons, while
hyperpolarizing only a minority of neurons in the same groups.
We have also shown that adiponectin directly excites NE CRH
neurons that express AdipoRs, leading potentially to an increase
in CRH release into pituitary portal circulation. Indeed, we have
measured an increase in plasma ACTH concentrations after lateral cerebroventricular injections of adiponectin.
In addition, we have identified two chemically distinct groups
of PA neurons: TRH expressing and OT expressing cells whose
electrical excitability is controlled by adiponectin, suggesting
that the peptide may play alternate regulatory roles in addition
to hypothalamic-pituitary axis induction through modulation of
caudally projecting, PA cells.
CRH is a potent anorexigenic peptide that when released
from parvocellular neurons into the median eminence, regulates
the secretion of ACTH from anterior pituitary cells, ultimately
838
Hoyda et al.
Adiponectin Influences Parvocellular PVN Neurons
FIG. 4. Adiponectin selectively depolarizes type 2 PA TRH neurons. A, Current
clamp recording of an identified type 2 PA neuron (inset) that expresses mRNA
for TRH (gel inset) and depolarizes to bath application of 10 nM adiponectin
(black bar). Scale bars, 20 mV and 100 msec (inset), 10 mV and 100 sec. B, Box
and whisker plots showing different subgroups of PVN cells that express TRH as
measured by single-cell RT-PCR and their response to adiponectin. C, Plasma TSH
concentrations after icv injections of vehicle vs. three increasing doses of
adiponectin measured at increasing time points up to 60 min after injection.
GAPDH, Glyceraldehyde-3-phosphate dehydrogenase; R1, receptor 1; R2,
receptor 2; VGLUT, vesicular glutamate transporter; GENO, genome.
controlling plasma glucocorticoid levels (22). Our observations
that adiponectin depolarizes the majority of NE CRH neurons
while also increasing plasma concentrations of ACTH suggests
mechanisms through which this peptide may control activation
of the stress axis. Previous reports indicate that when injected
intracerebroventricularly, adiponectin increases respiration, energy metabolism, and body temperature in mice (10), all indicators of elevated sympathetic tone. Intriguingly, iv injections of
adiponectin increase feeding through actions at the arcuate nucleus (13), which has recently been shown to express AdipoR1
and AdipoR2 (23), suggesting a site specificity for autonomic
function. Our results clarify the mechanism responsible for this,
and suggest that adiponectin’s actions at CRH neurons involved
in the hypothalamic-pituitary axis partially dictate the metabolic
and autonomic state of the animal.
PVN TRH neurons also control feeding behavior, participate
in the stress response, and control metabolic function (24). Increases in TRH secretion at the median eminence are associated
with elevated thyroid function ultimately increasing the drive to
promote negative energy expenditure. Given that icv injections
of adiponectin increase energy expenditure (10), we were sur-
Endocrinology, February 2009, 150(2):832– 840
prised to find that plasma concentrations of TSH after central
adiponectin injections were unchanged, an observation that ultimately correlates well with our electrophysiological data showing that the TRH NE cells tested were also unaffected by
adiponectin.
In contrast to neurosecretory TRH neurons, PA TRH neurons
were selectively depolarized by adiponectin. These neurons have
been suggested to project to autonomic preganglionic neurons in
the dorsal vagal complex (18) and spinal cord, and send information about core body temperature to peripheral targets (25).
Thus, adipocyte derived adiponectin acting through PA TRH
neurons may represent a vital connection coupling adiposity
stores to central thermoregulation. Although an attractive hypothesis, further experiments will be needed to investigate this
possibility.
Activation of PA OT neurons that project to the NTS has
exerted profound effects on feeding patterns (21). The excitation
of these PVN neurons leading to the release of OT into the hindbrain promotes the sensitization of NTS neurons to satiety cues
such as cholecystokinin, advancing meal termination (26). The
depolarizing effect of adiponectin on PA OT neurons would suggest that adiponectin may act centrally to control meal size.
These effects would have profound consequences on feeding behavior and may contribute to the effects seen on weight loss when
adiponectin is injected intracerebroventricularly (10). The effect
of adiponectin on PA OT neurons may not be limited to alterations in feeding behavior but may be heterogeneous in nature.
Caudally projecting PA neurons have functionally diverse roles
in the autonomic nervous system (27, 28), and further experiments will be needed to examine other systems.
Intriguingly, the depolarizing effects of adiponectin on type 2
PA OT neurons are in contrast to adiponectin’s hyperpolarizing
effects on PVN OT MNC neurons (3). Although these are two
functionally and anatomically independent systems, they share
the same signaling molecule OT and apparently are differentially
modulated by adiponectin. Together, these data would indicate
that the function of adiponectin in the PVN may not be to control
the release of a specific peptide but to coordinate diverse networks of neurons that may use the same signaling molecule but
have unique targets and, thus, different effects in vivo. The effective icv dose of adiponectin was 1 nmole, a gram per body
weight value similar to that used in previous in vivo studies (10).
Assuming a 1-ml volume of cerebral spinal fluid (CSF), the calculated CSF concentration of adiponectin is 1 ␮M. Although this
concentration is larger than the 10 nM used in the in vitro current
clamp studies, enzymatic degradation and diffusion to the
presumed active site in PVN will both result in further reductions in the active concentration reaching the PVN. These
considerations suggest that our icv injections likely achieve
concentrations in PVN that are closer to the 10-nM concentration used in vitro.
Adiponectin is unlikely to cross the blood-brain barrier (29,
30), however, concentrations of the peptide have been detected
in the CSF of humans and rats (31, 32), and CSF levels have
increased upon iv injections of the peptide (10, 23). These data
prompt speculation as to the source of the adiponectin for actions
in the CNS. Recent evidence suggests that adiponectin mRNA is
Endocrinology, February 2009, 150(2):832– 840
endo.endojournals.org
839
FIG. 5. The majority of type 2 PA OT neurons are depolarized by adiponectin. A, Current clamp recording of a type 2 PA OT neuron in response to bath administration
of 10 nM adiponectin. A majority of PA OT neurons showed a depolarizing shift in membrane potential followed by a return to baseline upon removal of adiponectin
from the bath. Scale bars, 10 mV and 50 sec. B, Box and whisker summary plot of type 2 PA OT neurons and their response to adiponectin. GAD67, ␥-Amino butyric
acid 67; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; R1, receptor 1; R2, receptor 2; VGLUT, vesicular glutamate transporter; VP, vasopressin.
readily expressed in chicken and mouse brain (33, 34). Although
we cannot exclude that peripherally derived adiponectin controls the excitability of CNS structures, the case for brain-derived
adiponectin as a modulator of these systems is an attractive alternative hypothesis and may play an important role in vivo.
Our data correlating AdipoR expression with cell responsiveness confirm previous reports from our laboratory (3, 12) showing that neurons expressing AdipoR1/R2, AdipoR1 alone, or
AdipoR2 alone all respond to adiponectin. Similarly, all responding CRH neurons expressed at least one AdipoR. These
observations suggest that the response of the neuron to adiponectin may not be dictated by receptor expression but, rather, by the
ion channel(s) targets expressed by the neuron and modulated by
activation of receptor(s). Elucidation of these target ion channels
will provide more information on the intracellular signaling
mechanisms responsible for adiponectin induced neuronal
excitability.
Several PA neurons that expressed TRH or OT and responded
to adiponectin did not express mRNA for either AdipoR. However, the response to adiponectin in these neurons was maintained in TTX, suggesting an effect, independent of AdipoR activation at the cell surface of these recorded neurons. Several
possibilities could explain these observations. Leptin and ghrelin
have been shown to confer their central effects on feeding
through activation of the PVN endocannabinoid system, leptin
specifically reducing excitatory synaptic drive to PVN neurons
through an endocannabinoid-dependent fast inhibitory feedback mechanism (35, 36). Whether adiponectin also signals
through the endocannabinoid system is unknown at the current
time but could represent a receptor-independent mechanism of
signaling in these neurons. A second possibility of how adiponectin could influence these neurons is the modulation of TTX insensitive dendritic release of neuromodulatory peptides. This
system has been shown to act as an autocrine or paracrine messaging system and can modulate neuronal output within the PVN
(37). A third explanation for the unique effect of adiponectin is
the interaction with another receptor. The cell surface receptor
T cadherin has been proposed to be a third receptor for circulating adiponectin; however, it is unlikely that activation of this
receptor is responsible for the effects seen here because T cadherin preferentially binds only high-molecular or hexameric
forms of adiponectin (38). Finally, although our serial dilution
controls have shown that both receptors can be detected in dilutions of whole PVN cDNA, reflecting far less volume than a
single cell (R1, 1/10,000,000; R2, 1/10,000,000), we cannot totally exclude the possibility that AdipoRs are expressed in these
cells that our single-cell RT-PCR technology cannot detect.
In conclusion, we have shown that adiponectin, through actions at its two receptors AdipoR1 and AdipoR2, in addition to
potentially a third unique mechanism, controls the excitability of
specific groups of neurons in the parvocellular regions of the
PVN, depolarizing NE CRH, PA TRH, and PA OT neurons.
Furthermore, through in vivo studies, we have shown that when
injected centrally, adiponectin selectively controls the release of
ACTH into the plasma while having no effect on TSH release.
This study highlights the diverse central roles played by adiponectin in controlling energy homeostasis and autonomic function, and may provide insight into the pathophysiology of disrupted adiponectin signaling in diabetes and obesity.
Acknowledgments
We thank Ms. Christie Hopf for her technical assistance with the singlecell RT-PCR experiments.
Address all correspondence and requests for reprints to: Alastair
V. Ferguson, Department of Physiology, Faculty of Arts and Science
Queen’s University, Kingston, Ontario, Canada K7L 3N6. E-mail:
[email protected].
This work was supported by grants from the Heart and Stroke Foundation (to A.V.F.), National Institutes of Health (to W.K.S.), and a Canadian Institute of Health Research Doctoral Research Award (to
T.D.H.).
Disclosure Statement: The authors have nothing to disclose.
References
1. Murphy KG, Bloom SR 2006 Gut hormones and the regulation of energy
homeostasis. Nature 444:854 – 859
840
Hoyda et al.
Adiponectin Influences Parvocellular PVN Neurons
2. Ahima RS, Lazar MA 2008 Adipokines and the peripheral and neural control
of energy balance. Mol Endocrinol 22:1023–1031
3. Hoyda TD, Fry M, Ahima RS, Ferguson AV 2007 Adiponectin selectively
inhibits oxytocin neurons of the paraventricular nucleus of the hypothalamus.
J Physiol 585(Pt 3):805– 816
4. Singhal NS, Lazar MA, Ahima RS 2007 Central resistin induces hepatic insulin
resistance via neuropeptide Y. J Neurosci 27:12924 –12932
5. Powis JE, Bains JS, Ferguson AV 1998 Leptin depolarizes rat hypothalamic
paraventricular nucleus neurons. Am J Physiol 274(5 Pt 2):R14682–R1472
6. Spanswick R, Smith MA, Groppi VE, Logan SD, Ashford MLJ 1997 Leptin
inhibits hypothalamic neurons by activation of ATP-sensitive potassium channels. Nature 390:521–525
7. Hu E, Liang P, Spiegelman BM 1996 AdipoQ is a novel adipose-specific gene
dysregulated in obesity. J Biol Chem 271:10697–10703
8. Scherer PE, Williams S, Fogliano M, Baldini G, Lodish HF 1995 A novel serum
protein similar to C1q, produced exclusively in adipocytes. J Biol Chem 270:
26746 –26749
9. Kubota N, Terauchi Y, Yamauchi T, Kubota T, Moroi M, Matsui J, Eto K,
Yamashita T, Kamon J, Satoh H, Yano W, Froguel P, Nagai R, Kimura S,
Kadowaki T, Noda T 2002 Disruption of adiponectin causes insulin resistance
and neointimal formation. J Biol Chem 277:25863–25866
10. Qi Y, Takahashi N, Hileman SM, Patel HR, Berg AH, Pajvani UB, Scherer PE,
Ahima RS 2004 Adiponectin acts in the brain to decrease body weight. Nat
Med 10:524 –529
11. Yamauchi T, Kamon J, Ito Y, Tsuchida A, Yokomizo T, Kita S, Sugiyama T,
Miyagishi M, Hara K, Tsunoda M, Murakami K, Ohteki T, Uchida S,
Takekawa S, Waki H, Tsuno NH, Shibata Y, Terauchi Y, Froguel P, Tobe K,
Koyasu S, Taira K, Kitamura T, Shimizu T, Nagai R, Kadowaki T 2003
Cloning of adiponectin receptors that mediate antidiabetic metabolic effects.
Nature 423:762–769
12. Fry M, Smith PM, Hoyda TD, Duncan M, Ahima RS, Sharkey KA, Ferguson
AV 2006 Area postrema neurons are modulated by the adipocyte hormone
adiponectin. J Neurosci 26:9695–9702
13. Kubota N, Yano W, Kubota T, Yamauchi T, Itoh S, Kumagai H, Kozono H,
Takamoto I, Okamoto S, Shiuchi T, Suzuki R, Satoh H, Tsuchida A, Moroi
M, Sugi K, Noda T, Ebinuma H, Ueta Y, Kondo T, Araki E, Ezaki O, Nagai
R, Tobe K, Terauchi Y, Ueki K, Minokoshi Y, Kadowaki T 2007 Adiponectin
stimulates AMP-activated protein kinase in the hypothalamus and increases
food intake. Cell Metab 6:55– 68
14. Ferguson AV, Washburn DLS 1998 Angiotensin II: a peptidergic neurotransmitter in central autonomic pathways. Prog Neurobiol 54:169 –192
15. Swanson LW, Sawchenko PE 1980 Paraventricular nucleus: a site for the
integration of neuroendocrine and autonomic mechanisms. Neuroendocrinology 31:410 – 417
16. Luther JA, Daftary SS, Boudaba C, Gould GC, Halmos KC, Tasker JG 2002
Neurosecretory and non-neurosecretory parvocellular neurones of the hypothalamic paraventricular nucleus express distinct electrophysiological properties. J Neuroendocrinol 14:929 –932
17. Tasker JG, Dudek FE 1991 Electrophysiological properties of neurones in the
region of the paraventricular nucleus in slices of rat hypothalamus. J Physiol
(Lond) 434:271–293
18. Stern JE 2001 Electrophysiological and morphological properties of pre-autonomic neurones in the rat hypothalamic paraventricular nucleus. J Physiol
537(Pt 1):161–177
19. Antunes-Rodrigues J, McCann SM, Rogers LC, Samson WK 1985 Atrial natriuretic factor inhibits dehydration- and angiotensin II-induced water intake
in the conscious, unrestrained rat. Proc Natl Acad Sci USA 82:8720 – 8723
Endocrinology, February 2009, 150(2):832– 840
20. Harms PG, Ojeda SR 1974 A rapid and simple procedure for chronic cannulation of the rat jugular vein. J Appl Physiol 36:391–392
21. Blevins JE, Schwartz MW, Baskin DG 2004 Evidence that paraventricular
nucleus oxytocin neurons link hypothalamic leptin action to caudal brain stem
nuclei controlling meal size. Am J Physiol Regul Integr Comp Physiol 287:
R87–R96
22. Charmandari E, Tsigos C, Chrousos G 2005 Endocrinology of the stress response. Annu Rev Physiol 67:259 –284
23. Guillod-Maximin E, Roy AF, Vacher CM, Aubourg A, Bailleux V, Lorsignol
A, Penicaud L, Parquet M, Taouis M 2009 Adiponectin receptors are expressed in hypothalamus and colocalized with proopiomelanocortin and neuropeptide Y in rodent arcuate neurons. J Endocrinol 200:93–105
24. Lechan RM, Fekete C 2006 The TRH neuron: a hypothalamic integrator of
energy metabolism. Prog Brain Res 153:209 –235
25. Arancibia S, Rage F, Astier H, Tapia-Arancibia L 1996 Neuroendocrine and
autonomous mechanisms underlying thermoregulation in cold environment.
Neuroendocrinology 64:257–267
26. Blevins JE, Eakin TJ, Murphy JA, Schwartz MW, Baskin DG 2003 Oxytocin
innervation of caudal brainstem nuclei activated by cholecystokinin. Brain Res
993:30 – 41
27. Rinaman L 1998 Oxytocinergic inputs to the nucleus of the solitary tract
and dorsal motor nucleus of the vagus in neonatal rats. J Comp Neurol
399:101–109
28. Toth ZE, Gallatz K, Fodor M, Palkovits M 1999 Decussations of the descending paraventricular pathways to the brainstem and spinal cord autonomic
centers. J Comp Neurol 414:255–266
29. Spranger J, Verma S, Gohring I, Bobbert T, Seifert J, Sindler AL, Pfeiffer A,
Hileman SM, Tschop M, Banks WA 2006 Adiponectin does not cross the
blood-brain barrier but modifies cytokine expression of brain endothelial cells.
Diabetes 55:141–147
30. Pan W, Tu H, Kastin AJ 2006 Differential BBB interactions of three ingestive
peptides: obestatin, ghrelin, and adiponectin. Peptides 27:911–916
31. Kusminski CM, McTernan PG, Schraw T, Kos K, O’Hare JP, Ahima R, Kumar
S, Scherer PE 2007 Adiponectin complexes in human cerebrospinal fluid: distinct complex distribution from serum. Diabetologia 50:634 – 642
32. Kos K, Harte AL, da Silva NF, Tonchev A, Chaldakov G, James S, Snead DR,
Hoggart B, O’Hare JP, McTernan PG, Kumar S 2007 Adiponectin and resistin
in human cerebrospinal fluid and expression of adiponectin receptors in the
human hypothalamus. J Clin Endocrinol Metab 92:1129 –1136
33. Maddineni S, Metzger S, Ocon O, Hendricks III G, Ramachandran R 2005
Adiponectin gene is expressed in multiple tissues in the chicken: food deprivation influences adiponectin messenger ribonucleic acid expression. Endocrinology 146:4250 – 4256
34. Wilkinson M, Brown R, Imran SA, Ur E 2007 Adipokine gene expression in
brain and pituitary gland. Neuroendocrinology 86:191–209
35. Malcher-Lopes R, Di S, Marcheselli VS, Weng FJ, Stuart CT, Bazan NG,
Tasker JG 2006 Opposing crosstalk between leptin and glucocorticoids rapidly modulates synaptic excitation via endocannabinoid release. J Neurosci
26:6643– 6650
36. Tucci SA, Rogers EK, Korbonits M, Kirkham TC 2004 The cannabinoid CB1
receptor antagonist SR141716 blocks the orexigenic effects of intrahypothalamic ghrelin. Br J Pharmacol 143:520 –523
37. Ludwig M, Leng G 2006 Dendritic peptide release and peptide-dependent
behaviours. Nat Rev Neurosci 7:126 –136
38. Hug C, Wang J, Ahmad NS, Bogan JS, Tsao TS, Lodish HF 2004 T-cadherin
is a receptor for hexameric and high-molecular-weight forms of Acrp30/adiponectin. Proc Natl Acad Sci USA 101:10308 –10313