Journal
of General Virology (2001), 82, 1687–1693. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
Acute hepatitis caused by a novel strain of hepatitis E virus
most closely related to United States strains
Yamina Kabrane-Lazizi,1 Mingdong Zhang,1 Robert H. Purcell,1 Kirk D. Miller,2 Richard T. Davey3
and Suzanne U. Emerson1
1, 2
Hepatitis Viruses and Molecular Hepatitis Sections, Laboratory of Infectious Diseases1 and Laboratory of Immunoregulation2,
National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892, USA
3
Critical Care Medicine Department, Clinical Center, National Institutes of Health, Bethesda, MD 20892, USA
A unique hepatitis E virus (HEV) strain was identified as the aetiological agent of acute hepatitis in
a United States (US) patient who had recently returned from vacation in Thailand, a country in which
HEV is endemic. Sequence comparison showed that this HEV strain was most similar, but not
identical, to the swine and human HEV strains recovered in the US. Phylogenetic analysis revealed
that this new HEV isolate was closer to genotype 3 strains than to the genotype 1 strains common
in Asia. The fact that this HEV was closely related to strains recovered in countries where HEV is not
endemic and was highly divergent from Asian HEV strains raises the questions of where the
patient’s infection was acquired and of whether strains are geographically as localized as once
thought.
Introduction
Hepatitis E virus (HEV) is a widespread, enterically
transmitted agent that is a serious public health problem in
many countries of Asia and Africa. HEV is responsible for
epidemic and sporadic hepatitis and is often spread by faecal
contamination of drinking water (Purcell, 1996 ; Balayan, 1997).
Furthermore in these countries, antibodies to HEV have been
detected in animals such as pigs (Balayan et al., 1990 ; Clayson
et al., 1995), sheep (Usmanov et al., 1994), monkeys (Arankalle
et al., 1994) and rats (Karetnyi et al., 1993). Therefore, such
animals might be a reservoir of HEV in developing countries.
In Western Europe and the United States (US), clinical cases
of hepatitis caused by HEV are rare and most often they have
been associated with travel to areas where HEV is endemic.
However, novel strains of HEV have been isolated in the US
(Schlauder et al., 1998) and in Europe (Schlauder et al.,
1999 ; Zanetti et al., 1999) from patients without a history of
travel to regions endemic for HEV. Serological studies in
industrialized countries have shown that the prevalence of
anti-HEV antibodies is 1–6 % among blood donors (Paul et al.,
1994 ; Mast et al., 1997) and is much higher in some populations
(Zaaijer et al., 1995 ; Thomas et al., 1997). The cause of this
relatively high prevalence of anti-HEV in countries where
Author for correspondence : Suzanne Emerson.
Fax j1 301 402 0524. e-mail semerson!niaid.nih.gov
0001-7455 # 2001 SGM
clinical hepatitis E is rare is unknown. The discovery of a new
strain of HEV circulating among swine in the US (Meng et al.,
1997) and the detection of anti-HEV antibodies in rodents in
the US (Kabrane-Lazizi et al., 1999 ; Favorov et al., 2000) raise
the possibility that an animal reservoir of HEV may exist even
in developed countries.
HEV is a small, non-enveloped virus that has a positivesense, single-stranded RNA genome of approximately 7n5 kb.
The genome contains three open reading frames (ORFs) ;
ORF1 encodes the non-structural proteins, ORF2 encodes the
capsid protein and ORF3 encodes a protein of unknown
function (Reyes et al., 1993). The sequences of ORF2 and ORF3
are well conserved among HEV isolates whereas one region of
ORF1 (the hypervariable region) displays significant genetic
diversity (Tsarev et al., 1992 ; Huang et al., 1995). Four
genotypes of HEV have been identified, based on comparisons
of nearly full-length genomic sequences. In general, different
genotypes circulate within different geographical areas. Genotype 1 comprises Southeast and Central Asian isolates from
Burma, Pakistan, India and China ; genotype 2 comprises a
single Mexican isolate ; genotype 3 comprises US isolates (two
human, one swine) ; and genotype 4 comprises recently
described Chinese isolates (Wang et al., 1999, 2000).
In the present study, we identified the aetiological agent of
acute hepatitis in a US patient who had recently returned from
a vacation in Thailand. We transmitted the HEV strain from the
patient to a monkey and demonstrated that the genome
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 09:24:27
BGIH
Y. Kabrane-Lazizi and others
represented a unique HEV strain related to, but not identical to,
US isolates.
Methods
Patient history. An HIV-positive patient (W) developed acute
hepatitis 6 weeks after returning to the US from a 2 week vacation with
three companions in Thailand. One week before leaving the US, he
received one dose of killed hepatitis A virus (HAV) vaccine (HAVRIX,
SmithKlineBeecham). Serum samples were collected from patient W 2
months before he left for Thailand and during the acute phase of the
hepatitis.
Animal transmission. A rhesus monkey (Macaca mulatta) was
inoculated intravenously with 0n2 ml of the first acute phase serum
collected from patient W. Serum samples were collected weekly from the
monkey for 12 weeks post-inoculation (p.i.) and tested for anti-HEV by
ELISA and for levels of serum liver enzymes by standard methods. Faecal
samples were collected daily for HEV RNA detection by RT–PCR.
Serological tests. Serology for hepatitis A (IgG and IgM antiHAV), for hepatitis B (HBsAg, IgG and IgM anti-HBc) and for hepatitis
C (anti-HCV) were performed using commercial ELISAs (Abbott
Laboratories). The detection of antibody to HAV non-structural protein
(3C proteinase) was performed as described previously (Stewart et al.,
1997). The detection of anti-HEV antibodies (IgG and IgM) in patient and
monkey sera was performed with an in-house ELISA using as antigen a
truncated (55 kDa) recombinant HEV capsid protein expressed from
baculovirus and purified from SF-9 insect cells (Robinson et al.,
1998 ; Tsarev et al., 1993).
RT–PCR. HEV RNA was extracted from 50 µl of patient or monkey
serum with TRIzol reagent (Gibco-BRL) or from 100 µl of a 10 %
suspension of faeces with a QIAamp viral RNA kit (Qiagen). Reverse
transcription was performed with random hexamers and a GeneAmp
RT–PCR kit according to the manufacturer’s protocol (Perkin Elmer).
Detection and titration of viral RNA by RT–PCR were performed with
degenerate primers described for amplification of a conserved region in
ORF1 and in ORF2 (Wang et al., 1999). These primers were also used to
amplify the ORF1 and ORF2 regions for sequencing. Additional primers
were designed to amplify three other regions of the genome : these were
HVR external sense 5h GGTAATAARACCTTCMGSACGWCGKTKGTTG (nt 1711–1741) ; HVR external antisense 5h CGGGAGCAAGTCTCCCGGTASGCWGCCTC (nt 2684–2656) ; HVR internal sense
5h CCCAGCGSCWTTCGCTGACCGG (nt 1985–2006) ; HVR internal
antisense 5h CCCGGTASGCWGCCTCAAGCCTC (nt 2671–2649) ;
ORF1, 2, 3 external sense 5h CGAGGGTTGACAAATGTTGCG (nt
4951–4971) ; ORF1, 2, 3 external antisense 5h CGGGTTGTGAAACGACATCG (nt 5381–5362) ; ORF1, 2, 3 internal sense 5h CCGTGTTTATGGAGTTAGCCCC (nt 4995–5016) ; ORF1, 2, 3 internal antisense
5h TGAGAATCAACCCTGTCACCCC (nt 5316–5294) ; ORF2 external
sense 5h GACAGAATTRATTTCGTCGGC (nt 6322–6345 ; ORF2
external antisense oligo(dT) – ; ORF2 internal sense 5h GTTGTCT"# ")
CGGCCAATGGCGAGC (nt 6371–6392) ; ORF2 internal antisense 5h
TTTTTTTTTTTTCCAGGGAGCGCGG. Primer positions are numbered according to swine HEV GenBank AF082843. Degenerate primers
contained multiple bases at the indicated positions where R l A or G, M
l A or C, S l C or G, W l A or T and K l G or T.
For genome characterization, RT–PCR was performed on HEV RNA
extracted from patient W serum (conserved region of ORF1 and ORF2)
and from a monkey faecal sample (remaining three regions) collected
2 days before the experimentally infected monkey seroconverted to
anti-HEV. The cDNAs were synthesized with Superscript II reverse
transcriptase (Gibco-BRL).
BGII
The PCR conditions used to amplify the different regions of the
genome varied. A 100 µl PCR reaction was performed with 10 µl of
cDNA or amplification product for first and second round respectively
and 50 pmol of each external or internal primer, 2 mM MgCl and 5 U
#
Taq polymerase. For amplification of GC-rich regions, first and second
round PCR were carried out in a 50 µl reaction using an Advantage-GC
cDNA PCR kit (Clontech). All the thermal procedures were performed in
a GeneAmp PCR system (Perkin Elmer).
Sequence and phylogenetic analysis. The PCR fragments were
purified with a QIAquick gel extraction kit (Qiagen) and cloned with a
TA cloning kit (Invitrogen). Both strands were sequenced with an
automated DNA sequencer. Nucleotide and amino acid sequences were
analysed with the Sequencher 3.0 software (Gene Codes Corp.). Strains
representing the four genotypes were compared with GAP (GCG version
9.0, Genetics Computer Group, Madison, WI, USA).
The nucleotide sequences were aligned using PILEUP (GCG) and
analysed with PAUPSEARCH and PAUPDISPLAY from the PAUP
computer software (4.0) to generate phylogenetic trees. Bootstrap 50 %
majority-rule consensus trees (midpoint rooting) were obtained by
performing heuristic search (optimality criterion, maximum parsimony ;all
characters equal weight ; 1000 replicates). The consensus trees were
viewed using the TREEVIEW program.
GenBank numbers : Pakistan (SAR-55), accession no. M80581 (Tsarev
et al., 1992) ; Burma (B1and B2), accession nos M73218 and D10330 (Tam
et al., 1991) ; Mexico M1, accession no. M74506 (Huang et al., 1992) ; US1
and US2, accession nos AF060668 and AF060669 respectively,
(Schlauder et al., 1998) ; US swine, accession no. AF082843 (Meng et al.,
1998) ; Italian (It1), accession nos AF110387, AF110309 (Schlauder et al.,
1999) ; Greek, (Gr1 and Gr2), accession nos AF110388, AF110391 and
AF110389, AF110392 (Schlauder et al., 1999) ; New Chinese, accession
no. AJ272108 (Wang et al., 2000) ; New Zealand swine (NZ swine),
accession nos AF215661, AF200704 (Garbavenko et al., 2000).
Results
Patient study
Although the patient did not have symptoms of hepatitis,
his serum levels of liver enzymes were elevated [alanine
aminotransferase (ALT) 1500, aspartate aminotransferase
(AST) 500], indicating that he probably had acute hepatitis.
Commercial serological tests for hepatitis B and C were
negative. The acute phase serum was positive for antibody to
hepatitis A virus (anti-HAV), but negative for anti-HAV IgM.
Since the patient had received an inactivated HAV vaccine just
prior to his trip, it was necessary to determine if the anti-HAV
was in response to the vaccination. Current diagnostic
commercial assays for HAV detect antibodies only to structural
proteins. In natural HAV infection, antibodies against both
structural and nonstructural proteins are induced whereas
vaccination with inactivated vaccine induces antibodies only
to structural proteins (Stapleton et al., 1995). To determine if
the anti-HAV antibody was induced by active HAV infection
or by vaccination, we performed in-house ELISA for antibody
to the HAV nonstructural protein, 3C proteinase. The test for
antibody to 3C proteinase was negative, suggesting that the
antibodies detected by the commercial HAV test were induced
by the recent vaccination.
The serum collected prior to visiting Thailand was negative
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 09:24:27
Hepatitis E in a US patient
Table 1. Nucleotide and deduced amino acid sequence identity of selected HEV strains
and the W isolate
W strain
HEV strain
US1
Swine (US)
Swine (NZ)
Italian (It1)
Greek (Gr1)
Mexico (M1)
Burma (B1)
Pakistan (SAR-55)
New Chinese (S15)
Genotype
ORF1* 221
nt
ORF2* 97
nt
ORF2–3h
end 798 nt
ORF1, 2, 3
246 nt§
3
3
?‡
?‡
?‡
2
1
1
4
86 (96)†
85 (93)
87 (95)
81 (92)
78 (95)
72 (89)
71 (86)
70 (85)
73 (90)
85 (94)
90 (94)
(85) (90)
80 (94)
81 (94)
78 (90)
82 (90)
84 (90)
72 (87)
87 (84)
87 (85)



74 (79)
78 (82)
77 (81)
78 (81)
86
89



77
78
78
77
* Conserved regions.
† Percentage identity of nucleotide or amino acid (parentheses) sequences.
‡ Sequence insufficient to genotype.
§ Amino acids not compared because of reading frame overlap.
, Not available.
for anti-HEV, but the two serum samples collected 1 week
apart during the acute phase were both strongly positive for
IgG and IgM anti-HEV antibodies. HEV RNA was also
detected by RT–PCR, indicating that the acute hepatitis in
patient W was caused by HEV. The first acute phase serum was
positive for HEV sequences at dilutions of 10–& and 10–(
respectively for ORF1 and ORF2. An aliquot of this serum
specimen was inoculated into a rhesus monkey. We also tested
sera from two of the three travelling companions 10 months
after they returned from Thailand. They were negative for
anti-HEV.
Transmission study
ALT values were elevated in the inoculated monkey on day
7, 14 and 42 p.i with the peak value (188 IU\l) on day 42 p.i.
The monkey seroconverted to anti-HEV IgG and anti-HEV
IgM 3 weeks after inoculation (day 21). HEV RNA was
detected by RT–PCR in serum collected 1 week (day 14)
before seroconversion and remained detectable for 3 weeks.
The six faecal specimens collected near the time of seroconversion (between days 18 and 30 p.i) were all positive for
HEV sequences by RT–PCR : RNA from the faecal specimen
collected 2 days before seroconversion was further characterized.
Sequence analysis of conserved regions in ORF1 and
ORF2
The PCR products corresponding to the most conserved
regions in ORF1 and in ORF2, respectively, were sequenced
since these regions have been frequently used for the
identification of new strains.
The comparison of the ORF1 nucleotide sequence amplified
from patient serum indicated that the HEV strain recovered
from patient W was most closely related to swine and human
strains recovered in the US (85–86 % identity) and to the swine
strain recovered in New Zealand (87 % identity) (Table 1). The
sequence identities between the W isolate and the European
HEV strains were lower (78–81 %). The nucleotide sequence of
the W isolate was significantly divergent from those of the
Asian, New Chinese and Mexican isolates (70–73 % identity).
The amino acid sequence comparisons also showed more
identity between the W isolate and HEV strains from the US
and European groups (92–96 %), compared to that observed
with the Asian group (85–86 %) or with the Mexican isolate
(89 %). However, the W isolate also had high amino acid
identities with NZ swine (95 %) and the New Chinese isolate
(90 %).
In ORF2, the nucleotide identity between the W isolate and
US strains (85–90 %) was also higher than that observed with
the Asian or European HEV strains (80–84 %) or with the
Mexican strain (78 %). The lowest identity (72 %) in this case
was with the New Chinese strain. The W isolate shared 94 %
amino acid identity with the US and European groups across
this region and approximately 90 % identity with all other
strains examined except for the New Chinese (87 % identity).
We confirmed these data by analysing the sequence of the
same regions amplified from stools collected from the infected
monkey.
Sequence analysis of the 3h portion of the genome
Approximately 800 bp of the 3h terminus of ORF2 was
amplified from the monkey faecal sample. The HEV strain from
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 09:24:27
BGIJ
Y. Kabrane-Lazizi and others
Fig. 1. Nucleotide sequence alignment of
the hypervariable region in ORF1 from
the W, US swine and US1 isolates
compared to the consensus sequence of
17 HEV strains. The nucleotide positions
are based on the US swine HEV
sequence. Cons, consensus sequence
(Erker et al., 1999) ; –, nucleotide
identity ; , nucleotide insertion ; *,
nucleotide deletion ; shaded region,
poly(C) tract.
patient W shared approximately 87 % nucleotide identity with
the US strains (swine and human) within this region and only
74–78 % with the Mexican, Asian and New Chinese strains
(Table 1). The amino acid sequence comparisons also showed
more identity between the patient W strain and the US strains,
84–85 % versus 81–82 % with the Asian strains and 79 % with
the Mexican strain.
We also amplified about 250 nt encompassing a portion of
ORF1 and the region of ORF2\ORF3 overlap, and compared
its sequence with the sequences available for other HEV
strains. The nucleotide identities found with swine and human
US strains (86–89 %) were 9–12 % higher than with the
genotype 1, 2 or 4 strains (Table 1). As in the US isolates, the
W strain had a deletion of 3 nt just downstream of the ORF3
initiation codon (data not shown). The amino acid sequences
within this region were not compared because all three reading
frames were utilized.
Sequence analysis of the hypervariable region in
ORF1
Because the HVR in ORF1 (between nt 2011 and 2325)
distinguishes between very closely related strains (Tsarev et al.,
1992), we amplified and analysed a fragment of 555 nt in this
region. The estimated nucleotide identity between the homologous regions of the W strain and the US strains (US1 and
swine) or the Pakistani, Burmese, Mexican and genotype 4
isolates was approximately 82 % and 59–61 %, respectively
(data not shown). We also compared a portion of the HVR
sequence of strain W to that of the swine and US1 strains and
to a consensus sequence of 17 strains (Fig. 1). The HVR of US
BGJA
human and swine strains has 42–45 nt more than do all the
Asian strains and 33–36 nt more than does the Mexican strain
(Meng et al., 1998). The W strain also had additional
nucleotides in this region but it had only 30 extra nucleotides
compared to the Asian strains since it did not have the poly(C)
tract characteristic of the US strains (Fig. 1). The New Chinese
strain had a similar number of additional nucleotides as did the
US strain in this region but lacked the poly(C) tract (data not
shown). Because of the high level of diversity and the difference
in lengths of the HVR, the exact positions of the 30 extra
nucleotides could not be defined relative to the other strains.
Phylogenetic analysis
Phylogenetic analyses of nucleotide sequences were performed to determine more precisely the relationship between
the W isolate and other HEV strains. The sequences of the
conserved regions of ORF1 and of ORF2 were compared with
those of the homologous regions from 18 human and swine
isolates. Phylogenetic trees based on alignment of the ORF1
sequence suggested that the W isolate was closer to the NZ
swine, US and European HEV strains than to the Asian strains
of genotype 1, which were all located at the other end of the
tree (Fig. 2 A). The New Chinese isolate of genotype 4 was
more closely related to the W strain than were the other strains
isolated in Asia. A similar tree generated for the ORF2
fragment indicated that all of the US, European and NZ strains
now grouped more closely with the W isolate and the Asian
strains were closer to the W strain than was either the Chinese
genotype 4 isolate or the Mexican genotype 2 strain (Fig. 2 B).
The topology of the tree obtained with either the 3h-
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 09:24:27
Hepatitis E in a US patient
Fig. 2. Phylogenetic trees generated from (A) 221 nt of the conserved region in ORF1, (B) 97 nt of the conserved region in
ORF2, (C) 798 nt at the 3h end of ORF2 and (D) 246 nt of the ORF1, 2, 3 overlap region. Branch lengths are proportional to
genetic distance. Bootstrap values for the different branches are shown as percentages of trees obtained from 1000 replicates
of the data.
terminal sequence of ORF2 (Fig. 2 C) or the overlap region (Fig.
2 D) was similar to that obtained with ORF1 sequence in that
the W isolate was more closely related to the US strains than
to the Asian or Mexican strains. In both cases, the Chinese
genotype 4 isolate again formed a distinct branch and was less
distant than were the Asian strains (Fig. 2 C, D).
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 09:24:27
BGJB
Y. Kabrane-Lazizi and others
Discussion
A novel isolate of HEV was identified in a US patient (W)
who had travelled in Thailand. Since HEV is endemic in
Thailand, it was thought that the patient probably was infected
with HEV in that country. However, the incubation period
until onset of disease varies between approximately 4 and 6
weeks so the patient could have been infected either in
Thailand or following his return to the US. Nucleotide
sequence comparisons from four different regions of the
genome all suggested that the HEV strain recovered from
patient W was phylogenetically distinct from the genotype 1
or 4 HEV strains commonly isolated in Asia and that it was
more closely related to strains of US genotype 3 (Fig. 2 and
Table 1). The ORF1 sequence amplified from serum of patient
W shared the highest degree of amino acid identity with the
US1 isolate, followed closely by the NZ swine HEV and Greek
isolates (Table 1). The NZ swine and Greek sequences were not
available for the ORF2–3h region but this region showed
higher amino acid identity with the US strains than with the
Mexican, Burmese, Pakistani or New Chinese strains. The
amino acid sequence analysis of the conserved region in ORF2
showed less distinction among the isolates, probably because
the amplified sequence compared in ORF2 was only 97 nt and
was from a highly conserved region. Thus, in all three genomic
regions compared, the amino acid sequence of the W isolate
was most closely related to that of strains recovered from areas
where HEV is not endemic in the human population.
To define further the relationship between the W isolate
and US isolates, we sequenced and analysed the HVR in ORF1.
Very low nucleotide or amino acid identities within the HVR
have been observed between geographically distant HEV
strains. For instance, the US isolates are approximately 85 %
identical to each other but only 42 % identical to the Pakistani
strain, 39 % identical to the Burmese strain and 32 % identical
to the Mexican strain in this region (Erker et al., 1999).
Furthermore, within this region, US isolates from humans and
from swine contain many nucleotide insertions and a unique
poly(C) tract, when compared to other strains. The W isolate
was similar to the US strains in having many insertions but
differed from them by lacking this characteristic poly(C) tract :
otherwise the HVR nucleotide sequences were quite similar
with an identity of 82 % (data not shown). The W strain
additionally had a 3 nt deletion in ORF3 as do US strains but
not Asian strains (Meng et al., 1998 ; Erker et al., 1999).
Comparison of the HVR of strain W with those of the
Pakistani, the Burmese and the New Chinese strains showed
lower nucleotide identities (59–61 %), consistent with the
results of nucleotide comparisons based on conserved regions
of ORF1 and ORF2. Therefore, the W strain shared some
unique features and considerable homology with the US
strains. However, its genotype cannot be assigned until more
sequence, preferably that of the entire genome, is obtained.
Originally, all HEV strains from Southeast and Central Asia
BGJC
were classified as genotype 1 but recently another group of
viruses from China was found to constitute a new genotype,
genotype 4. The only strain isolated from Mexico is of
genotype 2 although a new Nigerian strain is more closely
related to the Mexican strain than to other HEV strains
(Buisson et al., 2000). All these strains were isolated in areas
where hepatitis E is endemic or epidemic. In contrast, the
viruses isolated in the US, where hepatitis E is rare, form
another branch of the phylogenetic tree and constitute
genotype 3.
Additional isolates of HEV are being identified at a rapid
rate. North African HEV isolates cluster with the Asian strains
and constitute what appears to be a separate subtype within
genotype 1 (Tsarev et al., 1999). Unique isolates from other
countries have been assigned by their discoverers to genotype
4 (Hsieh et al., 1998) or to new genotypes 5–8 (Schlauder et al.,
1999, 2000). However, only very limited sequence data
( 400 nucleotides) are available for these latter strains and, as
shown by the data in Fig. 2 and Table 1, different degrees of
relatedness are predicted when different regions are compared.
For instance, the New Chinese strain was closer or more distant
to the W strain than were the Asian strains depending on the
region. Therefore, until more sequence data are obtained and a
consensus is reached on what defines a genotype, these strains,
as well as the W strain, are best considered as unclassified.
The fact that the new HEV isolate described in this study
was more closely related to the US and European strains than
to the Asian strains raises the questions of the origin of this
infection in the patient and of the distribution of HEV strains
worldwide. Indeed, the report of an isolation of a US\
European-like HEV from swine in NZ suggests that the
apparent localization of a particular genotype to a defined
geographical region may not be as stringent as previously
thought. Thus, the true geographical origin of the patient W
HEV isolate remains obscure.
References
Arankalle, V. A., Goverdhan, M. K. & Banerjee, K. (1994). Antibodies
against hepatitis E virus in Old World monkeys. Journal of Viral Hepatitis
1, 125–129.
Balayan, M. S. (1997). Epidemiology of hepatitis E virus infection.
Journal of Viral Hepatitis 4, 155–165.
Balayan, M. S., Usmanov, R. K., Zamiatina, N. A., Dzhumalieva, D. I. &
Karas, F. R. (1990). Experimental hepatitis E in domestic piglets. Journal
of Medical Virology 32, 58–59.
Buisson, Y., Grandadam, M., Nicand, E., Cheval, P., van Cuyck-Gandre,
H., Innis, B. L., Rehel, P., Coursaget, P., Teyssou, R. & Tsarev, S.
(2000). Identification of a novel hepatitis E virus in Nigeria. Journal of
General Virology 81, 903–909.
Clayson, E. T., Innis, B. L., Myint, K. S., Naraputi, S., Vaughn, D. W.,
Giri, S., Ranabhat, P. & Shrestha, M. P. (1995). Detection of hepatitis
E infection in domestic swine in Kathmandu Valley in Nepal. American
Journal of Tropical Medicine and Hygiene 53, 228–232.
Erker, J. C., Desai, S. M., Schlauder, G. G., Dawson, G. J. & Mushahwar,
I. K. (1999). A hepatitis E variant from the United States : molecular
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 09:24:27
Hepatitis E in a US patient
characterization and transmission in cynomolgus macaques. Journal of
General Virology 80, 681–690.
Favorov, M. O., Kosoy, M. Y., Tsarev, S. A., Childs, J. E. & Margolis,
H. S. (2000). Prevalence of antibody to hepatitis E virus among rodents
in the United States. Journal of Infectious Diseases 181, 449–455.
Garbavenko, O., Anderson, D., Shroeder, B. & Croxson, C. (2000).
Evidence of swine hepatitis E virus in New Zealand. 10th International
Symposium on Viral Hepatitis and Liver Disease, Atlanta, USA, April 9–13,
abstract E016.
Hsieh, S. Y., Yang, P. Y., Ho, Y. P., Chu, C. M. & Liaw, Y. F. (1998).
Identification of a novel strain of hepatitis E virus responsible for sporadic
acute hepatitis in Taiwan. Journal of Medical Virology 55, 300–304.
Huang, C. C., Nguyen, D., Fernandez, J., Yun, K. Y., Fry, K. E., Bradley,
D. W., Tam, A. W. & Reyes, G. R. (1992). Molecular cloning and
sequencing of the Mexico isolate of hepatitis E virus. Virology 191,
550–558.
Huang, R. T., Nakazono, N., Ishii, K., Kawamata, O., Kawaguchi, R. &
Tsukada, Y. (1995). II. Existing variations on the gene structure of
hepatitis E virus strains from some regions of China. Journal of Medical
Virology 47, 303–308.
Kabrane-Lazizi, Y., Fine, J. B., Glass, G. E., Higa, H., Diwan, A., Gibbs,
C. J., Meng, X.-J., Emerson, S. U. & Purcell, R. H. (1999). Evidence of
wide spread infection of wild rats with hepatitis E virus in the United
States. American Journal of Tropical Medicine and Hygiene 61, 331–335.
Karetnyi, Y. V., Dzhumalieva, D. I., Usmanov, R. K., Titova, I. P.,
Lituak, Y. A. & Balayan, M. S. (1993). Possible involvement of rodents
in the spread of hepatitis E (in Russian). Journal of Microbiology
Epidemiology and Immunology 41, 52–56.
Mast, E. E., Kuramoto, I. K., Favorov, M. O., Shoening, V. R.,
Burkholder, B. T., Shapiro, C. N. & Holland, P. V. (1997). Prevalence of
and risk factors for antibody to hepatitis E virus seroreactivity among
bloods donors in northern California. Journal of Infectious Diseases 176,
34–40.
Meng, X.-J., Purcell, R. H., Halbur, P. G., Lehman, J. R., Webb, D. M.,
Tsareva, T. S., Haynes, J. S., Thacker, B. J. & Emerson, S. U. (1997). A
novel virus in swine is closely related to the human hepatitis E virus.
Proceedings of the National Academy of Sciences, USA 94, 9860–9865.
Meng, X.-J., Halbur, P. G., Shapiro, M. S., Govindarajan, S., Bruna,
J. D., Mushahwar, I. K., Purcell, R. H. & Emerson, S. U. (1998). Genetic
and experimental evidence for cross-species infection by swine hepatitis
E virus. Journal of Virology 72, 9714–9721.
Paul, D. A., Knigge, M. F., Ritter, A., Gutierrez, R., Pilot-Matias, T.,
Chau, K. H. & Dawson, G. J. (1994). Determination of hepatitis E
seroprevalence by using recombinant fusion protein and synthetic
peptides. Journal of Infectious Diseases 169, 801–806.
Purcell, R. H. (1996). Hepatitis E virus. In Fields Virology, 3rd edn, vol.
2, pp. 2831–2843. Edited by B. N. Fields, D. M. Knipe & P. M. Howley.
Philadelphia : Lippincott–Raven.
Reyes, G. R., Huang, C. C., Tam, A. W. & Purdy, M. A. (1993). Molecular
organization and replication of hepatitis E virus (HEV). Archives of
Virology 7, 15–29.
Robinson, R. A., Burgess, W. H., Emerson, S. U., Leibowitz, R. S.,
Sosnovtseva, S. A., Tsarev, S. & Purcell, R. H. (1998). Structural
characterization of recombinant hepatitis E virus ORF2 proteins in
baculovirus-infected insect cells. Protein Expression and Purification 12,
75–84.
Schlauder, G. G., Dawson, G. J., Erker, J. C., Kwo, P. Y., Knigge, M. F.,
Smalley, D. L., Rosenblatt, J. E., Desai, S. M. & Mushahwar, I. K.
(1998). The sequence and phylogenetic analysis of a novel hepatitis E
virus isolated from a patient with acute hepatitis reported in the United
States. Journal of General Virology 79, 449–456.
Schlauder, G. G., Desai, S. M., Zanetti, A. R., Tassopoulos, N. C. &
Mushahwar, I. K. (1999). Novel hepatitis E virus (HEV) isolates from
Europe : evidence for additional genotypes of HEV. Journal of Medical
Virology 57, 243–251.
Schlauder, G. G., Frider, B., Sookoian, S., Castano, G. C. & Mushahwar,
I. K. (2000). Identification of 2 novel isolates of hepatitis E virus in
Argentina. Journal of Infectious Diseases 182, 294–297.
Stapleton, J. T. (1995). Host immune response to hepatitis A virus.
Journal of Infectious Diseases 171(Suppl. 1), 9–14.
Stewart, D. R., Morris, T. S., Purcell, R. H. & Emerson, S. U. (1997).
Detection of antibodies to the nonstructural 3C proteinase of hepatitis A
virus. Journal of Infectious Diseases 176, 593–601.
Tam, A. W., Smith, M. M., Guerra, M. E., Huang, C. C., Bradley, D. W.,
Fry, K. E. & Reyes, G. R. (1991). Hepatitis E virus (HEV) : molecular
cloning and sequencing of the full-length viral genome. Virology 185,
120–131.
Thomas, D. L., Yarbough, G. H., Vlahov, D., Tsarev, S. A., Nelson,
K. E., Saah, A. J. & Purcell, R. H. (1997). Seroreactivity to hepatitis E
virus in areas where the disease is not endemic. Journal of Clinical
Microbiology 35, 1244–1247.
Tsarev, S. A., Emerson, S. U., Reyes, G. R., Tsareva, T. S., Legters,
L. J., Malik, I. A, Iqbal, M. & Purcell, R. H. (1992). Characterization of
a prototype strain of hepatitis E virus. Proceedings of the National Academy
of Sciences, USA 89, 559–563.
Tsarev, S. A., Tsareva, T. S., Emerson, S. U., Kapikian, A. Z., Ticehurst,
J., London, W. & Purcell, R. H. (1993). ELISA for antibody to hepatitis
E virus (HEV) based on complete open-reading frame 2 protein expressed
in insect cells : identification of HEV infection in primates. Journal of
Infectious Diseases 168, 369–378.
Tsarev, S. A., Binn, L. N., Gomatos, P. J., Arthur, R. R., Monier, M. K.,
van Cuyck-Gandre, H., Longer, C. F. & Innis, B. L. (1999). Phylogenetic
analysis of hepatitis E virus isolates from Egypt. Journal of Medical
Virology 57, 68–74.
Usmanov, R. K., Balayan, M. S., Dvoinikova, O. V., Alynbayeva, D. B.,
Zamayatina, N. A., Kazachkov, Y. A. & Belov, V. I. (1994). Experimental
hepatitis E infection in lambs. Voprosy Virusologii 39, 165–168.
Wang, Y., Ling, R., Erker, J. C., Zhang, H., Li, H., Desai, S. M.,
Mushahwar, I. K. & Harrison, T. J. (1999). A divergent genotype of
hepatitis E virus in Chinese patients with acute hepatitis. Journal of General
Virology 80, 169–177.
Wang, Y., Zhang, H., Ling, R., Li, H. & Harrison, T. J. (2000). The
complete sequence of hepatitis E virus genotype 4 reveals an alternative
strategy for translation of open reading frames 2 and 3. Journal of General
Virology 81, 1675–1686.
Zaaijer, H. L., Mauser-Bunschoten, E. P., ten Veen, J. H., Kapprell,
H. P., Kok, M., van den Berg, H. M. & Lelie, P. N. (1995). Hepatitis E
virus antibodies among patients with hemophilia, blood donors, and
hepatitis patients. Journal of Medical Virology 46, 244–246.
Zanetti, A. R., Schlauder, G. G., Romano, L., Tanzi, E., Fabris, P.,
Dawson, G. J. & Mushahwar, I. K. (1999). Identification of a novel
variant of hepatitis E virus in Italy. Journal of Medical Virology 57,
356–360.
Received 4 October 2000 ; Accepted 14 March 2001
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 09:24:27
BGJD