This information is current as
of June 17, 2017.
Mismatch Repair Proteins and AID Activity
Are Required for the Dominant Negative
Function of C-Terminally Deleted AID in
Class Switching
Anna J. Ucher, Sanjay Ranjit, Tatenda Kadungure, Erin K.
Linehan, Lyne Khair, Elaine Xie, Jennifer Limauro,
Katherina S. Rauch, Carol E. Schrader and Janet Stavnezer
References
Subscription
Permissions
Email Alerts
This article cites 63 articles, 32 of which you can access for free at:
http://www.jimmunol.org/content/193/3/1440.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2014 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
J Immunol 2014; 193:1440-1450; Prepublished online 27
June 2014;
doi: 10.4049/jimmunol.1400365
http://www.jimmunol.org/content/193/3/1440
The Journal of Immunology
Mismatch Repair Proteins and AID Activity Are Required for
the Dominant Negative Function of C-Terminally Deleted
AID in Class Switching
Anna J. Ucher, Sanjay Ranjit, Tatenda Kadungure, Erin K. Linehan, Lyne Khair,
Elaine Xie,1 Jennifer Limauro,2 Katherina S. Rauch,3 Carol E. Schrader, and
Janet Stavnezer
A
ctivation-induced cytidine deaminase (AID) initiates Ab
gene diversification after immunization or infection by
deamination of cytosines in Ig S regions, leading to
double-strand breaks (DSBs) and class-switch recombination (CSR),
as well as in recombined V(D)J gene segments, leading to somatic
hypermutation (SHM) (1–4). It has been known for several years
that the C terminus of AID is required for CSR, although it does not
appear to have a role during SHM of Ab genes (5–7). Some hyper-
Department of Microbiology and Physiological Systems, University of Massachusetts
Medical School, Worcester, MA 01655
1
Current address: Queen’s University Medical School, Kingston, Ontario, Canada.
2
Current address: Steritech, Charlotte, NC.
3
Current address: Center for Chronic Immunodeficiency, University Medical Center
Freiberg, University of Freiburg, Freiburg, Germany.
Received for publication February 7, 2014. Accepted for publication June 3, 2014.
This work was supported by National Institute of Allergy and Infectious Diseases
Grants R01 AI023283 and R21 AI099988 (to J.S.) and R03 AI092528 (to C.E.S.).
J.L. and E.X. were supported by the Summer Undergraduate Research Experience
fellowship program, funded by the University of Massachusetts Medical School.
The content is solely the responsibility of the authors and does not necessarily
represent the official views of the National Institutes of Health.
Address correspondence and reprint requests to Dr. Janet Stavnezer, Department of
Microbiology and Physiological Systems, University of Massachusetts Medical
School, AS8-1053, 368 Plantation Street, Worcester, MA 01655. E-mail address:
[email protected]
Abbreviations used in this article: AID, activation-induced cytidine deaminase;
DAID, activation-induced cytidine deaminase lacking the C terminus; APE1/2,
apurinic/apyrimidinic endonuclease 1 and 2; ChIP, chromatin immunoprecipitation;
CSR, class-switch recombination; DN, dominant negative; DSB, double-strand
break; dU, deoxyuridine; ER, estrogen receptor; HIGM, hyper-IgM; LM-PCR,
ligation-mediated PCR; MFI, mean fluorescence intensity; MH, microhomology;
MMR, mismatch repair; MutSa, Msh2-Msh6; NHEJ, nonhomologous end joining;
RV, retroviral; SHM, somatic hypermutation; SSB, single-strand break; T4 Pol, T4
DNA polymerase; UNG, uracil-N-glycosylase; WT, wild-type.
Copyright Ó 2014 by The American Association of Immunologists, Inc. 0022-1767/14/$16.00
www.jimmunol.org/cgi/doi/10.4049/jimmunol.1400365
IgM (HIGM) human patients, who cannot undergo CSR, are heterozygous for mutant AID proteins lacking 8 or more amino acids
at the C terminus of AID (DAID), indicating that DAID is a dominant negative (DN) mutant (5, 8). Although it is not known why
DAID is a DN mutant, some data suggest that AID functions as
a dimer or tetramer (5, 9–12) and that perhaps the full-length AID
and DAID heterodimerize and fail to perform a function or fail to
interact with a protein essential for CSR (5). However, dimerization
of full-length AID and DAID would not explain the very low level
of CSR in human HIGM patients because both proteins are likely
to be induced simultaneously; therefore, some dimers of full-length
AID should be present.
Mouse and human AID have a deaminase domain between aa 56
and 94, a C-terminal domain reported to be required for CSR, but
not for SHM, between aa 182 and 198 (2, 5–7), and a nuclear export
signal also located at the C terminus between aa 190 and 198 (13,
14). AID predominantly resides in the cytoplasm, and nuclear AID
undergoes rapid ubiquitin-mediated proteasomal degradation,
causing the half-life of nuclear AID to be three times shorter than
that of cytoplasmic AID (15). However, nuclear export is not required for CSR, because mouse AIDF198A is not exported from
nuclei, and yet CSR and SHM are only modestly reduced in cells
expressing this mutant (14). Also, some C terminus substitution
mutants that retain a functional nuclear export signal cannot potentiate CSR (16).
A relevant difference between CSR and SHM is that the latter
does not require DSBs or recombination. During CSR, the deoxyuridines (dUs) in S regions generated by AID are converted into
DSBs in the donor (Sm) and acceptor Sx regions (17). The dU
bases are excised by uracil-N-glycosylase (UNG), and UNG deficiency causes a dramatic reduction in S-region DSBs and CSR
(18–20). Apurinic/apyrimidinic endonuclease 1 and 2 (APE1/2)
can nick the abasic sites generated by UNG and are important
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Activation-induced cytidine deaminase (AID) is essential for class-switch recombination (CSR) and somatic hypermutation (SHM)
of Ig genes. The AID C terminus is required for CSR, but not for S-region DNA double-strand breaks (DSBs) during CSR, and it is
not required for SHM. AID lacking the C terminus (DAID) is a dominant negative (DN) mutant, because human patients
heterozygous for this mutant fail to undergo CSR. In agreement, we show that DAID is a DN mutant when expressed in AIDsufficient mouse splenic B cells. To have DN function, DAID must have deaminase activity, suggesting that its ability to induce
DSBs is important for the DN function. Supporting this hypothesis, Msh2-Msh6 have been shown to contribute to DSB formation
in S regions, and we find in this study that Msh2 is required for the DN activity, because DAID is not a DN mutant in msh22/2
cells. Our results suggest that the DNA DSBs induced by DAID are unable to participate in CSR and might interfere with the
ability of full-length AID to participate in CSR. We propose that DAID is impaired in its ability to recruit nonhomologous end
joining repair factors, resulting in accumulation of DSBs that undergo aberrant resection. Supporting this hypothesis, we find that
the S–S junctions induced by DAID have longer microhomologies than do those induced by full-length AID. In addition, our data
suggest that AID binds Sm regions in vivo as a monomer. The Journal of Immunology, 2014, 193: 1440–1450.
The Journal of Immunology
Msh2. Our results suggest that the DN function depends upon the
ability of DAID to bind Sm and to induce DSBs in S regions, as well
as indicate that DAID-induced DSBs are not recombined by NHEJ.
It is possible that the inability of these DSBs to recombine by NHEJ
results in inefficient S–S recombination and generation of aberrantly
resected DSBs that interfere with the ability of full-length AID to
induce normal DSBs that can be recombined properly during CSR.
Materials and Methods
Mice
Mice were extensively (at least eight generations) backcrossed to C57BL/6
mice. AID-deficient mice were obtained from T. Honjo (Kyoto University,
Kyoto, Japan) (1). Msh2-deficient mice were obtained from T. Mak
(University of Toronto, Toronto, ON, Canada) (41). Mlh1-deficient mice
were obtained from R.M. Liskay (Oregon Health Sciences University,
Portland, OR) (42). UNG-deficient mice were obtained from D. Barnes and
T. Lindahl (London Research Institute, London, U.K.) (43). Msh6-deficient
mice were obtained from W. Edelmann (Albert Einstein Medical College,
New York, NY) (44). For each experiment, splenic B cells were isolated
from littermates. Mice were housed in the Institutional Animal Care and
Use Committee–approved specific pathogen-free facility at the University
of Massachusetts Medical School; mice were used according to the
guidelines from University of Massachusetts Medical School Institutional
Animal Care and Use Committee.
Abs
Abs to ER (sc-8002X), GAPDH (sc-25778), Grb2 (sc-255), and Msh6 (sc10798) were purchased from Santa Cruz, and Ab to lamin A/C was from
Cell Signaling (#2032). Rabbit Abs to mouse AID (20) and UNG (23) were
described previously. For ChIP experiments using untagged AID, we used
rabbit AID Ab provided by J. Chaudhuri (The Rockefeller University, New
York, NY) (10).
Production of retroviruses in Phoenix-E cells
pMX-PIE-AID-FLAG-ER-IRES-GFP-puro and pMX-PIE-DAID-FLAG-ERIRES-GFP-puro (7) were received from Dr. V. Barreto and Dr. M. Nussenzweig
(The Rockefeller University). The control retrovirus pMX-PIE-ER-IRESGFP was constructed, and viruses were prepared as previously described
(25). To create the DAIDH56R/E58Q and AIDH56R/E58Q mutants, the AID-ER
gene was subcloned into Bluescript (Stratagene), mutated using QuikChange (Stratagene), sequenced, and then reinserted into pMX-PIE.
pMIG-AID and pMIG (45) were provided by J. Chaudhuri. pMIG-DAID
was created by converting amino acid position 189 to a nonsense codon.
ChIP
Live cells were isolated by flotation on Lympholyte M (CEDARLANE,
Burlington, ON, Canada) 24 h after RV transduction. After recovery and
washing twice, ∼2 3 107 live cells were resuspended in balanced salt solution and cross-linked with formaldehyde at a final concentration of 1% for
5 min at 37˚C. Cross-linking was stopped by adjustment to 125 mM glycine
and incubation for 5 min at room temperature. Cross-linked cells were intermittently sonicated at 4˚C for a total of 22.5 min. Samples were filtered
through glass wool. A total of 2 3 106 cell equivalents was incubated
overnight with Ab at 4˚C. On the following day, Protein G or Protein A
Dynabeads (Invitrogen) were added to the samples and incubated for 2 h at
4˚C. The beads were washed five times for 10 min, and reverse cross-linking
was performed at 65˚C in the presence of RNase A. The samples were
treated with Proteinase K at 55˚C, and DNA was recovered using phenolchloroform extraction, followed by ethanol precipitation. ChIP results were
assayed by real-time PCR using SYBR Green. Significance was calculated
by a paired two-tailed t test. Primers for Sm were forward primer DK99: 59AACTAGGCTGGCTTAACCGAGATG-39 and reverse primer DK100: 59GTCCAGTGTAGGCAGTAGAGTTTA-39. Primers for mb-1/CD79a were
mb-1FW: 59-CCACGCACTAGAGAGAGACTCAA-39 and mb-1REV: 59-CCGCCTCACTTCCTGTTCAGCCG-39. Primers for Cm were forward primer
CuPG-F: 59-TCTGACAGGAGGCAAGAAGACAGATTCTTA-39 and reverse
primer CuPG-R: 59-GCCACCAGATTCTTATCAGACAGGGG-39 (46), with
the exception of the experiment shown in Fig. 5C, in which previously described Cm primers were used (25).
B cell purification and cultures
Mouse splenic B cells were isolated by T cell depletion with Ab and
complement (21). B cells were cultured at 105 cells/ml. LPS (25 mg/ml)
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
for creating S-region DSBs during CSR (21). When the singlestrand breaks (SSBs) created by APE activity on opposite DNA
strands within Sm are sufficiently near, they can form a DSB,
which can recombine with a DSB in a downstream S region. When
the SSBs created by AID-UNG-APE activities are too far apart to
spontaneously form a DSB, mismatch repair (MMR) proteins are
thought to convert these distal SSBs into DSBs during CSR, and
S-region DSBs are decreased by 50–80% in MMR-deficient B cells
(17, 22–24). The DSBs in two different S regions are recombined
by nonhomologous end joining (NHEJ), resulting in CSR.
Retrovirally transduced AID tagged at the C terminus with the
estrogen receptor (ER) binds to S regions, as assayed by chromatin
immunoprecipitation (ChIP) in aid2/2 splenic B cells (25). In that
study (25), we reported that DAID associated poorly with S-region
DNA. However, our current ChIP results, now obtained many
times, show that DAID associates with Sm, as well as full-length
AID. We cannot repeat the previous result and do not understand
the basis of this discrepancy; we published a correction (26). All
other results reported previously are reproducible. The new finding that DAID binds Sm is in better agreement with the fact that
DAID is competent for introducing mutations and DSBs at the Sm
and Sg3 regions (7, 25, 27, 28).
DAID-ER introduces as many mutations in unrearranged
(germline) Sm in B cells induced to undergo CSR as does AID-ER
(7); thus, DAID can produce the DNA substrate for UNG and
Msh2-Msh6 (MutSa). However, these repair proteins bind poorly
to Sm in cells expressing DAID, indicating the importance of the C
terminus for their binding (25, 29). Consistent with the dependence on the C terminus for the binding of UNG, there is an increase in the proportion of transition mutations at G:C bp in the
Sm region in cells expressing DAID, as expected if UNG does not
readily access the mutations (7). CSR is reduced 2–3-fold in
Msh2- or Msh6-deficient B cells relative to MutSa-sufficient cells
(30–33), and this effect is reproduced in our retroviral (RV) system
when full-length RV-AID is expressed in Msh2- or Msh6-deficient
aid2/2 B cells (25). However, when DAID is expressed, the small
amount of CSR induced (∼10% of full-length AID) is not reduced
further in MutSa-deficient cells. This indicates that MMR does not
contribute to CSR efficiency in cells expressing DAID, consistent
with the poor binding of Msh2 and Msh6 to Sm in cells expressing
DAID (25).
It is not understood why the AID C terminus is required for
CSR, nor is it understood how its deletion creates a DN mutation.
Aid2/2 B cells transduced with DAID-ER have S-region DSBs
(25, 27), indicating that the AID C terminus is important for
events after DSB formation. However, it is possible that S-region
DSBs are aberrantly processed and/or inefficiently introduced in cells
expressing DAID and that they accumulate as a result of lack of
repair and/or inefficient S–S recombination. Thus, the C terminus
might be required for recruiting proteins involved in producing
nonresected DSBs that are appropriate for NHEJ and/or for recruiting proteins involved in the end-joining process itself, as
previously suggested (29, 34, 35). If AID functions as a dimer, it is
possible that a heterodimer of AID and DAID cannot recruit these
proteins. Numerous proteins were demonstrated to associate with
AID (36), and several require the AID C terminus for their association (14, 37, 38). These proteins were shown to help export
AID from the nucleus (14, 39), help maintain it in the cytoplasm
(38), or help recruit AID to S regions (37, 40).
In this article, we show that the DN function of DAID observed
in humans is also found in mouse B cells, and we also show that
DAID lacking deaminase activity does not have DN function and
does not associate stably with Sm in aid+/+ cells. We also find that
the DN phenotype of DAID depends upon the MMR protein
1441
1442
THE DOMINANT NEGATIVE EFFECT OF AID C TERMINUS DELETION
and anti-IgD dextran (0.3 ng/ml; Fina Biosolutions), with or without IL-4
(20 ng/ml), were used to induce CSR to IgG1 and IgG3, respectively.
Human BLyS/BAFF (50 ng/ml; Human Genome Sciences) was included in
all cultures. RV infection and assay of CSR by FACS was performed as
previously described (25). Briefly, cells were activated for 2 d and then
infected. One day later, they were harvested for all experiments. The one
exception is noted in the Results. Statistical differences in CSR between
different cultures were determined by a two-tailed t test.
Western blotting
Preparation of extracts and Western blots was described previously (21).
RT-PCR
Ligation-mediated PCR
After culture for 2 d, viable cells were isolated by flotation on FicollHypaque gradients (r = 1.09) or Lympholyte (CEDARLANE); cells
were embedded in low-melt agarose plugs, and DNA was isolated as described (20). For linker ligation, 50 ml 13 ligase buffer was added to the
plugs, which were heated to 68˚C to melt the agarose. A total of 20 ml
DNA (∼10,000 cell equivalents) was added to 2 ml T4 DNA Ligase
(2 Weiss units; MBI Fermentas, Hanover, MD), 10 ml double-stranded
annealed linker in 13 ligase buffer, 3 ml 103 ligase buffer, 5 ml 50% PEG
4000, and 25 ml dH2O and incubated overnight at 16˚C. Linker was prepared by annealing 5 nmol each LMPCR.1 (59-GCGGTGACCCGGGAGATCTGAATTC-39) and LMPCR.2 (59-GAATTCAGATC-39) in 300 ml
13 ligase buffer, which results in a double-stranded oligo with a 14-nt
single-strand overhang that can only ligate unidirectionally. Ligated DNA
samples were heat inactivated at 70˚C for 10 min, diluted three times in
dH2O, and heated to 70˚C for an additional 20 min. This sample was
assayed for mb1 DNA (primer sequences same as used for ChIP) by PCR
to adjust DNA input prior to ligation-mediated PCR (LM-PCR). The
primer 59 Sm (59-GCAGAAAATTTAGATAAAATGGATACCTCAGTGG39) was used in conjunction with linker primer (LMPCR.1) to amplify
DNA breaks. Three-fold dilutions of input DNA (0.5, 1.5, and 4.5 ml) were
amplified by HotStar Taq (QIAGEN) using a touchdown PCR program.
PCR products were electrophoresed on 1.25% agarose gels and blotted
onto nylon membranes. Blots were hybridized with an Sm-specific oligonucleotide probe (m probe 59: 592AGGGACCCAGGCTAAGAAGGCAAT39 for 59 Sm LM-PCR, end-labeled with [g[32P]]-ATP at 37˚C overnight, and
washed at 50˚C with 23 SSC/0.1% SDS.
Amplification and sequencing of Sm–Sa junctions
Genomic DNA (100 ng) from RV-transduced cells induced to switch to
IgA (47) is amplified (in 12 reactions/genotype) using two nested PCRs
(Expand Long Template System; Roche), using the same program for each
PCR. Primers for the first round were 5u3: 59-AATGGATACCTCAGTGGTTTTTAATGGTGGGTTTA-39 and SaR3: 59-CCCATCCCATCCCATCCCATC-39, and primers for the second round were u3H3: 59-AACAAGCTTGGCTTAACCGAGATGAGCC-39 and SaR2: 59-CCAGCCCAGCTCAGGCCATTT-39. The products were cloned using the Topo TA cloning kit (Invitrogen) and sequenced by Macrogen.
Results
DAID-ER is a DN mutant in aid+/+ cells
To study the DN effect of DAID, we transduced RV constructs
encoding full-length AID-ER, DAID-ER, or the ER tag alone into
wild-type (WT) mouse splenic B cells 2 d after activation to induce CSR. The cultures were treated with tamoxifen at the time of
RV transduction to induce nuclear localization of ER-tagged proteins, allowing AID to reach its target. We harvested the cells 1 d
after transduction, because we found this was optimal for their viability (25). We detected no consistent difference in cell viability or
FIGURE 1. Quantitation of transduced AID-ER and endogenous AID
levels in splenic B cells induced to switch to IgG3. (A) Western blots of
cytoplasmic and nuclear extracts (20 mg) from RV-infected splenic B
cells 1 day after viral transduction were probed with anti-ER Ab and with
Abs to GAPDH or lamin A/C for loading controls. (B) Western blot of
total cell extracts (75 mg) from the RV-infected or uninfected splenic B
cells [from the same experiment shown in (A)] probed with Ab to mouse
AID to detect endogenous AID. (C) Quantitative RT-PCR analysis shows
that endogenous AID mRNA and AID mRNA transcribed from RV-AIDER are present at similar levels in B cells activated to switch, 1 d after
transduction with RV-AID-ER or RV-ER. Results of two independent
experiments (two mice) are normalized to endogenous AID mRNA in
RV-AID-ER–transduced cells. -RT, reverse transcriptase was not added.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
RNA was isolated using TRIzol reagent (Ambion) from splenic B cells after
2 d of activation under IgG3 switching conditions. The RNA was treated
with DNase I twice (DNA-free Kit; Ambion), and cDNA synthesis was
performed using oligo p(dT)10 and SuperScript II reverse transcriptase
(Invitrogen). Primers to amplify endogenous AID mRNA were located in
exon 4 (forward primer: 59-AACTTCGGCGCATCCTTTTG-39) and in the
39 untranslated region (reverse primer: 59-CGTGTGACATTCCAGGAGGT39). Primers to amplify RV-AID-ER included the same forward primer as for
endogenous mRNA, and the reverse primer was located in the ER tag (59GGTTGGCAGCTCTCATGTCT-39).
recovery from cultures expressing full-length AID, DAID, or the ER
tag alone at this time point; it averaged ∼90%. Two days after
transduction, cell viability was reduced to ∼70% among all cultures.
To compare expression of the AID constructs, we prepared extracts
of transduced WT cells for Western blot analysis of AID and DAID
expression. Full-length AID-ER and DAID-ER are expressed at
similar levels in cytoplasmic and nuclear extracts from WT cells
with similar GFP expression (Fig. 1A, three leftmost lanes). Note
that the ER-tagged constructs have two forms of protein, which
probably are monomers and dimers, although their apparent molecular masses do not have a clear 2-fold relationship on these
gradient polyacrylamide gels. To determine whether the transduced
AID-ER or DAID-ER affects endogenous AID levels, we also
assayed endogenous AID in total cell extracts and did not find a
difference among cells transduced with the three retroviruses (Fig.
1B). This indicates that expression of DAID does not cause degradation of endogenous AID, ruling out one possible explanation for
the mechanism of its DN effect. Because our AID Ab is specific for
the C terminus of AID, which is where the ER tag is located, we
cannot detect transduced DAID with this Ab. To compare the levels
of transduced AID-ER and endogenous AID, we compared their
relative mRNA levels by quantitative RT-PCR. As shown in
The Journal of Immunology
FIGURE 2. Dose-response assays of
IgG1 (A and C) and IgG3 (B and D)
switching in aid+/+ mouse splenic B
cells expressing increasing levels of
AID-ER or DAID-ER, as assayed by
GFP expression (MFI). Each data point
in (A) and (B) represents the average
percentage of IgG1 or IgG3 (6 SEM)
at the indicated MFI [binned as shown
in (C) and (D)] of three cultures from
one mouse transduced with the indicated retrovirus relative to the percentage of CSR in cells transduced
with the empty ER retrovirus. Data
points on the y-axis (MFI = 2.5) in (A)
and (B) represent CSR in GFP2 cells
expressing only endogenous AID. CSR
in the GFP2 cells are shown in the
leftmost boxes of the FACS dot plots in
(C) and (D). The procedure used for
gating is illustrated in Fig. 7A.
highly expressed in mouse splenic B cells 2 d after treatment with
switch inducers (20), which is the day of RV transduction and 1 d
prior to harvesting.
Untagged DAID has DN activity
To better compare with endogenous DAID in HIGM patients, we
tested whether an untagged DAID expressed in the pMIG retrovirus would show DN function in RV-transduction experiments.
Fig. 3A shows that CSR to IgG3 and to IgG1 is significantly lower
in WT cells expressing DAID than in cells expressing the empty
pMIG, demonstrating that the DN effect is not dependent upon the
ER tag. In these experiments, we did not add tamoxifen to the
cultures, and we infected the cells 1 d after activation and harvested them 2 d later. The increased duration of infection used in
experiments with untagged AID (2 d instead of 1 d) was required
to obtain the DN effect with these constructs, probably because,
unlike ER-tagged DAID, untagged DAID appears to be poorly
expressed, as reported previously for human DAID (29, 39). This
is consistent with the facts that DAID lacks a nuclear export
signal, and AID is degraded more rapidly in nuclei than in cytoplasm (15). We could not examine the expression of DAID di-
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
Fig. 1C, the levels of mRNAs for endogenous and transduced AID
are similar. Taken together, the data in Fig. 1 indicate that endogenous AID, AID-ER, and DAID-ER are expressed at similar levels
in aid+/+ cells 1 d after transduction and that DAID-ER does not
cause degradation of endogenous AID.
To determine whether DAID-ER has a DN effect on CSR when
expressed in WT mouse splenic B cells, we performed a doseresponse assay to compare IgG1 and IgG3 CSR as a function of
GFP mean fluorescence intensity (MFI), which is an indicator of
AID and DAID expression levels. Increasing expression of fulllength AID-ER results in increased IgG1 CSR (Fig. 2A, 2C), as
previously reported (48), whereas increasing doses of DAID results in decreasing CSR to IgG1. Also, CSR to IgG3 increases
with increasing expression of AID in WT B cells, but it decreases
with increasing expression of DAID (Fig. 2B, 2D). These data
demonstrate that DAID has a DN effect on CSR in WT mouse
B cells. The weaker DN effect that we observed relative to the
nearly complete inhibition of CSR found in most HIGM patients
with the heterozygous C-terminal AID deletion (5, 8) is likely due
to the fact that, in our experiments, endogenous full-length AID is
expressed prior to RV transduction. Endogenous AID is already
1443
1444
THE DOMINANT NEGATIVE EFFECT OF AID C TERMINUS DELETION
FIGURE 3. Untagged DAID has DN activity, induces very few Sm
DSBs, and does not cause degradation of endogenous AID. (A) Compilation of IgG1 and IgG3 CSR results (+SEM) for the untagged DAID in
WT cells relative to CSR in cells expressing pMIG. The control retrovirus
pMIG does not affect CSR significantly, because GFP2 cells switched
similarly to cells transduced with pMIG (data not shown). In these
experiments, cells were activated to switch for 24 h, transduced, and
harvested 2 d later. The procedure for gating is illustrated in Fig. 7A. In
addition, we gated on the brightest GFP+ cells (∼50% of the cells). Results
from two independent experiments (two mice) with two cultures each are
shown. (B) LM-PCR assay of Sm DSBs in aid2/2 cells induced to switch
to IgG3 transduced with untagged AID, DAID, or the empty retrovirus
pMIG. Transduction was performed on day 2 after activation, and cells
were harvested on day 3. The vertical line indicates where the image was
cut to remove irrelevant lanes. Three-fold titrations of input DNA were
used, and the mb-1 gene was amplified as an internal control for template
input. The mb-1 PCR bands shown were obtained by electrophoretic
analysis on a QIAxcel Advanced instrument, which subjects each sample
to electrophoresis in a capillary and provides an image and quantitation of
each lane. (C) LM-PCR assay of Sm DSBs in aid2/2 cells induced to
switch to IgG3 transduced with AID-ER, DAID-ER, or the control retrovirus ER. Methods used were similar to those described for (B). (D)
Western blot of 80 mg of total cell extracts of aid2/2 and aid+/+ cells
rectly, because our AID Ab is directed against the C terminus. We
tested the two commercially available Abs that were reported to be
against different epitopes in mouse AID; however, unlike our AID
Ab, they did not detect mouse AID in our Western blots. Again, we
did not detect consistent differences in cell viability or recovery
postinfection with the different viruses, although the cells were less
viable when harvested 2 d postinfection (∼70%) than when harvested after 1 d (∼90%), independent of the particular AID expression construct. Although it was speculated that untagged DAID
poorly induces CSR because of its low expression, the finding that
both DAID-ER and untagged DAID poorly induce CSR, and both
have DN effects on CSR in WT cells, indicate that the phenotype of
DAID is not solely due to its low expression.
Because untagged DAID might be less stable than DAID-ER,
we asked whether untagged DAID might destabilize endogenous
AID. As shown in Fig. 3D, the levels of endogenous AID in
WT cells expressing DAID are not reduced relative to untransduced WT cells or cells transduced with pMIG, similar to the
results obtained with DAID-ER and confirming that DAID does
not exert a DN effect by causing degradation of endogenous AID.
We used LM-PCR to determine whether untagged DAID induces
DSBs in the Sm region in aid2/2 cells and found that, although it
does, there are many fewer than in cells expressing full-length
AID (Fig. 3B). This result differs from what we observed in
transduced with untagged AID and DAID expressed in the retrovirus pMIG
and then probed with Ab to AID and to Grb2 for loading controls. Cells
were cultured and transduced as in (A), but similar results were observed if
cells were cultured for 2 d prior to transduction and harvested 1 d later.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 4. LM-PCR assays of Sm DSBs in WT (aid+/+) or aid2/2 cells
induced to switch to IgG3 transduced with pMIG expressing untagged AID
constructs (A) or pMXpie expressing ER-tagged AID constructs (B).
Methods are the same as described in Fig. 3.
The Journal of Immunology
cells transduced with DAID-ER, in which the DSB frequency is
similar to that observed in cells transduced with AID-ER (Fig. 3C)
(25). This difference is consistent with the likely reduced expression of untagged DAID relative to that of DAID-ER. Note that
LM-PCR only detects DSBs that are blunt; if T4 DNA polymerase
(T4 Pol) is added prior to ligation, staggered DSBs can be
detected. However, addition of T4 Pol does not change the relative
frequency of DSBs induced by AID-ER or DAID-ER (25). If
DAID induces extensively end-resected DSBs, as suggested by the
results of Zahn et al. (29), these DSBs would not be detected by
this assay.
To determine whether DAID might affect Sm DSBs detected
in WT cells, we performed LM-PCR experiments in WT cells
transduced with untagged and tagged AID viruses, using T4 Pol
to fill in staggered ends. In WT cells, we detected similar numbers
1445
of DSBs in cells expressing DAID as in cells expressing fulllength AID, whether DAID was untagged (Fig. 4A) or tagged
(Fig. 4B). Because the intensity of the signals is slightly greater in
cells expressing full-length AID, it is possible that these DSBs are
slightly more numerous or more efficiently amplified. Similar
results were obtained in the absence of T4 Pol (data not shown).
Again, extensively end-resected DSBs would not be detected. As
pointed out previously (25, 27), the role of the C terminus of AID
appears to manifest itself subsequent to DSB formation.
ChIP assays show that DAID binds Sm in WT cells
To further explore the mechanism of the DN effect, we asked
whether DAID-ER binds Sm in WT cells expressing endogenous
AID or whether endogenous AID might compete and, thereby,
inhibit its binding. WT B cells transduced with ER were used as
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 5. Both the DN effect and association of DAID-ER with Sm depend upon deaminase activity of DAID-ER. (A) ChIP of AID-ER proteins at
Sm and Cm in WT cells relative to input DNA using anti-ER Ab. Error bars indicate SEM. Five ChIPs (two independent experiments, two mice) were
performed, with the exception of the no Ab control for FL-AID, for which four were performed. ChIP was analyzed by quantitative PCR; percentage
input was calculated, and percentage input in the absence of Ab was subtracted. (B) ChIP of the AID-ER proteins at Sm and Cm in aid2/2 cells relative
to input DNA. Six ChIPs for AID, DAID, and ER and three ChIPs for AIDRQ and DAIDRQ were performed (two mice). Analysis was done as in (A). (C)
ChIP experiments performed with aid2/2 cells transduced with untagged AID pMIG constructs, immunoprecipitated with anti-AID Ab (10). Error bars
indicate SEM. Five or six ChIPs (two independent experiments, two mice) were performed. ChIPs were analyzed by quantitative PCR; percentage input
was calculated, and percentage input in the absence of Ab was subtracted. The p values were determined by the two-tailed t test. (D) Compilation of
IgG1 and IgG3 CSR results (+SEM) for the indicated RV-AID constructs in GFPhi WT splenic B cells. Results are normalized to AID-ER results in one
of the cultures each for IgG1 and IgG3. Six cultures (three mice, two cultures each) were performed. CSR is plotted for GFPhi cells, which are ∼50% of
the total GFP+ cells. Cells transduced with ER switch similarly to GFP2 cells in the same cultures (data not shown). (E) Western blots of AID-ER in
nuclear, cytoplasmic, and whole-cell extracts from transduced WT splenic B cells. A total of 20 mg protein was loaded in each lane. *Unknown irrelevant protein.
1446
THE DOMINANT NEGATIVE EFFECT OF AID C TERMINUS DELETION
negative controls. As shown in Fig. 5A, DAID-ER is recruited at
least as well as AID-ER to the Sm region in AID-sufficient cells,
similar to results in aid2/2 cells (Fig. 5B). Binding of AID and
DAID was not detected at the Cm gene in WT or aid2/2 cells.
DAID lacking deaminase activity is not a DN mutant and does
not bind Sm in WT cells
The DN effect of DAID depends on the presence of Msh2
Msh2 and Msh6 are required for optimal CSR in B cells expressing full-length AID-ER but do not contribute to CSR in B cells
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
We previously showed that AID lacking deaminase activity due to
mutations in the catalytic domain, AIDH56R/E58Q (AIDRQ) (10, 49),
does not bind to Sm and Sg3 in our ChIP assays in aid2/2 cells
(25) (Fig. 5B). This result differs from that reported by Vuong
et al. (50), who found that AIDRQ expressed without a tag binds
similarly as WT AID to Sm; therefore, we asked whether the
difference was due to the ER tag. However, we found that untagged AIDRQ is also unable to bind Sm under our ChIP conditions
(Fig. 5C). There are several differences between the ChIP conditions in our laboratory and those of Vuong et al. (50), and we do
not know which ones are important. Taken together, the data from
our laboratory and the Chaudhuri laboratory (50) suggest that
AIDRQ binds Sm but less stably than WT AID.
We next asked whether DAIDRQ-ER would have DN function
by analyzing CSR in WT cells transduced with DAIDRQ in
comparison with ER and full-length AIDRQ and DAID. Fig. 5D
shows the combined CSR data, normalized to CSR in cells expressing ER alone. Again, CSR in cells expressing DAID is significantly lower than in cells expressing ER. However, there is no
DN effect observed in cells expressing DAIDRQ or AIDRQ. This is
consistent with our finding that DAIDRQ or AIDRQ do not stably
associate with Sm in WT cells (Fig. 5A). As shown in the Western
blot in Fig. 5E, the AIDRQ-ER proteins are expressed at similar
levels to DAID-ER in nuclei, cytoplasm, and whole-cell extracts,
ruling out the possibility that DAIDRQ does not have a DN effect
due to lack of expression. These data suggest that the DN effect
depends upon the ability of DAID to bind Sm and/or the ability of
DAID to deaminate cytosines and to induce Sm DSBs.
If AIDRQ and DAIDRQ heterodimerize with endogenous AID,
they might be expected to bind Sm in WT cells. Although AID
and DAID are detected at Sm in WT cells, neither AIDRQ nor
DAIDRQ binds (Fig. 5A), suggesting that a functional deaminase
domain must be present in both partners of the heterodimer for
detectable binding to Sm, that endogenous WT AID does not
heterodimerize with catalytically inactive AID, or that AID
functions as a monomer.
a human AID with a 17-aa C-terminal deletion in mouse aid2/2
B cells (29, 52). We also examined junctions in cells expressing
untagged DAID and found a 2.8-fold increase in MH lengths in
comparison with cells expressing full-length untagged AID (Fig.
6C). There also were significant differences in the distribution of
MH lengths between cells expressing AID and DAID, whether it
was tagged or untagged (Fig. 6A, 6B, respectively). Note that in
cells expressing DAID, we observed junctions with up to 15 and 27
bp of MH. These data suggest that the AID C terminus is involved
in directing S-region DSBs toward recombination by NHEJ, as
suggested previously (29, 35, 52).
Sm–Sa junctions show increased microhomology in cells
expressing DAID
Because the deaminase activity of AID is essential for S-region
DNA breaks, we hypothesized that the DN function of DAID
depends upon its ability to induce S-region breaks. Perhaps the
breaks are aberrantly processed and cannot participate in S–S
recombination by NHEJ. They might interfere with normal S–S
recombination induced by full-length AID. To begin to address
this possibility, we examined the S–S junctions in aid2/2 cells
expressing DAID to determine whether they showed increased
amounts of microhomology (MH) as would be expected if they
were not recombined by NHEJ, which is the predominant mechanism for recombining S–S junctions. We examined Sm–Sa junctions because Sa has the greatest amount of homology to Sm of any
S region, thus increasing the sensitivity of the assay (51). Indeed,
we found that Sm–Sa junctions showed an average of 2.3-fold
greater lengths of MH in aid2/2 cells expressing DAID-ER compared with cells expressing AID-ER (Fig. 6C), similar to observations in human HIGM patients expressing both C-terminally deleted
AID and full-length AID (35), as well as recent reports studying
FIGURE 6. MH at Sm–Sa junctions in aid2/2 cells transduced with
AID-ER, DAID-ER, and untagged AID and DAID. (A) Percentage of
junctions with the indicated lengths of MH cloned from aid2/2 cells
transduced with AID-ER and DAID-ER retroviruses. Junctions with inserts
are not included. (B) Same as in (A), except junctions from cells transduced with untagged AID and DAID. The p values show differences in
distributions of MH between AID and DAID, determined by a Mann–
Whitney two-tailed test. (C) Compiled mean junctional MH 6 SEM for the
ER tagged and untagged AID and DAID, as indicated. Sequences with
inserts are not included in the calculations of MH.
The Journal of Immunology
expressing DAID-ER (25). It is clear that at least one of the roles
of MMR in CSR is to increase S-region DSBs, most likely by
converting distal SSBs to DSBs (17, 22–24). Furthermore, in the
absence of the MMR proteins Mlh1 or Pms2, S–S junctions show
1447
increased MH (53–55), similar to the junctions in cells expressing
DAID. To determine whether the DN effect depends on MMR, we
expressed AID-ER and DAID-ER in AID-sufficient msh22/2 or
mlh12/2 B cells and analyzed CSR by flow cytometry. Fig 7A
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
FIGURE 7. FACS analyses of CSR in WT, msh22/2, and mlh12/2 cells demonstrate that the DN effect of DAID-ER requires the presence of Msh2. (A)
Gating strategy used for all FACS experiments in this article, proceeding from left to right. Example is from (D): WT cells transduced with AID-ER
transduced and induced to switch to IgG1. Retrovirally infected cultured cells were stained with 7-aminoactinomycin D (7AAD) to detect dying/dead cells
and with Ab F(ab9)2 to IgG1 or IgG3 conjugated to PE. The percentage of viable (7AAD2) retrovirally infected (GFP+) cells that were IgG1+ or IgG3+ was
determined as shown. Compensation and gating were performed using FlowJo software (TreeStar). (B) FACS results for one representative CSR experiment
comparing the DN effect of DAID-ER in WT and msh22/2 B cells (expressing endogenous AID). The FACS plots show only viable and GFP+ cells; the
gates represent PE-IgG1/PE-IgG3+ cells within the GFP+ populations, as indicated. The entire GFP+ population was analyzed in these experiments. (C)
Compilation of IgG1 and IgG3 CSR results (+SEM) for the indicated constructs in WT and msh22/2 cells relative to CSR in WT cells expressing AID-ER.
Two independent experiments (two mice, three cultures each) were performed. IgG1 and IgG3 CSR are significantly increased in WT cells expressing AIDER relative to ER (p = 0.004 and p = 0.011, respectively). IgG1 and IgG3 CSR in msh22/2 cells expressing AID-ER relative to ER were not significantly
increased (p = 0.065 and p = 0.284, respectively). (D) FACS results for one experiment comparing the DN effect of DAID-ER in WT and mlh12/2 B cells.
(E) Compilation of IgG1 and IgG3 CSR results (+SEM) for the indicated constructs in WT and mlh12/2 cells relative to CSR in WT cells expressing AIDER. Three independent experiments (three mice, three cultures each) were performed. IgG1 and IgG3 CSR were significantly increased in WT cells
expressing AID-ER relative to ER (p = 0.002 and p = 0.027, respectively). IgG1 CSR in mlh12/2 cells expressing AID-ER relative to ER was significantly
increased (p = 0.004), but IgG3 CSR was not (p = 0.256). SSC, side scatter.
1448
THE DOMINANT NEGATIVE EFFECT OF AID C TERMINUS DELETION
Discussion
DAID functions as a DN mutant in HIGM patients that retain one
allele encoding WT AID (5), and we addressed the mechanism of
this DN effect in this study. We show that the DN effect of DAID
requires Msh2 and that DAID must have deaminase activity. The
deaminase activity is required for binding of DAID-ER, Msh2Msh6, and UNG to Sm in our ChIP assays (25) (and data herein).
However, deaminase activity is also essential for AID to induce
DNA breaks, suggesting that the DN effect might require the induction of DNA breaks. Consistent with this hypothesis, MMR
proteins are important for creating DSBs during CSR (23).
We showed that Msh2 and Msh6 are recruited to Sm, dependent
upon both the C terminus of AID and deaminase activity (25).
Thus, it seemed surprising that the DN effect of DAID depends
upon Msh2, because DAID poorly recruits Msh2 to Sm. However,
full-length endogenous AID would recruit Msh2-Msh6 in cells
expressing DAID, which could increase S-region DSBs. Thus, the
FIGURE 8. Model for role of the AID C
terminus in the introduction of S-region DSBs
and S–S recombination. (A) Cells expressing
full-length AID. (B) Cells expressing DAID.
dependence of the DN effect upon Msh2 supports the hypothesis
that DSBs are required for the DN effect. MMR is normally involved in postreplicative repair during S phase, whereas CSR
occurs during G1 phase (23, 57), so it is possible that MMR must
be specifically recruited to increase DSBs during CSR. Because
DAID does not recruit UNG to Sm as well as does full-length AID
(25, 29, 52), it is also likely that DAID inefficiently induces SSBs.
Thus, it is possible that, in cells expressing haploid amounts of
both AID and DAID, DSBs might be even more dependent upon
MMR compared with cells expressing only full-length AID. MMR
appears to help generate DSBs that can be recombined by NHEJ
and perhaps contributes to recruitment of NHEJ proteins, because
S–S junctions in cells lacking Mlh1 or Pms2 show increased MH,
similar to those in cells lacking NHEJ proteins (53, 54, 58, 59).
It is clear that the DSBs induced in aid2/2 cells expressing
DAID cannot undergo efficient S–S recombination by NHEJ,
because CSR is 90% reduced compared with cells expressing fulllength AID, and the S–S junctional MH is increased. It is possible
that AID, but not DAID, recruits NHEJ proteins, which normally
perform S–S recombination. Thus, in cells expressing DAID, DSBs
might undergo extensive end resection. We hypothesize that the reason why the numbers of DSBs in S regions in both aid2/2 and WT
cells expressing DAID-ER appear similar in LM-PCR experiments to
those in cells expressing AID-ER is because, although DSBs are created less efficiently as a result of poor recruitment of UNG and MMR,
those that are made are also repaired less efficiently as a result of poor
recruitment of NHEJ. Also, DAID was reported to have higher deaminase activity than full-length AID (28, 29). To explain how the
putative inability of DAID to recruit NHEJ proteins could have a DN
effect, it is possible that aberrantly resected DSBs predominate over
breaks induced by endogenous full-length AID, because of their inability to recombine efficiently, and these DSBs interfere with recombination by NHEJ. Fig. 8 presents an outline model of this
hypothesis.
UNG and Msh2 do not appear to bind AID directly, and we only
detected their interaction with AID by ChIP, dependent upon the C
terminus of AID (25). The fact that deaminase activity is required
for binding of Msh2 and UNG to Sm in our ChIP experiments (25)
suggests that UNG and MutSa require their DNA substrates, dU
and U:G mismatches, respectively, for binding to DNA. It is pos-
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
shows the gating strategy used in these experiments. Fig. 7B and
7D provide examples of the switching results in the GFP+ transduced cells, and Fig. 7C and 7E present the compiled results.
Demonstrating the DN effect, CSR is significantly lower in
WT cells expressing DAID than in cells expressing ER (Fig. 7C,
7E). However, DAID does not have a DN effect in msh22/2 cells,
because CSR is not significantly lower in DAID-expressing
msh22/2 cells than in ER-expressing cells (Fig. 7B, 7C). The
levels of RV-AID proteins or endogenous AID in the transduced
cells are not affected by lack of the MMR protein Msh2 (Fig. 1A,
1B). In mlh12/2 cells, the DN effect borders on significance
(Fig. 7E), perhaps due to the presence of Msh2-Msh6 in these
cells. MMR is partially functional in the absence of Mlh1-Pms2
(17, 56). These results suggest that the DN effect of DAID in
AID-sufficient cells depends upon a function that Msh2 provides.
At first glance, this seems surprising because we showed previously that MMR does not contribute to CSR induced by DAID
and because the AID C terminus is important for recruiting
MMR proteins to S regions (25). However, endogenous AID can
recruit MMR proteins in cells expressing DAID; thus, it is
possible that the ability of MMR to increase S-region DSBs is
important for the DN effect.
The Journal of Immunology
Acknowledgments
We thank J. Chaudhuri for pMIG, pMIG-AID, and anti-AID Ab, as well as
for very helpful discussions; V. Barreto and M. Nussenzweig for the pMXPIE-AID-FLAG-ER-IRES-GFP-puro and pMX-PIE-DAID-FLAG-ER-IRESGFP-puro plasmids; and the University of Massachusetts Medical School Flow
Cytometry Core Facility for excellent technical assistance. We also thank
Drs. T. Honjo, T. Mak, R.M. Liskay, and W. Edelmann for knock-out mouse
lines.
Disclosures
The authors have no financial conflicts of interest.
References
1. Muramatsu, M., K. Kinoshita, S. Fagarasan, S. Yamada, Y. Shinkai, and T. Honjo.
2000. Class switch recombination and hypermutation require activation-induced
cytidine deaminase (AID), a potential RNA editing enzyme. Cell 102: 553–563.
2. Revy, P., T. Muto, Y. Levy, F. Geissmann, A. Plebani, O. Sanal, N. Catalan,
M. Forveille, R. Dufourcq-Labelouse, A. Gennery, et al. 2000. Activationinduced cytidine deaminase (AID) deficiency causes the autosomal recessive
form of the Hyper-IgM syndrome (HIGM2). Cell 102: 565–575.
3. Petersen-Mahrt, S. K., R. S. Harris, and M. S. Neuberger. 2002. AID mutates E.
coli suggesting a DNA deamination mechanism for antibody diversification.
Nature 418: 99–103.
4. Maul, R. W., H. Saribasak, S. A. Martomo, R. L. McClure, W. Yang,
A. Vaisman, H. S. Gramlich, D. G. Schatz, R. Woodgate, D. M. Wilson, III, and
P. J. Gearhart. 2011. Uracil residues dependent on the deaminase AID in immunoglobulin gene variable and switch regions. Nat. Immunol. 12: 70–76.
5. Ta, V. T., H. Nagaoka, N. Catalan, A. Durandy, A. Fischer, K. Imai,
S. Nonoyama, J. Tashiro, M. Ikegawa, S. Ito, et al. 2003. AID mutant analyses
indicate requirement for class-switch-specific cofactors. Nat. Immunol. 4: 843–
848.
6. Shinkura, R., S. Ito, N. A. Begum, H. Nagaoka, M. Muramatsu, K. Kinoshita,
Y. Sakakibara, H. Hijikata, and T. Honjo. 2004. Separate domains of AID are
required for somatic hypermutation and class-switch recombination. Nat.
Immunol. 5: 707–712.
7. Barreto, V., B. Reina-San-Martin, A. R. Ramiro, K. M. McBride, and
M. C. Nussenzweig. 2003. C-terminal deletion of AID uncouples class switch
recombination from somatic hypermutation and gene conversion. Mol. Cell 12:
501–508.
8. Imai, K., Y. Zhu, P. Revy, T. Morio, S. Mizutani, A. Fischer, S. Nonoyama, and
A. Durandy. 2005. Analysis of class switch recombination and somatic hypermutation in patients affected with autosomal dominant hyper-IgM syndrome
type 2. Clin. Immunol. 115: 277–285.
9. Dickerson, S. K., E. Market, E. Besmer, and F. N. Papavasiliou. 2003. AID
mediates hypermutation by deaminating single stranded DNA. J. Exp. Med. 197:
1291–1296.
10. Chaudhuri, J., M. Tian, C. Khuong, K. Chua, E. Pinaud, and F. W. Alt. 2003.
Transcription-targeted DNA deamination by the AID antibody diversification
enzyme. Nature 422: 726–730.
11. Prochnow, C., R. Bransteitter, M. G. Klein, M. F. Goodman, and X. S. Chen.
2007. The APOBEC-2 crystal structure and functional implications for the deaminase AID. Nature 445: 447–451.
12. Jaszczur, M., J. G. Bertram, P. Pham, M. D. Scharff, and M. F. Goodman. 2013.
AID and Apobec3G haphazard deamination and mutational diversity. Cell. Mol.
Life Sci. 70: 3089–3108.
13. Ito, S., H. Nagaoka, R. Shinkura, N. Begum, M. Muramatsu, M. Nakata, and
T. Honjo. 2004. Activation-induced cytidine deaminase shuttles between nucleus
and cytoplasm like apolipoprotein B mRNA editing catalytic polypeptide 1.
Proc. Natl. Acad. Sci. USA 101: 1975–1980.
14. McBride, K. M., V. Barreto, A. R. Ramiro, P. Stavropoulos, and
M. C. Nussenzweig. 2004. Somatic hypermutation is limited by CRM1dependent nuclear export of activation-induced deaminase. J. Exp. Med. 199:
1235–1244.
15. Aoufouchi, S., A. Faili, C. Zober, O. D’Orlando, S. Weller, J. C. Weill, and
C. A. Reynaud. 2008. Proteasomal degradation restricts the nuclear lifespan of
AID. J. Exp. Med. 205: 1357–1368.
16. Ellyard, J. I., A. S. Benk, B. Taylor, C. Rada, and M. S. Neuberger. 2011. The
dependence of Ig class-switching on the nuclear export sequence of AID likely
reflects interaction with factors additional to Crm1 exportin. Eur. J. Immunol. 41:
485–490.
17. Stavnezer, J., J. E. J. Guikema, and C. E. Schrader. 2008. Mechanism and regulation of class switch recombination. Annu. Rev. Immunol. 26: 261–292.
18. Rada, C., G. T. Williams, H. Nilsen, D. E. Barnes, T. Lindahl, and
M. S. Neuberger. 2002. Immunoglobulin isotype switching is inhibited and somatic hypermutation perturbed in UNG-deficient mice. Curr. Biol. 12: 1748–
1755.
19. Imai, K., G. Slupphaug, W. I. Lee, P. Revy, S. Nonoyama, N. Catalan, L. Yel,
M. Forveille, B. Kavli, H. E. Krokan, et al. 2003. Human uracil-DNA glycosylase deficiency associated with profoundly impaired immunoglobulin classswitch recombination. Nat. Immunol. 4: 1023–1028.
20. Schrader, C. E., E. K. Linehan, S. N. Mochegova, R. T. Woodland, and
J. Stavnezer. 2005. Inducible DNA breaks in Ig S regions are dependent on AID
and UNG. J. Exp. Med. 202: 561–568.
21. Guikema, J. E., E. K. Linehan, D. Tsuchimoto, Y. Nakabeppu, P. R. Strauss,
J. Stavnezer, and C. E. Schrader. 2007. APE1- and APE2-dependent DNA breaks
in immunoglobulin class switch recombination. J. Exp. Med. 204: 3017–3026.
22. Min, I. M., C. E. Schrader, J. Vardo, T. M. Luby, N. D’Avirro, J. Stavnezer, and
E. Selsing. 2003. The Smu tandem repeat region is critical for Ig isotype
switching in the absence of Msh2. Immunity 19: 515–524.
23. Schrader, C. E., J. E. Guikema, E. K. Linehan, E. Selsing, and J. Stavnezer. 2007.
Activation-induced cytidine deaminase-dependent DNA breaks in class switch
recombination occur during G1 phase of the cell cycle and depend upon mismatch repair. J. Immunol. 179: 6064–6071.
24. Cortizas, E. M., A. Zahn, M. E. Hajjar, A. M. Patenaude, J. M. Di Noia, and
R. E. Verdun. 2013. Alternative end-joining and classical nonhomologous endjoining pathways repair different types of double-strand breaks during classswitch recombination. J. Immunol. 191: 5751–5763.
25. Ranjit, S., L. Khair, E. K. Linehan, A. J. Ucher, M. Chakrabarti, C. E. Schrader,
and J. Stavnezer. 2011. AID binds cooperatively with UNG and Msh2-Msh6 to
Ig switch regions dependent upon the AID C terminus. J. Immunol. 187: 2464–
2475.
26. Ranjit, S., L. Khair, E. K. Linehan, A. J. Ucher, M. Chakrabarti, C. E. Schrader,
and J. Stavnezer. 2014. Correction: AID binds cooperatively with UNG and
Msh2-Msh6 to Ig switch regions dependent upon the AID C terminus. J.
Immunol. 192: 4934.
27. Doi, T., L. Kato, S. Ito, R. Shinkura, M. Wei, H. Nagaoka, J. Wang, and
T. Honjo. 2009. The C-terminal region of activation-induced cytidine deaminase
is responsible for a recombination function other than DNA cleavage in class
switch recombination. Proc. Natl. Acad. Sci. USA 106: 2758–2763.
28. Kohli, R. M., S. R. Abrams, K. S. Gajula, R. W. Maul, P. J. Gearhart, and
J. T. Stivers. 2009. A portable hot spot recognition loop transfers sequence
preferences from APOBEC family members to activation-induced cytidine deaminase. J. Biol. Chem. 284: 22898–22904.
29. Zahn, A., A. K. Eranki, A. M. Patenaude, S. P. Methot, H. Fifield, E. M. Cortizas,
P. Foster, K. Imai, A. Durandy, M. Larijani, et al. 2014. Activation induced
deaminase C-terminal domain links DNA breaks to end protection and repair
during class switch recombination. Proc. Natl. Acad. Sci. USA 111: E988–E997.
30. Schrader, C. E., W. Edelmann, R. Kucherlapati, and J. Stavnezer. 1999. Reduced
isotype switching in splenic B cells from mice deficient in mismatch repair
enzymes. J. Exp. Med. 190: 323–330.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
sible that NHEJ proteins are also part of a complex that is recruited
by AID, dependent upon the C terminus and deaminase activity.
DNA-PKcs, a DNA-dependent kinase, is very important for NHEJ
(60). It was reported to bind to the AID C terminus, but only in the
presence of DNA (34). Consistent with this, DNA-PKcs was shown
to associate in ChIP assays with Sm in CH12 B lymphoma cells
expressing full-length AID but not human DAID (52). Also, KU70
was recently shown to bind by ChIP at Sm in mouse splenic B cells
expressing human AID but not DAID (29). Recent evidence indicates that APE1 and AID interact directly, dependent upon phosphorylation of AID at S38 (50). Thus, NHEJ proteins could be
recruited as part of a complex that converts AID-induced dUs to
DSBs and then forms S–S junctions.
If AID functions as a dimer, then AID lacking deaminase activity should be able to heterodimerize with endogenous WT AID, because the catalytic site is not located in regions thought to be involved
in AID dimerization (11, 12) or in DNA binding (61). However, because we did not detect binding of AID lacking deaminase activity
(AIDRQ) to S regions in WT cells, one possible explanation for our
results is that both subunits of the putative AID dimer must have
deaminase activity for AID to bind detectably to Sm. If heterodimers
of DAIDRQ and AID cannot bind DNA, they should not interfere with
the function of WT AID, because transduced AID was not expressed
in excess over endogenous AID in our experiments. Alternatively, our
results could be interpreted to indicate that AID functions as a
monomer. Although several reports suggested that AID functions as a
dimer or tetramer (5, 9, 62), another report indicated that purified
AID functions preferentially as a monomer in vitro, acting on ssDNA
and on a small loop in dsDNA (63). Thus, our data suggest that an
AID–DAIDRQ heterodimer does not form or if it forms, it cannot bind
DNA, perhaps because of an inability to recruit UNG and/or MutSa
or, alternatively, that AID functions as a monomer.
1449
1450
THE DOMINANT NEGATIVE EFFECT OF AID C TERMINUS DELETION
48. Sernández, I. V., V. G. de Yébenes, Y. Dorsett, and A. R. Ramiro. 2008. Haploinsufficiency of activation-induced deaminase for antibody diversification and
chromosome translocations both in vitro and in vivo. PLoS ONE 3: e3927.
49. Papavasiliou, F. N., and D. G. Schatz. 2002. The activation-induced deaminase
functions in a postcleavage step of the somatic hypermutation process. J. Exp.
Med. 195: 1193–1198.
50. Vuong, B. Q., K. Herrick-Reynolds, B. Vaidyanathan, J. N. Pucella, A. J. Ucher,
N. M. Donghia, X. Gu, L. Nicolas, U. Nowak, N. Rahman, et al. 2013. A DNA
break- and phosphorylation-dependent positive feedback loop promotes immunoglobulin class-switch recombination. Nat. Immunol. 14: 1183–1189.
51. Stavnezer, J., A. Björkman, L. Du, A. Cagigi, and Q. Pan-Hammarström. 2010.
Mapping of switch recombination junctions, a tool for studying DNA repair
pathways during immunoglobulin class switching. Adv. Immunol. 108: 45–109.
52. Sabouri, S., M. Kobayashi, N. A. Begum, J. Xu, K. Hirota, and T. Honjo. 2014.
C-terminal region of activation-induced cytidine deaminase (AID) is required for
efficient class switch recombination and gene conversion. Proc. Natl. Acad. Sci.
USA 111: 2253–2258.
53. Ehrenstein, M. R., C. Rada, A. M. Jones, C. Milstein, and M. S. Neuberger.
2001. Switch junction sequences in PMS2-deficient mice reveal a microhomology-mediated mechanism of Ig class switch recombination. Proc. Natl.
Acad. Sci. USA 98: 14553–14558.
54. Schrader, C. E., J. Vardo, and J. Stavnezer. 2002. Role for mismatch repair
proteins Msh2, Mlh1, and Pms2 in immunoglobulin class switching shown by
sequence analysis of recombination junctions. J. Exp. Med. 195: 367–373.
55. Péron, S., A. Metin, P. Gardès, M. A. Alyanakian, E. Sheridan, C. P. Kratz,
A. Fischer, and A. Durandy. 2008. Human PMS2 deficiency is associated with
impaired immunoglobulin class switch recombination. J. Exp. Med. 205: 2465–
2472.
56. Zhang, Y., F. Yuan, S. R. Presnell, K. Tian, Y. Gao, A. E. Tomkinson, L. Gu, and
G. M. Li. 2005. Reconstitution of 59-directed human mismatch repair in a purified system. Cell 122: 693–705.
57. Sharbeen, G., C. W. Yee, A. L. Smith, and C. J. Jolly. 2012. Ectopic restriction of
DNA repair reveals that UNG2 excises AID-induced uracils predominantly or
exclusively during G1 phase. J. Exp. Med. 209: 965–974.
58. Yan, C. T., C. Boboila, E. K. Souza, S. Franco, T. R. Hickernell, M. Murphy,
S. Gumaste, M. Geyer, A. A. Zarrin, J. P. Manis, et al. 2007. IgH class switching
and translocations use a robust non-classical end-joining pathway. Nature 449:
478–482.
59. Boboila, C., F. W. Alt, and B. Schwer. 2012. Classical and alternative endjoining pathways for repair of lymphocyte-specific and general DNA doublestrand breaks. Adv. Immunol. 116: 1–49.
60. Lieber, M. R. 2010. The mechanism of double-strand DNA break repair by the
nonhomologous DNA end-joining pathway. Annu. Rev. Biochem. 79: 181–211.
61. Uchimura, Y., L. F. Barton, C. Rada, and M. S. Neuberger. 2011. REG-g
associates with and modulates the abundance of nuclear activation-induced deaminase. J. Exp. Med. 208: 2385–2391.
62. Larijani, M., A. P. Petrov, O. Kolenchenko, M. Berru, S. N. Krylov, and
A. Martin. 2007. AID associates with single-stranded DNA with high affinity and
a long complex half-life in a sequence-independent manner. Mol. Cell. Biol. 27:
20–30.
63. Brar, S. S., E. J. Sacho, I. Tessmer, D. L. Croteau, D. A. Erie, and M. Diaz. 2008.
Activation-induced deaminase, AID, is catalytically active as a monomer on
single-stranded DNA. DNA Repair (Amst.) 7: 77–87.
Downloaded from http://www.jimmunol.org/ by guest on June 17, 2017
31. Ehrenstein, M. R., and M. S. Neuberger. 1999. Deficiency in Msh2 affects the
efficiency and local sequence specificity of immunoglobulin class-switch recombination: parallels with somatic hypermutation. EMBO J. 18: 3484–3490.
32. Li, Z., S. J. Scherer, D. Ronai, M. D. Iglesias-Ussel, J. U. Peled, P. D. Bardwell,
M. Zhuang, K. Lee, A. Martin, W. Edelmann, and M. D. Scharff. 2004. Examination of Msh6- and Msh3-deficient mice in class switching reveals overlapping and distinct roles of MutS homologues in antibody diversification. J.
Exp. Med. 200: 47–59.
33. Martomo, S. A., W. W. Yang, and P. J. Gearhart. 2004. A role for Msh6 but not
Msh3 in somatic hypermutation and class switch recombination. J. Exp. Med.
200: 61–68.
34. Wu, X., P. Geraldes, J. L. Platt, and M. Cascalho. 2005. The double-edged sword
of activation-induced cytidine deaminase. J. Immunol. 174: 934–941.
35. Kracker, S., K. Imai, P. Gardès, H. D. Ochs, A. Fischer, and A. H. Durandy.
2010. Impaired induction of DNA lesions during immunoglobulin class-switch
recombination in humans influences end-joining repair. Proc. Natl. Acad. Sci.
USA 107: 22225–22230.
36. Stavnezer, J. 2011. Complex regulation and function of activation-induced cytidine deaminase. Trends Immunol. 32: 194–201.
37. Xu, Z., Z. Fulop, G. Wu, E. J. Pone, J. Zhang, T. Mai, L. M. Thomas, A. AlQahtani, C. A. White, S. R. Park, et al. 2010. 14-3-3 adaptor proteins recruit AID
to 59-AGCT-39-rich switch regions for class switch recombination. Nat. Struct.
Mol. Biol. 17: 1124–1135.
38. Häsler, J., C. Rada, and M. S. Neuberger. 2011. Cytoplasmic activation-induced
cytidine deaminase (AID) exists in stoichiometric complex with translation
elongation factor 1a (eEF1A). Proc. Natl. Acad. Sci. USA 108: 18366–18371.
39. Geisberger, R., C. Rada, and M. S. Neuberger. 2009. The stability of AID and its
function in class-switching are critically sensitive to the identity of its nuclearexport sequence. Proc. Natl. Acad. Sci. USA 106: 6736–6741.
40. Nowak, U., A. J. Matthews, S. Zheng, and J. Chaudhuri. 2011. The splicing
regulator PTBP2 interacts with the cytidine deaminase AID and promotes
binding of AID to switch-region DNA. Nat. Immunol. 12: 160–166.
41. Reitmair, A. H., M. Redston, J. C. Cai, T. C. Chuang, M. Bjerknes, H. Cheng,
K. Hay, S. Gallinger, B. Bapat, and T. W. Mak. 1996. Spontaneous intestinal
carcinomas and skin neoplasms in Msh2-deficient mice. Cancer Res. 56: 3842–
3849.
42. Baker, S. M., A. W. Plug, T. A. Prolla, C. E. Bronner, A. C. Harris, X. Yao, D.M. Christie, C. Monell, N. Arnheim, A. Bradley, et al. 1996. Involvement of
mouse Mlh1 in DNA mismatch repair and meiotic crossing over. Nat. Genet. 13:
336–342.
43. Baar, J., N. M. Pennell, and M. J. Shulman. 1996. Analysis of a hot spot for DNA
insertion suggests a mechanism for Ig switch recombination. J. Immunol. 157:
3430–3435.
44. Edelmann, W., K. Yang, A. Umar, J. Heyer, K. Lau, K. Fan, W. Liedtke,
P. E. Cohen, M. F. Kane, J. R. Lipford, et al. 1997. Mutation in the mismatch
repair gene Msh6 causes cancer susceptibility. Cell 91: 467–477.
45. Vuong, B. Q., M. Lee, S. Kabir, C. Irimia, S. Macchiarulo, G. S. McKnight, and
J. Chaudhuri. 2009. Specific recruitment of protein kinase A to the immunoglobulin locus regulates class-switch recombination. Nat. Immunol. 10: 420–426.
46. Rajagopal, D., R. W. Maul, A. Ghosh, T. Chakraborty, A. A. Khamlichi, R. Sen,
and P. J. Gearhart. 2009. Immunoglobulin switch mu sequence causes RNA
polymerase II accumulation and reduces dA hypermutation. J. Exp. Med. 206:
1237–1244.
47. Ucher, A. J., E. K. Linehan, G. W. Teebor, C. E. Schrader, and J. Stavnezer.
2012. The DNA glycosylases Ogg1 and Nth1 do not contribute to Ig class
switching in activated mouse splenic B cells. PLoS ONE 7: e36061.