TOXICOLOGICAL SCIENCES 86(2), 281–290 (2005)
doi:10.1093/toxsci/kfi204
Advance Access publication May 18, 2005
Di-n-Butyl Phthalate Activates Constitutive Androstane Receptor and
Pregnane X Receptor and Enhances the Expression of SteroidMetabolizing Enzymes in the Liver of Rat Fetuses
Michael E. Wyde,* Shaun E. Kirwan,* Fan Zhang,* Ashley Laughter,* Holly B. Hoffman,* Erika Bartolucci-Page,*
Kevin W. Gaido,* Bingfang Yan,† and Li You*,1
*CIIT Centers for Health Research, Research Triangle Park, North Carolina; †Department of Biomedical Sciences,
University of Rhode Island, Kingston, Rhode Island
Received March 17, 2005; accepted May 9, 2005
The plasticizer di-n-butyl phthalate (DBP) is a reproductive
toxicant in rodents. Exposure to DBP in utero at high doses alters
early reproductive development in male rats. Di-n-butyl phthalate
also affects hepatic and extrahepatic enzymes. The objectives of this
study were to determine the responsiveness of steroid-metabolizing
enzymes in fetal liver to DBP and to investigate the potential of
DBP to activate nuclear receptors that regulate the expression of
liver enzymes. Pregnant Sprague-Dawley rats were orally dosed
with DBP at levels of 10, 50, or 500 mg/kg/day from gestation days
12 to 19; maternal and fetal liver samples were collected on day 19
for analyses. Increased protein and mRNA levels of CYP 2B1, CYP
3A1, and CYP 4A1 were found in both maternal and fetal liver in
the 500-mg dose group. Di-n-butyl phthalate at high doses also
caused an increase in the mRNA of hepatic estrogen sulfotransferase and UDP-glucuronosyltransferase 2B1 in the dams but not in
the fetuses. Xenobiotic induction of CYP3A1 and 2B1 is known to
be mediated by the nuclear hormone receptors pregnane X receptor
(PXR) and constitutive androstane receptor (CAR). In vitro
transcriptional activation assays showed that DBP activates both
PXR and CAR. The main DBP metabolite, mono-butyl-phthalate
(MBP) did not interact strongly with either CAR or PXR. These
data indicate that hepatic steroid- and xenobiotic-metabolizing
enzymes are susceptible to DBP induction at the fetal stage; such
effects on enzyme expression are likely mediated by xenobioticresponsive transcriptional factors, including CAR and PXR. Our
study shows that DBP is broadly reactive with multiple pathways
involved in maintaining steroid and lipid homeostasis.
Key Words: di-n-butyl phthalate; CYP2B; CYP3A; CAR; PXR;
rat fetuses.
INTRODUCTION
Di-n-butyl phthalate (DBP) is a high-production-volume
chemical used as a plasticizer and solvent in numerous
1
To whom correspondence should be addressed at CIIT Centers for Health
Research, 6 Davis Drive, Research Triangle Park, NC 27709–2137. Fax: (919)
558-1300 . E-mail: [email protected].
consumer products. Humans are exposed to DBP through
contaminated food and occupational sources (Kavlock et al.,
2002). Data from the National Health and Nutrition Examination Survey (1999–2000) indicated that DBP exposure occurs in
the general U.S. population, including children and women of
child-bearing age (CDC, 2003); however, the estimated exposure levels are well under the Environmental Protection Agency
reference dose (RfD) of 0.1 mg/kg/day (USEPA, 2005).
Di-n-butyl phthalate has been demonstrated to be a reproductive toxicant in laboratory animals (Kavlock et al., 2002). Male
rats exposed to DBP at the perinatal stages develop adverse
responses, including reduced anogenital distance, hypospadias,
malformations of the epididymis and vas deferens, retention of
thoracic nipples or areolae, and Leydig cell hyperplasia or abnormal formation of the seminiferous cord (Foster et al., 2001;
Wine et al., 1997). These effects are proposed to manifest
through an antiandrogenic mechanism, since testosterone production was reduced in the fetal testes after DBP exposure
(Mylchreest et al., 1998, 2002; Shultz et al., 2001). In addition,
the ability of many phthalates to interact with peroxisome
proliferator–activated receptors (PPARa, b, c) may also represent a mechanism for the phthalate-caused reproductive toxicity;
but the evidence in this regard is not yet conclusive (Corton and
Lapinskas, 2005).
In addition to the toxic effects in the reproductive tract, DBP
exposure also causes an increase in liver weight and creates
hepatic lesions (Marsman, 1995; Wine et al., 1997). The
increase in liver organ weight is accompanied by enhanced
total cytochrome P450 (CYP) enzyme activity (Walseth and
Nilsen, 1986). Among the mediators for DBP-caused enzyme
induction are PPARs, which are known to be transcriptional
factors targeting P450 genes (Waxman, 1999; You, 2004). Din-butyl phthalate activates PPARa (Lapinskas et al., 2005) and
causes changes in the expression of a number of PPARaregulated genes (Fan et al., 1998; O’Brien et al., 2001; Wong
and Gill, 2002). The main metabolite of DBP, mono-n-butyl
phthalate (MBP), was shown to be inactive at both PPARa and
PPARc (Hurst and Waxman, 2003; Lapinskas et al., 2005). The
Ó The Author 2005. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved.
For Permissions, please email: [email protected]
282
WYDE ET AL.
inability of MPB to activate the PPARs suggests a possibility
that other transcriptional factors may be involved in the DBPassociated changes in hepatic enzyme expression.
Like PPAR, the constitutive active receptor (CAR) and the
pregnane X receptor (PXR) are nuclear receptors that are highly
enriched in the liver and that function as transcriptional
regulators for a number of metabolic enzymes (reviewed in
Handschin and Meyer, 2003; Wang and Negishi, 2003). Target
genes for CAR and PXR include the families of CYP 2B, CYP
3A, and UDP glucuronosyltransferases (UGT) (Honkakoski
et al., 1998; Lin and Wong, 2002; Wyde et al., 2003). These
genes are involved in the metabolism of drugs, toxicants, and
endogenous substances such as lipids, bile acids, and steroids
(Mohan and Heyman, 2003). Changes of steroid metabolism and
homeostasis may be an important component in the endocrine
and reproductive toxicities of phthalates. The objectives of this
study were to determine the responsiveness of steroid-metabolizing enzymes to DBP exposure and to establish relevant
mechanisms. We evaluated the expression levels in fetal liver
for CYP2B and 3A, UGT, and estrogen sulfotransferase (EST) in
response to DPB exposure; we also investigated the potential
of DBP to interact with nuclear receptors that regulate the
expression of these enzymes. We found that hepatic CYP2B and
CYP3A were inducible by DBP at the fetal stage, likely
as the result of a mechanism of xenobiotic activation of nuclear receptors CAR and PXR. Such enzyme modulations suggest a potential for DBP to interfere with steroid and lipid
homeostasis.
METHODS
Animals and treatment. Time-mated Sprague-Dawley female rats were
purchased from Charles River Laboratories (Raleigh, NC) and delivered on
gestation day (GD) 0, the day that sperm was detected in the vaginal smear.
Upon randomization into different treatment groups, the pregnant dams were
housed individually in plastic cages with dry cellulose bedding (Shepherd
Specialty Papers, Kalamazoo, MI). Rodent diet NIH-07 (Zeigler Brothers,
Gardners, PA) and reverse-osmosis water were provided ad libitum. Animals
were identified by ear tags and cage cards. The animal room was maintained
within a temperature range of 22–25°C, relative humidity of 50 ± 10%, and 12-h
light cycles (7:00–19:00). Body weight and food consumption of each dam
were recorded on a twice-weekly schedule.
Dams were treated with DBP (Aldrich, Milwaukee, WI) by daily gavage in
corn oil vehicle from GD 12 to GD 19. Di-n-butyl phthalate was administered at
dose levels of 0, 10, 50, or 500 mg/kg/day. All dams were euthanized by CO2
asphyxiation on GD 19 at 2 h following the last dose. Fetuses were removed by
cesarean section. All fetuses were euthanized by decapitation, and their sex was
determined by internal examination of the reproductive organs. The fetal livers
from male and female fetuses and liver tissue from the dams were snap-frozen
in liquid nitrogen and stored separately at 80°C. For analyses performed for
this report, liver samples were obtained from one male and one female fetus in
each pregnant dam; four dams were included in each treatment group.
Experimental details of this study were also described elsewhere (Lehmann
et al., 2004).
Protein immunoblotting. Immunoblotting was performed as previously
described (You et al., 1999) for the cytochrome P450 enzymes CYP 3A1, 2B1,
1A1, and 4A and nuclear receptors CAR, PXR, aryl hydrocarbon receptor
(AhR), and PPARa. For each treatment group, 4 samples, from fetuses of
different maternal sources, were included for analysis in two separate blots.
Total protein extracts from liver tissue were denatured and separated by sodium
dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) with 12%
polyacrylamide. Proteins were transferred to nitrocellulose membranes; transfer efficiency and equal loading of different samples were confirmed by visual
inspection of Ponceau Red staining. The membranes were then blocked for
nonspecific binding, and incubated with polyclonal primary antibodies for
CYP3A1, CYP2B1, CYP1A1, CYP4A, CAR, PXR, AhR, and PPARa. After
incubation with primary antibody, membranes were incubated with horseradish
peroxidase–linked anti-rabbit (CYP3A1, PXR, PPARa, and CAR) or anti-goat
(CYP1A1, CYP2B1, and CYP 4A1) IgG secondary antibodies and visualized
on film exposed to enhanced chemiluminescence (Hyperfilm-ECL, Amersham). Goat anti-rat polyclonal antibodies against rat CYP2B1 and CYP4A1
were obtained from Daiichi Pure Chemical Company (Tokyo, Japan). CYP3A1
antibodies were obtained from Research Diagnostics, Inc. (Flanders, NJ).
CYP1A1 antibody was obtained from Santa Cruz Biotechnology (Santa Cruz,
CA). The anti-PXR and anti-CAR antibodies were used as previously described
(Wyde et al., 2003). Rabbit anti-PPARa antibody (H-98) was obtained from
Santa Cruz Biotechnology (Santa Cruz, CA). The anti-AhR antibody was
obtained from Affinity Bioreagents (Golden, CO).
The relative protein amounts in identified immunoblot bands were estimated
by measuring the optical densities of the bands on exposed Autorad films, with
the NIH ImageJ software (Rasband, 2005). The measurements were background adjusted and the values were statistically analyzed.
Quantitative RT-PCR. To quantitate the amount of CYP 2B1 and 3A1
mRNA, cDNA was synthesized from total RNA isolated from liver tissue.
Random hexamers and the Taqman reverse transcription reagents (PE Applied
Biosystems, Foster City, CA) were used according to the manufacturer’s
protocol. The PCR primers were designed with Primer Express software
(PE Applied Biosystems). The design parameters were as follows: low Tm ¼
60°C, high Tm ¼ 64°C, optimum Tm ¼ 62°, amplicon length ¼ 80–150 bp, and
primer length 20–24 bp, with an optimum of 22 bp.
The production of a single PCR product was confirmed by gel electrophoresis for each pair of PCR primers before quantification. Primer efficiency was
determined according to the manufacturer’s suggested protocol. Real-time
quantitative PCR (Taqman) was performed on a 7700 PRISM Sequence
Detector (Applied Biosystems), using either SYBR Green (for CYP2B1,
CYP3A1, and PXR) or a probe sequence (for CAR, EST, and UGT2B1)
according to the manufacturer’s instructions, for quantification of relative gene
expression (User Bulletin no. 2: P/N 4303859). GAPDH was used as
a housekeeping gene for normalization. The primary and probe sequences
are listed in Table 1.
PXR and CAR transactivation assays. Transient transcriptional activation
assays for CAR and PXR have been described elsewhere (Wyde et al., 2003).
The assays for CAR and PXR transactivation assays were developed in
different laboratories using two different cell lines. Both assays have been
applied extensively and broadly (Yoshinari et al., 2001; Zhang et al., 1999);
both cell lines contain the receptor heterodimer partner RXR and are known to
support transcriptional activities of nuclear receptors. The choice of cell lines in
this study therefore was not expected to affect the basic results. Briefly, COS-7
cells were used for transient transfection assay of PXR activation. Pregnane X
receptor transfection was conducted by lipofection with LipofectAMINE
(Gibco/BRL) and 100 ng of rat PXR plasmid, 100 ng of reporter plasmid
(pGL-3 SV40 firefly luciferase containing two copies of rat PXR response
element [IR6 and DR6] in the promoter region), and 10 ng of pRL-TK plasmid
containing Renilla Luciferase. Assays to determine the activation of CAR were
based on co-transfection of HepG2 cells with the rat CAR expression vector
(Yoshinari et al., 2001), luciferase reporter plasmid [(NR1)5-tk-Luc], and pRLSV40 Renilla Luciferase (Wyde et al., 2003). Co-transfection of CAR and
reporter vectors used TransIT-LT1 reagents (Mirus, Madison, WI). For both the
PXR and the CAR assays, transfected cells were cultured for 24 h before being
283
PHTHALATE ACTIVATES NUCLEAR RECEPTORS CAR AND PXR
TABLE 1
Primer Sets and Probe Sequences for Real-Time Quantitative RT-PCR Analyses
Gene
Forward primer
Reverse primer
CYP2B1
CYP3A1
CAR
PXR
EST
UGT2B1
TGAGAACCTCATGATCCCTGC
CTCTTCACCGTGATCCACAGCACT
TTTGACCAGTTTGTGCAGTTCAGG
AAGACGGCAGCATCTGGAACT
GGCCAGATGACCTTCTCATTGT
CTGCAAGATGTCTATGAAACAGACTTC
AGGAAACCATAGCGGAGTGTGG
ATGCTGCCCTTGTT CTCCTTGC
TGAGCAGAGGCAACACGGG
ACGCCCTTGAACATGTAGGTTG
GCATTTTTCCACATCACCTTCTTT
CTGTGGGCCACACTAGCACTT
CAR
EST
UGT2B1
5#-CATCACCGGCCTTTCCAGCCCCTG-3#
5#-TGGCAGCACATGGA-3#
5#-AGCTCATATGCTACTTTAGAC-3#
Probe sequence
treated with DBP and MBP at various concentrations for an additional 24 h, and
the reporter enzyme activities were assayed with a Dual-Luciferase Reporter
Assay System (Promega, Madison, WI), in which the Renilla Luciferase was
used as transfection control. The firefly luciferase reporter activity was
normalized based on the transfection control. The treatment data were then
derived by normalizing to DMSO control values.
Statistics. All data are presented as means ± standard deviation. Significant
differences were determined by analysis of variance (ANOVA) and Dunnett’s
test ( p < 0.05).
RESULTS
A basal level expression of hepatic CYP 3A1 and 2B1
proteins was detected through immunoblotting in untreated
male and female Sprague-Dawley rat fetuses at GD 19
(Fig. 1A–1D). Treatment with DBP from GD 12 to 19 at the
maternal daily gavage dose of 500 mg/kg (but not at 10 mg/kg
and 50 mg/kg) increased significantly (p < 0.05) the hepatic
CYP 2B1 protein in both male and female fetuses (Fig. 1A and
1B). The level of hepatic 3A1 protein was not affected by
in utero exposure to DBP in either male or female fetuses
(Fig. 1C and 1D). A basal expression of CYP4A1 was also
detected in fetal liver; this CYP isoform is significantly induced
by DBP treatment in both female and male fetuses at the 500
mg/kg dose level (Fig. 1E and 1F). In several cases (female and
male CYP2B1 and male CYP4A1), the amounts of enzyme proteins seemed to decrease from the control group to the 5 mg/kg
and 50 mg/kg DBP groups before they became significantly
induced at the 500 mg/kg level. These downward trends were
not statistically significant.
Nuclear receptor CAR and PXR proteins were detectable in
the livers of both male and female rat fetuses at GD 19 (Fig. 2).
No difference in CAR protein level was observed in males or
females between control and DBP-treated fetuses (Fig. 2A and
2B). The level of PXR protein in GD 19 fetal liver was
increased in both male and female rats in the 500 mg/kg group
(Fig. 2C and 2D), whereas the doses of 10 and 50 mg DBP/kg
had no effect in this regard. The protein levels of hepatic
PPARa and CYP4A were also increased in both male and
female fetuses in the 500 mg/kg DBP group (data not shown).
The proteins of CAR, PXR, CYP 2B1, and CYP 3A1 were
detected in liver samples of the pregnant dams (data not
shown). The basal levels of these proteins in the maternal liver
were greatly enhanced beyond those observed in the fetal liver.
Di-n-butyl phthalate exposure did not cause an appreciable
change in the levels of CAR and PXR proteins; however, the
amounts of CYP2B1 and 3A1 were moderately increased in the
500 mg/kg dose group (data not shown).
Quantitative reverse transcriptase–polymerase chain reaction (RT-PCR) was performed to determine the amounts of
mRNA of CAR, PXR, CYP 2B1, CYP 3A1, and the steroidconjugating enzymes UGT2B1 and EST. Liver mRNA levels of
both CYP 2B1 and 3A1 were increased twofold in the dams
exposed to 500 mg DBP/kg compared to the controls (Fig. 3).
In addition, mRNA levels of EST were increased twofold and
threefold at the 50 and 500 mg/kg doses, respectively, whereas
the CAR mRNA was increased fourfold at the 500 mg/kg dose
level. In the male fetuses, hepatic CYP2B1 mRNA was
markedly increased by the 500 mg/kg DBP treatment, which
also increased the PXR mRNA (Fig. 3). Female fetuses showed
a response pattern identical to that of male fetuses, with both
CYP2B1 and PXR mRNA increases at similar dose–response
magnitudes (data not shown). No treatment-related differences
were detected in mRNA expression of CYP 3A1, UGT2B1,
EST, or CAR in fetal liver.
The ability of DBP to activate PXR and CAR was
investigated in cell lines transiently transfected with expression
plasmids for the receptors and luciferase reporters. Constitutive
androstane receptor activation was tested with rat CARtransfected HepG2 cells and a dual luciferase reporter assay,
whereas PXR activation was tested with PXR-transfected
COS-7 cells and a dual luciferase reporter assay. Both systems
have been used in numerous studies, and both were proven to
be sensitive and specific assay tools for detecting the activation
of the respective receptors (Wyde et al., 2003; Yoshinari et al.,
284
WYDE ET AL.
FIG. 1. Di-n-butyl phthalate increased CYP2B1 and 4A1 proteins in fetal liver. Immunoblot analyses of the effects of DBP exposure on fetal levels of CYP2B1
(A, B), CYP3A1 (C, D), and CYP4A1 (E, F) proteins in liver tissue of female and male Sprague-Dawley rat fetuses on GD 19 following daily gavage dosing of the
compound to pregnant dams from GD 14 to GD 19 at doses of 0, 10, 50, and 500 mg/kg body weight. The bar graphs indicate the optical density values (mean ± SD,
n ¼ 4) of the bands in the blots; two blots for each protein were used for quantification. *Significantly different from the control (ANOVA and Dunnett’s test,
p < 0.05). An increase of hepatic CYP2B1 and CYP 4A1 proteins in both male and female fetuses was evident. Aliquots of 20 lg total protein samples were
separated by SDS-PAGE and blotted with antibodies against the specific CYP isoforms. Each lane represents a sample from one fetus from one dam.
2001; Zhang et al., 1999). In the CAR assay, we used
androstenol (an inverse agonist) (Forman et al., 1998) to
repress the constitutive CAR activity and 1,1-dichloro-2,2-bis
(p-chlorophenyl)ethylene (DDE) as a positive control (Wyde
et al., 2003). Di-n-butyl phthalate treatment did not result in
CAR activation; rather, it caused slight inhibition of the CAR
transcriptional activity (Fig. 4A). Cells treated with the inverse
agonist androstenol (4 lM) demonstrated approximately an
80% inhibition in CAR transcriptional activity, and this
inhibition was reversed by DBP treatment in a dose-dependent
manner in the concentration range of 5 to 50 lM (Fig. 4B).
For PXR assays, we used pregnenolone 16-a-carbonitrile
(PCN) and rifampicin as rat and human PXR positive controls,
respectively (Zhang et al., 1999). The PXR transactivation
assay demonstrated an ability of DBP to activate both rat and
human PXR (Fig. 5). Activation of the rat PXR occurred at
a lower dose (5 lM) than that for human PXR (20 lM). The
peak activation of rat PXR occurred at 20 lM of DBP; that of
human PXR, at 50 lM.
The ability of MBP, the main hydrolytic product of DBP,
to activate PXR and CAR was also investigated. Mono-
butyl-phthalate treatment did not increase the CAR receptor
activity. nor did it reverse the repression of CAR by androstenol
(Fig. 6A and 6B). Mono-butyl-phthalate treatment did, however, increase rat (but not human) PXR activation approximately twofold at the concentration of 50 lM (Fig 6C and 6D);
this increase, however, was much smaller than the 8-fold
induction caused by DBP (Fig. 5A).
DISCUSSION
At the fetal stage, the developing animal is particularly
sensitive to reproductive effects of DBP, which can manifest at
maternal doses that are without apparent effect on the dam
(Mylchreest et al., 1998, 1999; Parks et al., 2000). In fetal
testes, DBP exposure represses the genes involved in steroidogenesis, resulting in reduced androgen production (Lehmann
et al., 2004; Mylchreest et al., 2002; Parks et al., 2000). The
current study demonstrated that fetal liver, like fetal testis, is
also susceptible to DBP through maternal exposure. We also
demonstrated that DBP activates CAR and PXR, in addition to
285
PHTHALATE ACTIVATES NUCLEAR RECEPTORS CAR AND PXR
FIG. 2. Di-n-butyl phthalate increased PXR protein in fetal liver. Immunoblot analyses of the effects of DBP exposure on the fetal levels of CAR (A, B) and
PXR (C, D) proteins in the liver tissue of female and male Sprague-Dawley rat fetuses on GD 19 following daily gavage dosing of the compound to pregnant dams
from GD 14 to 19 at doses of 0, 10, 50, and 500 mg/kg body weight. The bar graphs indicate the optical density values (mean ± SD, n ¼ 4) of the bands in the blots;
two blot for each protein were used for quantification. *Significantly different from the control (ANOVA and Dunnett’s test, p < 0.05). An increase of hepatic PXR
protein in both male and female fetuses was evident. Aliquots of 20 lg total protein samples were separated by SDS-PAGE and blotted with antibodies against the
receptor proteins. Each lane represents a sample from one fetus from one dam.
being a known activator of PPARa; these nuclear receptors are
likely among the key regulators for DBP effects on liver enzymes.
The no-observable-adverse-effect level (NOAEL) of DBPcaused reproductive development effects in male rats was
established at the 50 mg/kg maternal gavage dose (Mylchreest
et al., 2000), whereas the lowest-observable-adverse-effect level (LOAEL) of DBP-caused inhibition on the expression of testicular steroidogenic genes was determined to be the 50 mg/kg
maternal gavage dose (Lehmann et al., 2004). The current
study detected DBP effects on the metabolic apparatus in the
maternal and fetal liver at the 500 mg/kg dose level in proteins
(CYP2B1 and PXR) and at the 50 mg/kg dose level in mRNA
(CYP3A1, CYP2B1, and EST in the dams and CYP2B1 and
PXR in the fetuses). The Lehmann et al. study (2004) demonstrated coordinated changes in gene expression of key testicular steroidogenic factors and testosterone production at
the 50 mg/kg dose level. We do not know whether the similar
sensitivities to DBP treatment of hepatic-metabolizing enzymes and testicular steroidogenic enzymes are based on
shared mechanisms in the liver and testis.
5
Fold Change
4
3
2
10
50
500
10
50
500
10
50
500
10
50
500
10
50
500
10
50
500
10
50
500
10
50
500
10
50
500
10
50
500
10
50
500
10
50
500
1
CYP2B1 CYP3A1 UGT2B1
CYP2B1 CYP3A1 UGT2B1
EST
Dam
CAR
PXR
EST
CAR
PXR
Male Pup
FIG. 3. Di-n-butyl phthalate increased mRNA levels of several metabolic enzymes and nuclear receptors in maternal fetal liver. Quantitative RT-PCR analyses
of the effects of DBP exposure on mRNA levels of CYP2B1, CYP3A1, UGT2B1, EST, CAR, and PXR in liver tissue samples of the dams and male fetuses
following daily gavage dosing of the compound to pregnant dams from GD 14 to 19 at doses of 0, 10, 50, and 500 mg/kg body weight. Samples were run in
triplicate for each liver sample that represents either a dam or one fetus in a dam. The average of the triplicate was normalized to GAPDH and expressed as fold
change relative to the control. Female fetal samples had similar results to the male samples (not shown).
286
WYDE ET AL.
CAR
Without androstenol
A
1800
180
*
1600
Percentage of Control
160
140
120
100
80
60
40
1400
1200
1000
*
800
600
*
*
*
400
200
20
25
50
DM
E
10
5
N
0.5
1
5
10
20
50
DBP (µM)
DBP (µM)
dro
ste
DD
no
l
SO
DM
1
SO
0
0
PC
Percentage of Control
PXR (Rat)
A
PXR (Human)
An
B
600
*
CAR
With androstenol
120
*#
60
*#
#
*#
400
300
*
200
*
100
40
*
pic
0.5
1
5
10
20
50
DBP (µM)
Rif
DM
in
0
am
*
20
SO
Percentage of Control
100
80
*
500
Percentage of Control
B
l
no
ste
dro
1
5
10
20
50
DBP (µM)
An
DM
SO
0
FIG. 4. Effects of DBP on rat CAR transactivation. HepG2 cells were
cotransfected with plasmids for rat CAR and pRL-SV40 and a (NR1)5-tkluciferase reporter plasmid. Cells were incubated with different concentrations
of DBP for 24 h before being assayed for dual luciferase activities. Data
showing transactivation by DBP in the absence (A) and presence (B) of the
inverse agonist androstenol (4 lM). In the B panel, all the DBP treatment was
carried in combination with androstenol. The DMSO bar represents the control
value (constitutive CAR activity when cells were treated with DMSO vehicle
only) for both A and B panels. *Significantly different from DMSO control and
#significantly different from androstenol alone, as determined by ANOVA and
Dunnett’s test ( p < 0.05).
Phthalates belong to a class of peroxisome proliferator
chemicals. Exposure to those chemicals evokes a set of
pleiotropic responses that include hepatocellular hypertrophy,
hyperplasia, and induction of metabolic enzymes in rodent
liver (Lock et al., 1989); these effects are known to be mediated
mainly through PPARa (Reddy and Hashimoto, 2001). The
ability of DBP to activate PPARa was demonstrated in an
in vitro reporter gene transactivation assay (Lapinskas et al.,
2005). This activation of PPARa explains a DBP-caused
FIG. 5. Effects of DBP on PXR transactivation. COS-7 cells were cotransfected with plasmids for rat or human PXR, pGL-SV40 firefly luciferase
gene with IR6 and DR6 PXR response elements in the promoter, and pRL-tk
Renilla Luciferase. Cells were incubated with different concentrations of DBP
for 24 h before being assayed for dual luciferase activities. Data show
transactivation by DBP of rat PXR (A) and human PXR (B). PCN (10 lM)
was used as a positive control for rat CAR (A); rifampicin (10 lM) was used as
a positive control for human CAR (B). The DMSO bar represents the control
value of the PXR activity when the cells were treated with DMSO vehicle only.
*Significantly different from DMSO control as determined by ANOVA and
Dunnett’s test (p < 0.05).
increase in hepatic CYP4A expression (Lapinskas et al.,
2005), since CYP4A is a well-characterized target gene of
PPARa (Lee et al., 1995; Ripp et al., 2002). As expected, the
present study found that DBP exposure induced hepatic
CYP4A1, and this induction, presumably mediated by PPARa,
was operative at the fetal stage.
However, PPARa activation cannot explain the induction of
CYP2B1 and 3A1 by DBP in the present study. In PPARa-null
mouse, CYP3A11, a mouse homolog of the rat CYP3A1 gene, is
inducible by xenobiotics (Ripp et al., 2002). In contrast, CYP2B
was not inducible in CAR-null mouse, and CYP3A was not
inducible in PXR-null mouse (Sonoda and Evans, 2003).
287
PHTHALATE ACTIVATES NUCLEAR RECEPTORS CAR AND PXR
CAR (Rat)
Without androstenol
A
120
Percentage of Control
100
80
60
40
20
10
5
1
MBP (µM)
PXR (Rat)
C
80
60
40
20
0
50
Ve
ct
or
C
on
tro
l
DM
SO
0
100
D
An MS
O
dr
os
te
no
l
Percentage of Control
120
D
1600
10
5
1
20
50
MBP (µM)
PXR (Human)
600
1200
1000
800
600
400
200
0.5
1
*
*
5
10 20 50
MBP (µM)
400
300
200
100
0
0.5
1
5
10
20
50
MBP (µM)
Ri
PC
N
DM
SO
0
*
*
500
DM
S
fam O
pic
in
*
1400
Percentage of Control
Percentage of Control
CAR (Rat)
With androstenol
B
FIG. 6. Effects of MBP on the transactivation of rat CAR and PXR and human PXR. Constitutive androstane receptor was constitutively active compared
to the vector control, but MBP did not increase the transcriptional activity of rat CAR (A) or reverse a repression of CAR activity by the inverse agonist androstenol
(4 lM) (B). MBP had limited activity at rat PXR, increasing the activity about twofold (C), but did not activate human PXR (D). PCN and rifampicin were used as
positive controls for rat and human PXR, respectively. *Significantly different from DMSO control, ANOVA, and Dunnett’s test ( p < 0.05).
Constitutive androstane receptor and PXR regulate hepatic
genes, including the CYP2B and 3A families (Wang and Negishi,
2003; Wei et al., 2002). Thus, activation of PXR and CAR, but
not PPARa, was likely required for the CYP3A1 and 2B1
induction in fetal rat liver by DBP. Indeed, DBP was shown to
enhance the expression of hepatic CYP2B and 3A, whereas the
PPARa agonist Wy-14,643 did not (Fan et al., 2004), further
supporting that activating PXR and CAR, rather than PPARa, is
responsible for the DPB effects. We have demonstrated in the
present study that DBP interacts directly with CAR and PXR;
such interactions are highly likely to be the mechanisms for DBP
induction of genes in the CYP2B and 3A families (Wang and
Negishi, 2003; Wei et al., 2002). The manner in which DBP
activates PXR resembles the activation of PXR by DDE (Wyde
et al., 2003). Di-n-butyl phthalate interacts differently with CAR
than with PXR. Although DBP did not change the constitutive
activity of CAR, it reversed the androstenol-imposed CAR
repression; this type of CAR activation has been shown for
other CAR activators as well (Blizard et al., 2001). Although we
did not examine enzyme activities in these experiments,
transcriptional increase of the hepatic CYP enzymes is known
to correlate well with their protein levels and catalytic activities
(Fan et al., 2004; Wyde et al., 2003; You et al., 1999).
We noted that, at the lower doses of DPB used in this study
(5 mg/kg and 50 mg/kg), the protein amounts of several CYP
isoforms seemed to be reduced, contrary to inductions at 500
mg/kg dose level. Similar reduction of CYP3A1 was previously reported to be associated with treatment with DDE and
mifepristone (RU486), both PXR activators (Schuetz et al.,
2000; Wyde et al., 2003). One potential mechanism for DBP
to have such a seemingly biphasic effect on CYP expression is
the mediation of glucocorticoid actions. The glucocorticoid
receptor (GR) is essential for both basal and stimulated
expression of CYP2B (Schuetz et al., 2000). Glucocorticoidreceptor–enhanced CYP expression is not mediated through
cis-acting element but through complex protein–protein interactions (Honkakoski and Negishi, 2000). Activation of GR
results in enhanced expression of PXR and RXR (Pascussi
et al., 2000); the latter is the heterodimer partner of both PXR
and CAR. Di-n-butyl phthalate may thus act either through an
inhibition on steroidogenesis (reducing glucocorticoid level) or
through displacement of endogenous activators at PXR (and
possibly other CYP-regulating nuclear receptors) to cause
reduction in certain CYP isoforms at specific doses.
Phthalic acid was reported to promote PXR interaction with
steroid hormone receptor coactivator-1 (SRC-1), to increase
288
WYDE ET AL.
PXR transcriptional activity in reporter gene assay, and to
induce CYP3A1 in adult male rat liver (Masuyama et al.,
2000). In the current study, we demonstrated that fetal liver is
also susceptible to the effects of phthalates in regard to
metabolic enzyme induction. We detected the proteins of
CAR, PXR, AhR, and PPARa in fetal liver tissue. These
receptors function as ligand-responsive transcriptional factors
regulating hepatic induction of CYP2B1, 3A1, 1A1, and 4A1 in
the rat. Constitutive androstane receptor and PXR also crossregulate the CYP2B1 and 3A1 genes (Honkakoski et al., 2003).
Detection of these receptor regulators of hepatic CYP enzymes
at the fetal stage suggests physiological roles of these receptors
in sensing and regulating the fetal environment. Although the
CYP enzymes are regulated by ligand activation of these
receptors, treatment-caused changes in receptor expression
level may also play a role in controlling target gene expression.
By examining the relationship between nuclear receptor
expression and their target enzyme expression, we found no
consistent coupling between increase in receptor expression
and increase in enzyme expression.
A number of hepatocyte-enriched transcription factors are
essential in coordinating gene expression during fetal liver
differentiation (Cereghini, 1996); the differentiation process is
necessary for the developing liver to acquire metabolic
capacity. Hepatocyte nuclear factor-4a (HNF4a) is a transcriptional coregulator of CAR and PXR for the human CYP3A4
gene (Tirona et al., 2003). In addition, HNF4a is a transcriptional factor for the PXR gene in fetal hepatocytes (Kamiya
et al., 2003). In the present study, DBP treatment enhanced the
expression of PXR and PPARa. Whether DBP interacts with
hepatic transcriptional factors such as HNF4a remains to be
seen; such interaction, if exists, would provide a mechanism for
DBP-caused changes in the expression of PXR and PPARa.
Di-n-butyl phthalate toxicity is attributed in large part to
MBP, a major hydrolysis product of DBP in vivo (Kavlock
et al., 2002). In contrast to the ability of DBP to activate CAR
and PXR, MBP showed little or no ability to activate these
receptors. Similarly, MBP activation of PPARa was reported to
be insignificant (Lapinskas et al., 2005). The fact that only very
high doses of DBP caused induction of CYP enzymes suggests
the possibility that a portion of the parent compound may
escape the initial metabolism at high doses, that it may reach
fetal liver cells, and that it may activate the corresponding
receptors. Another possibility is that MBP may alter gene
expression of CYP enzymes through mechanisms that are
receptor independent.
In addition to CYP enzymes, CAR and PXR also regulate the
expression of conjugating enzymes in the families of glutathione S-transferases (GST), UDP-glucuronosyltransferases
(UGT), sulfotransferases (SULT), and multidrug-resistance–
associated proteins (MRP) (Maglich et al., 2002; Xie et al.,
2003). Although we detected only a slight change of UGT2B1
mRNA in dam liver (but not in fetuses), we found greater
changes (over twofold and threefold at 50 and 500 mg/kg
doses) for the expression of estrogen sulfotransferase. The
induction of sulfotransferase is likely a consequence of
activating CAR, instead of PXR, because the rat CAR activator
TCPOBOP, but not the rat PXR activator PCN, was shown to
be associated with regulating sulfotransferase expression
(Maglich et al., 2002). The effects of phthalate on UGTs and
SULTs are important, because the conjugating reactions catalyzed by these enzymes render the many endogenous molecules and chemical metabolites highly hydrophilic and easily
excreted from the body (You, 2004). The lack of response
in conjugating enzyme expression to DBP in the fetal liver
suggests that a change in these conjugation pathways is not
a significant factor in regulating hormone activities in the
fetuses.
Although there may be implications with regard to developmental dysregulation, the significance of fetal liver effects
caused by DBP after maternal exposure remains to be
adequately appraised. The diverse nature of DBP interaction
with nuclear receptors PXR, CAR, and PPARa, among
possible others, and the extensive involvement of these nuclear
receptors in regulating numerous metabolic pathways suggest
broad potentials of DBP modulation on the metabolism of
lipids, steroids, and other biological processes, including lipid
homeostasis, cholesterol metabolism, and steroidogenesis in
the gonads.
ACKNOWLEDGMENTS
This research was funded by the American Chemistry Council Long-Range
Research Initiative (to L.Y.) and a National Institutes of Health grant (R01GM61988) (to B.Y.). We thank Drs. Susan Borghoff and Kamin Johnson for
reading the manuscript and Dr. Barbara Kuyper for editorial review. Conflict
of interest: none declared.
REFERENCES
Blizard, D., Sueyoshi, T., Negishi, M., Dehal, S. S., and Kupfer, D. (2001).
Mechanism of induction of cytochrome p450 enzymes by the proestrogenic
endocrine disruptor pesticide—methoxychlor: Interactions of methoxychlor
metabolites with the constitutive androstane receptor system. Drug Metab.
Dispos. 29, 781–785.
CDC (Centers for Disease Control and Prevention). (2003). The National
Report on Human Exposure to Environmental Chemicals: Phthalate. http://
www.cdc.gov/exposurereport/2nd/phthalates.htm. Accessed March 14, 2005
Cereghini, S. (1996). Liver-enriched transcription factors and hepatocyte
differentiation. FASEB J. 10, 267–282.
Corton, J. C., and Lapinskas, P. J. (2005). Proxisome proliferator-activated
receptors: Mediators of phthalate ester–induced effects in the male reproductive tract? Toxicol. Sci. 83, 4–17.
Fan, L-Q., Cattley, R. C., and Corton, J. C. (1998). Tissue-specific induction of
17 beta-hydroxysteroid dehydrogenase type IV by peroxisome proliferator
chemicals is dependent on the peroxisome proliferator–activated receptor
alpha. J. Endocrinol. 158, 237–246.
Fan, L-Q., You, L., Brown-Borg, H., Brown, S., Edwards, R. J., and Corton, J. C.
(2004). Regulation of phase I and phase II steroid metabolism enzymes
by PPARa activators. Toxicology 204, 109–121.
PHTHALATE ACTIVATES NUCLEAR RECEPTORS CAR AND PXR
Forman, B. M., Tzameli, I., Choi, H. S., Chen, J., Simha, D., Seol, W., Evans, R. M.,
Moore, D. D. (1998). Androstane metabolites bind to and deactivate the
nuclear receptor CAR-beta. Nature 395, 612–615.
Foster, P. M., Mylchreest, E., Gaido, K. W., and Sar, M. (2001). Effects of
phthalate esters on the developing reproductive tract of male rats. Hum.
Reprod. 7, 231–235.
289
Mylchreest, E., Sar, M., Cattley, R. C., and Foster, P. M. (1999). Disruption of
androgen-regulated male reproductive development by di(n-butyl) phthalate
during late gestation in rats is different from flutamide. Toxicol. Appl.
Pharmacol. 156, 81–95.
Handschin, C., and Meyer, U. A. (2003). Induction of drug metabolism: The
role of nuclear receptors. Pharmacol. Rev. 55, 649–673.
Mylchreest, E., Wallace, D. G., Cattley, R. C., and Foster, P. M. (2000). Dosedependent alterations in androgen-regulated male reproductive development
in rats exposed to di(n-butyl) phthalate during late gestation. Toxicol. Sci. 55,
143–151.
Honkakoski, P., Zelko, I., Sueyoshi, T., and Negishi, M. (1998). The nuclear
orphan receptor CAR-retinoid X receptor heterodimer activates the phenobarbital-responsive enhancer module of the CYP2B gene. Mol. Cell Biol.
18, 5652–5658.
Mylchreest, E., Sar, M., Wallace, D. G., and Foster, P. M. (2002). Fetal
testosterone insufficiency and abnormal proliferation of Leydig cells and
gonocytes in rats exposed to di(n-butyl) phthalate. Reprod. Toxicol. 16,
19–28.
Honkakoski, P., and Negishi, M. (2000). Regulation of cytochrome P450 (CYP)
genes by nuclear receptors. Biochem. J. 15, 321–337.
O’Brien, M. L., Cunningham, M. L., Spear, B. T., and Glauert, H. P.
(2001). Effects of peroxisome proliferators on glutathione and glutathione-related enzymes in rats and hamsters. Toxicol. Appl. Pharmacol. 171,
27–37.
Honkakoski, P., Sueyoshi, T., and Negishi, M. (2003). Drug-activated nuclear
receptors CAR and PXR. Ann. Med. 35, 172–182.
Hurst, C. H., and Waxman, D. J. (2003). Activation of PPARalpha and
PPARgamma by environmental phthalate monoesters. Toxicol. Sci. 74,
297–308.
Kamiya, A., Inoue, Y., and Gonzalez, F. J. (2003). Role of the hepatocyte
nuclear factor 4alpha in control of the pregnane X receptor during fetal liver
development. Hepatology 37, 1375–1384.
Kavlock, R., Boekelheide, K., Chapin, R., Cunningham, M., Faustman, E.,
Foster, P., Golub, M., Henderson, R., Hinberg, I., Little, R. et al. (2002). NTP
Center for the Evaluation of Risks to Human Reproduction: Phthalates expert
panel report on the reproductive and developmental toxicity of di-n-butyl
phthalate. Reprod. Toxicol. 16, 489–527.
Lapinskas, P. J., Brown, S., Leesnitzer, L. M., Blanchard, S., Swanson, C.,
Cattley, R. C., and Corton, J. C. (2005). Role of PPARalpha in mediating
the effects of phthalates and metabolites in the liver. Toxicology 207,
149–163.
Lee, SS-T., Pineau, T., Drago, J., Lee, E. J., Owens, J. W., Kroetz, D. L.,
Fernandez-Salguero, P. M., Westphal, H., and Gonzalez, F. J. (1995).
Targeted disruption of the a isoform of the peroxisome proliferator–activated
receptor gene in mice results in abolishment of the pleiotropic effects of
peroxisome proliferators. Mol. Cell Biol. 15, 3012–3022.
Lehmann, K. P., Phillips, S., Sar, M., Foster, P. M., and Gaido, K. W. (2004).
Dose-dependent alterations in gene expression and testosterone synthesis in
the fetal testes of male rats exposed to Di (n-butyl) phthalate. Toxicol. Sci.
81, 60–68.
Lin, J. H., and Wong, B. K. (2002). Complexities of glucuronidation affecting
in vitro in vivo extrapolation. Curr. Drug Metab. 3, 623–646.
Lock, E. A., Mitchell, A. M., and Elcombe, C. R. (1989). Biochemical
mechanisms of induction of hepatic peroxisome proliferation. Annu. Rev.
Pharmacol. Toxicol. 29, 145–163.
Maglich, J. M., Stoltz, C. M., Goodwin, B., Hawkins-Brown, D., Moore, J. T.,
and Kliewer, S. A. (2002). Nuclear pregnane X receptor and constitutive
androstane receptor regulate overlapping but distinct sets of genes involved
in xenobiotic detoxification. Mol. Pharmacol. 62, 638–646.
Marsman, D. (1995). NTP Technical Report on the toxicity studies of dibutyl
phthalate (CAS No. 84–74–2) administered in reed to F344/N rats and
B6C3F1 mice. Toxicol. Rep. Ser. 30, 1–G5.
Masuyama, H., Hiramatsu, Y., Kunitomi, M., Kudo, T., and MacDonald, P. N.
(2000). Endocrine disrupting chemicals, phthalic acid and nonylphenol,
activate pregnane X receptor-mediated transcription. Mol. Endocrinol.
14, 421–428.
Mohan, R., and Heyman, R. A. (2003). Orphan nuclear receptor modulators.
Curr. Top. Med. Chem. 3, 1637–1647.
Mylchreest, E., Cattley, R. C., and Foster, P. M. (1998). Male reproductive tract
malformations in rats following gestational and lactational exposure to
di(n-butyl) phthalate: An antiandrogenic mechanism? Toxicol. Sci. 43, 47–60.
Parks, L. G., Ostby, J. S., Lambright, C. R., Abbott, B. D., Klinefelter, G. R.,
Barlow, N. J., and Gray, L. E., Jr. (2000). The plasticizer diethylhexyl
phthalate induces malformations by decreasing fetal testosterone synthesis
during sexual differentiation in the male rat. Toxicol. Sci. 58, 339–349.
Pascussi, J., Gerbal-Chaloin, S., Pichard-Garcia, L., Fabre, J., Maurel, P., and
Vilarem, M. (2000). Dexamethasone induces pregnane X receptor and
retinoid X receptor-a expression in human hepatocytes: Synergistic increase
of CYP3A4 induction by pregnane X receptor activators. Mol. Pharmacol.
58, 361–372.
Reddy, J. K., and Hashimoto, T. (2001). Peroxisomal beta-oxidation and
peroxisome proliferator-activated receptor alpha: An adaptive metabolic
system. Annu. Rev. Nutr. 21, 193–230.
Ripp, S. L., Fitzpatrick, J. L., Peters, J. M., and Prough, R. A. (2002). Induction
of CYP3A expression by dehydroepiandrosterone: Involvement of the
pregnane X receptor. Drug Metab. Dispos. 30, 570–575.
Rasband, W. S. (2005). ImageJ. U. S. National Institutes of Health, Bethesda,
Maryland, USA, http://rsb.info.nih.gov/ij/.
Schuetz, E. G., Schmid, W., Schutz, G., Brimer, C., Yasuda, K., Kamataki, T.,
Bornheim, L., Myles, K., and Cole, T. J. (2000). The glucocorticoid receptor
is essential for induction of cytochrome P-4502B by steroids but not for drug
or steroid induction of CYP3A or P-450 reductase in mouse liver. Drug
Metab. Dispos. 28, 268–278.
Shultz, V. D., Phillips, S., Sar, M., Foster, P. M., and Gaido, K. W. (2001).
Altered gene profiles in fetal rat testes after in utero exposure to di(n-butyl)
phthalate. Toxicol. Sci. 64, 233–242.
Sonada, J., and Evans, R. M. (2003). Biological function and mode of action of
nuclear xenobiotic receptors. Pure Appl. Chem. 75, 1733–1742.
Tirona, R. G., Lee, W., Leake, B. F., Lan, L. B., Cline, C. B., Lamba, V., Parviz, F.,
Duncan, S. A., Inoue, Y., Gonzalez, F. J. et al. (2003). The orphan
nuclear receptor HNF4alpha determines PXR- and CAR-mediated
xenobiotic induction of CYP3A4. Nat. Med. 9, 220–224.
USEPA (United States Environmental Protection Agency). (2005). IRIS
website (http://www.epa.gov/iris/subst/0038.htm). Accessed March 8, 2005.
Walseth, F., and Nilsen, O. G. (1986). Phthalate esters: Effects of orally
administered dibutylphthalate on cytochrome P-450 mediated metabolism in
rat liver and lung. Acta Pharmacol. Toxicol. (Copenh.) 59, 263–269.
Wang, H., and Negishi, M. (2003). Transcriptional regulation of cytochrome
p450 2B genes by nuclear receptors. Curr. Drug Metab. 4, 515–525.
Waxman, D. J. (1999). P450 gene induction by structurally diverse xenochemicals: Central role of nuclear receptors CAR, PXR, and PPAR. Arch.
Biochem. Biophys. 369, 11–23.
Wei, P., Zhang, J., Dowhan, D. H., Han, Y., and Moore, D. D. (2002). Specific
and overlapping functions of the nuclear hormone receptors CAR and PXR
in xenobiotic response. Pharmacogenomics J. 2, 117–126.
290
WYDE ET AL.
Wine, R. N., Li, L. H., Barnes, L. H., Gulati, D. K., and Chapin, R. E. (1997).
Reproductive toxicity of di-n-butylphthalate in a continuous breeding
protocol in Sprague-Dawley rats. Environ. Health Perspect. 105, 102–107.
Wong, J. S., and Gill, S. S. (2002). Gene expression changes induced in mouse
liver by di(2-ethylhexyl) phthalate. Toxicol. Appl. Pharmacol. 185, 180–196.
Wyde, M. E., Bartolucci, E., Ueda, A., Zhang, H., Yan, B., Negishi, M., and
You, L. (2003). The environmental pollutant 1,1-dichloro-2,2-bis (pchlorophenyl)ethylene induces rat hepatic cytochrome P450 2B and 3A
expression through the constitutive androstane receptor and pregnane X
receptor. Mol. Pharmacol. 64, 474–481.
Xie, W., Yeuh, M. F., Radominska-Pandya, A., Saini, S. P., Negishi, Y.,
Bottroff, B. S., Cabrera, G. Y., Tukey, R. H., and Evans, R. M. (2003).
Control of steroid, heme, and carcinogen metabolism by nuclear pregnane X
receptor and constitutive androstane receptor. Proc. Natl. Acad. Sci. U.S.A.
100, 4150–4155.
Yoshinari, K., Sueyoshi, T., Moore, R., and Negishi, M. (2001). Nuclear
receptor CAR as a regulatory factor for the sexually dimorphic induction
of CYP2B1 gene by phenobarbital in rat livers. Mol. Pharmacol. 59,
278–284.
You, L., Chan, S. K., Bruce, J. M., Archibeque-Engle, S., Casanova, M.,
Corton, J. C., and Heck, H. (1999). Modulation of testosterone-metabolizing
hepatic cytochrome P-450 enzymes in developing Sprague-Dawley rats
following in utero exposure to p,p#-DDE. Toxicol. Appl. Pharmacol. 158,
197–205.
You, L. (2004). Steroid hormone biotransformation and xenobiotic induction
of hepatic steroid metabolizing enzymes. Chem.-Biol. Interact. 147,
233–246.
Zhang, H., LeCulyse, E., Liu, L., Hu, M., Matoney, L., Zhu, W., and Yan, B.
(1999). Rat pregnane X receptor: Molecular cloning, tissue distribution, and
xenobiotic regulation. Arch. Biochem. Biophys. 368, 14–22.