Molecular Genetics Review Questions Use the word bank to fill in the blanks. Put the correct number in the space provided. 1 primase 6 phosphate bonds 11 reannealing 16 Okazaki fragments 2 continuously 7 DNA ligase 12 toward 17 primers 3 excises 8 replication fork 13 phosphodiester bond 18 hydrogen bonds 4 complementary parent 9 away from 14 RNA 19 DNA polymerase I 5 proofread 10 3’ end 15 discontinuously 20 DNA polymerase III The enzyme helicase breaks the _____ holding the two _____ strands together, resulting in an unzipped helix that terminates at the ____. Single-­‐stranded binding proteins anneal to the newly exposed template strands, preventing them from____. The enzyme _____lays down _____ primers that will be used by _____ as a starting point to build the new complementary strands. DNA polymerase III adds the appropriate deoxyribonucleoside triphosphates to the _____ of the new strand using the template strand as a guide. The energy in the breaking of the _____ is used to drive the process. The leading strand is built _____ _____ the replication fork. A lagging strand composed of short segments of DNA, known as_____, is built _____ _____ the replication fork. DNA polymerase I _____the RNA _____ and replaces them with the appropriate deoxyribonucleotides. _____ joins the gaps in the Okazaki fragments by the creation of a _____. _____ and DNA polymerase III _____ by excising incorrectly paired nucleotides at the end of the complementary strand and adding the correct nucleotides Label the following diagram by putting the letter on the corresponding part of the diagram. a) helicase e) primase b) single stranded binding proteins c) DNA polymerase III f) RNA primer g) Okazaki fragment h) leading strand d) DNA ligase i) lagging strand What is the purpose of PCR? List the steps of a cycle of PCR in order. What is the Central Dogma? What does the “ m ” in mRNA stand for? What does the “ t ” in tRNA stand for? What is the region upstream of the transcription unit called? What two nitrogenous bases are in abundance in this region? Identify a transcription factor by name. What enzyme binds to the transcription factors to start transcription? Is the sense strand the coding strand or template strand? Is the antisense strand the coding strand or template strand? Is helicase required to unwind DNA during transcription? What are the two modifications made to the primary transcript after transcription? Thoroughly review the Virtual Cell Animations on transcription, mRNA processing, splicing & translation. Examine the stretch of DNA below: 5’ tggccgatgccctccaatcgcgcgaaaccttttatttgacaccccgcg 3’ This is the primary transcript. The exons are in bold. Show this transcript after the intron has been spliced out. Circle the start and stop codons. Use the genetic code on page 240 to show the polypeptide encoded by the final transcript. Mutation 1: 5’ tggccgatgacctccaatcgcgcgaaaccttttatttgacaccccgcg 3’ What kind of mutation is this and would it be definitely harmful, possibly harmful or not harmful? Mutation 2: 5’ tggccgatgcgcctccaatcgcgcgaaaccttttatttgacaccccgcg 3’ What kind of mutation is this and would it be definitely harmful, possibly harmful or not harmful? Mutation 3: 5’ tggccgatgccctccaatcgcgcgaaaccttattatttgacaccccgcg 3’ What kind of mutation is this and would it be definitely harmful, possibly harmful or not harmful? Create a mutation of your own that would be not harmful at all due to wobble. Examine the 5800 bp plasmid below. What fragments would be generated from the following digestions: Remember to inspect the entire map, it is possible for enzymes to cut a plasmid more than once. KpnI KpnI & BamHI EcoRI KpnI & EcoRI