Synthetic Retinoid Am80 Reduces Scavenger Receptor
Expression and Atherosclerosis in Mice by Inhibiting IL-6
Norifumi Takeda, Ichiro Manabe, Takayuki Shindo, Hiroshi Iwata, Satoshi Iimuro,
Hiroyuki Kagechika, Koichi Shudo, Ryozo Nagai
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Background—Macrophage scavenger receptors facilitate the uptake of modified low-density lipoprotein (LDL), formation
of foam cells, and development of atherosclerosis. Given that proinflammatory cytokines, including IL-6, can modulate
the macrophage foaming process, the aim of the present study was to determine whether the synthetic retinoic acid
receptor-␣/␤-specific agonist Am80, which is also an IL-6 inhibitor, can modulate macrophage lipid accumulation and
foam cell formation.
Methods and Results—Am80 suppressed IL-6 production induced by 12-myristate 13-acetate (PMA) or angiotensin II in
mouse Raw264 macrophages. It also suppressed expression of the 2 major scavenger receptors (scavenger receptor-A
[SR-A] and CD36), in part by inhibiting IL-6, and inhibited macrophage foam cell formation. Systemic administration
of Am80 led to reductions in the areas of atherosclerotic lesions and foam cell accumulation in the aortas of
apolipoprotein E (apoE)-deficient mice and reduced serum concentrations of IL-6 and IL-1␤ without affecting body
weights, serum lipid profiles or IL-10 levels.
Conclusions—Am80 suppresses scavenger receptor expression and macrophage foam cell formation in vitro and prevents
atherogenesis in apoE-deficient mice in vivo. This suggests Am80 is a novel candidate agent that could be highly useful
in the prevention and treatment of atherosclerosis. (Arterioscler Thromb Vasc Biol. 2006;26:1177-1183.)
Key Words: macrophage 䡲 IL-6 䡲 CD36 䡲 scavenger receptor-A 䡲 retinoid
M
IL-6 plays a key role in angiotensin II (Ang II)-mediated CD36
expression and uptake of oxidized LDL in mouse peritoneal
macrophages, and promotes atherogenesis.6,7 That mouse peritoneal macrophages obtained from IL-6– deficient mice do not
show upregulation of CD36 expression in response to Ang II
stimulation6 suggests inhibition of IL-6 is potentially promising
therapeutic strategy for the treatment of atherosclerosis.
Am80 is a retinoic acid receptor (RAR) ␣/␤-specific
synthetic retinoid, and it neither binds to nor transactivates
the retinoid X receptors (RXRs).8 Am80 is also known to
inhibit the IL-6 signaling.9 –11 Am80 suppresses IL-6 production in splenic mononuclear cells and reduces the severity
and progression of inflammatory disease models, including
2,4-dinitrofluorobenzene–induced contact dermatitis,10 collageninduced arthritis,11 and allergic encephalomyelitis.9 Recently,
we reported that Am80 inhibits neointima formation in a
mouse vascular injury model, suggesting it also modulates
inflammatory and remodeling processes in the vessel wall.12
However, it is not yet known whether Am80 has the capacity
to modulate macrophage function.
The aims of the present study were to determine1 whether
Am80 can inhibit macrophage IL-6 production and foam cell
acrophage foam cell formation is a hallmark of both
early and late atherosclerotic lesions.1 During that
process, macrophages take up modified low-density lipoprotein
(LDL) via scavenger receptors in the vessel wall and release a
variety of immune mediators, reactive oxygen species and
proteases, thereby playing a pivotal role in atherogenesis.
Two macrophage scavenger receptors, scavenger receptor-A
(SR-A) and CD36, mediate the majority of modified LDL
uptake and promote the development of atherosclerosis.2
Indeed, mice lacking these 2 receptors do not accumulate
esterified cholesterol derived from modified LDL.3 Thus,
development of drugs that modulate scavenger receptor
function could potentially provide a strong basis for a novel
antiatherogenic therapy.2
Proinflammatory cytokines are known to affect both the
expression of scavenger receptors and the formation of
macrophage foam cells.2 IL-6, for example, is expressed
within atherosclerotic lesions in macrophage-rich areas4 and
may stimulate inflammatory responses in macrophages, as
well as proliferation of smooth muscle cells (SMCs) and
pro-thrombotic activity.5 Recent studies have also shown that
Original received August 31, 2005; final version accepted February 3, 2006.
From the Department of Cardiovascular Medicine (N.T., H.I., S.I., R.N.) and Nano Bioengineering Education Program (I.M.), Graduate School of
Medicine, University of Tokyo, Tokyo, Japan; and Department of Organ Regeneration, Shinshu University Graduate School of Medicine, Matsumoto,
Japan (T.S.), School of Biomedical Science, Tokyo Medical and Dental University, Tokyo (H.K.); Research Foundation Itsuu Laboratory (K.S.), Tokyo,
Japan.
Correspondence to Ryozo Nagai, MD, PhD, Department of Cardiovascular Medicine, Graduate School of Medicine, University of Tokyo, 7-3-1 Hongo,
Bunkyo, Tokyo 113-8655, Japan. E-mail [email protected]
© 2006 American Heart Association, Inc.
Arterioscler Thromb Vasc Biol. is available at http://www.atvbaha.org
1177
DOI: 10.1161/01.ATV.0000214296.94849.1c
1178
Arterioscler Thromb Vasc Biol.
May 2006
formation in vitro, and2 whether treatment with Am80 can
affect the development of atherosclerotic lesions in apolipoprotein E (apoE)-deficient mice in vivo. Our findings
indicate that Am80’s ability to inhibit IL-6 expression enables it to suppress both macrophage foam cell formation and
atherogenesis.
Materials and Methods
Plasmids
The IL-6 promoter reporter constructs pIL6-luc651, pIL6-luc651 ⌬NF␬B, and pIL6-luc651 ⌬C/EBP␤ were a generous gift from Dr O.
Eickelberg.13 The CD36 promoter reporter constructs pGL-CD36
(-273/luc), was a generous gift from Dr R.M. Evans.14 The RXRa
expression vector CMX-hRXR␣ was a general gift from Dr R. Schule.15
The PPAR␥ expression vector pCAG-PPAR␥ was previously
described.16
For enhanced Materials and Methods used in this article, please
see http://atvb.ahajournals.org.
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Results
Am80 Inhibits IL-6 Expression
We first analyzed the effect of Am80 on production of IL-6 in
macrophages. Raw264 cells were cultured with or without
various concentrations of Am80 in the presence of 100 ng/mL
PMA, a model agonist that induces scavenger receptor expression14 or 1 ␮mol/L Ang II. As shown in Figure 1A, PMA and
Ang II induced significant IL-6 production and secretion in
Raw264 cells, and this effect was dose-dependently inhibited by
Am80. Likewise, Am80 dose-dependently inhibited PMA and
Ang II–induced IL-6 mRNA expression (Figure 1B).
Am80 Inhibits the IL-6 Promoter
Through C/EBP␤
Its inhibition of IL-6 mRNA expression suggested that Am80
may inhibit IL-6 gene expression at the level of transcription.
To test that idea, we analyzed the effect of Am80 on IL-6
promoter activity. Raw264 cells were transfected with an IL-6
promoter-reporter construct (pIL6-luc651), after which the
transfected cells were incubated with or without Am80 (10⫺7
mol/L) for 6 hour and then treated with PMA for 24 hour. As
expected, PMA stimulated IL-6 promoter activity (Figure
1C). This effect was inhibited by Am80, further confirming
that the retinoid suppresses IL-6 production at least in part by
inhibiting IL-6 transcription.
The IL-6 promoter is known to be controlled by C/EBP␤
(NF-IL6) and NF-␬B.17,18 Because earlier studies have shown
that ligand-bound RAR inhibits transactivation by C/EBP␤,18
we hypothesized that Am80 might suppress IL-6 transcription
by inhibiting C/EBP␤. To test that idea, we transfected cells
with mutant IL-6 promoter constructs in which either the
C/EBP␤ or NF-␬B binding site was mutated. Mutation of the
NF-␬B binding site resulted in a significant (49%) reduction
in IL-6 promoter activity, as compared with the wild-type
construct under the basal culture conditions; mutation of the
C/EBP␤ binding site reduced activity to a slightly lesser
degree (24%). PMA significantly increased the activity of
both mutant promoter constructs. Am80, however, significantly reduced the reporter activity of the NF-␬B site mutant
(pIL6-luc651 ⌬NF-␬B) but had no effect on that of the
C/EBP␤ site mutant (pIL6-luc651 ⌬C/EBP␤) (Figure 1C).
Figure 1. Am80 suppresses IL-6 production in macrophages.
Raw264 cells were pretreated with the indicated concentration
of Am80 for 12 hours and then stimulated with 100 ng/mL PMA
or 1 ␮mol/L Ang II for 24 hours (A) or 12 hours (B). IL-6 released
into the medium was analyzed by enzyme-linked immunosorbent assay (ELISA) (A). IL-6 mRNA expression was assessed by
real-time polymerase chain reaction (PCR; B). Data are
expressed as means⫾SD of triplicate wells. #P⬍0.01 vs
untreated control; *P⬍0.05, **P⬍0.01 vs PMA alone. C, Am80
suppresses IL-6 promoter activity; Raw264 or Ang II cells were
transfected with pIL6-luc651, pIL6-luc651 ⌬NF-␬B or pIL6luc651 ⌬C/EBP␤ reporter plasmid. Am80 (10⫺7 mol/L) was
added 18 hours after transfection, and after an additional 6
hours the cells were treated with PMA (100 ng/mL). Luciferase
activity was measured 48 hours after transfection. To correct for
variation in transfection efficiency, we cotransfected pCMV-␤gal
in all experiments. The ratio of the luciferase activity to the
␤-galactosidase activity in each sample served as a measure of
the normalized luciferase activity. Data are expressed as
means⫾SD of triplicate wells and are representative of three
independent experiments. #P⬍0.05, ##P⬍0.01 vs control of
each construct; *P⬍0.05, **P⬍0.01 vs PMA alone of each
construct.
Apparently, an intact C/EBP␤ binding site is required for
Am80 to exert an effect on IL-6 promoter activity.
We also tested whether Am80 treatment would influence
C/EBP␤ expression and found that it had no effect on basal
expression of C/EBP␤, nor did it affect the ability of PMA
to stimulate C/EBP␤ expression19 (Figure I, see http://atvb.
ahajournals.org). This suggests that Am80 may inhibit IL-6
promoter activity by interfering with the function of C/EBP␤.
Am80 Reduces the Cholesterol Content and the
Size and Number of Lipid Droplets in Mouse
Peritoneal Macrophages
We next tested whether Am80’s ability to inhibit IL-6
production in macrophages might affect foam cell formation.
When peritoneal macrophages were incubated with acety-
Takeda et al
A Synthetic Retinoid Am80 Suppresses Atherogenesis
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Figure 2. Am80 reduces the cholesterol content and the size
and number of lipid droplets in mouse peritoneal macrophages.
A, Oil Red O staining. Mouse peritoneal macrophages were
treated with 10⫺7 mol/L Am80 for 12 hours and then stimulated
with 50 ␮g/mL acetylated LDL (upper) or 25 ␮g/mL oxidized
LDL (lower) for 48 hour. The macrophages were then fixed and
stained with Oil Red O. The scale bar indicates 20 ␮m. B, Cellular cholesterol content. Mouse peritoneal macrophages were
treated with the indicated concentration of Am80 for 12 hours
and then stimulated with 50 ␮g/mL acetylated LDL (left) or 25
␮g/mL oxidized LDL (right) for 48 hours, after which intracellular
total cholesterol (TC) and free cholesterol (FC) were measured
using an enzymatic fluorometric microassay. The amount of
esterified cholesterol was calculated by subtracting FC from TC.
Data are means⫾SD of 3 independent experiments. #P⬍0.01 vs
each control; *P⬍0.05, **P⬍0.01 vs acetylated or oxidized LDL
alone.
lated or oxidized LDL in the presence or absence of Am80,
the number and size of intracellular lipid droplets were
markedly smaller in the Am80-treated cells (Figure 2A).
Consistent with those results, Am80 significantly reduced
intracellular levels of both cholesterol ester and free cholesterol (Figure 2B). Taken together, these findings indicate
that Am80 can indeed suppress macrophage-to-foam cell
transformation.
Am80 Suppresses Expression of SR-A and CD36
in Mouse Peritoneal and Raw264 Macrophages
Modified LDL promotes its own uptake into macrophages by
upregulating the scavenger receptors SR-A and CD36.20 We
therefore hypothesized that Am80 might affect expression of
these receptors. To test that idea, we treated Raw264 macrophages with PMA, which is known to upregulate expression
of both SR-A and CD36.21,22 As expected, PMA treatment
increased mRNA expression of both of those genes in peritoneal
1179
macrophages, Raw264 cells (Abelson virus-transformed, murine
macrophage-derived cell line23) and THP-1 cells (human acute
monocytic leukemia cell line24) (Figure 3A). Am80 dosedependently inhibited the PMA-induced expression of the 2
scavenger receptors in peritoneal macrophages and Raw264
cells and reduced expression of SR-A in THP-1 cells (Figure
3A). However, CD36 expression was somewhat upregulated by
Am80 in THP-1 cells. Although the exact mechanism is unknown, the differential effect of Am80 on CD36 expression in
macrophages (Raw264 and peritoneal macrophages) and monocytic THP-1 cells might reflect differences in species and in the
differentiation state of the cells (see Discussion). Because the
patterns of regulation of both SR-A and CD36 were similar in
mouse peritoneal macrophages and Raw264 cells, we deemed
Raw264 cells to be an appropriate model for use in the following
experiments.
Like PMA, oxidized LDL upregulated SR-A and CD36 in
Raw264 cells, and that upregulation was dose-dependently
inhibited by Am80 (Figure 3B), which is consistent with the
Am80-induced inhibition of cholesterol uptake by peritoneal
macrophages seen in Figure 2. When we considered whether
its inhibitory effect on IL-6 signaling might be involved in
Am80’s inhibition of scavenger receptor expression, we
found that addition of exogenous IL-6 partially restored
expression of CD36 and SR-A mRNA, which was otherwise inhibited by Am80 (Figure 3C). Similarly, induction of
the surface CD36 and SR-A proteins in Raw264 cells was
inhibited by Am80 by flow cytometric analysis (Figure 3D),
and this inhibition was partially restored by IL-6. These data
demonstrate that Am80 acts to suppress expression of scavenger receptors at least in part via effects on IL-6 expression.
Am80 Inhibits the IL-6 Signaling
We then analyzed if Am80 might affect the IL-6-induced
CD36 and SR-A expression. As expected, IL-6 upregulated
expression of the scavenger receptor genes in Raw264 cells
(Figure 4A). Am80 treatment resulted in decreases in the
levels of the gene expression, suggesting Am80 might modulate the signaling mechanism that is elicited by IL-6 and
leads to upregulation of CD-36 and SR-A.
To further analyze effects of Am80 on the signaling
mechanism elicited by IL-6, we analyzed its effects on the
CD36 promoter in Raw264 cells. As with the endogenous
CD36 expression, CD36 promoter activity was augmented by
IL-6 treatment (Figure 4B). This activation of the promoter
was suppressed by Am80. These results suggest that Am80
affects both expression of IL-6 and the signaling elicited by IL-6.
Effect of Am80 on Atherosclerosis in
ApoE-Deficient Mice
Given our observations that it inhibits IL-6 production and
signaling elicited by IL-6, scavenger receptor expression and
foam-cell formation in mouse macrophages, we hypothesized
that Am80 might be able to modulate atherogenesis in vivo.
To test that idea, 8-week-old apoE-deficient mice were fed a
western diet for 2 months, during which they were orally
administered Am80 (1.0 mg/kg body weight) or vehicle daily.
There were no significant differences in the body weights or
serum lipid profiles in the 2 groups (Table). Serum IL-6
1180
Arterioscler Thromb Vasc Biol.
May 2006
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Figure 3. Effect of Am80 on scavenger receptor expression in macrophages. A, Peritoneal macrophages, Raw264 cells, and THP-1
cells were pretreated with Am80 (10⫺6 mol/L), atRA(10⫺6 mol/L) or vehicle for 12 hours, and then treated with 50 ng/mL of PMA or vehicle for additional 48 hours. Expression of SR-A and CD36 mRNA was analyzed by real-time PCR. B, Raw264 cells were treated with
the indicated concentrations of Am80 for 12 hour and then stimulated with 25 ␮g/mL of oxidized LDL for 48 hours. C, IL-6 restores
scavenger receptors in PMA/Am80-treated cells. Raw264 cells were treated with Am80 (10⫺6 mol/L) for 12 hours and then stimulated
with the indicated concentrations of mouse IL-6 and 50 ng/mL PMA for 48 hours. Data are means⫾SD of 3 independent experiments.
#P⬍0.05, ##P⬍0.01 vs untreated control (A,B); *P⬍0.05, **P⬍0.01 vs PMA (A) or oxidized LDL (B) alone. *P⬍0.05, **P⬍0.01 vs PMA/
Am80 alone (C). D, Flow cytometry; Raw264 cells were treated with Am80 (10⫺7 mol/L) or vehicle for 12 hours, and then stimulated with
50 ng/mL PMA with or without 30 ng/mL mouse IL-6 for 30 hours. SR-A (A) and CD36 (B) expression were detected by flow cytometry.
Black line histogram represents the control (untreated) cells; blue is PMA treated; red is PMA/Am80; and green is PMA/Am80 plus IL-6,
respectively.
levels were significantly reduced in the Am80-treated group,
as expected. Levels of the proinflammatory cytokine IL-1␤
were also reduced in the Am80 group, but levels of the
anti-inflammatory cytokine IL-10 were not. Fatty atherosclerotic lesions, measured as the percentage of the entire
aorta affected or as the affected area of the aortic roots,
were significantly smaller in the Am80-treated mice than in
those receiving only vehicle (entire aorta: vehicle-treated,
7.3⫾0.8%; Am80-treated, 0.5⫾0.3%; P⬍0.01; n⫽8 in each
group; aortic roots: vehicle-treated, 206 429⫾12 352 ␮m2;
Am80-treated, 149 021⫾19 282 ␮m2; P⬍0.01; n⫽8 in each
group) (Figure 5A to 5E). Immunohistochemical analysis
showed that expression of IL-6 was decreased in plaques in
the Am80-treated animals (Figure 5F). In addition, accumulation of extracellular matrix components around the
aortic sinus and coronary artery was also reduced in Am80-
treated mice (Figure 5G). Thus, Am80 does appear capable of
inhibiting macrophage foam cell formation and atherogenesis in vivo.
Discussion
A hallmark of atherosclerotic lesions is the accumulation of
macrophage foam cells, which play a central role in the
development and progression of atherosclerosis. During that
process, modified LDL is taken up primarily via 2 scavenger
receptors, SR-A and CD36.2 Macrophages taken from mice
lacking these 2 receptors fail to accumulate esterified cholesterol,3 suggesting these scavenger receptors represent potential therapeutic targets for inhibition of atherogenesis. In
that regard, we have shown here that Am80 inhibits expression of scavenger receptors in mouse macrophages in vitro
and substantially reduces atherosclerotic lesion formation
Figure 4. Effect of Am80 on IL-6 induced signaling. A, Raw264 cells were pretreated with 10 ng/mL IL-6 or vehicle for 12 hours, and
then treated with the indicated concentrations of Am80 or vehicle for additional 48 hours. Expression of SR-A and CD36 mRNA was
analyzed by real-time PCR. Data are means⫾SD of 3 independent experiments. B, CD36 promoter activity; Raw264 cells were transfected with human CD36 promoter, pCAG-PPAR␥ and CMX-hRXR␣. Am80 (10⫺7 mol/L) and IL-6 (20 ng/mL) was added 24 hours after
transfection. All luciferase activity was measured 36 hour after transfection. Data were expressed as means⫾SD of triplicate wells and
are representative of three independent experiments. #P⬍0.05, ##P⬍0.01 vs untreated control; *P⬍0.05 vs IL-6 alone.
Takeda et al
A Synthetic Retinoid Am80 Suppresses Atherogenesis
Characteristics of ApoE-Deficient Mice Treated With Am80 on
Western Diet for 2 Months
Vehicle
Am80
Initial body wt, g
22.43⫾1.84
22.64⫾1.64
Final body wt, g
27.25⫾2.42
27.35⫾2.17
Total cholesterol, mg/dL
1319⫾127
1332⫾143
Triglyceride, mg/dL
165.3⫾31.3
169.3⫾27.1
Serum concentration
IL-6, pg/mL
62.8⫾6.2
41.3⫾6.3*
IL-1␤, pg/mL
132.6⫾12.4
86.9⫾15.3*
IL-10, pg/mL
36.3⫾4.7
38.3⫾5.2
Results are expressed as the mean⫾SD n⫽8, each group.
*P⬍0.05 vs vehicle-treated group.
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
in apoE-deficient mice in vivo; moreover, we previously
showed that it inhibits neointima formation in a vascular
injury model.12 Am80, which specifically binds to RAR-␣/␤,
has been used safely to treat acute promyelocytic leukemia,25
which would seem to make it an attractive candidate drug
with which to treat and prevent atherosclerosis.
Our findings demonstrate that Am80 inhibits IL-6 expression and the signaling elicited by IL-6 in macrophages. The
central role played by IL-6 in cardiovascular disease is
Figure 5. Am80 reduces plaque formation in apoE-deficient
mice. Representative photographs showing the appearance of
the aortic arch (A) and en face atherosclerotic lesions over the
entire aorta stained with Sudan IV (B). C, Percentage of aortic
area affected by en face atherosclerotic lesions (n⫽8). Representative photomicrographs of the aortic sinus stained with Oil
Red O (D), IL-6 antibody (F), and Masson trichrome stains (G). E,
Area affected by atherosclerotic lesions in the aortic sinus. The
scale bar indicates 100 ␮m (F). Data are means⫾SD. *P⬍0.05,
**P⬍0.01 vs vehicle-treated group.
1181
suggested by clinical studies showing that serum levels of the
cytokine are increased in patients with unstable angina,5 that
it is expressed in atherosclerotic lesions, and that it colocalizes with Ang II in the macrophage-rich shoulder region of
plaques.4 IL-6 is thought to be a pivotal regulator of extracellular matrix deposition and reorganization.5 In addition,
IL-6 has been shown to be involved in foam cell formation, and Keider et al reported that Ang II does not stimulate
CD36 expression in peritoneal macrophages taken from IL-6 –
deficient mice, indicating that IL-6 is an important component
of the signaling pathways that control CD36 expression.6 The
results of the present study suggest that inhibition of IL-6
expression and signaling by Am80 reduces SR-A and CD36
expression in macrophages in vitro (Figure 3). Recent studies
have shown that the JNK signaling is important for IL-6
expression in response to free cholesterol loading.26 However, Am80 did not alter JNK1/2 phosphorylation26 induced
by the ACAT inhibitor (TMP-153) treatment27 in Raw264
cell (unpublished observations, Takeda and Manabe, 2005),
suggesting that the JNK pathway is not involved in the
inhibition of IL-6 expression by Am80.
Considering its various functions, Am80’s inhibition of
IL-6 would be expected to affect both matrix degradation and
foam cell formation in vivo. Systemically treating apoEdeficient mice with Am80 reduced accumulation of not only
foam cells within atherosclerotic lesions but also extracellular
matrix components (Figure 5). These findings suggest that
inhibition of IL-6 production is a key mechanism by which
Am80 suppresses plaque formation in apoE-deficient mice.
Still, we and others have shown that Am80 also affects the
functions of other cell types that play important roles in
atherogenesis, including SMCs and T cells. For instance,
Am80 suppresses expression of PDGF-A in SMCs by inhibiting KLF5,12 and it induces IL-10 secretion in T-cells.28 In
addition, atRA has been shown to promote fibrinolysis and to
inhibit thrombosis and platelet aggregation.29 Given that
atherogenesis is an integral of a variety of cellular activities
involving multiple cell types and various growth factors and
cytokines, it is very likely that it is Am80’s cumulative effects
on all affected cell types that leads to reduced plaque
formation in apoE-deficient mice.
Somewhat surprisingly atherosclerotic plaque formation
was recently found to be enhanced in apoE⫺/⫺ IL-6⫺/⫺ double
knockout mice.30 Those investigators noted several findings
that may be related to the reported enhancement of plaque
formation, however. First, serum total cholesterol, LDL, and
VLDL levels were all significantly higher in the double
knockout mice than in single apoE knockout mice. Second,
expression of the anti-inflammatory cytokine IL-10 was
much reduced in the double knockout mice. Third, matrix
metalloproteinase (MMP) activity was enhanced leading to
disintegration of extracellular matrix and alteration of its
assembly within the vessel wall, which could affect plaque
development.31 In the context of those changes, the effects of
Am80 treatment appear to differ from those of total ablation
of IL-6 gene. For instance, IL-6 production was reduced but
not completely blocked in Am80-treated animals (Table), and
total cholesterol and LDL levels were unaffected. It is also
noteworthy that levels of IL-10 were not reduced in Am80-
1182
Arterioscler Thromb Vasc Biol.
May 2006
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
treated animals. As mentioned above, Am80 affects the functions of a variety of cell-types, presumably via both IL-6independent and -dependent mechanisms. These differences in
effects of Am80 and null mutation of IL-6 are likely to have led
to differential effects on plaque formation in apoE⫺/⫺ mice.
The present findings are also at variance with earlier
studies showing that RA induces CD36 in human monocytic
THP-1 cells,32–34 and IL-6 inhibits SR-A expression in THP-1
cells and human peripheral monocytes.35 This discrepancy
may reflect differences between the models, the species, and
the differentiation state of the cells. THP-1 cells are a
monocytic cell line in which expression of SR-A and CD36
accompanies differentiation into macrophages. Raw264 cells
and peritoneal macrophages, by contrast, are mouse macrophages and express CD36 even under basal culture conditions. Previous studies have shown that atRA promotes
macrophage differentiation of THP-1 cells.36 We found that
Am80 also promotes macrophage differentiation of THP-1
cells (unpublished observations, Takeda and Manabe, 2005).
It is therefore plausible that the upregulation of CD36 seen in
Figure 3A reflects differentiation, though the exact mechanisms underlying the differential effects of Am80 on CD36
remain unknown.
The results of our reporter assays suggest that Am80
suppresses IL-6 production at least in part at the level of
transcription by inhibiting C/EBP␤-dependent transactivation
of the IL-6 promoter. In Raw264 cells, PMA induced both
IL-6 and C/EBP␤ (Figure 1 and Figure I), whereas Am80
inhibited the PMA-induced IL-6 expression but not the
C/EBP␤ expression. This suggests that Am80 in some way
interferes with the function of C/EBP␤. Consistent with that
idea, C/EBP␤-dependent gene transcription is similarly inhibited by RA in adipocytes, although C/EBP␤ expression
is not.37
Tontonoz et al recently demonstrated that CD36 gene is
controlled by PPAR␥ via the PPAR␥/RXR-responsive element (PPRE) within ⫺274/⫺263-bp region of the CD36
promoter.14 However, we found that the PPRE was dispensable for inhibition of the promoter activity by Am80. Moreover, Am80 did not affect the activity of PPRE-dependent
minimal promoter38 (Takeda and Manabe, unpublished observations, 2005). These results suggest that Am80 inhibits
the CD36 transcription via mechanisms independent of
PPAR␥. It is noteworthy to mention that the CD36 promoter
has neither RARE nor the C/EBP binding motif. It would be
important to determine the molecular mechanisms by which
Am80 inhibits CD36 transcription in future studies for better
understanding the role played by RAR in the control of
macrophage function. Of particular importance will be
RAR’s interactions with other transcription factors.
In conclusion, our findings support the notion that modulation of the function of inflammatory and vascular cells
using synthetic retinoids is a promising strategy for the
treatment and prevention of vascular diseases, including
atherosclerosis.
Acknowledgments
This work was supported in part by grants-in-aid for Scientific
Research from the Japan Society for the Promotion of Science and
from Ministry of Education, Culture, Sports, Science, and Technology (to R.N. and I.M.), Grant-in-aid from National Institute of
Biomedical Innovation, Japan (to R.N.), and research grants from the
Tokyo Biochemical Research Foundation and Kato Memorial Bioscience Foundation (to I.M.).
References
1. Glass CK, Witztum JL. Atherosclerosis. The road ahead. Cell. 2001;104:
503–516.
2. Li AC, Glass CK. The macrophage foam cell as a target for therapeutic
intervention. Nat Med. 2002;8:1235–1242.
3. Kunjathoor VV, Febbraio M, Podrez EA, Moore KJ, Andersson L, Koehn
S, Rhee JS, Silverstein R, Hoff HF, Freeman MW. Scavenger receptors
class A-I/II and CD36 are the principal receptors responsible for the
uptake of modified low density lipoprotein leading to lipid loading in
macrophages. J Biol Chem. 2002;277:49982– 49988.
4. Schieffer B, Schieffer E, Hilfiker-Kleiner D, Hilfiker A, Kovanen PT,
Kaartinen M, Nussberger J, Harringer W, Drexler H. Expression of
angiotensin II and interleukin 6 in human coronary atherosclerotic
plaques: potential implications for inflammation and plaque instability.
Circulation. 2000;101:1372–1378.
5. Rattazzi M, Puato M, Faggin E, Bertipaglia B, Zambon A, Pauletto P.
C-reactive protein and interleukin-6 in vascular disease: culprits or
passive bystanders? J Hypertens. 2003;21:1787–1803.
6. Keidar S, Heinrich R, Kaplan M, Hayek T, Aviram M. Angiotensin II
administration to atherosclerotic mice increases macrophage uptake of
oxidized ldl: a possible role for interleukin-6. Arterioscler Thromb Vasc
Biol. 2001;21:1464 –1469.
7. Huber SA, Sakkinen P, Conze D, Hardin N, Tracy R. Interleukin-6
exacerbates early atherosclerosis in mice. Arterioscler Thromb Vasc Biol.
1999;19:2364 –2367.
8. Nagy L, Thomazy VA, Shipley GL, Fesus L, Lamph W, Heyman RA,
Chandraratna RA, Davies PJ. Activation of retinoid X receptors induces
apoptosis in HL-60 cell lines. Mol Cell Biol. 1995;15:3540 –3551.
9. Wang T, Niwa S, Bouda K, Matsuura S, Homma T, Shudo K, Nagai H.
The effect of Am-80, one of retinoids derivatives on experimental allergic
encephalomyelitis in rats. Life Sci. 2000;67:1869 –1879.
10. Niwa S, Ochi T, Hirano Y, Wang T, Inagaki N, Shudo K, Nagai H. Effect
of Am-80, a retinoid derivative, on 2,4-dinitrofluorobenzene-induced
contact dermatitis in mice. Pharmacology. 2000;60:208 –214.
11. Nagai H, Matsuura S, Bouda K, Takaoka Y, Wang T, Niwa S, Shudo K.
Effect of Am-80, a synthetic derivative of retinoid, on experimental
arthritis in mice. Pharmacology. 1999;58:101–112.
12. Shindo T, Manabe I, Fukushima Y, Tobe K, Aizawa K, Miyamoto S,
Kawai-Kowase K, Moriyama N, Imai Y, Kawakami H, Nishimatsu H,
Ishikawa T, Suzuki T, Morita H, Maemura K, Sata M, Hirata Y, Komukai
M, Kagechika H, Kadowaki T, Kurabayashi M, Nagai R. Kruppel-like
zinc-finger transcription factor KLF5/BTEB2 is a target for angiotensin II
signaling and an essential regulator of cardiovascular remodeling. Nat
Med. 2002;8:856 – 863.
13. Eickelberg O, Pansky A, Mussmann R, Bihl M, Tamm M, Hildebrand P,
Perruchoud AP, Roth M. Transforming growth factor-beta1 induces
interleukin-6 expression via activating protein-1 consisting of JunD
homodimers in primary human lung fibroblasts. J Biol Chem. 1999;274:
12933–12938.
14. Tontonoz P, Nagy L, Alvarez JG, Thomazy VA, Evans RM. PPARgamma
promotes monocyte/macrophage differentiation and uptake of oxidized LDL.
Cell. 1998;93:241–252.
15. Pfitzner E, Kirfel J, Becker P, Rolke A, Schule R. Physical interaction
between retinoic acid receptor and the oncoprotein myb inhibits retinoic acid-dependent transactivation. Proc Natl Acad Sci U S A. 1998;95:
5539 –5544.
16. Oishi Y, Manabe I, Tobe K, Tsushima K, Shindo T, Fujiu K, Nishimura
G, Maemura K, Yamauchi T, Kubota N, Suzuki R, Kitamura T, Akira S,
Kadowaki T, Nagai R. Kruppel-like transcription factor KLF5 is a key
regulator of adipocyte differentiation. Cell Metab. 2005;1:27–39.
17. Matsusaka T, Fujikawa K, Nishio Y, Mukaida N, Matsushima K,
Kishimoto T, Akira S. Transcription factors NF-IL6 and NF-kappa B
synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8. Proc Natl Acad Sci U S A. 1993;90:10193–10197.
18. Nagpal S, Cai J, Zheng T, Patel S, Masood R, Lin GY, Friant S, Johnson
A, Smith DL, Chandraratna RA, Gill PS. Retinoid antagonism of NF-IL6:
insight into the mechanism of antiproliferative effects of retinoids in
Kaposi’s sarcoma. Mol Cell Biol. 1997;17:4159 – 4168.
Takeda et al
A Synthetic Retinoid Am80 Suppresses Atherogenesis
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
19. Natsuka S, Akira S, Nishio Y, Hashimoto S, Sugita T, Isshiki H, Kishimoto
T. Macrophage differentiation-specific expression of NF-IL6, a transcription
factor for interleukin-6. Blood. 1992;79:460–466.
20. Shiffman D, Mikita T, Tai JT, Wade DP, Porter JG, Seilhamer JJ,
Somogyi R, Liang S, Lawn RM. Large scale gene expression analysis of
cholesterol-loaded macrophages. J Biol Chem. 2000;275:37324 –37332.
21. Nicholson AC. Expression of CD36 in macrophages and atherosclerosis:
the role of lipid regulation of PPARgamma signaling. Trends Cardiovasc
Med. 2004;14:8 –12.
22. Feng J, Han J, Pearce SF, Silverstein RL, Gotto AM Jr, Hajjar DP,
Nicholson AC. Induction of CD36 expression by oxidized LDL and IL-4
by a common signaling pathway dependent on protein kinase C and
PPAR-gamma. J Lipid Res. 2000;41:688 – 696.
23. Ralph P, Nakoinz I. Antibody-dependent killing of erythrocyte and tumor
targets by macrophage-related cell lines: enhancement by PPD and LPS.
J Immunol. 1977;119:950 –954.
24. Tsuchiya S, Yamabe M, Yamaguchi Y, Kobayashi Y, Konno T, Tada K.
Establishment and characterization of a human acute monocytic leukemia
cell line (THP-1). Int J Cancer. 1980;26:171–176.
25. Tobita T, Takeshita A, Kitamura K, Ohnishi K, Yanagi M, Hiraoka A,
Karasuno T, Takeuchi M, Miyawaki S, Ueda R, Naoe T, Ohno R.
Treatment with a new synthetic retinoid, Am80, of acute promyelocytic
leukemia relapsed from complete remission induced by all-trans retinoic
acid. Blood. 1997;90:967–973.
26. Li Y, Schwabe RF, DeVries-Seimon T, Yao PM, Gerbod-Giannone MC,
Tall AR, Davis RJ, Flavell R, Brenner DA, Tabas I. Free cholesterolloaded macrophages are an abundant source of tumor necrosis factoralpha and interleukin-6: model of NF-kappaB- and map kinase-dependent inflammation in advanced atherosclerosis. J Biol Chem. 2005;280:
21763–21772.
27. Sugiyama Y, Ishikawa E, Odaka H, Miki N, Tawada H, Ikeda H.
TMP-153, a novel ACAT inhibitor, inhibits cholesterol absorption and
lowers plasma cholesterol in rats and hamsters. Atherosclerosis. 1995;
113:71–78.
28. Iwata M, Eshima Y, Kagechika H. Retinoic acids exert direct effects on
T cells to suppress Th1 development and enhance Th2 development via
retinoic acid receptors. Int Immunol. 2003;15:1017–1025.
1183
29. van Giezen JJ, Boon GI, Jansen JW, Bouma BN. Retinoic acid enhances
fibrinolytic activity in-vivo by enhancing tissue type plasminogen activator (t-PA) activity and inhibits venous thrombosis. Thromb Haemost.
1993;69:381–386.
30. Schieffer B, Selle T, Hilfiker A, Hilfiker-Kleiner D, Grote K, Tietge UJ,
Trautwein C, Luchtefeld M, Schmittkamp C, Heeneman S, Daemen MJ,
Drexler H. Impact of interleukin-6 on plaque development and morphology in experimental atherosclerosis. Circulation. 2004;110:3493–3500.
31. Lijnen HR. Metalloproteinases in development and progression of
vascular disease. Pathophysiol Haemost Thromb. 2003;33:275–281.
32. Wuttge DM, Romert A, Eriksson U, Torma H, Hansson GK, Sirsjo A.
Induction of CD36 by all-trans retinoic acid: retinoic acid receptor signaling in the pathogenesis of atherosclerosis. FASEB J. 2001;15:1221–1223.
33. Han S, Sidell N. Peroxisome-proliferator-activated-receptor gamma
(PPARgamma) independent induction of CD36 in THP-1 monocytes by
retinoic acid. Immunology. 2002;106:53–59.
34. Szanto A, Nagy L. Retinoids potentiate peroxisome proliferator-activated
receptor gamma action in differentiation, gene expression, and lipid
metabolic processes in developing myeloid cells. Mol Pharmacol. 2005;
67:1935–1943.
35. Liao HS, Matsumoto A, Itakura H, Doi T, Honda M, Kodama T, Geng
YJ. Transcriptional inhibition by interleukin-6 of the class A macrophage
scavenger receptor in macrophages derived from human peripheral
monocytes and the THP-1 monocytic cell line. Arterioscler Thromb Vasc
Biol. 1999;19:1872–1880.
36. Matikainen S, Hurme M. Comparison of retinoic acid and phorbol myristate acetate as inducers of monocytic differentiation. Int J Cancer.
1994;57:98 –103.
37. Schwarz EJ, Reginato MJ, Shao D, Krakow SL, Lazar MA. Retinoic acid
blocks adipogenesis by inhibiting C/EBPbeta-mediated transcription. Mol
Cell Biol. 1997;17:1552–1561.
38. Vu-Dac N, Schoonjans K, Kosykh V, Dallongeville J, Fruchart JC, Staels
B, Auwerx J. Fibrates increase human apolipoprotein A-II expression
through activation of the peroxisome proliferator-activated receptor.
J Clin Invest. 1995;96:741–750.
Downloaded from http://atvb.ahajournals.org/ by guest on June 17, 2017
Synthetic Retinoid Am80 Reduces Scavenger Receptor Expression and Atherosclerosis in
Mice by Inhibiting IL-6
Norifumi Takeda, Ichiro Manabe, Takayuki Shindo, Hiroshi Iwata, Satoshi Iimuro, Hiroyuki
Kagechika, Koichi Shudo and Ryozo Nagai
Arterioscler Thromb Vasc Biol. 2006;26:1177-1183; originally published online February 16,
2006;
doi: 10.1161/01.ATV.0000214296.94849.1c
Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association, 7272
Greenville Avenue, Dallas, TX 75231
Copyright © 2006 American Heart Association, Inc. All rights reserved.
Print ISSN: 1079-5642. Online ISSN: 1524-4636
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://atvb.ahajournals.org/content/26/5/1177
Data Supplement (unedited) at:
http://atvb.ahajournals.org/content/suppl/2006/02/16/01.ATV.0000214296.94849.1c.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Arteriosclerosis, Thrombosis, and Vascular Biology can be obtained via RightsLink, a service of the
Copyright Clearance Center, not the Editorial Office. Once the online version of the published article for
which permission is being requested is located, click Request Permissions in the middle column of the Web
page under Services. Further information about this process is available in the Permissions and Rights
Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular Biology is online
at:
http://atvb.ahajournals.org//subscriptions/
Enhanced Materials and Methods
Plasmids
The IL-6 promoter reporter constructs pIL6-luc651, pIL6-luc651 ΔNF-κB, and
pIL6-luc651 ΔC/EBPβ were a generous gift from Dr O. Eickelberg.1 The CD36
promoter reporter constructs pGL-CD36(-273/luc), was a generous gift from Dr RM.
Evans.2 The RXRα expression vector CMX-hRXRα was a general gift from Dr R.
Schule.3 The PPARγ expression vector pCAG-PPARγ was previously described.4
Preparation of Lipoproteins
Low density lipoprotein (LDL, density = 1.063-1.210 g/mL) was isolated from the
plasma of healthy, fasting volunteers by sequential density ultracentrifugation, as
described previously.5 For oxidative modification, LDL was incubated with CuSO4 at 37
ºC. LDL was acetylated by repetitive additions of acetic anhydride.
Cell Culture
The Raw264 mouse macrophage cell line was purchased from RIKEN (Japan) and
cultured in Dulbecco’s modified Eagle’s medium supplemented with 10% (v/v) FBS.
THP-1 human monocytic leukemia cell line was purchased from ATCC (Manassas) and
cultured in RPMI-1640 containing 10% (v/v) FBS and differentiated to THP-1
macrophages by the treatment with 50 ng/ml phorbol 12-myristate 13-acetate (PMA) for
48 h. Mouse peritoneal macrophages were obtained from the peritoneal cavity of male
C57Bl/6 mice (8-week-old) 4 days after injection of 4% thioglycolate (Sigma). The
cells were washed, resuspended in RPMI-1640 supplemented with 10% (v/v) FBS, and
plated. Non-adherent cells were removed by washing 1 hour after plating.
Cholesterol Determination
Cellular lipids were extracted using hexane/isopropanol, evaporated and dissolved in
isopropanol. The cholesterol mass was quantified by enzymatic fluorometric microassay
using to the method of Heider and Boyett with minor modifications.5 The amount of
esterified cholesterol was calculated by subtracting the free cholesterol from the total
1
cholesterol. The amount of cellular protein was quantified using BCA Protein Assay
Reagent (Pierce) after dissolving the cells in 0.1 N NaOH.
Oil Red O Staining
Mouse peritoneal macrophages were cultured in 4-chamber plates at 1.0x106
cells/chamber and treated with modified LDL and Am80. The cells were then washed
twice with PBS, fixed with 4% (w/v) paraformaldehyde in PBS, stained with Oil Red O
in 60% (v/v) isopropanol, and counterstained with hematoxylin.
RNA extraction and Quantification
Total RNA was purified from cells using an RNeasy Mini kit (Qiagen). The methods for
reverse transcription of RNA has been described.6 For quantitation of the transcripts,
real-time PCR was carried out in a LightCycler (Roche) using a QuantiTect SYBR
green PCR kit (Qiagen). The expression level of each gene was normalized to that of
18s rRNA, which served as an endogenous internal control. The sequences of the PCR
primers for C/EBPβ 4 have been published previously. The sequences of the PCR
primers were: mouse IL-6, 5'- agttgccttcttgggactga -3' and 5'- tccacgatttcccagagaac-3';
mouse SR-A, 5’-ctggacaaactggtccacct-3’ and 5’-tccccttctctcccttttgt-3’; mouse CD36,
5’-gagcaactggtggatggttt-3’ and 5’-gcagaatcaagggagagcac-3’; human SR-A(I/II),
5’-cctcgtgtttgcagttctca-3’ and 5’-ccatgttgctcatgtgttcc-3’; human CD36,
5’-agatgcagcctcatttccac-3’ and 5’-gccttggatggaagaacaaa-3’.
Measurement of Biochemical Parameters
IL-6 released from cells into the medium, and serum concentrations of IL-6, IL-1β and
IL-10 were measured using a BioSource mouse ELISA kit following the manufacturer’s
protocol. Other serum biochemical parameters were determined using commercially
available kits (Wako Pure Chemicals).
Transfection of Cells and Measurement of Luciferase Activity
Raw264 cells were transfected with indicated reporter and expression vector plasmids
using Lipofectamine 2000 (Invitrogen). To correct for variation in transfection
2
efficiency, we co-transfected 100 ng of pCMV-βgal in all experiments. Luciferase
activity was assayed (Promega) luminometrically, and β-galactosidase activity was
evaluated as described previously.7 The ratio of the luciferase activity to the
β-galactosidase activity in each sample served as a measure of the normalized luciferase
activity.
Flow Cytometry
To detect CD36 expression, cells were harvested, washed with PBS/3%BSA, and then
incubated with phycoerythrin (PE)-conjugated anti-CD36 (Santa Cruz) antibody. To
detect SR-A expression, the cells were incubated with anti-SR-A (clone 2F8, Cell
Sciences) antibody, followed by a fluorescein isothiocyanate (FITC)-conjugated
secondary antibody (Vector). Labeled cells were analyzed on a FACSCalibur flow
cytometer using the CellQuest software program (BD Biosciences).
Animals
C57Bl/6 and ApoE-deficient mice (hybrids of the C57Bl/6 and 129Sv strains) were
obtained from the Jackson Laboratories. All experiments were approved by the
University of Tokyo Ethics Committee for Animal Experiments.
Atherosclerosis in ApoE-Deficient Mice
Eight-week-old ApoE-deficient mice were fed an atherogenic diet containing 20%
(wt/wt) fat with 0.15% (wt/wt) cholesterol. After the mice were killed, the extent of
fatty streak formation was evaluated by measuring (1) the area of the en face surface
lesion in the entire aorta and (2) the cross-sectional lesion area at the aortic root. Briefly,
for evaluation of the entire aorta, the aorta was dissected from the aortic sinus to the
iliac bifurcation, and lipid-rich atheroma was visualized by staining with Sudan IV. To
assess cross-sectional lesions of the aortic sinuses, 5 serial sections at intervals of 50 µm
were prepared and analyzed by Oil Red O staining and immunohistochemistry.
Air-dried cryostat sections were fixed in acetone and stained with anti-mouse IL-6
antibody (BD PharMingen). After incubation with biotinylated secondary antibody
(DakoCytomation), the sections were incubated with horseradish peroxidase-labeled
3
streptavidin solution (DakoCytomation) and visualized using 3-3’ diaminobenzidine
(DAB). The sections were then counterstained with Mayer’s hematoxylin.
Statistical Analyses
All values in the text and figures represent means ± S.D. Statistical analysis of the data
was carried out using Student’s unpaired t test or 1-way ANOVA followed by
Bonferroni/Dunn test for multiple comparisons. Values of P<0.05 were considered
significant.
4
References
1.
2.
3.
4.
5.
6.
7.
Eickelberg O, Pansky A, Mussmann R, Bihl M, Tamm M, Hildebrand P,
Perruchoud AP, Roth M. Transforming growth factor-beta1 induces interleukin-6
expression via activating protein-1 consisting of JunD homodimers in primary
human lung fibroblasts. J Biol Chem. 1999;274:12933-12938.
Tontonoz P, Nagy L, Alvarez JG, Thomazy VA, Evans RM. PPARgamma promotes
monocyte/macrophage differentiation and uptake of oxidized LDL. Cell.
1998;93:241-252.
Pfitzner E, Kirfel J, Becker P, Rolke A, Schule R. Physical interaction between
retinoic acid receptor and the oncoprotein myb inhibits retinoic acid-dependent
transactivation. Proc Natl Acad Sci U S A. 1998;95:5539-5544.
Oishi Y, Manabe I, Tobe K, Tsushima K, Shindo T, Fujiu K, Nishimura G, Maemura
K, Yamauchi T, Kubota N, Suzuki R, Kitamura T, Akira S, Kadowaki T, Nagai R.
Kruppel-like transcription factor KLF5 is a key regulator of adipocyte
differentiation. Cell Metab. 2005;1:27-39.
Okazaki H, Osuga J, Tsukamoto K, Isoo N, Kitamine T, Tamura Y, Tomita S,
Sekiya M, Yahagi N, Iizuka Y, Ohashi K, Harada K, Gotoda T, Shimano H,
Kimura S, Nagai R, Yamada N, Ishibashi S. Elimination of cholesterol ester
from macrophage foam cells by adenovirus-mediated gene transfer of
hormone-sensitive lipase. J Biol Chem. 2002;277:31893-31899.
Aizawa K, Suzuki T, Kada N, Ishihara A, Kawai-Kowase K, Matsumura T, Sasaki
K, Munemasa Y, Manabe I, Kurabayashi M, Collins T, Nagai R. Regulation of
platelet-derived growth factor-A chain by Kruppel-like factor 5: new pathway of
cooperative activation with nuclear factor-kappaB. J Biol Chem.
2004;279:70-76.
Manabe I, Kurabayashi M, Shimomura Y, Kuro-o M, Watanabe N, Watanabe M,
Aikawa M, Suzuki T, Yazaki Y, Nagai R. Isolation of the embryonic form of
smooth muscle myosin heavy chain (SMemb/NMHC-B) gene and
characterization of its 5'-flanking region. Biochem Biophys Res Commun.
1997;239:598-605.
5
Supplemental Figure I.
Am80 does not affect PMA-induced C/EBPβ expression
Raw264 cells were pretreated with or without Am80, after which expression of C/EBPβ
were assessed by real-time PCR at the indicated times after PMA treatment. Data are
means ± S.D. of three independent experiments. #P < 0.05, ##P < 0.01 vs. PMA
untreated control.
6