ICANCER RESEARCH57. 4940-4947. November I, 9971
B Lymphocytes from Patients with Chronic Lymphoproliferative Disorders Are
Equipped with Different Costimulatory Molecules'
Livio Trentin,
Renato
Zambello,
Rosaria
Sancetta,
Monica
Facco,
Andrea
Cerutti,2
Alessandra
Penn,
Marta
Siviero,
Umberto Basso, Michela Bortolin, Fausto Adami, Carlo Agostini, and Gianpietro Semenzato3
Department of Clinical and Experimental Medicine, Padua University School of Medicine IL 1'., R. Z, R. S., M. F., A. C., A. P., M. S., U. B., M. B., F. A., C. A.. G. S.], and
Division ofHematology,
Vicenza Hospital IL 7'.. R. ZJ. 35128 Padua. italy
INTRODUCTION
ABSTRACT
Several costimulatory molecules play a key role in the differentiation
of B lymphocytesand in T-B-cell interactions. In this study, we ad
dressed the question of whether different receptors and counter-recep
tors may be expressed on malignant B lymphocytes from chronic B-cell
malignancies. Using flow cytometry and reverse transcription PCR
analyses, the expression of molecules belonging to the tumor necrosis
factor receptor (TNFR) and tumor necrosis factor ligand (TNFL)
families, as well as the expression of CD8O and CD86 molecules, was
analyzed in normal B cells and In different chronic lymphoproliferative
disorders of B-cell type, including B-cell chronic lymphocytic leukemia
(CLL), mantle cell lymphoma, hairy cell leukemia (HCL), and HCL
variant.
Different patterns of expression of TNFR and TNFL superfamily
molecules were demonstrated among B-cell malignancies. In particu
lar, CD4O was commonly observed on all B cells (both tumor and
normal),whereasits ligand (CD4OL),whichis usuallyundetectableon
resting normal B lymphocytes, was expressed in CLL and HCL but not
in other chronic lymphoproliferative disorders. CD27 was not shown in
normal B cells, although it was present in all malignancies and with
particularly high density in mantle cell lymphoma. CD7O was widely
distributed on tumor B lymphocytes, but not on the CD5+ normal
counterpart. CD3Owas strongly expressed in HCL variant and weakly
in B-cell CLL, whereas its ligand showed a wide pattern of expression,
including all neoplastic and normal B cells. TNFR II (CD12Ob) and
CDSO were distributed on neoplastic B cells from all groups, usually at
an intermediate to high degree ofintensity, whereas the CDS6 molecule
was present at lower intensity than CD8O. Finally, reverse transcrip
tion PCR analysis confirmed the presence of CD4OL, CD3O, and
CD3OL mRNAs in those B cells expressing the corresponding mem
brane-bound proteins at low density.
Our data indicate that TNFR and TNFL molecules are of use
clinically both in differentiating B-cell malignancies from the normal
counterpart (i.e., CD27, CD7O, CD4OL, CD3O, and CD8O) and in
defining different chronic B-cell disorders (i.e., CD4OL, CD27, and
CD3O). Interestingly, the observation that several receptors and their
ligands (i.e., CD4O/CD4OL, CD3O/CD3OL, and CD27/CD7O) can be
expressed on the same cell suggests that these molecules play a role in
initiating and maintaining the neoplastic process by mediating B-T and
B-B interactions.
Received 6/I 1/97; accepted 9/5/97.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance with
@
18 U.S.C. Section 1734 solely to indicate this fact.
This work was supported by the Italian Association for Cancer Research (Milan.
Italy), by the National Research Council (Rome. Italy), Special Project on Clinical
Applications of Oncological Research. and by the Ministero dell'Università e Ricerca
Scientifica e Tecnologica (Rome, Italy). M. F. is the recipient of a fellowship from the
Italian Association for Cancer Research (Milan, Italy), and R. S. is the recipient of a
fellowship from the Ministero della Sanità , Istituto Superiore di Sanità (Rome, Italy).
2 Present
address:
Cornell
University
Division of Molecular Immunology,
Medical
College,
Department
of
Pathology,
1300 York Avenue, New York, NY 10021.
CLDs4 of B-cell lineage represent a heterogeneous group of ma
lignancies that includes different histological and clinical entities. The
use of morphological criteria does not allow a definitive character
ization of different types of CLDs. In the last 10 years, the use of
mAbs recognizing a large variety of surface molecules in most in
stances has identified the normal B-cell counterpart from which the
malignant transformation originates (1). These studies first made the
distinction of B lymphocytes in cells lacking or expressing the CDS
molecule, this antigen being consistently present in at least two B-cell
disorders (i.e., B-CLL and MCL) whereas CDS—B-cell malignancies
represent a heterogeneous group of CLDs with discrete phenotype,
including HCL, HCL-v, marginal zone NHL, centerfollicular NHL,
and lymphocytic lymphoma, among others (1—3).These diseases may
be differentiated from each other on the basis of the expression of
several markers, including CD23, CD25, CDI lc, CDIO, CD1O3,
CD38, and CD77 determinants.
The TNFR superfamily represents an emerging family of receptors,
the components of which bind surface membrane molecules acting as
cytokines,
which are referred
to as the TNFL superfamily
(4—9). Most
of these components are implicated in cell-to-cell communication and
play a pivotal role in the regulation of normal B-cell activation,
proliferation, and differentiation, thus controlling cell survival or
death by apoptosis. In addition to the above molecules, other struc
tures are known to display a role in costimulatory mechanisms (i.e.,
CD8O and CD86 molecules). These other structures do not belong to
the TNFR superfamily, but they can be up-regulated following inter
action of TNFR superfamily molecules (i.e., CD4O) with their ligands,
or, alternatively, following triggering of TNFR molecules by specific
antibodies (10—15). The role of some of these molecules in the
proliferation of neoplastic B cells has been emphasized in the past
(16—21).In particular, TNFR II (CD12Ob) is a structure that trans
duces proliferation signals to malignant B cells in B-CLL and HCL
following binding to its ligand (TNF), a molecule that can behave as
an autocrine factor (17, 19). CD4O, as well as other TNFR and TNFL
superfamily components, has been reported to play a regulatory role
in normal and neoplastic B cells, mainly in CLL (14, 15, 22—25).
To investigate their pattern of distribution, CD4O-CD4OL, CD27CD7O, CDl2Oa,b-mTNF, CD3O-CD3OL, CD9S(Fas)-CD95L(FasL),
and CD28-CD8O/CD86 were analyzed by flow cytometry analysis
and RT-PCR on a wide spectrum of B-cell populations, including
normal B cells and neoplastic B lymphocytes from CLL, MCL, HCL,
and HCL-v. The data reported in this study suggest the possible
clinical use of these molecules in differentiating chronic B-cell ma
lignancies. In addition, evidence is provided that some receptors and
their ligands may be expressed on the same cell, thus suggesting the
4 The abbreviations
used are: CLD, chronic
lymphoproliferative
disorder;
mAb, mono
clonal antibody; CLL, chronic lymphocytic leukemia; B-CLL, B-cell CLL; MCL, mantle
cell lymphoma; HC, hairy cell; HCL, HC leukemia; HCL-v, HCL variant form; NHL,
non-Hodgkin B-cell lymphoma; TNF, tumor necrosis factor; TNFR, TNF receptor; TNFL,
timento di Medicina Clinics e Sperimentale, Via Giustiniani 2, 35128 Padua, Italy. Phone:
TNF ligand; mTNF, membrane TNF; RT, reverse transcription; PBMC, peripheral blood
mononuclear cell; MFI. mean fluorescence intensity; oligo(dT), oligodeoxythymidylic
39-49-82 1-2298 or 39-49-82 1-2299; Fax: 3949-875-4179.
acid.
3 To
whom
requests
for
reprints
should
be addressed,
at UniversitÃ
di Padova,
Dipar
4940
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1997 American Association for Cancer Research.
COSTIMULATORY MOLECULES ON NEOPLASTIC B LYMPHOCYTES
involvement of B-B-cell interactions in initiating and maintaining the
neoplastic process.
CD8O(BB1), CD86 (BU63), CD95 (UB2), and isotype-matched controls. The
PATIENTS
CD3Oligand (CD3OIJCD153, M8l; kindly provided by Dr. A. Troutt, lmmu
nex Co., Seattle, WA); B0.l54.2 anti-TNFa mAb (kindly provided by Dr. G.
(L293), CD4O (5C3), CD4O ligand (CD4OL/CD154,
following non-commercially
Patients.
AND METHODS
Thirty-four
patients
Trinchieri, Philadelphia,
with different
B-cell malignancies
have been
24—31),CD7O (BU69),
available mAbs were also used: CD3O (M44) and
PA); utr-l and htr-9 recognizing
the 75-kDa TNFR
(CD12Ob,TNFR II) and the 55-kDa TNFR (CD12Oa,TNFR I), respectively
(kindly provided by Dr. M. Brockhaus, Basel, Switzerland).
studied. Sixteen patients (10 males and 6 females, ages 42—56years) with
B-CLL were graded according to Rai staging system (26) as follows: stage 0,
6 cases; stage I, 4 cases; stage II, 2 cases; stage III, 2 cases; and stage IV, 2
ecules. The expression
cases. The total lymphocyte count ranged from 25,200 to 7 1,320 cells/mm3.
Leukemic B cells from these patients expressed CD19 B cell-related antigen
and the CD5 molecule; they bear surface immunoglobulins (SmIg) at low
cence assay as described previously (27). An indirect immunofluorescent
technique was performed as reported previously (28) to evaluate the positivity
Flow Cytometric
assessed
Analysis
of B Cell-related
and Counterreceptor
of the above-mentioned
by flow cytometry
analysis
using direct
antigens
Mol
on B cells was
or indirect
immunofluores
intensity, with restriction for Klight chain in 10 patients and for A light chain
for CD12Oa,CDl2Ob, CD3OL,and mTNF. Following incubation of cells with
in 6 patients. All patients were studied at diagnosis. Six patients (four males
and two females, ages 52—65years) with MCL in the leukemic phase were
the above-mentioned mAbs or the control matched mAb, they were washed,
and a FITC-conjugated antimouse IgG mAb (Technogenetics, Turin, Italy) was
studied. These cells expressed the CDI9 and CD5 antigens but lacked the
CD23 and CD25 molecules (1). Eight HCL patients (five males and three
added. After this last incubation, cells were washed and subjected to analysis.
For FACS analysis, 1 X l0@ cells were acquired, and the analysis was
determined by overlaying the histograms of the samples stained with the
females,
ages 45—62 years) with leukemic
B cells in the peripheral
blood were
investigated. The diagnosis was established on the basis of clinical, morpho
different
logical, cytochemical, histological, and immunological features as described
previously (19). HCs showed the immunological pattern of typical HCL,
bearing CD19, CD1O3, CD25, and CD11c molecules; all patients showed
Dickinson), and data were processed using the CELLQuest or Lysys programs
(Becton Dickinson). Log MFI values were obtained by subtracting the MFI of
isotype control from the MFI of the positively stained sample. Furthermore, to
positivity for tartrate-resistant
evaluate
acid phosphatase. None of the patients received
therapy at the time of the study. Four patients with HCL-v (two males and two
females, ages 40—55years) were included. These cells stained CDI9, CDI lc,
and CDIO3 antigens but lacked the CD25 molecule (3).
Preparation of Cell Suspensions. PBMCs from patients with B-CLDs
were harvested from freshly heparinized blood specimens by centrifugation on
a Ficoll-Hypaque gradient as reported previously (27). Normal CD5+ and
reagents.
whether
Cells were scored using a FACScan
the differences
between
analyzer
(Becton
the peaks of cells were statistically
significant with respect to control, the Kolmogorov-Smirnov
test for analysis
of histograms was used (20), according to the CELLQuest software user's
guide
(Becton
Dickinson).
RNA Extraction, cDNA Synthesis, and PCR Amplification of CD3O,
CD3OL, and CD4OL. Total cellular RNA was extracted using the Ultraspec-Il
RNA isolation system (Biotecx Laboratories, Houston, TX) from purified
five normal spleens, respectively. Cord blood lymphocytes were recovered
following centrifugation on a Ficoll-Hypaque gradient, and splenic mononu
clear cells were collected after mechanical disruption of the spleen as already
leukemic cells (>99% CDI9+ lymphocytes) and phytohemagglutinin (5 @tg/
ml)-stimulated PBMCs. cDNAs were prepared from 2 @.tg
of total cellular RNA
by RT at 42°Cfor 30 mm in a 20-Mlreaction. eDNA was synthesized in the
presence of Moloney murine leukemia virus reverse transcriptase (2.5 units),
described (28). Cell samples were washed three times with PBS and resus
pended in endotoxin-free RPMI 1640 (Sigma Chemical Co., St. Louis, MO)
using 2.5 p@Moligo(dT) acid primer and reaction conditions described by the
manufacturer (Invitrogen Corp., San Diego, CA). The reaction was stopped by
supplemented with 20 misiHEPES and L-glutamine, 100 units/mI penicillin,
heating the sample to 99°Cfor 5 mm.
For the amplification of CD3O,CD3OL,CD4OL,FasL, and (3-actin,a PCR
CD5— B lymphocytes
were obtained
100 @&g/ml
streptomycin,
from five cord blood samples
and from
and 10% FCS (ICN Flow, Costa Mesa, CA).
T cells were removed from the entire cell suspension by rosetting with
neuroaminidase (Sigma)-treated sheep RBC. Cell samples were further de
pleted of adherent cells by incubation for 1—2
h in plastic Petri dishes at 37°C
in an atmosphere of 95% air and 5% CO2. Additional enrichment of B cells
was obtained by removing residual CD3@,CDl6@, and CD56@lymphocytes
using high-gradient
magnetic separation columns (Miltenyi Biotec, Bergisch
Gladbach, Germany) as described previously (20). Briefly, 10 X 106 cells
obtained as above were incubated for 30 mm at 4°Cin 80 pi of PBS with
purified sodium azide-free CD3 (OKT3, Ortho Pharmaceuticals, Raritan, NJ),
CD16 (Leu-llc, Becton Dickinson, Sunnyvale, CA), and CD56 (Leu-19,
Becton
Dickinson)
mAbs.
After
two washes
with
PBS
supplemented
was conducted in a 50-@d reaction using 2
@l
of eDNA as template. The PCR
mixture consisted of 1.5 mmol/liter MgCl2, 50 mmol/liter KC1, 10 mmol/liter
TRIS-HCL,
0.2 mM/liter concentrations
of each deoxynucleotide
triphosphate,
2.5 units of Taq polymerase (Perkin-Elmer Corp., Norwalk, CT), and 25 @M
each specific primer. The following sense and antisense oligonucleotide primer
sequences were used. For CD3O: 5'-CACCGGAGGGCCTGCAGGAAGC
GAAT, 3'-CCCAGGCCTCAC'ITFCCAGAGGCAGC (expected size of 574
bp); for CD3OL: 5'-CTCCTGGAGACACAGCCATGC,
3'-TGCTTGTATC
TATGTACTGGA (expected size of 618 bp); for CD4OL:5'-ACATACAAC
CAAAC11@CTCCC,3'-AGATGTFGlTVrACrGCTGGC (expected size of
398); for FasL: 5'-GGGATGlTI'CAGCTCTI'CCACCTAC,
with
0.5% BSA, 20 ,.d of colloidal superparamagneticmicrobeads conjugated with
goat antimouse IgG antibodies were added. The CD3@,CDl6@, and CD56@
cells being rosetted with microbeads were then isolated and removed applying
3'-GCTCTA
GAACATTCCTCGGTGCCTGTAAC (expected size of 600 bp); for @-actin:
5'-GTGGGGCGCCCCAGGCACCA,
3'-CTCCUAATGTCACGCACGAT
a magnetic system to the outer wall of the columns. Cord blood CD5 + B
TFC (expected size of 540 bp; Ref. 29). CD3O, CD3OL, CD4OL, and FasL
were amplified under the following conditions: 45 s of melting at 94°C,45 s
lymphocytes
of annealing
were
further
enriched
by removing
residual
CD1 lb@, CDl3@,
at 60°C, and 120 s of extension
at 72°C for 30 cycles
followed
by
and CDl4@ cells using Leu-15 (Becton Dickinson), WM-47 (Dako, Glostrup,
a final extension for 7 mm at 72°Cin a Perkin-Elmer Cetus thermal cycler. For
Denmark), and Leu-M3 (Becton Dickinson) mAbs and by positive enrichment
using CD5 mAb and magnetic beads. Following this multistep negative selec
tion procedure, more than 98% of the resulting cell population was CDl9@
(Leu-l2, Becton Dickinson), whereas less than 1% was [email protected] than 97%
of the cells were viable when tested by the trypan blue exclusion. Enriched
@3-actin, amplification
conditions
were 60 s of melting at 94°C, 60 s of
annealing at 55°C, and 120 s of extension at 72°C for 30 cycles followed by
B-cell samples
simultaneously
stained
with CD19 and CD5 (IOT1a,
Immuno
a final extension of 7 mm at 72°C.Twenty
@ilof each PCR product was
electrophoresed in a 2% agarose gel in Tris-borate EDTA buffer. Gels were
stained with ethidium bromide and photographed. To avoid contamination,
reagent controls were performed. Furthermore, monocyte and T-cell contam
ination
tech, Marseille, France) mAbs showed the following percentages of
of B-cell mRNA
samples
was checked
using specific
primers
for CD3
CDl9@CD5@ lymphocytes: cord blood B cells from 92 to 96%, splenic B cells
and CD14. No detectable messages for these molecules were observed in
from 1 to 3%, and B-CLL cells from 98 to 100%.
mAbs. The commercially available mAbs used belonged to the Ancell
enriched B-cell samples.
(Bayport, MN), Becton Dickinson
RESULTS
& Co., DAKO, Immunotech
(Marseille,
France), PharMingen (San Diego, CA), Serotec (Oxford, United Kingdom),
and Ancell (Bayport, MN) series and included the following: CD5 (BL1a and
UCHT2), CD23 (Leu-20), CD25 (a chain of IL-2R), CD27 (M-T27l), CD28
Table 1 summarizes the overall results of flow cytometry data
obtained in different cell suspensions. All of the molecules under
4941
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1997 American Association for Cancer Research.
COSTIMULATORY MOLECULES ON NEOPLASTIC B LYMPHOCYTES
Table
Cell type
CD4O
CLL
Summary
B-cell CLDs
of
TNFR IIin mTNF'@ CD95
TNFR Imolecules
CD3OLcostimulatory
CD7O―of CD3O―expression
CD40L'@1 CD27'@ofpatterns
CD95Lb
CD8O
CD86
CD28
++++c@++++++++—+—+—+++—++++—+++++—++—+—+—+++—++++————++—+—+—+——+++++++++—++—++++—+++++—++++—+++++++++—+++++—++++—++++—++—+—+—+—+++—
MCL
Normal CD5 + B cells
HCL
HCL-v
Normal CD5 —B cells
a Putative relevanceon clinical grounds.
b Data concerning CD95L
were obtained by RT-PCR.
C_ , negative;+ to + + + + , gradingof the intensityof a moleculeon the surfacemembrane.
@
study showed a unimodal expression on cell surface, and the histo
gram was shifted to the right in relation to the intensity of antigen
expression. The findings were obtained by overlaying histograms of a
defined molecule and the related control. Table 2 shows the MFIs of
the molecules tested.
Flow Cytometry Analysis of Costimulatory Molecules on Nor
mal B Lymphocytes. Both CD5+ and CD5— normal B cells were
taken into account for flow cytometry analysis (Tables I and 2; Figs.
1 and 2). Some of these molecules have been initially reported as
negative (28), probably related to the enrichment procedure of normal
B cells. To rule out the effect ofenrichment technique, freshly isolated
samples were herein double stained with CD5, CD19, and other
mAbs. The analysis of these molecules showed that CD4O was highly
expressed on normal CD5+ B cells (Fig. lc), as well as normal
CDS —B cells (Fig. 2c). Its ligand, CD4OL, was absent (Figs. if and
2J). CD27 and CD7O were lacking on normal CD5+ B lymphocytes
(Fig. i, and 1, respectively), whereas they have been demonstrated at
very low intensity on normal CD5 —B cells (Fig. 2, i and 1, respec
tively). CD3O (Figs. io and 2o) was not detected, whereas CD3OL was
present both on CD5+ (Fig. lr) and CD5— (Fig. 2r) B cells. CD8O
was observed to various degrees on both CD5+ (Fig. lu) and CDS
(Fig. 2u) normal B lymphocytes, whereas CD86 was negative on
CD5 + (Fig. lx) and positive on CD5— (Fig. 2x) normal B lympho
cytes.
Flow Cytometry Analysis of Costimulatory Molecules on Leu
kemic B Cells from CLL. The phenotypic pattern of leukemic cells
from the 16 B-CLL patients studied was consistent with the common
immunological profile of these cells (low-density SmIg, CD5+,
CD23+, and CD25±). The CD4O molecule was detected at high
density in all patients (Fig. la). The expression of its ligand, CD4OL,
although faint, was significantly shifted with respect to control mAb
(Fig. 14 CD27 and its ligand, CD7O, were expressed on B-CLL
malignant cells (Tables 1 and 2 and Fig. 1, g and j). The CD3O
molecule was faint in CLL (Fig. lm); its ligand (Fig. ip and Tables 1
and 2) was detectable at low density. Flow cytometry analysis of
CDl2Oa and CD12Ob (Table 1) was consistent with the data reported
in the literature (18, 19). In fact, the CDl2Ob (TNFR II, p75), but not
the CDl2Oa (TNFR I, p55) was shown on leukemic cells in B-CLL
(Table 1). The CD95 antigen was consistently present on these cells
(Tables I and 2), whereas its ligand was lacking. Concerning the
CD8O and CD86 molecules, B-CLL leukemic cells were commonly
stained with CD8O (Fig. Is), whereas the CD86 molecule was lacking
or was very faint (Tables 1 and 2 and Fig. lv). The counterreceptor for
these two molecules, represented by CD28, was absent in all B-CLL
neoplastic cells (Table 1).
In conclusion, B-CLL cells bear CD4O, CD4OL, CD27, CD7O,
CD9S, and CD8O and differ from normal CD5+ B cells that lack
CD4OL, CD27, CD7O, and CD3O molecules. CD4OL and CD3O also
proved to be useful in differentiating B-CLL from MCL (Table 1).
CD3O also may be expressed by malignant B cells in B-CLL but not
on normal B lymphocytes. Furthermore, CD3O can distinguish CLL
from HCL-v, as well as distinguishing these two disorders from
normal B cells and other B-cell malignancies.
Flow Cytometry Analysis of Costhnulatory
Molecules on Neo
plastic B Cells from MCL. B lymphocytes from six patients with
MCL in leukemic phase stained with the mAbs CD19, CD2O, and
CDS, whereas CD23, CDllc, and CD1O molecules were lacking.
The flow cytometry analysis of TNFR superfamily molecules and
their ligands, as well as the CD8O/CD86 antigens, is reported in
Tables I and 2 and in Fig. 1. CD4O has been observed on purified
mantle cells (Fig. lb), with a pattern similar to that shown in other
B-cell types, whereas its ligand, CD4OL, was lacking (Fig. le).
Malignant cells from MCL showed both the CD27 (Fig. lh) and its
ligand CD7O (Fig. 1k) on their surface membrane; CD27 was
highly expressed on these cells as compared to B-CLL lympho
cytes (Fig. lg). CD3O was usually lacking (Fig. ln), whereas its
ligand was definitively detectable (Fig. lq). Of the two TNFRs,
only CDl2Ob was seen in MCL. CD8O was highly expressed on
mantle cells (Fig. 1t), whereas CD86 was weak (Fig. 1w).
These data indicate that the peculiar features of MCL are repre
sented by the marked expression of CD27 and CD8O antigens and the
lack of CD4OL and CD3O molecules. This distinguishes mantle cells
from normal CD5+ B lymphocytes and from other malignant B cells.
Flow Cytometry Analysis of Costimulatory
Molecules on B
Cells from HCL. Data related to flow cytometry analysis are pre
sented in Tables 1 and 2 and in Fig. 2. The CD4O histogram was
highly shifted with respect to the control antibody on HCs from all
patients (Fig. 2a). HCs also bore CD4OL (Fig. 2d). CD27 (Fig. 2g) and
its ligand, CD7O, (Fig. 2j) were expressed at low density on HCs.
CD3O was always completely negative on these cells (Fig. 2m),
Table 2 Flow cytometiy analysis of costimulatory molecules in B-cell CLDs°
Cell types
CD4O
CD4OL
CD27
CD7O
CD3O
CD3OL
TNFR I
TNFR II
mTNF
CD95
CD8O
CD86
CD28
CLL
MCL
207.3±18.143.1±14.7 36.4±10.722.2±14.9 21.9±5.4 37.7±6.7 1.1±0.9 28.3±6.3 5.8 ±1.3 28.9±7.3 100.4±18.123.1±8.2 3.9 ±2.6
213.4±22.8 5.2 ±3.2 130.7±19.160.2±28.9 4.7 ±2.7 77.6±16.13.8 ±2.1 30.8±8.9 9.9 ±4.4 27.9±6.5 83.2±13.730.2±7.3 5.4 ±2.1
Normal CD5+
201.6 ±24.7
9.4 ±3.3
3.7 ±2.1
5.2 ft 0.8
4.4 ±2.1 53.0 ±19.7 2.3 ±1.3 34.7 ±5.9
7.4 ±4.3 23.2 ±3.9
34.8 ±11.7
9.4 ±3.4
6.3 ±2.7
B cells
HCL
249.8 ±30.1 51.2 ±17.4
HCL-v
230.5 ±22.5 1.0 ±0.7
Normal CD5—265.4 ±12.9 4.8 ±2.9
B cells
@
57.8 ±7.6
28.6 ±13.3
1.7 ±1.7 67.0 ±21.7 6.4 ±2.4 75.8 ±6.9 28.3 ±5.2 34.8 ±8.3 151.3 ±21.6 70.3 ±22.2 3.3 ±0.8
32.6 ±13.3 50.7 ±4.3 100.7 ±7.4 87.7 ±7.5 3.9 ±2.9 88.1 ±9.1 36.4 ±6.9 30.4 ±5.1 70.3 ±22.2 48.5 ±7.0 4.7 ±1.1
15.6 ±1.9 12.1 ±2.6
3.8 ±1.1 12.8 ±1.7 8.3 ±3.1 36.7 ±7.4 7.6 ±3.7 29.8 ±4.3 46.3 ±8.4 18.5 ±9.1 5.9 ±0.9
a
reportedas mean ±SE of the MFIs for eachgroupof subjectsafter subtractingthe MR of isotypecontrolmAb from the MR of positivelystainedsamples.Bold numbers
denote the significant values.
4942
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1997 American Association for Cancer Research.
COSTIMLJLATORYMOLECULES ON NEOPLASTIC B LYMPHOCYTES
MCL
CLL
a
CD4O
@
. :;@a@-@-r
;-r.i@Jr-.
@.
.
d
CD4OL:
normalCD5+B cells
L.J;pTL,.
5....1
CD27
@
Fig. 1. Flow cytometry analysis of the expression
I. .._.
.â. €˜
CD7O
ofCD27/CD7O, CD4O/CD4OL,CD3O/CD3OL,CD8O,
and CD86 molecules on normal and malignant CDS+
B cells. The analysis was performed on enriched B
cells after acquiring I X l0@cells. Overlayed histo
grams related to control and cells stained with specific
m
mAbs are shown in each panel. The Kolmogorov
Smirnov test was used to assess the statistical differ
CD3O
ence between histograms.
@i@@,iTh__
. , ..
p
CD3OL:
CD8O
CD86
Log. fluorescence
whereas its ligand was detected (Fig. 2p), as in other malignant and
normal B cells. Of the two TNFRs, only CDl2Ob has been shown on
leukemic B cells; mTNF was also detectable on HCs (Tables 1 and 2).
CD95 was usually present at low density, whereas its ligand was
lacking. The CD8O molecule has been observed (Fig. 2s) on HCs at a
intensity
Flow Cytometry Analysis of Costimulatory Molecules on B
and for the
Cells from Patients with HCL-v. With respect to the classical form
of HCL, the CD4OL was lacking in HCL-v (Fig. 2e), whereas CD27
(Fig. 2h), CD7O (Fig. 2k), CD3O (Fig. 2n), CD3OL (Fig. 2q), CD95
(Table 1), and CDl2Ob (Table 1) were regularly present. Both CD8O
(Fig. 2:) and CD86 (Fig. 2w) were expressed; CD8O was stronger than
CD86. Both CD4OL and mTNF were detectable on HCs with respect
to the control B lymphocyte.
higher density of CD8O antigen. Furthermore, the expression of
CD4OL differentiates HCL from HCL-v and MCL, whereas CD3O
expression better differentiates HCL from HCL-v and B-CLL.
the classical HCL and its variant form is based on the presence of CD3O
and the lack of CD4OL in HCL-v with respect to HCL.
density
higher
than CD86
(Fig. 2v).
In summary, HCs differ from normal CD5 —B lymphocytes for the
presence
of CD4OL and mTNF on their surface
membrane
In terms of the markers evaluated
in this study, the distinction
between
4943
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1997 American Association for Cancer Research.
COSTIMULATORY MOLECULES ON NEOPLASTIC B LYMPHOCYTES
HCL
normalCD5-B cells
HCL-variant
CD4O
CD4OL
CD27
Fig. 2. Flow cytometry analysis of the expression of CD27/CD7O, CD4O/CD4OL, CD3O/CD3OL
CD7O
CD8O,andCD86moleculeson normaland malig
, . .@;e@-i-rn.@. .1.....
nant CD5—B cells. The analysis was performed on
enriched B cells after acquiring I X l0@'cells.
Overlayed histograms related to control and cells
stained with specific mAbs are shown in each
panel. The Kolmogorov-Smirnov test was used to
assess the statistical difference between histograms.
CD3O
I
CD3OL
r
--.@--@-@
CD8O
CD86
Log. fluorescence intensity
Characterization
of FasL, CD3O, CD3OL, and CD4OL on Hu
man B Cells by PCR Analysis. Due to the low expression of some
shown in CLL and HCL, whereas it was lacking in MCL, HCL-v, and
control B lymphocytes (both CD5+ and CD5—; Lanes 6 and 12,
TNFR and TNFL superfamily molecules on malignant B cells, the
respectively).
presence of CD4OL, CD3O, CD3OL, and FasL molecules were also
analyzed by RT-PCR (Fig. 3). mRNA for FasL was commonly absent
both in normal and malignant B lymphocytes (data not shown). The
findings reported in this figure are consistent with the data obtained by
flow cytometry analysis. In particular, CD3O was faint in CLL and
strongly expressed in HCL-v, whereas it was usually lacking in other
malignant B cells tested (HCL and MCL). CD3OL was detected in all
neoplastic B cells taken into consideration. CD4OL was consistently
DISCUSSION
This study was designed to investigate the expression of TNFR
superfamily molecules and their ligands on B cells from normal
subjects and on malignant B lymphocytes from patients with CLDs,
including B-CLL, MCL, HCL, and HCL-v. We observed that several
molecules are present in malignant B cells (i.e., CD27, CD7O, and
4944
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1997 American Association for Cancer Research.
COSTIMULATORY MOLECULES ON NEOPLASTIC B LYMPHOCYTES
MCL
B-CLL
@
MC+C-1
@
I —
—@—@
2
3
11
4
N
5
6
CD4OL
HCL
7
8
__
HCL-v
9
ii
101112
N
II
1398
CD3O
CD3OL
@
Actin
MU@
@..
@‘ @*
@. .@
540bp
Fig. 3. RT-PCR analysis of mRNAs for CD4OL,CD3O,and CD3OLon purified B cells from chronic lymphoproliferative disorders and normal subjects. M, molecular weight marker;
C+, phytohemagglutinin-stimulated PBMCs; C—,negative control obtained following PCR amplification without eDNA. Lanes 1—3.
three patients with B-CLL; Lanes 4 and 5. two
patients with MCL; Lane 6. normal CD5+ B cells; Lanes 7—9,
three patients with HCL; Lanes 10 and ii, two patients with HCL-v; Lane 12. normal CD5—B lymphocytes.
CD86), but not in the normal counterpart and that some of them
(CD4OL, CD27, and CD3O) are specifically expressed in discrete
B-cell malignancies (B-CLL, MCL, HCL, and HCL-v). Our data also
emphasize the presence of a defined receptor and its ligand on the
same tumor B cell, such as CD27-CD7O, CD4O-CD4OL, or CD3OCD3OL molecules. The coexpression of these pairs suggests that some
molecules allow both T-B- and B-B-cell contacts and may play a
relevant role in the B-cell accumulation occurring in these disorders.
The first goal of this study was the identification of new molecules
that may be relevant in the diagnosis of CLD. In particular, CD4OL
mAb stained CLL and HCL neoplastic B lymphocytes, but not MCL
and HCL-v; CD27 was detectable at a higher density in MCL than
CLL and other B-cell malignancies; CD3O was present in HCL-v and
not in HCL and other disorders; and CD8O showed a higher intensity
in MCL, HCL, and HCL-v than in other CLDs. These results
strengthen the clinical utility of assessing these molecules in the
diagnosis of patients with malignant B-cell neoplasms. In fact, the
analysis of the above-mentioned molecules not only allows a better
distinction between CD5 + and CD5—malignancies but also permits
a better discrimination of malignant B cells sharing a similar pheno
typic profile. In this regard, detecting the presence of CD4OL and
CD3O molecules better differentiates B-cell malignancies coexpress
ing the CD5 molecule (i.e., CLL and MCL). In addition, the analysis
of CD4OL allows the identification of an additional phenotypic hall
mark that is useful in distinguishing HCL from HCL-v.
The demonstration herein provided of the presence of CD4OL on
freshly isolated malignant B cells represents a novel finding in these
disorders. In fact, CD4OL is commonly detectable on activated T cells
and other immunocompetent cells but not on resting normal B lym
phocytes; the latter express the molecule only following in vitro
stimulation (30). Our observation and data from the literature indicate
that the CD4O/CD4OL complex may be relevant not only in B-T-cell
communications but also in B-B-cell contacts (31, 32). In this context,
the presence of the CD4O/CD4OL pair on the same cell might lead to
B-B-cell contacts that ultimately drive the proliferation and accumu
lation of malignant B lymphocytes, thus ending in a “self-rescue―
from apoptosis. On the contrary, CD4O-mediated signaling is closely
linked to apoptosis during B-cell development and differentiation. In
fact, the triggering of this pathway up-regulates the expression of Fas,
which may drive cell death after binding to its ligand (3 1, 33—36).The
Fas antigen (CD9S) is commonly detected on almost all normal and
malignant B cells analyzed in this study. Fas may induce B cells
susceptible to Fas-mediated death following binding to specific anti
bodies or by T cell-derived FasL.
Another issue that deserves a comment is the possible involvement
of the CD4O/CD4OL pair in autoimmune phenomena. In particular, in
up to 30% of patients with B-CLL, the presence of autoantibodies
against hematopoietic antigens on the surface membrane of RBCs,
and more rarely on platelets, has been demonstrated (37); these
antibodies may account for autoimmune hemolytic anemia and throm
bocytopenia observed in some patients with CLDs. Several studies
performed in a model of murine nephritis have shown that the au
toantibody production accounting for autoimmune disorders (i.e.,
systemic lupus erithematodes) is dependent upon cognate help from
CD4+ T cells, due to the involvement of the CD4O/CD4OL interac
tion (38). With this as a background, it can be suggested that the
expression of CD4O and CD4OL on neoplastic B lymphocytes in
B-CLL4riggers not only the accumulation of these cells, but also, via
the up-regulation of CD8O and CD86, the transformation of anergic B
cells of CLL into fully functional antigen-presenting cells.
The role of CD27 and CD7O molecules in the regulation of tumor
cell growth in patients with B-CLL has already been strengthened by
the observations of Ranheim et a!. (24). Our findings extend the
observations coming from CLL to other tumor cells, including HCL-v
and MCL. B-CLL and MCL are characterized by the expansion of
clonal B lymphocytes bearing the CD5 antigen, a molecule that is
commonly
detectable
on normal
tumor CD5 + B lymphocytes
equipped
B-I
lymphocytes.
The finding
that
from B-CLL and MCL patients are
with CD27 and CD7O antigens,
whereas
normal
B-I cells do
4945
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1997 American Association for Cancer Research.
COSTIMULATORY MOLECULES ON NEOPLASTIC B LYMPHOCYTES
REFERENCES
not bear them, suggests that these molecules play a relevant role in the
B-B-cell contacts in these disorders.
CD3O is a TNFR superfamily molecule detectable on several neo
plastic cells, including Reed-Sternberg cells in Hodgkin's disease and
large-cell lymphomas (4, 5, 7, 39). Our data expand these observa
tions,
demonstrating
that the CD3O molecule
1. Harris, N. L., Jaffe, E. S., Stein, H., Banks, P. M., Chan, J. K. C., Cleary, M. L..
Delsol, G., De WoIf-Peeters, C., Falini, B., Ganer, K. C., Grogan, T. M., Isaacson,
P. 0., Knowles,D. M.,Mason,D. Y.,Mueller-Hermeling,
H. K.,Pileri,S. A.,Pins,
M.A.,Ralfkiaer,E.,andWarnke,R. A. A revisedEuropean-American
classification
of lymphoid neoplasms: a proposal from the international lymphoma study group.
may also be constitu
tively present on tumor B lymphocytes from patients with HCL-v. The
ligand for CD3O has been demonstrated at varying intensity on tumor
and normal B lymphocytes (Ref. 23 and our data). Although CD3O is
highly expressed on resting HCL-v, leukemic B cells, and, to a lesser
extent, B-CLL lymphocytes, its ligand is systematically detectable on
normal and malignant B cells. Our findings that different subsets of
neoplastic B cells bear this membrane molecule at different intensities
suggest that this heterogeneous expression is related to the B-cell
maturation stage.
The CD4O-mediated signaling activates pathways involved in
growth, immunoglobulin class switch recombination, and induction of
genes encoding costimulatory molecules for T cells, including B7—l
and B7—2proteins (CD8O and CD86, respectively), and proteins
involved in differentiation (6, 10, 12, 15, 40—43). Our data showed
that malignant B cells bear both CD8O and CD86 molecules, although
at different degrees of intensity. Whereas CD86 is very weak, CD8O
is usually
detected
at intermediate
density
on normal
and malignant
B
cells; the positivity of tumor cells is statistically significant with
respect to normal B lymphocytes. In this context, the intensity of
expression of these molecules may be relevant in the interactions
between leukemic B cells and normal T lymphocytes. In fact, it has
been reported that the threshold level of expression of CD8O and, to
a lesser extent, of CD86, is important in the induction of T-cell
proliferation in a MLR in vitro (12). According to the animal model
(12), we speculate that the lack of expression or low expression of
CD8O molecule may explain the paucity of immune reaction against
tumor, particularly in terms of cytotoxic function. Support for this
hypothesis comes from the demonstration that in discrete NHL (i.e.,
follicular lymphoma) the priming of malignant B cells with CD4OL
induces an increase in CD8O/CD86 expression and a consequent
recognition of these cells by normal T lymphocytes (12). The latter
mediate cytolytic activity and induce apoptosis of malignant B cells.
Taken together, our data indicate that the engagement of the CD4O
molecule on malignant B cells by the CD4OL, present on the same
cells
or, alternatively
on “normal―autologous
T cells,
results
in a
series of phenomena that could end in the following: (a) bidirectional
proliferative signals with proliferation of tumor B lymphocytes and
accumulation and/or selection of antitumor reactive T cells; (b) dis
equilibrium
between
cell accumulation
via rescue
from apoptosis
and
tumor cell death through apoptotic mechanisms mediated by Fas; and
(c) autoimmune phenomena due to an inappropriate triggering of B
cells, with the consequent production of autoantibodies. In this view,
functional in vitro studies using malignant B cells triggered by CD4O
may clarify the role of CD8O/CD86 molecules on auto- or alloreactive
T cells. Future studies should be focused on investigating the func
tional role of CD4OL expressed on tumor B cells to gain insights into
the B-B-cell communications.
Blood, 84: 1361—1392,1994.
2. Foon, K., and Todd, R. F. I. Immunologic classification of leukemia and lymphoma.
Blood. 68: 1—31,1986.
3. Dc Totero, D., Tazzani, P. L., Lauria, F., Raspadori, D., Francis di Celle. P., Carbone,
A., Gobbi, M., and Foà R
, . Phenotypic analysis of hairy cell leukemia: “variant―
cases
express the interleukin-2 receptor (3 chain, but not the a chain (CD2S). Blood, 82:
528—535,
1993.
4. Smith,C. A.,Gross,H.J., Davis,T..Anderson,D.,Farrah,T., Baker,E.,Sutherland,
0. R., Brannan, C. I., Copeland, N. G., Jankins, N. A., Grabstein, K. H., Gliniak, B.,
McAlister, I. B., Fanslow, W., Anderson, M., Falk, B., Gimpel, S., Gillis, S., Din,
W. S., Goodwin, R. G., and Armitage, R. J. CD3O antigen, a marker for Hodgkin's
lymphoma, is a receptor whose ligand defines an emerging family of cytokines with
homology for TNF. Cell, 73: 1349—1360,1993.
5. Falini, B., Pileri, S., Pizzolo, G., Durkop. H., Flenghi, L., Stirpe, F., Martelli, M. F.,
and Stein, H. CD3O(Ki-l) molecule: a new cytokine receptor of the tumor necrosis
factor receptor superfamily as a tool for diagnosis and immunotherapy. Blood, 85:
1—14,
1995.
6. Hollenbaugh, D., Ochs, H. D., Noelle, R. J., Ledbetter, J. A., and Aruffo, A. The role
of CD4O and its ligand in the regulation of immune response. Immunol. Rev.. 138:
23—37,1994.
7. Goodwin, R. 0., Anderson,
Davis-Smith, T., Hennen,
Grabstein, K. H., Farrah,
biological characterization
M. R., Smith, C. A., Armitage, R. i., Schoenborn, M. A.,
K., Falk, B., Cosman, D., Baker, E., Sutherland, G. R.,
T., Gin, J. G., and Beckmann, M. P. Molecular and
of a ligand for CD27 defines a new family of cytokines
with homology to tumor necrosis factor. Cell, 73: 447—456,1993.
8. Gross, H. J., and Dower, S. K. Tumor necrosis factor ligand superfamily: involvement
in the pathology of malignant lymphomas. Blood, 85: 3378—3404, 1995.
9. Bazzoni, F., and Beutler, B. The tumor necrosis factor ligand and receptor families.
N. EngI.J.Med.,334: 1717—1725,
1996.
10. Clark, E. A., and Ledbetter, J. A. How B and T cells talk to each other. Nature
(Land.), 367: 425—428.1994.
11. June, C. H., Bluestone, J. A., Nadler, L. M., and Thompson, C. B. The B7 and CD28
receptor families. Immunol. Today. 15: 321—331.1994.
12. Schultze, J., Nadler, L. M., and Gribben, J. G. B7-mediated costimulation and the
immune response. Blood Rev., 10: 111—127,1996.
13. Lynch, D. H., Ramsdell, F., and Alderson, M. R. Fas, and FasL in the homeostatic
regulation of immune responses. Immunol. Today, 16: 569—574, 1994.
14. Hintzen, R. Q., de Jong, R., Lens, S. M. A., and van Lier, R. A. W. CD27: marker and
mediator of T cell activation? Immunol. Today. 15: 307—311,1994.
15. Durie, F. H., Foy, T. M., Masters, S. R., Laman, J. D., and Noelle, R. J. The role of
CD4Oin the regulation of humoral and cell-mediated immunity. Immunol. Today. 15:
406—411,1994.
16. Cordingley, F. T., Bianchi, A., Hoftbrand, A. V., Reittie, J. E.. Heslop, H. E..
Vyakarnam. A., Turner, M., Meager, A., and Brenner, M. K. Tumour necrosis factor
as an autocrine tumour growth factor for chronic B-cell malignancies. Lancet, I:
969—971.
1988.
17. Digel, W.. Stefanic, M., Schoniger, W., Buck, C., Raghavachar, A., Frickhofen, N.,
Heimpel, H., and Porzsolt, F. Tumor necrosis factor induces proliferation of neoplas
tic B cells from chronic lymphocytic leukemia. Blood, 73: 1242—1246,1989.
18. Digel, W., Schoniger, W., Stefanic, M., Janssen, H., Buck, C., Schmid, M.,
Raghavachar, A., and Porzsolt, F. Receptors for tumor necrosis factor on neoplastic
B cells from chronic lymphocytic leukemia are expressed in vitro but not in vivo.
Blood. 76: 1607—1613,
1990.
19. Trentin. L., Zambello, R., Agostini, C., Siviero, F., Adami, F., Marcolongo, R.,
Raimondi, R., Chisesi, T., Pizzolo, G., and Semenzato, G. Expression and functional
role of tumor necrosis factor receptors on leukemic cells from patients with type B
chronic lyrnphoproliferative disorders. Blood, 8!: 752—758,1993.
20. Trentin, L., Zambello, R., Agostini, C., Enthammer, C., Cenitti, A., Adami, F.,
Zaniboni, S., and Semenzato, G. Expression and regulation of tumor necrosis factor,
interleukin-2, and hematopoietic growth factor receptors in B-cell chronic lympho
cytic leukemia. Blood, 84: 4249—4253, 1994.
21. Foà ,R., Massaia, M., Cardona, S., Gillio Tos, A., Bianchi, A., Attisano, C., Guarmni,
A.. Francia di Celle, P., and Fierro, M. Production of tumor necrosis factor a (TNF)
by B-cell chronic lymphocytic leukemia cells. A possible regulatory role of 1'NF in
the progression of the disease. Blood, 76: 393—400, 1990.
22. de Bruin, P. C., Gross, H. J., van der Valk, P., Willemze, R., and Meijer. C. J. L. M.
CD3Oexpressionin normaland neoplasticlymphoidtissue:biologicalaspectsand
clinical implications. Br. J. Haernatol.. 9: 1620—1627, 1995.
23. Younes, A., Consoli, U., Thao, S., Snell, V., Thomas, E., Gross, H. J., Cabanillas, F.,
and Andreeff, M. CD3O ligand is expressed on resting normal and malignant B
ACKNOWLEDGMENTS
We thank Dr. M. Gangemi from the Obstetric and Gynecological Clinic of
Padua University for providing cord blood samples. We also thank Dr. A.
Troutt (Immunex Co., Seattle, WA) for providing M44 and M8l mAbs, Dr. M.
Brockhaus (Basel, Switzerland) for providing utr-l and htr-9 mAbs, Dr. G.
Trinchieri
for providing
anti-TNF-a
mAb, and Martin
Donach
for his help in
the preparation of the manuscript.
lymphocytes. Br. J. Haematol., 93: 569—571, 1996.
24. Ranheim, E. A., Cantwell, M. J., and Kipps, T. J. Expression of CD27 and its ligand,
CD7O,on chroniclymphocyticleukemiaB cells.Blood,85: 3556—3565,
1995.
25. Lederman, S., Yellin, M. J., Cleary, A. M.. Pernis, A., Inghirami, G., Cohn, L. E.,
Covey, L. R., Lee, J. J., Rothman, P., and Chess, L. T-BAM/CD4O-L on helper T
lymphocytes augments lyrnphokine-induced
B cell Ig switch recombination and
rescues B cells from programmed cell death. J. Immunol.. 152: 2163—2171.
1994.
26. Rai, K. R., Sawitsky,
A., Cronkite,
E. P., Chanana,
A. D., Levy, R. N., and
4946
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1997 American Association for Cancer Research.
COSTIMULATORY
MOIECULESON NEOPLASTICB LYMPHOCYTES
Pasternack,
B. S. Clinical staging of chronic lymphocytic
leukemia.
34. Wang, J., Taniuchi, I., Howard, M., Cooper, M. D., and Watanabe, T. Expression and
function of Fas antigen on activated murine B cells. Eur. J. Immunol.. 26: 92—96,
Blood, 46:
219—225,
1975.
27. Trentin, L., Zambello, R., Agostini, C., Ambrosetti, A., Chisesi, T., Raimondi, R.,
Bulian, P., Pizzolo, G., and Semenzato, G. Mechanisms accounting for the defective
natural killer activity in patients with hairy cell leukemia. Blood, 75: 1525—1530,
1996.
35. Garrone, P., Neidhardt, E-M., Garcia, E., Galibert, L., van Kooten, C., and Bancherau,
J. Fax ligation induces apoptosis of CD4O-activated human B lymphocytes. J. Exp.
Med.,182: 1265—1273,
1995.
1990.
28. Cerutti, A., Trentin, L., Zambello, R., Sancetta, R., Milam, A., Tassinani, C., Adami,
F., Agostini, C., and Semenzato, G. The CD5/CD72 receptor system is coexpressed
with several functionally relevant counterstructures on human B cells and delivers a
critical signaling activity. J. Immunol., 157: 1854—1862,1996.
29. Trentin, L., Cerutti, A., Zambello, R., Sanceua, R., Tassinari, C., Facco, M., Adami,
F., Rodeghiero,F., Agostini,C., and Semenzato,G. Interleukin-15promotesthe
36. Rathmell, J. C., Townsend, S. E., Xu, J. C., Flavell, R. A., and Goodnow, C. C.
Expansion or elimination of B cells in vivo: dual roles for CD4O- and Fas (CD95)ligands modulated by the B cell antigen receptor. Cell, 87: 319—429, 1996.
37. Caligaris-Cappio, F. B-chronic lymphocytic leukemia: a malignancy of anti-self B
cells. Blood, 87: 2615—1620, 1996.
38. Buhlmann, J. E., and Noelle, R. J. Therapeutic potential for blockade of the CD4O
growth of leukemic cells of patients with B-cell chronic lymphoproliferative disor
ligand, gp39. J. Clin. Immunol., 16: 83—89,1996.
39. Durkop, H., Latza, U., Hummel, M., Eitelbach, F., Seed, B., and Stein, H. Molecular
cloning and expression of a new member of the nerve growth factor receptor family
ders.Blood,87:3327—3335,
1996.
30. Grammar, A. C., Bergman, M. C., Miura, Y., Fujita, K., Davis, L. S., and Lipsky,
P. E. The CD4Oligand expressed by B cells costimulates B cell responses. J. Immu
nol., 154: 4996—5010,1995.
that is characteristic for Hodgkin's disease. Cell, 68: 421—427,1992.
40. Grewal, I. S., and Flavell, R. A. A central role of CD4O ligand in the regulation of
CD4+ T-cell responses. Immunol. Today, 17: 410—414,1996.
41. Gray, D., Siepmann, K., van Essen, D., Poudnier, J., Wykes, M., Jainandunsing, S.,
Bergthorsdottir, S., and Dullforce, P. B-T lymphocyte interactions in the generation
31. Scott, D. W., Grdina, T., and Sin, Y. T cells commit suicide, but B cells are murdered.
J. Immunol., 156: 2352—2356,1996.
32. Nishioka, Y., and Lipsky, P. E. The role ofCD4O-CD4O
ligand interaction in human
T cell-B cell collaboration. J. Immunol., 153: 1027—1036,
1994.
33. Schattner, E. J., Elkon, K. B., Yoo, D., Tumang, J., Krammer, P. H., Crow, M. K., and
Friedman, S. M. CD4O ligation induces Apo-l/Fas expression on human B lympho
cytes and facilitates apoptosis through the Apo-lIFas pathway. J. Exp. Med., 182:
1557—1565,
1995.
and survival of memory cells. Immunol. Rev., 150: 45—61, 1996.
42. Bancherau, J., Briere, F., Liu, Y. J., and Rousset, F. Molecular control of B lympho
cyte growth and differentiation. Stem Cells, /2: 278—288. 1994.
43. Klaus, S. J., Berberich, I., Shu, G., and Clark, E. A. CD4O and its ligand in the
regulation of humoral immunity. Semin. Immunol., 6: 279—286,1994.
4947
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1997 American Association for Cancer Research.
B Lymphocytes from Patients with Chronic Lymphoproliferative
Disorders Are Equipped with Different Costimulatory Molecules
Livio Trentin, Renato Zambello, Rosaria Sancetta, et al.
Cancer Res 1997;57:4940-4947.
Updated version
E-mail alerts
Reprints and
Subscriptions
Permissions
Access the most recent version of this article at:
http://cancerres.aacrjournals.org/content/57/21/4940
Sign up to receive free email-alerts related to this article or journal.
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Department at [email protected].
To request permission to re-use all or part of this article, contact the AACR Publications
Department at [email protected].
Downloaded from cancerres.aacrjournals.org on June 17, 2017. © 1997 American Association for Cancer Research.