THE JOURNAL OF BIOL.OCKXL CHEMHTRY Q 1990 by The American Society for Biochemistry Vol. 265, No. 25, Issue of September 5, pp. 15145-15153,199O Printed in U.S.A. and Molecular Biology, Inc. Transcription Pausing by Escherichia coli RNA Polymerase Modulated by Downstream DNA Sequences* (Received Donna N. Lee$, Le PhungSP, From the Departments of SBiology St. Louis, Missouri 63130 Judith Stewart& and llBiochemistry and Robert and Molecular Escherichia coli RNA polymerase pauses immediately after transcription of certain sequences that can form stable secondary structures in the nascent RNA transcript; pausing appears to be essential for several types of bacterial transcription attenuation mechanisms. Because base changes that weaken the RNA secondary structures reduce the half-life of pausing by RNA polymerase, nascent transcript RNA hairpins are thought to cause pausing at these sites. We show here that, for the well characterized trpL pause site, the determinants of transcription pausing are not limited to the RNA hairpin, but include the not-yet-transcribed sequence of DNA immediately downstream from the pause site. We show that this effect extends to bases up to fourteen nucleotides downstream from the pause site, that placement of a oligo(dT) tract in the nontranscribed strand in this region does not convert the pause site to a termination site, and that shifting the position of pausing by one nucleotide downstream almost eliminates pausing. From an analysis of many variants of this downstream sequence, we argue that the effect of downstream sequence is not related simply to its GC content. We suggest that these effects are mediated by altered interactions between RNA polymerase and the DNA template downstream from the enzyme’s active site. Transcription by Escherichia coli RNA polymerase is discontinuous (l-4). At most positions on the template, the enzyme rapidly catalyzes RNA chain elongation; at certain “pause” sites, however, RNA polymerase requires 100-1000 times longer to extend the RNA chain (5). Two types of pause sites have been described: (i) those that occur immediately after a region of dyad symmetry that can produce an RNA hairpin in the nascent transcript, termed RNA hairpin-induced pausing (3, 5), and (ii) those that occur where no potential secondary structures are obvious, termed sequencedependent pausing (l-3, 5). The most notable RNA hairpinassociated pause sites occur in the leader regions of amino acid biosynthetic operons that are regulated by attenuation. Here, transcription pausing is thought to play a key role in uiuo, by stopping the transcribing RNA polymerase until a * This work was supported by Grant GM-38660 from the National Institute of General Medical Science, a Presidential Young Investigator Award from the National Science Foundation, and an award from the Searle Scholars Program. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC. Section 1734 solely to indicate this fact. § Current address: Dept. of Biochemistry and Molecular Biology, The University of Chicago, Chicago, Illinois 60637. (1 To whom correspondence should be addressed. Is for publication, April 13, 1990) LandickSliII Biophysics, Washington University, ribosome initiates translation of the leader peptide coding region. The requirement of a stable, base-paired RNA structure for transcription pausing has been inferred from analyses of the effect on pausing of sequence changes in the DNA segments that specify the RNA hairpin (6,7). The mechanism by which formation of a nascent transcript RNA hairpin causes the transcription complex to stop elongation is unknown. Available evidence is consistent with the view that the putative RNA hairpin structure forms within the transcription complex and disrupts at least a portion of the RNA:DNA heteroduptex (8). At least three substantial controversies remain: (i) do RNA hairpins interact directly with RNA polymerase to alter its activity (9) or do they affect elongation simply by disrupting a portion of the RNA:DNA heteroduplex (5, 10); (ii) are pause RNA hairpins fundamentally different from termination RNA hairpins or do they simply disrupt less of the RNA:DNA heteroduplex; and (iii) is the RNA:DNA hybrid 12 f 1 base pairs, as conventionally thought (5), or is a substantial portion of the RNA in the transcription complex actually bound in a nascent transcript binding site (ll)?’ If the recently synthesized RNA actually lies in such a binding site, then models in which RNA hairpin formation partially or completely removes it from this site or in which direct RNA-RNA polymerase interactions influence pausing also should be considered. To more completely characterize the causes of transcription pausing, we have studied the effect on pausing of DNA sequences downstream from the pause site. We show here that a complete description of transcription pausing in the trp leader region cannot be limited solely to the causes and effects of nascent transcript RNA hairpin formation. Not-yet-transcribed DNA sequences downstream from the catalytic site in trpL paused transcription complexes alter the half-life of the complex. Specifically, we show that replacement of these sequences with arbitrarily chosen sequences reduces the pause half-life by a factor of 3 and that this reduction does not correlate with the GC content of the replacement sequence. This effect extends at least 14 nucleotides past the site of pausing, roughly to the downstream border of RNA polymerase on DNA in the paused transcription complex (8). We argue that this effect arises from the interaction of RNA polymerase with the double-stranded DNA helix in the portion of the transcription complex downstream from the catalytic site. EXPERIMENTAL Materials, Bacterial Strains, PROCEDURES and DNA Manipulations-E. coli RNA polymerasewas prepared by the method of Burgessand Jendrisak (12). NusA Chamberlin bonucleotides 15145 ’ C. Kane protein was purified by the method of Schmidt and (13) from an overproducing E. coli strain (14). Deoxyriwere from Sigma; high performance liquid chromatogand M. Chamberlin, personal communication. 15146 Downstream DNA Sequences raphy-purified ribonucleotides were purchased from Pharmacia LKB Biotechnology Inc. Plasmid DNAs were routinelv isolated bv the alkaline lysis-procedure (15) from strain RL511. RL5ll (also designated KTl) is a derivative of HBlOl (16) that carries an unknown mutation that stabilizes plasmids containing strong E. coli RNA polymerase promoters.* DNA fragments for in vitro transcription reactions were prepared by the polymerase chain reaction, using the M13-20 universal primer (New England Biolabs) and a custom oligonucleotide (5’.d[GCTTCGCAACGTTCAAATCC]-3’) that paired with a sequence in rrnB Tl T2 DNA to amplify the desired DNA fragments directly from -200 ng of plasmid DNA (17). The DNA fragments were recovered from polymerase chain reactions by extraction with phenol/chloroform followed by ethanol precipitation. The fragments were dissolved in TE buffer (10 mM Tris-HCI, 1 mM Na,EDTA, pH 7.9) and used directly for in vitro transcription by E. coli RNA polymerase (see below). DNA sequencing was performed by the dideoxynucleotide sequencing method (18, 19) using modified T7 DNA polymerase (SequenaseTM, United States Biochemical Corp.), [a-35S]dATP (Amersham Corp.), and synthetic oligonucleotide primers. Singlestranded DNA for sequencing was prepared by polymerase chain reaction amplification of the DNAs of interest using the Ml3 universal primer that had been modified to contain biotin at the 5’ end (20) and a custom oligonucleotide that matched a sequence in rrnB Tl T2 DNA. The biotin-tagged DNAs were bound to strepavidin-agarose, loaded on top of a Sephadex G-50 column, and strand-separated with NaOH as described bv Mitchell and Merril (21). The collected DNA was ethanol-precipitated and used directly in the DNA sequencing reactions. Plasmid Constructions-Plasmids pRL407, pRL417, and pRL424 are related to the pUC119 (22) derivative pRL418 (7), which contains the phage T7 Al promoter from pAR1707 (23), a short polylinker, and the rrnB Tl T2 terminator region (24). pRL407 contains a RsaI (trpL + 44) to TaqI (trpL + 187) fragment from the wild-type trp leader region in the HincII site of pRL418. pRL417 contains a RsaI (trpLep + 44) to NlaIII (trpLep + 97) fragment of the trpLep derivative of the trp operon’ between the HincII and SphI sites of pRL418. pRL424 contains a RsaI (trpLep + 44) to Sau3A (trpLep + 260; treated with DNA polymerase I Klenow fragment) fragment of trplep” between the X&I and PstI sites of pRL418 that had been treated with T4 DNA polymerase to produce blunt ends. pRL433 was derived by oligonucleotide-directed mutagenesis (26) of pRL417 and contains an NcoI site at the trpL transcription pause site (Table I). ~RL456. ~RL457. and pRL458 were derived from pRL433 by insertions of double-stranded, synthetic oligonucleotides in the NcoI site (Table I). pRL459 and pRL520 were unintended artifacts that arose from these procedures (Table I). pRL491, pRL492, pRL496, pRL497, and pRL499 were derived similarly from pRL433 using self-complementary oligonucleotides that specified various homopolymer or alternating polymer tracts (Table I). pRL500 was similarly derived from pRL433 using oligonucleotides that restored 39 nucleotides of wild-type sequence after the trpL pause site followed by nucleotides that specify XhoI, HpaI, BglII, and StuI restriction endonuclease recognition sites (Table I). ~RL553 and aRL498 were constructed by insertion of synthetic, double-strandedoligonucleotides between the unique NcoI and BglII sites in pRL538. pRL538 is a derivative of pRL500 that contains, in the DNA polymerase I Klenow fragment-modified NcoI site, a forward-oriented BamHI to SphI fragment from the tet gene of pBR322 (27) that had been modified to make the BamHI site blunt-ended and to add to the SphI site a synthetic, double-stranded DNA sequence, AGATCTGCTAG d ( GTACTCTAGACGATC ) . The deletion series pRL509 through pRL519 was prepared by exonuclease III/mung bean nuclease (Stratagene) treatment of XhoIcleaved pRL500 following a protocol supplied by the vendor. Nuclease-treated DNAs were recovered by phenol extraction and ethanol precipitation and ligated to synthetic XhoI linkers (dlCTCGAGCTCGAG1). These samples then were treated with XhoI and BamHI and electrophoresed through low-melting agarose. Fragments of the desired sizes were excised from the gel and directly ligated pRL500 that had been cut with BamHI and XhoI. Plasmids L 1. ’ J. Majors, personal communication. ” Landick, R., Yanofsky, C., Choo, Biol., in press. K., and Phung, L. (1990) J. Mol. Modulate Transcription Pausing derived by this procedure were screened for the size of the BumHIXhoI fragment and promising candidates were sequenced. In Vitro Transcription Reactions-Standard synchronous transcription reactions were performed at 37 “C essentially as described previously (9). A20 complexes (28) were formed on the polymerase chain reaction-synthesized DNA fragments by incubation of 2.5 pmol of RNA polymerase and 1 pmol of DNA in 50 ~1 of 40 mM Tris-HCl, 20 mM NaCl, 14 mM MgCl,, 14 mM P-mercaptoethanol, 2% (v/v) glycerol, 20 pg of acetylated bovine serum albumin/ml, 240 pM ApU dinucleotide, and 2.5 MM ATP, CTP, and GTP for 20 min at 37 “C. Elongation from A20 was initiated by adjusting GTP to 20 FM and the ATP. CTP. and UTP to 150 uM. Five-u1 aliauots were removed at appropriate time intervals and mixed with 5 ~1 of 2 X TBE, 0.025% bromphenol blue, 0.025% xylene cyan01 saturated with urea. RNA samples were analyzed by electrophoresis through 0.4 mm x 24 cm X 30.cm 10% polyacrylamide, 7 M urea gels in TBE buffer. Radioactivity in the pause RNA bands was quantitated by placing the gel in an AMBIS radioanalytic scanner and using algorithms supplied by the manufacturer. After subtraction of appropriate background values, these data were used for semi-logarithmic regression analysis and the pseudo-first order rate of pause RNA disappearance was determined from the slope. RESULTS Replacement of Sequences Downstream from the trpL Pause Site Lowered the Pause Half-life by a Factor of 3-We discovered the effect of downstream sequence on transcription pausing at the trpL pause site during analysis of in vitro transcription of the altered trp leader region from plasmid pRL417 (Fig. 1; Table I). On pRL417, the DNA sequence immediately after the trpL pause site was replaced by sequences from the E. coli rrnB terminator region (rrnZ3 Tl T2; see Ref. 24). When this truncated trpL DNA was transcribed in uitro by E. coli RNA polymerase, the half-life of pausing at the trpL pause site was reduced from the wild-type level of 44 s observed with pRL407, to 13 s (Figs. 1 and 2; Table I). The reduction in pausing by a factor of 3 also occurred when transcription was conducted in the presence of NusA (Fig. 2, C and D; Table I). In this initial comparison, the wild-type trpL region fused to the T7 Al promoter was compared to a truncated pause site DNA that contained a minor alteration to the loop of the pause RNA hairpin and is designated trpLep (Fig. 1). Analyses of wild-type trpL and trpLep under a variety of conditions have revealed no difference in any transcriptional phenotype either in uiuo or in vitro (29, 30).3 To verify that the effect on pausing that we observed was caused by differences in the downstream sequence and not by the difference in the pause RNA hairpin loops, we prepared and tested a T7 Al-trpLep fusion, pRL424, which contains the trpLep pause RNA hairpin and wild-type attenuator and differs from pRL417 only downstream from the pause site (Table I). This new plasmid gave the same pause half-lives as pRL407 with or without NusA (Table I). Thus we concluded that the reduction by a factor of three in the pause RNA half-life on the pRL417 template was due solely to differences in the not-yet-transcribed DNA downstream from the pause site. On the pRL417 template, the reduction in pause half-life was not caused by the first three nucleotides after the pause site, since these are the same in pRL407, pRL417, and pRL424. Properties of the Template DNA Molecule Ztself within 35 Nucleotides Downstream from the Pause Site Modulate the Half-life of Transcription Pausing in the trp Leader-To better delineate the effect of downstream DNA sequence on pausing, we prepared and tested several additional derivatives of pRL417. To rule out the possibility that reduced pausing on the pRL417 template was due to the absence of DNA sequences from the trpL termination region, we constructed and tested pausing on pRL455 and pRL458, derivatives that lack Downstream DNA Sequences Modulate Transcription 15147 Pausing A B PpL 77 Al - frpL FUSION 1:2 WA G U A A C C,GG C&G FIG. 1. Schematic representation of transcription templates and sequence of transcripts from the pRL407 and pRL417 templates. A, arrangement of transcription template components (not to scale). Details of construction of the templates are given under “Experimental Procedures.” PCRl and PCR2 designate the approximate positions at which oligonucleotides hybridize for polymerase chain reaction amplification of the transcription templates. B, sequence of the pRL407 transcript up to the trpL terminator. Bases shown in bold are derived from the T7 Al transcription unit and polylinker of plasmid pUC19 (25). Arrows indicate the position of pausing by E. coli RNA polymerase. C, sequence of the pRL417 transcript up to the rrnB Tl terminator. u AUCGAG c g:; A=lJ CrG ii G Gto WG C G A t? 70 AAU U c AG IIOC=G G=C C=Gm C’-G C=G G=C uA UU GX U=A GzC GICSO GGGAUCCUCUAGAGUCAC~GAAAGGUU=AUGCGUAAAGCAAUCAGAGACCCA=UUUUUUUU : G 20 40 4 PAUSE C 9o la l&J rrnB T7 Al - trpLep - rrnB FUSION “$,,JP .. Tl AUCGAG $ G G 10 t A C G E &GAUCC~JCUAGACUGCAG~~P 20 30 g”c C=G A=U U” GEC U=A GEC GrC rGGUU =AUGCGAGAGUAGGGAACUGCCAGGAUCAAAG ids’” A=U U=A A= U 110 @-=4 m ‘w PAUSE the 34 terminator region, but which contain wild-type sequence for 35 nucleotides downstream from the pause site (Table I). These two plasmids are identical except that pRL455 contains two repeats of the downstream DNA sequence, whereas pRL458 contains only a single copy of this sequence (Table I). Pausing on the pRL455 and pRL458 templates was indistinguishable from wild type (Table I). Thus the effect of downstream DNA sequence on trpL pausing was not mediated by formation in the DNA of the structure analogous to the 3:4 termination hairpin. To determine whether or not the exact wild-type DNA sequence downstream from the pause site was required for normal pausing, we prepared two single base substitutions. Substitution of a C for the T at position +4 (pRL457) or a C for an A at position +6 (pRL456) did not reduce significantly the pause half-life (Table I). Thus, normal transcription pausing at the trpL pause site does not require an exact downstream DNA sequence; single substitutions at positions +4 and +6 have minimal effects on the half-life of trpL paused transcription complexes. To test if the effect of downstream sequence on pausing was somehow related to binding of nucleotide triphosphate substrates, we examined pausing on the pRL433 template, which specifies 3 tandem G residues immediately after the pause site. Pausing in the trp leader is sensitive to the concentration of GTP (31). This alteration also created an NcoI 15148 Downstream DNA Sequences Modulate Transcription Pausing TABLE I Half-lives of transcription complexes paused at the trpL pause site on downstream sequence variants Synchronized transcription reactions at 20 KM GTP with or without 50 nM NusA protein at 37 “C were performed as described under “Experimental Procedures.” Half-lives were determined as described under “Experimental Procedures.” Two standard-deviation error was calculated from the regression analysis. Designation Sequence Half-life transcription after pause site” of paused complexes -NusA +NusA s pRL407 pRL417 pRL424 pRL458 pRL455 pRL456 pRL457 pRL433 GCGTAAAGCAATCAGATACCCAGCCCGCCTAATGAGGCGGGCTTTTTTTT(wild-type) GCGAGAGTAGGGAACCTGCCAGGCATCAAAGAAAACGAAAGGCACAGTCG GCGTAAAGCAATCAGATACCCAGCCCGCCTAATGAGGCGGGCTTTTTTTT(trpLep) GCGTAAAGCAATCAGATACCCAGCCCGCCTAATGAGATCTGTTAACTCGA GCGTAAAGCAATCAGATACCCAGCCCGCCTAATGAGATCTGTTAACTCGAGCCAT~ GCGTACAGCAATCAGATACCCAGCCCGCCTAATGAGATCTGTTAACTCGA GCGCAAAGCAATCAGATACCCAGCCCGCCTAATGAGATCTGTTAACTCGA GGGAGAGTAGGGAACCTGCCAGGCATCAAAGAAAACGAAAGGCACAGTCG pRL553 pRL511 pRL512 pRL513 pRL514 pRL515 pRL509 pRL510 GGCATTTCGTTAGTCTATGGGTCGGGCGGATTACAGATCCTCTACGCCGG GCGCTCGAGTTAACAGATCTAGGCCTTCGAG GCGTCTCGAGTTAACAGATCTAGGCCTTCGAG GCGTACTCGAGTTAACAGATCTAGGCCTTCGAG GCGTAACTCGAGTTAACAGATCTAGGCCTTCGAG GCGTAAAGCTCGAGTTAACAGATCTAGGCCTTCGAG GCGTAAAGCCTCGAGTTAACAGATCTAGGCCTTCGAG GCGTAAAGCACTCGAGTTAACAGATCTAGGCCTTCGAG GCGTAAAGCAACTCGAGTTAACAGATCTAGGCCTTCGAG GCGTAAAGCAATCTCGAGTTAACAGATCTAGGCCTTCGAG GCGTAAAGCAATCCTCGAGTTAACAGATCTAGGCCTTCGAG GCGTAAAGCAATCAGACTCGAGTTAACAGATCTAGGCCTTCGAG GCGTAAAGCAATCAGATACCCAGCCCGCCTAATGAGATCCTCGAGTT~CAGAT GTTTTTTTTCATGGGAGAGTAGGGAACCTGCCAGGCATCAAAGAAAACGA GAAAAAAAACATGGGAGAGTAGGGAACCTGCCAGGCATCAAAGAAAACGA GATATATATCATGGGAGAGTAGGGAACCTGCCAGGCATCAAAGAAAACGA GCCCCCCCCCATGGGAGAGTAGGGAACCTGCCAGGCATCAAAGAAAACGA GGGGGGGGCGATCTGCTAGCATGGGAGAGTAGGGAACCTGGCCAGGCATC GCGCGCGCGCATGGGAGAGTAGGGAACCTGCCAGGCATCAAAGAAAACGA CGCACAGCAATCAGATACCCAGCCCGCCTAATGAGATC CGTACAGCAATCAGATACCCAGCCCGCCTAATGAGATC pRL516 pRL517 pRL518 pRL519 pRL500 pRL491 pRL492 pRL496 pRL497 pRL498 pRL499 pRL520 nRL459 (trpLep A3:4) (trpLep A4) 44 f 4 13 t 2 42 -t 4 50+ 15 43 + 4 51 c9 41 +- 4 15 + 3 140 32 f 140 ND* 150 + 146 k 156 + 35 * 32 + 6 41+ 4 26 + 3 22+ 11 29 f 2 50 -c 8 43 f 6 50 f 5 52 f 7 60 f 9 59 -+ 8 40f 10 48 + 6 18 f 3 16 + 2 10 + 2 16 f 3 10 + 3 26 f 4 <5‘+ <5 78 + 130 + 89 + 82 + 80 f 120 k 93 k 140 t 155 f 230 +150 k ND 115 f 50 + 32 f 22 + 52 k 32 _c 115 + <5 <5 7 26 50 37 11 13 16 14 14 18 12 8 34 15 16 75 21 10 15 15 8 6 23 ’ Italicized sequences are those that differ from the wild-type sequence. Some sequences have been underlined to emphasize certain aspects of the altered sequences. ’ ND, not determined. ’ pRL455 differs from pRL458 in that the sequence from +3 to the end on that shown is repeated once. d Pausing either was not detectable or was too short to allow half-life determination. We estimate that 5 s is the maximum half-life for pausing that would not be detectable in these assays. site that was useful for further manipulations (Table I; see “Experimental Procedures”). The pause half-life of trpL paused transcription complexes formed on the pRL433 template was identical to that of complexes formed on the pRL417 template (Table I). That a requirement for three G residues in a row immediately after the pause did not increase the pause half-life during in vitro transcription at 20 FM GTP suggests that the effect of downstream DNA sequence on pausing is not due to binding of the nucleoside triphosphates specified by the sequence but to properties of the DNA molecule itself. This conclusion is supported further by the observation of extremely weak pausing on a variant template that specifies 8 consecutive Gs after the pause site (pRL498, Table I; see below). To determine whether the orientation of base pairs after the pause site contributes to the effect of downstream sequence on pausing, we tested the effect of inverting each base pair after the pause site so that the overall composition and order of base pairs was maintained, but the sequence of the two DNA strands was reversed (pRL533; Table I). We observed a slight, but significant, reduction in pause half-life on the pRL533 template (Table I), suggesting that the base sequence of each DNA strand and not simply the order of base pairs, contributes to the effects of downstream sequence on transcription pausing. Alteration Site Affects of Sequences Transcription up to 14 Nucleotides past Pausing-To determine the Pause how far downstream from the pause site the effect of DNA sequence on pausing extends, we prepared and tested a set of derivatives of pRL458 (trpLep plus 35 nucleotides of wild-type downstream DNA sequence; Table I) that altered progressively greater amounts of this DNA (Table I; Fig. 3). To facilitate construction of these altered templates, we used a XhoI-linker sequence to replace the wild-type sequence downstream of the trpL pause site. When this sequence was placed at +4, in a position analogous to the sequence substitution in pRL417, the pause half-life was unaffected (pRL511; Table I, Fig. 3). However, as the amount of wild-type sequence was increased, Downstream A pRL407 DNA Sequences Modulate Transcription Pausing 15149 NusA 12345676910 --am-..- T T P --rrr” -a -. P - -a- w*.m i 1 7 3 I: j 6 - 3 0 ‘3 ‘2 3 ‘t AUGCGTAAAGCAA-CAGATAC***** POSITION OF XHOI-LINKER 4 PAUSE CTCGAGTTAACAGAT --- T P :- --0 -me.* 0 -*rryryIc T P‘ --- AI FIG. 2. Autoradiograms from gels containing pause RNAs from transcription of the pRL407 and pRL417 templates. Synchronized transcription reactions with or without 50 nM NusA protein at 37 “C were performed as described under “Experimental Procedures.” Samples were removed from the reactions at the times indicated above the lane designations. A, pRL407 (wild-type trpL) template without NusA. Lane 1, sample removed prior to addition of chase mix t.o reaction; lane 2, sample removed after 10 s; lane 3, sample removed after 20 s; lane 4, sample removed after 30 s; lane 5, sample removed after 45 s; lane 6, sample removed after 1 min; lane 7, sample removed after 1.5 min; lane 8, sample removed after 2 min; lane 9, sample removed after 2.5 min; lane IO, sample removed after 3.5 min. The positions of the A20 (A), pause (P), and terminated (ZJ RNAs are indicated on the left. B, pRL417 (trpLep:rrnR) template without NusA. Samples in each lane and markers on left are as for A. C, pRL407 (wild-type trpL) template with 50 nM NusA. Lane 1, sample removed prior to addition of chase mix to reaction; lane 2, sample removed after 30 s; lane 3, sample removed after 1 min; lane 4, sample removed after 1.5 min; lane 5, sample removed after 2 min; lane 6, sample removed after 2.5 min; lane 7, sample removed after 3.5 min; lane 8, sample removed after 5 min; lane 9, sample removed after 7 min; lane 10, sample removed after 12 min. Markers on left are as for A. D, pRL417 (trpLep:rrnB) template with NusA. Samples in each lane and markers on left are as for C. the pause half-life fell significantly and was roughly twothirds of the wild-type level when six nucleotides of wild-type sequence were present (pRL514; Table I, Fig. 3). We did not obtain derivatives with the linker sequence attached to the 7th or 8th nucleotide downstream from the pause site, but when the XhoI-linker sequence was attached to nucleotides 9, 10, 11, or 13, we observed a slightly greater than wild-type pause RNA half-life (pRL509-pRL518; Table I, Fig. 3). Fi- 5 ‘C I’ b ‘I ATTACHMENT SEQUENCE SEPLACING W 7 AT IND CA-ED ?OSI-IOIS FIG. 3. Pause half-life uersus the position of sequence alteration downstream from the trpL pause RNA hairpin. Data are from Table 1. The wild-type sequence downst.ream from the trpL, pause site and last two bases of the trpL pause RNA are shown below the graph. The replacement sequence is shown below it. Half-lives are plotted above the position at which the replacement sequence would begin in the various constructs. Note that, since cytosine is normally present at position 9, pRL515 alters the wild-type sequence only from position 10 on; thus the data from pRL515 and pRL509 were averaged and plotted at position 10. The same is true for position 13 and pRL517 and pRL518; the averaged data are plotted at position 14. nally, with 16 nucleotides of wild-type sequence present, the pause RNA half-life returned to the wild-type level (pRL519; Table I, Fig. 3). We conclude that nucleotides up to at least position +14 make some contribution to setting the half-life of transcription pausing in the trp leader. Substitution of Homopolymer Sequences Downstream from the Pause Site Suggests That GC-richness Does Not Determine the Contribution of Downstream Sequences to Transcription Pausing-Several researchers who have investigated sequence-dependent pausing have suggested that GC-rich DNA could slow the transcription complex by presenting a barrier to unwinding the duplex (Refs. 5, 32, 33; see “Discussion”). To determine the role of downstream sequence composition in determining the trpL paused transcription complex halflife, we prepared and tested variants of pRL433 in which eight-nucleotide homopolymer tracts were placed from +2 to +9 relative to the pause site, in the region that we found to be important for the downstream sequence effect. We found that any tract of eight identical or alternating nucleotides significantly reduced the pause half-life (pRL491-pRL499; Table I). The strongest reductions occurred with a run of eight dG nucleotides or four (dA-dT) dinucleotides (half-lives = 10 s; pRL498 and pRL496, Table I). Significantly, the presence of three different arrangements of eight C-G base pairs did not increase the pause RNA half-life to above the wild-type level (pRL497-pRL499; Table I). Moreover, a run of 8 Cs in the nontranscribed strand (pRL497) gave a reduced pause RNA half-life that was identical to that produced by a run of eight Ts or eight As (pRL491 and pRL492; Table I). Clearly, the GC content of the DNA sequence downstream from the trpL pause site is not the primary determinant by which these sequences influence transcription pausing. Placement of a dT Tract Immediately Downstream Does Not Convert the trpL Pause Site to a Termination Site-An oftencited model for p-independent termination is that formation of the secondary structure in the nascent transcript induces RNA polymerase to pause and that subsequent synthesis of oligoribo(U) allows release of the transcript, presumably be- 15150 Downstream DNA Sequences Modulate cause the rU-dA base pairs do not form a sufficiently stable RNA:DNA hybrid (5, 9). From this view, one particularly interesting variant that we obtained was pRL491, which contains a run of eight T residues immediately after the trpL pause site. This modification did not cause any transcription termination at the run of Ts; all transcription complexes transcribed past this sequence to the end of the DNA template either at 20 FM GTP or at 2.5 pM GTP and 50 nM NusA protein (Fig. 4, C and F), conditions that should maximize termination (6). Thus a simple test of the notion that a pindependent termination site is composed of an RNA hairpininduced pause site followed by a run of T residues is negative. However, we believe that a complete test of this view requires systematic variation of the position of the T-tract relative to the segments that specify the RNA hairpin. As yet, we have not completed such an analysis. The Effects of Downstream Sequence on Pausing Are Not Mediated by the NusA Transcription Factor-For each of the variants we obtained, we determined the pause RNA half-life in the presence and absence of 50 nM NusA protein (Table I). In general, we observed a 3-fold increase in pause half-life in the presence of NusA, regardless of what the half-life was without NusA. Thus the contribution of downstream sequence to pausing most likely is independent of the NusA transcription factor. These findings are consistent with the view that NusA interacts with and stabilizes the RNA hairpin in a paused transcription complex (8). A pRL455 20$4 GTP N”r/\ B pRL459 20 IIt.4GTP N”sA C pRL491 20)iMGE=. N”sA Transcription Pausing Shifting the Position of Pausing One Nucleotide Drastically Reduces Its Half-Life-Two interesting derivatives of pRL458 that arose from an artifact in the cloning procedures (pRL459 and pRL520) rearranged the downstream DNA sequence so that the G nearest the pause site was one nucleotide further away from the pause RNA hairpin. The site of pausing on these templates at limiting GTP was shifted one nucleotide further downstream, as would be predicted from the sequence (verified by high-resolution electrophoresis; data not shown). However, transcription pausing was almost eliminated on these templates (Table I; Fig. 4, B and E). This effect was much greater than any we observed from variations in the downstream sequence alone, and thus is not likely to be due to the sequence downstream from the new pause site but to the altered position of pausing. Even at 2.5 FM GTP and 50 nM NusA protein, the pause half-life on the pRL459 and pRL520 templates was less than 30 s and was nearly equivalent to other pauses before addition of G to the growing transcript on these templates (Fig. 4E, note that pause RNA is present in the first 3 lanes because many RNA polymerases do not reach the pause site for up to 90 s under these conditions). We conclude that there is a precise requirement for the spacing between the pause RNA hairpin and the site at which pausing occurs. DISCUSSION Transcription pausing by RNA polymerase was detected first during transcription of the early portion of the luc operon D ?RL455 S5pMGTP.Nus.4 pP . FIG. 4. Autoradiograms from gels containing pause RNAs from transcription of the pRL455, pRL459, and pRL491 templates. Synchronized transcription reactions at 20 FM GTP without NusA protein or 2.5 PM GTP with 50 nM NusA protein at 37 “C were performed as described under “Experimental Procedures.” Samples were removed from the reactions at the times indicated above the lane designations and below. The position of the pause (I’) RNA is indicated on the left. A, pRL455 (wild-type trpL to position +35 after the pause site) template at 20 pM GTP without NusA. Lane I, sample removed after 15 s; lane 2, sample removed after 30 s; lane 3, sample removed after 45 s; lane 4, sample removed after 1 min; lane 5, sample removed after 1.5 min; lane 6, sample removed after 2 min; lane 7, sample removed after 2.5 min; lane 8, sample removed after 3 min. B, pRL459 (position of pause shifted one nucleotide downstream) template at 20 pM GTP without NusA. Samples in each lane are as for A. C, pRL491 (specifies 8 uridine residues immediately after the pause site) template at 20 PM GTP without NusA. Samples in each lane are as for A. D, pRL455 (wild-type trpL to position +35 after the pause site) template at 2.5 pM GTP with 50 nM NusA. Lane 1, sample removed after 30 s; lane 2, sample removed after 1 min; lane 3, sample removed after 1.5 min; lane 4, sample removed after 2 min; lane 5, sample removed after 3 min; lane 6, sample removed after 5 min; lane 7, sample removed after 7 min; lane 8, sample removed after 10 min. E, pRL459 (position of pause shifted one nucleotide downstream) template at 2.5 pM GTP with 50 nM NusA. Samples in each lane are as for D except that no sample taken after 10 min is present. F, pRL491 (specifies 8 uridine residues immediately after the pause site) template at 2.5 pM GTP with 50 nM NusA. Samples in each lane are as for D. Downstream DNA Sequences in studies by Gilbert and Maizels (1, 3234). The presence of GC-rich sequences one helical turn upstream from the pause sites led them to suggest that difficulty in dissociating a stable RNA:DNA heteroduplex could impede the progress of the transcription complex. Several other examples of so-called “sequence-dependent” pausing have been described (X 6 S RNA, Refs. 2 and 35; E. coli rrnB leader, Ref. 36; phage T7 early region, Refs. 4, 33, 37; and the SV40 DNA F1 region, Ref. 3). The mechanism underlying these pause events has remained obscure (5, 33). The most commonly entertained view has been that certain sequences, presumably GC-rich, downstream from the catalytic site may be more difficult to unwind and thus slow the transcription complex (5, 32, 33). In contrast, transcription pausing associated with formation of an RNA hairpin in the nascent transcript (RNA hairpin-induced pausing) is a well-documented component of many bacterial attenuation mechanisms (7; Ref. 38 and references therein). In the best studied example of RNA hairpininduced pausing, which occurs in the leader region of the E. coli trp operon, it has been shown that pausing (i) is sensitive to the concentration of the next nucleotide (GTP) to be added after the pause (31, 39); (ii) is enhanced by the NusA protein (40, 41); (iii) is reduced by base changes that destabilize the RNA hairpin (6), but not by base changes in the loop region of the pause RNA hairpin (6)“; (iv) can be enhanced or reduced by amino acid substitutions in the /3 subunit of RNA polymerase that similarly increase or decrease transcription termination (42); (v) is detectable during transcription in uiuo (43); and (vi) is relieved by a ribosome translating the trp leader peptide coding region (44). Thus, the role of the RNA hairpin as the causative agent of transcription pausing has been generally accepted. Transcription Pausing at the trpL Pause Site Is Influenced by Downstream DNA Sequences-We have shown here that the not-yet-transcribed DNA sequence immediately downstream from the site of pausing is an important determinant of pausing at the trpL pause site. Thus, the distinction between RNA hairpin-induced and sequence-dependent pausing is not clear-cut. Rather, both elements may contribute to the half-life of transcription complexes paused during transcription of the trp leader region. Although a significant body of evidence points to a role of RNA secondary structure in transcription pausing (6, 7), a critical re-examination of this view may be in order, in light of the findings reported here. Telesnitsky and Chamberlin (45) have described a similar effect of downstream sequence on the efficiency of termination at the phage T7Te terminator. They found that changing an AT-rich sequence to a GC-rich sequence immediately past the site that specifies the 3’ end of the terminated RNA reduces the efficiency of termination at T7Te from 65 to 3%. Thus the effect of downstream sequences on elongation by RNA polymerase is not limited to transcription pausing but apparently affects properties of the transcription complex in ways that influence both pausing and termination. Our examination of the effects on pausing of various DNA sequences downstream from the trpL pause site yielded two other important findings. First, a run of uridine residues positioned immediately after the trpL pause site did not cause transcription termination (Fig. 4). Thus, a p-independent termination site is not simply an RNA hairpin-induced pause site followed by a run of Us. As noted under “Results,” we have yet to test the effect of moving the uridine tract closer to the center of dyad symmetry before the pause site; such a construction may cause termination. Second, the spacing between the position of RNA hairpin formation and the site of pausing is crucial. When the position of pausing at limiting Modulate Transcription Pausing 15151 GTP was shifted one nucleotide downstream by repositioning the critical G residue on the pRL459 and pRL520 templates, pausing was nearly abolished (Table I, Fig. 4). This might be due either to a spacing requirement for location of the RNA hairpin in a binding site on RNA polymerase or to the extension by one nucleotide of the segment of putative RNA:DNA hybrid or RNA-RNA polymerase interaction that would not be disrupted by RNA hairpin formation. Contacts between RNA Polymerase and Double-stranded DNA May Determine the Effect of Downstream DNA Sequences on Transcription Pausing-How might downstream DNA sequences influence the elongation behavior of RNA polymerase? Shi et al. (46) have shown that E. coli RNA polymerase is able to transcribe a template DNA strand to within one nucleotide of a psoralen cross-link between the two strands of DNA. Since this cross-link prevents melting of the helix, a simple interpretation of their data is that the active site of RNA polymerase is located one base upstream from the position of DNA unwinding. Such a topography would require that, in a paused transcription complex, the DNA sequences downstream from the pause site be doublestranded. However, the data of Shi et al. (46) do not rule out unequivocally the possibility that the distance between catalytic and DNA-helix unwinding sites on RNA polymerase is not fixed and that downstream DNA sequences may, on occasion, be single-stranded (44). If so, many additional effects of these sequences on the stability and catalytic efficacy of the transcription complex become possible. However, in the absence of data requiring consideration of such complications, it is simplest to assume that the downstream sequences we have examined are double-stranded at the time of transcription pausing. At least two explanations are possible for how doublestranded DNA sequences downstream from the catalytic site might contribute to the half-life of the paused transcription complex. First, since this region of the DNA helix must be unwound in order for the transcription complex to translocate forward, an exceptionally high free energy requirement to break the hydrogen-bonded base pairs in these sequences could slow the rate of elongation. If so, one would predict that GC-rich sequences would be more difficult to melt than ATrich sequences. However, we did not observe enhanced pausing when GC-rich sequences were placed downstream from the pause site (Table I). Indeed, an oligo(dC) tract in the nontranscribed strand created as poor a pause site as oligo(dT) or oligo(dA) tracts and oligo(dG) and oligo(dA-dT) tracts equivalently cause the greatest reduction in paused transcription complex half-life (Table I). Thus, the strength of base pairing in sequences downstream from the pause site does not explain the effect of these sequences on pausing. The second possibility is that contacts between RNA polymerase and the DNA helix downstream from the catalytic site influence the translocation of the enzyme. Since difficulty in unwinding the downstream DNA sequences appears to be an unlikely explanation, such a model for the effects of downstream sequence on pausing seems most tenable. Unfortunately, there is nothing distinguishing about the wild-type DNA sequence downstream from the trpL pause site that suggests a simple hypothesis. We have considered the possibility that bending of the downstream DNA sequences is important. Such a view has been suggested to explain the effects of DNA sequences on transcription termination by purified calf thymus RNA polymerase II (47). Here a correlation between bending, caused by two runs of dT nucleotides (dA nucleotides in the template strand) phased one helical turn apart, and transcription ter- 15152 Downstream DNA Sequences Modulate Transcription Pawing mination has been established (47). However, there are no obvious phased dA or dT tracts in the sequence that follows the trpL pause site. Moreover, replacement of an A with C at +6, in the middle of the only dA tract within the downstream region, had no significant effect on transcription pausing. Telesnitsky and Chamberlin (45) have suggested that increased breathing of sequences downstream from the T7Te termination site might facilitate chain release. Although we have not explicitly examined breathing of the DNA downstream from the trpL pause site, it seems unlikely that reduced pausing caused by both GC-rich and AT-rich sequences (Table I) could be explained by increased or decreased breathing relative to the wild type. The downstream DNA sequences that maximize chain release at a terminator might be significantly different from those that maximize transcription pausing. Elucidation of this relationship might yield clues to the mechanisms of these two types of transcription elongation control. Thus we are left without a clear explanation for how the DNA sequence downstream from the trpL pause site enhances transcription pausing. Examination of a much larger number of sequence variants would be required before a statistical analysis of the effect of sequence composition on pausing would be valid. At present, the simplest picture is offered by consideration of the proposed three-dimensional structure of RNA polymerase from Kornberg’s group (48). From electrondiffraction studies of the enzyme, they have suggested that RNA polymerase contains a large cleft through which the DNA template passes, much as for the known structure of the Klenow fragment of E. coli DNA polymerase I (49). In this cleft, RNA polymerase must interact with the template molecule. In principle, this interaction might be either through specific contacts between amino acid sides chains and bases such as are found in DNA-repressor complexes (50, 51), or through a less specific electrostatic interaction. We favor the latter view. Perhaps the overall shape of the helix determines a charge distribution that may either facilitate or slow the forward progress of RNA polymerase. It is likely that similar interactions between RNA polymerase and the DNA template, RNA transcript, or RNA:DNA heteroduplex occur on the upstream side of the transcription complex (5, 11) and could influence the half-life of transcription pausing and the efficiency of transcription termination. Demonstration of such a contribution, however, is complicated by the effect of sequence changes on the stability on nascent transcript secondary structures. Examination of the effects of various DNA sequences on pausing at a site completely devoid of potential secondary structures might circumvent this problem. many other possible DNA sequences in this position significantly weaken the transcription pause (Table I). Thus, it appears that both the RNA hairpin and the downstream DNA sequence have evolved to form a strong transcription pause site precisely where it would be required to synchronize transcription of the attenuator with translation of the leader peptide control codons. This finding further strengthens the view that transcription pausing is an integral component of the attenuation mechanism. The Effect of Downstream Sequences Suggests Transcription Pausing at the trpL Pause Site Is a Component of the trp Attenuation Mechanism-Although pausing by RNA polymerase is well documented, and can be detected in uiuo (43), as 22. Vieira, 23. Studier, yet it has been impossible to prove that pausing is required for proper regulation of transcription attenuation in amino acid-biosynthetic operons (7, 52). A strong alternative has been that the pause RNA hairpin serves the entirely distinct function of “protector” against antiterminator (preemptor) formation during folding of the leader transcript (53), and that pausing by RNA polymerase is an accidental consequence of the presence of the protector RNA hairpin. One counterargument to this view is that very similar pause sites are found in the leader regions of different amino acid-biosynthetic operons, suggesting that pausing is a conserved function (7). We show here that the DNA sequence after the trpL pause site strongly favors transcription pausing and that Acknowledgments-We for useful discussions thank and helpful C. Chan, criticisms R. Keene, and L. London of the manuscript. REFERENCES 1. Maizels, N. (1973) Proc. Natl. Acad. Sci. U. S. A. 70, 3585-3589 2. Dahlberg, J. E., and Blattner, F. R. (1973) in Virus Research (Fox. C. F.. and Robinson. W. S.. eds) nn. 533-543. Academic Press, New York ’ -3. Reisbig, R. R., and Hearst, J. E. (1981) Biochemistry 20, 19071918 4. Kassavetis,G. A., and Chamberlin, M. J. (1981) J. Biol. Chem. 256,2777-2786 5. Yager,T. D., and von Hippel, P. H. (1987) in Escherichiacoli and Salmonella typhimurium: Cellular and Molecular Biology (Neidhardt, F. Schaechter, American 6. Landick, R., 11555 7. Chan, C. L., C., Ingraham, J. L., Low, K. B., Magasanik, B., M., and Umharger, H. E., eds.) pp. 1241-1275, Society for Microbiology, Washington, D. C. and Yanofsky, C. (1984) J. Biol. Chem. 259,11550and Landick, R. (1989) J. Biob Chem. 264,20796- 20804 8. Landick, R., and Yanofsky, C. (1987) J. Mol. Biol. 196,363-377 9. Farnham, P. J., and Platt, T. (1980) Cell 20,739-748 10. Yager, T. D., and von Hippel, P. H. (1990) Biochemistry, in press 11. Arndt, K. M., and Chamberlin, M. J. (1990) J. Mol. Biol. 213, 79-108 12. Burgess, R. R., and Jendrisak, J. J. (1975) Biochemistry 14, Biochemistry 23, 4634-4638 13. Schmidt, 197-203 14. Gribskov, 118 15. Birnboim, M. C., and Chamberlin, M., and Burgess, H. C., and Doly, M. J. (1984) R. R. (1983) J. (1979) Gene Nucleic (Amst.) Acids 26, 109- Res. 7, 1513- 1523 16. Boyer, H. W., and Roulland-Dussoix, D. (1969) J. Mol. Biol. 459-472 17. Higuchi, Res. R., Krummel, B., and Saiki, R. K. (1988) Nucleic 41, Acids 16,7351-7367 18. Ausubel.F. M.. Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., ‘Smith’ J. A.,.and Molecular Bi5loev. John Struhl, Wilev K. (1989) Current Protocol in & Sons. New York 19. Sanger, F., Nicklen, S., and Cbulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467 20. Connolly, B. A. (1987) Nucleic Acids Res. 15, 3131-3139 21. Mitchell, L. G., and Merril, C. R. (1989) Anal. Biochem. 178, 239-242 J., and Messing, J. (1987) Methods Enzymol. F. W., and Rosenberg, A. H. (1981) J. Mol. 503-525 24. Csordas-Toth, 25. 26. 27. 28. 29. 30. 31. 153, 3-11 Biol. 153, E., Boros, I., and Venetianer, P. (1979) Nucleic Acids Res. 7.2189-2197 Yanisch-Perron, C., Vieira, J., and Messing, J. (1985) Gene (Amst.) 33,103-119 Kunkel. T. A.. Roberts, J. D.. and Zakour, R. A. (1987) Methods Enzymol. 154,367-382 Bolivar. F.. Rodrizuez. R. L.. Greene, P. J., Betlach, M. C., Heyneker, H. L.: Bayer, H.‘W., Crosa, J. A., and Falkow, S. (1977) Gene (Amst.) 2,95-113 Levin, J. R., Krummel, B., and Chamberlin, M. J. (1987) J. Mol. Biol. 196.85-100 Roesser.J. R.. and Yanofskv, C. (1988) J. Biol. Chem. 263, 14251114255 Roesser, J. R., Nakamura, Y., and Yanofsky, C. (1989) J. Biol. Chem. 264,12284-12288 Winkler, M. E., and Yanofsky, C. (1981) Biochemistry 20,3738- 3744 Downstream DNA Sequences Modulute 32. Gilbert, W. J. (1976) in RNA Po/ymerose (Losick, R., and Chamberlin, M., eds) pp. 193-205, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY M. J. (1987) J. Mol. Biol. 196,6133. Levin, J. R., and Chamberlin, 84 34. Gilbert. W., Maizels. N.. and Maxam, A. (1973) Cold Snrina _ Harbor Symp. @ant. Biol. 38, 845-855 35. Gravhack. E. J.. Yang. X.. Lau. L. F.. and Roberts. J. W. (1985) Ck 42; 259-269 -’ ’ ’ ’ 36. Kingston, R. E., and Chamberlin, M. J. (1981) Cell 27,523-531 37. Darlix, J.-L., and Horaist, M. (1975) Nature 256, 288-292 38. Landick, R., and Yanofsky, C. (1987) in Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology (Neidhardt, F. C., Ingraham, J. L., Low, K. B., Magasanik, B., Schaechter, M., and Umbarger, H. E., eds) pp. 1276-1301. American Society for Microbiology, Washington; D. C. 39. Fisher. R. F.. Das. A.. Kolter. R.. Winkler. M. E.. and Yanofskv. “I ’ C. (i985) ci Mot. B;ol. lSi, 367-409 40. Farnham, P. J., and Platt, T. (1981) Nucleic Acids Res. 9, 563577 41. Fisher, R., and Yanofsky, C. (1983) J. Biol. Chem. 258, 92089212 42. Fisher, R. F., and Yanofsky, C. (1983) J. Biot. Chem. 258,81468150 43. 44. 45. 46. 47. 48. 49. 50. 51. 52. 53. Transcription Pausing 15153 Landick, R., Carey, J., and Yanofsky, C. (1987) Proc. Natl. Acad. Sci. U. S. A. 84,1507-1511 Landick, R., Carey, J., and Yanofsky, C. (1985) Proc. Natl. Acad. Sci. U. S. A. 82,4663-4667 Telesnitsky, A., and Chamberlin, M. J. (1989) Biochemistry 28, 5210-5218 Shi, Y., Gamper, H., Van Houten, B., and Hearst, J. E. (1988) J. Mol. Biol. 199, 277-293 Kerppola, T. K., and Kane, C. M. (1990) Biochemistry 29,269278 Darst, S. A., Kubalek, E. W., and Kornberg, R. D. (1989) Nature 340,730-732 Ollis, D. L., Brick, P., Hamlin, R., Xuong, N. G., Steitz, T. A. (1985) Nature 313, 762-766 von Hippel, P. H., and Berg, 0. G. (1986) Proc. Natl. Acad. Sci. U. S. A. 83,1608-1612 Pabo, C. O., and Sauer, R. T. (1984) Annu. Reo. Biochem. 53, 293-321 Landick, R. (1987) in RNA Polymerase and the Regulation of Transcription (Reznikoff, W. S., Burgess, R. R., Dahlburg, J. E., Gross, C. A., Record, M. T., and Wickens, M. P., eds) pp. 441-444, Elsevier, New York Keller, E. B., and Calvo, J. M. (1979) Proc. Natl. Acad. Sci. U. S. A. 76,6186-6190
© Copyright 2026 Paperzz