Evolution of the mimetic African swallowtail
butterfly Papilio dardanus: molecular data
confirm relationships with P. phorcas and f?
constantinus
R. I. VANE-WRIGHT', DINARZARDE C. RAHEEM',
ALEXANDRA CIESLAK' AND ALFRIED P. VOGLER','*
'Department of Entomolopy, The Natural Histoly Museum, Cromwell Road, London
SW7 5BD. 2Department of Biology, Imperial College at Silwood Park, Ascot,
Berkshire SL5 7PY
Receirifd 18 September 1997; arrepted f o r publziation 23 June 1998
Sister group relationships of the African Mocker Swallowtail, Pupilio dardunus, were determined
using mitochondria1 16s rRNA and Cytochrome B sequcnces, and nuclear Elongation Factor
EF- l a and the ITS- 1 re,+;lon of the ribosomal RNA locus. All four data sets placed P durdanus
as the sister species of l? ptiorcas, with P ron.stuntiiius as the next closest relative, and quite
distinct from other African Papilios such as P nobilis. These data support earlicr morphological
studies indicating that the only two African Pupilio species with multiple femalc colour forms
have a common ancestor not shared with any other living species. This information is
important for conclusions about the evolution of female-limited mimicry in swallowtail
butterflies, and successful use of the ITS- 1 gene opens up new possihilities for studying this
phenomenon within l? dardanu.i.
0 1999 The I.iniirm Socirtv 0 1 1,ondon
ADDITIONAL KEY W0KDS:~polyinorphism sex-limitation
inance cladistics molecular systematics.
~
~~
aridromorphism
~
dom-
~
CONTENI'S
Introduction . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . .
Material and methods
Materials . . . . . . . . . . . . . . . . . . . .
PCR amplification and DNA sequencing . . . . . . . . .
Results
. . . . . . . . . . . . . . . . . . . . . .
Discussion . . . . . . . . . . . . . . . . . . . . .
Origin of mimetic pattern and pattern control in Pupilio dardunus and
l? ptiorca., . . . . . . . . . . . . . . . . . . . .
Phylogenctic relationships at species level . . . . . . . . .
ITS sequences and phylogenctic relationships amongst phorcas group
species and sulxpccics . . . . . . . . . . . . . .
* Correspondence
.
.
.
.
.
.
.
. .
.
. .
.
.
2 16
2 17
2 17
2 18
218
223
. .
. . .
223
225
. . .
226
to A. P. Voglcr at The National History Museum. E-mail: [email protected]
0024 40(i6/99/0202 1.5
+ I 5 $:3o.l)o/o
213
0 1995) 'l'hr L.iiiiiem Society of 1,trndon
R. I. VANE-WRIGH’I’ E T A L .
216
Acknowledgements
Rcferences . .
. . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . .
227
227
INI‘RODUCTION
In many parts of central and southern Africa the females of the Mocker Swallowtail,
Papilio dardanus Brown, occur in two, three or even more forms, each resembling a
different, unrelated but chemically protected species of butterfly or moth. These
dardanur females have rounded wings, and are white, black and cream, or black and
orange, or simply black and white, matching their supposed models. The three most
commonly encountered mimetic morphs are governed by threc autosomal, sexlimited alleles located at a single locus (the H locus) which, within a local population
or race, form a dominance hierarchy, ensuring that heterozygotes are hardly ever
intermediate in phenotype (Clarke & Sheppard, 1963). Although male dardanus carry
these genes they are never expressed, the non-mimetic males always being bright
fluorescent yellow with a few black spots and black borders, and long hindwing
tails. In some areas, notably Madagascar, Grande Comore and Somalia, the females
have tails and a very similar fluorescent yellow and black pattern to the males. In
Ethiopia (and probably Eritrea), where such male-like females occur together with
tailed but otherwise mimetic females, the allele determining the male-like pattern is
dominant, or largely so, to the alleles determining the mimetic morphs.
After speculations and investigations spanning more than a century (e.g. Trimen,
1869; Poulton, 1890; Eltringham, 1910, Punnett, 1915; Ford, 1936; Clarke &
Sheppard, 1963; Vane-Wright, 1978; Clarke et al., 1985, 1996; Cook et al., 1994))
Papilio dardanus has come to have a special place in our understanding of mimicry
and polymorphism, including the evolution of balancing selection, genetic dominance
and supergenes (Sheppard, 1975; Turner, 1984). T o place such ecological and
genetical insights in a comparative framework, a sound phylogenetic context is
required.
Following the suggestion that another polymorphic African swallowtail, Papilio
phorcas Cramer, is the Mocker Swallowtail’s closest living relative (i.e. that dardanus
and phorcas share a sister-species relationship: Vane-Wright, 1978)) a number of
novel ideas about the evolution of these butterflies were put forward or investigated.
These included the hypothesis that the nominal species Papilio nandina represents a
natural hybrid between dardanus andphorcas (first proposed by the late Bob Carcasson,
and since repeatedly confirmed in the laboratory: Clarke, 1980; Clarke et al., 1985,
1991; Clarke & Gill, 1996);that the striking phenotypic differences between dardanus
and phorcas may be related to their inter- as well as intra-specific signalling needs
(Vane-Wright & BopprC, 1993); that the polymorphism of dardanus and phorcas might
predate their origin and/or be a direct result of the speciation process involved
(Vane-Wright, 1978); that male-like patterns in female dardanu (and phorcas) might
be secondarily and independently acquired (Vane-Wright, 1981; cf. Bernardi, 1963);
that such secondary convergence on male-like pattern might be brought about by
‘pseudosexual selection’ and intraspecific mimicry (Vane-Wright, 1984; but see Cook
et al., 1994); and that evolution of ‘transvestism’ (or tranrference: Darwin, 1871 vol. 2,
p. 193; Huxley, 1963) could also explain the genetic dominance of male-like females
to alternative morphs in both Papilio dardanuJ and tl phorcas (Vane-Wright, 1979,
1984; Vane-Wright & Smith, 1991). (For other views regarding dominance in these
butterflies, see Clarke & Sheppard, 1963; O’Donald & Barrett, 1973; Charlesworth
& Charlesworth, 1976; Clarke et al., 1985.)
While the morphological data linking dardanus and phorcas (together with a third
African swallowtail, Papilio constantinus Ward: Vane-Wright & Smith, 1991) are
plausible, they are not conclusive. As the continuing debate (Clarke et al., 1996)
about pattern evolution in Papilio dardanus currently hinges on precise and wellresolved cladistic relationships, it is crucial to assess the robustness of any phylogenetic
interpretation by analysis of independent data sets. This paper employs molecular
techniques to test the existing hypotheses.
Of the 53 Papilio species confined to the Afrotropics, eight taxa (nireus Linnaeus,
nobilis Rogenhofer, demodocus Esper, phorcas, conJtantinus and three subspecies of
dardanus), together with two outgroups, were studied. The following list gives details
of provenance and rationale for selection.
Papilio (Princeps) dardanus tibullus Kirby (from Kenya coast, ex Sir Cyril Clarke), 19
d. meriones Felder & Felder (Madagascar, ex Sir Cyril Clarke), and 19 d. humbloti
Oberthur (Grande Comore, ex Alex Freeman). Papilio durdanus is the primary focus
of this investigation.
Papilio (Princeps) phorcas ruscoei Kruger (Kakamega, Kenya, ex S. Collins).
Papilio (Princeps) constantinus constantinus (Watamu, near Malindi, Kenya, supplied
by R.M. Bennett via S. Collins). According to Vane-Wright & Smith, (1991), this
species forms the sister group to (dardanus phorcas).
Papilio (Princeps) nobilis nobilis (Nairobi, Kenya, ex S. Collins). Grossly similar to
male 19 dardanus in general appearance, and often cited as a close relative (e.g.
Aurivillius, 1898-99; Berger, 1951 ; Turner, 1963).
Papilio (Princeps) nireus ijJaeusDoubleday (Nairobi, Kenya, ex S. Collins). The Papilio
nireus complex represents a major group of mostly green-banded African swallowtails,
grossly similar to Z? phorcas.
Papilio (Princeps) demodocus demodocus (Nairobi, Kenya, ex S. Collins). Although
lacking hindwing tails, the colour pattern of this species is complex, with many
apparently plesiomorphic features, and is broadly comparable to 19 constantinus.
Graphium (Arisbe) polistratus Grose-Smith (Shimba Hills, Kenya, ex S. Collins).
Graphium, the only other genus of swallowtails found in mainland Africa; belongs to
a separate major tribe of the Papilioninae, the Lampropterini, and represents a
relatively close outgroup.
Amauris (Amaura) ochlea ochlea Boisduval (Kenya, ex M. BopprC). Amongst the
approximately 14 000 species of Papilionoidea (true butterflies), the nymphalid
subfamily Danainae is extremely distant from the Papilionidae (deJong et al., 1996).
The Afrotropical danaine genus Amauris includes the primary models for the two
basic mimetic morphs of Papilio dardanus (form ‘cenea’ and the ‘hippocoon’‘hippocoonides’-‘niavioides’series), and represents a remote outgroup.
+
218
K.I. \'ANE-M'RI<:HT E T d L
PCR amplijication and DNA sequencing
Specimens were freshly collected in the field and sent to the laboratory alive,
where they were frozen at -80°C until DNA was extracted following a standard
phenol/chloroform protocol as described previously (Vogler et al., 1993). Two regions
of mitochondria1 genome were analysed, from the Cytochrome B (CytB) gene using
primers CB1 and CB2 (Crozier & Crozier, 1992) (position 10933-11367 of the
corresponding D.yakuba sequence: Clary & Wolstenholme, 1985), and the 16s
rRNA gene using primers 16sbr and 16sar (Simon et al., 1991) (position 12865-1 3398
of D.yakuba), both of which amplified readily from total genomic DNA of Papilio.
Elongation
Factor
EF- 1a was
amplified using primers
EFS599
(ATCTCCGGATGGCACGGYGACAA) and EFA923 (ACGTTCTTCACGTTGAARCCAA) (Normark, 1994). Cycle conditions were 1 min at 94"C, 20 sec at
45"C, and 20sec at 72"C, for 40 cycles. PCR fraLg;mentswere analysed directly
using an ABI 373 automated sequencer and a dye terminator cycle sequencing kit.
The amplification primers were also used for sequencing, and reads from both ends
were largely overlapping. The ITS- 1 region (Internal Transcribed Spacer Region
1) was amplified using primers as described by Vogler & DeSalle (1994). Sequencing
was directly from amplified PCR product without prior subcloning. DNA sequences
were not legible in part in a number of taxa, presumably because of variation within
single individuals or due to imprecise PCR amplification in long stretches of
nucleotide repeats present in most taxa analysed. Sequences for I? dardanus and its
closest relatives were not affected by problems of intra-individual polymorphisms.
Alignments of variable length sequences in the 16s rRNA gene were performed
using MALIGN (Wheeler & Gladstein, 1994) and the 'quick' algorithm for the
search of shortest trees, varying the settings for the gap cost between 1:1 and 8: 1.
MALIGN aims to find the alignment resulting in the shortest tree; thus, the CytB
data were also included during the search for the optimal alignment. Length variation
in 16s rRNA was mostly limited to inferred single base pair insertion/deletions.
Sequence variation in the ITS-1 regions was characterized by the presence of long
indels and very high levels of sequence variation between species, making alignments
based on overall similarity impossible. However, variation between I? dardanus, I?
phorcas and I? constantinus was lower, and several regions were identical or closely
similar. The alignment of the ITS-1 region was done 'by eye', aiming to make
presumptive gaps contiguous.
Phylogenetic analysis was performed using maximum parsimony, with gaps coded
as a fifth character state. Shortest trees were determined using PAUP ver. 3.1.1.
(Swofford, 1993) and exhaustive searches. Trees from mtDNA sequences were
rooted with Amauris ochlea. Rooting of the ITS-1 tree was at midpoint. Decay indices
(Bremer, 1988) were used as a measure of support for each node.
RESULTS
The aligned data matrix of mtDNA sequences contains 896-898 characters
under different gap-cost to change-cost ratios. Phylogenetic analysis of the mtDNA
sequences generated one tree in each case, with identical topoloLgy(Fig. 1). The
, l3
KLLA 1IOhSHIPS O F PAPII,IO I)IIRI)ILtL'A
,
1 6 s rRNA
173 steps, 1 tree, ,
ci = 0.605, ri = 0.552
I
l
l? d. tibullus
::
~
l
219
l? d. meriones
l? ohorcas
7
1
I? constantinus
l? nobilis
P nireus
1
I
I
19
l? demodocus
22
Graphium
Amauris
37
3
27
2
14
l? phorcas
10
4
l? constantinus
18
14
6
13
l? demodocus
l6
l? nobilis
27
l? nireus
7
3
I
Amauris
7
8
0
2
4
l? phorcas
P constantinus
l? nobilis
I! nireus
I
l? demodocus
Graphium
Figure 1. Phylogenetic hypothcsis from mtDNA (16s and cytB regions) and EF-la. Alignment for
16s: gap codcha nge cost = 2/1, gap coded as fifth character state. Numbers of inferred character
changes are shown above the branches, Bremrr Support Index is given below the branches. Brcmcr
Support for the 16s and cytB regions was obtained from alignments with gap c o d c h a n g e cost ratio =
2 / 1, but different alignmcnt parameters had a negligible effect on these numbers. Bremer Support =
0 indicates nodes that are unresolved in a strict consensus of all shortcst trees.
level of support was determined for trees based on two of these alignments (gap to
change = 2:l and 8:1), which resulted in similar levels of support for all nodes
under both procedures. DNA sequences from EF-la produced six shortest trees of
84 steps, one of which is identical to that obtained from 16s rRNA (Fig. 1). In all
220
17)
l? dardanus
tLbullus
25 123)
I
47 (39)
36 (28)
7 (7)
22 (17)
10 ( 6 )
l? phorcas
l? constantinus
Graphium
*
Amauris
w
221
trees from single data sets and in the combined analysis (Fig. 2))P dardanus, P phorcas
and P constantinus form a well-supported monophyletic group in the manner first
indicated by Vane-Wright (1978): dardanus and phorcas are each other's closest
relatives, and form the sister group of constantinus. The two subspecies included in
this analysis, dardanus meriones, and dardanus tibullus, form a strongly supported terminal
group, but nonetheless differ in several base pairs. A second specimen analysed of
each subspecics was found to be identical in sequence in each case.
Sister relationships of the dardanu.s-i~iorcas-co72stantinus group are not well resolved.
It is interesting, however, that in none of the reconstructions does P nobilis (= pringlei
Sharpe) emerge as sister taxon of the phol-cas group, as might have been expected
from Hancock's (1993) analysis. P nobilis is the only other African Papilio with an
overall yellow phenotype broadly comparable to that of male dardanus, and its
existence and supposed close relationship to dardanus (as proposed by e.g. Aurivillius,
1898-99; see also Berger, 1951) have sometimes been cited in support of Trimen's
(1 869) original suggestion that mimicry in female dardanus evolved from a male-like,
largely yellow morph (e.g. Turner, 1963). Papilio nobilis is the sister to P nireus in
each of the single reconstructions and in the combined analysis. While clearly outside
the dardanu.r/phorcas/coizstantinusclade, their inferred sister relationship could be the
result of spurious long-branch attraction (Felsenstein, 1978); however, until more
African Papilio species are studied, this must be regarded as speculative. As anticipated,
Graphium, the other main African swallowtail genus, is very remote from the Papilio
species, and from Amauris, a member of the family Nymphalidae.
The ITS-1 region comprises between 326 base pairs in P d. tibullus (two identical
specirncns) and 336 base pairs in P d. meriones (Fig. 3). Because we are also interested
in a nuclear DNA marker appropriate to analyse relationships within the P dardanus
complex in the future, we also included a specimen of a third subspecies, P d.
humbloti, to evaluate levels of variation in related subspecies. Pairwise distance
between each of the three subspecies was around 2% (or 3-5'10 when gaps were
coded as fifth charactcr state). The sequences of P phorcas differed on average by
about 19% from I? dardanus (24% if gaps are coded as characters), whereas the
sequence for P canstantinus is much longer and more divergent (Constantine's
Swallowtail also includes a long stretch of A, C and G homopolymers: Fig. 3).
Phylogenetic analysis of these ITS-1 sequences (Fig. 4) resulted in a single tree of
345 steps when gaps in the sequences are treated as a separate character state (CI =
0.935; RI=0.926). With gaps coded as missing data, three shortest trees of 179
steps (CI=0.953; RI=0.951) were found which were similar, but varied in the
grouping of the three dardanus races (not shown). The tree topology (Fig. 4) reinforced
Figure 2. (Oppo.\it~)
One of three shortest trccs from the combined analysis of 16S, cytB and EF-1 Q.
N ~ i n i b c rof
~ inferred charactcr changcs arc shown above, and Bremer Support Index valucs below
the branches. Numbers in parentheses arc (or analyses that include only the two mitochondria1 markcrs.
The images rcprcscnt kcy morphs (lcft malc, right fcmalc) associated with the branches: P constantinus
(monomorphic: male and female similar); I! phorc.a.r (narrow-banded conslantinus-like morph found only
in females); P dnrdunu., tihullzii, female-limited polymorphic, with t h c k and white dmaurir niarius-like
fcmalc morph showm); P dardanrc.c mrrions\ (monomorphic: female differs in dark marking in forewing
discal cell). The othcr spccics shown (Pupilio dmiodor.u.\, ctc.) arc csscntially similar in both scxcs; the
Amauri\ shown ('4. niarius) is the supposcd primary model for the illustrated mimetic morph of P
dnrdanus, but was not the ;IitinuriJ sequenced (A. or.hLa).
R. I. \'ANE-WRIGHT BTilL.
222
10
20
10
40
50
60
70
90
90
1001
attaacgCatatc-attgtgt--atatt-----aCaCaCatgaCttatacaaaaataattcattcagagcgtccatcgggacacac-----caaacgggg
Pdhumbloti
attaacgtataccaatcgtgCaC~tattafatatatatatatgatttatacaaaaataattcaCtcagagcgtccatcgggacacac-----caaacggg~
Pdnerionesl
attaacgtatatcaatcgtgCatacatta--ttatataCatgatttaca~a~aaataaCtcattcagagcgtccatcgggacacac-----caaacgggg
Pmeriones2
attaacgCatatcaatcgtgtaCatattaCtttatatatatgattcacacaaaaataaCtcattcagagcgtccatcgggacacac-----caaacgggg
Pdtibulusl
aCtaacgtatatcaatcgtgtaCatatCatCCCaCatatatgatttatacaaaaaCaattcattcagagcgtccaCcgggacacac-----caaacgggg
Pdtibulus2
attaacgtatatatcgatcgt--aca-cact---tatatatgatttatacaaaaataaCccactcagagcgcccatcgggacacac-----caaac3ggg
Pphnrcasl
actaacgtatatatcgatcgt--ata-tact---tatatatgatttacacaaaaacaatccattcagagcgtccaCcgggacacac-----caaacgggg
Pphorcas2
Fcnnstantinus attaacgt~tatat---------------------------taCttatacaaa~aCaatccattcagagc~tccaCcgggacacaaacacacaaacggtg
L
[
PdhumblOCi
Pdnnerionesl
Pdnneriones2
Pdfibulusl
Pdtibulus2
PphoKCaSl
Ppnircas2
Pconscantinus
[
Pdhumbloti
Pmnerionesl
Pheriones2
Pdcibulusl
Pdtibulus2
Pphorcasl
Fpnarcas2
Pcmstancinus
1
Pdhumbloti
Phlerionesl
Pberiones2
Pdtibulusl
Pdtibulus2
Pphvrcasl
Pphorcas2
Fcmstancinus
[
Pdhumbloti
Pdnerionesl
Pdneriones2
Pdcibulusl
Pdtibulus:
Ppnarcasl
Ppharsas2
P c m stan tinus
110
120
140
110
150
160
170
cgcata...ccc.-.-----------------....---------------.-----------------.-----.---.-----------...--...a
cgtata---ccc......-.------------------......~-.-------------...------.-..-------.--..---.---.---.--a
180
190
2001
cgeata--.ccc--....-.-----.-------------.~-..~~..~~..~--~---~~.~...~~~--~~--.--------..--.----------a
cgtaea---ccc~--------.--...~...--------~~~~.~~~.~~..~~~~.~-~----..~..~-~----------------..--...ataa
cgeata...ccct--------.-...----.....----------------------..--.-------.----------------------..--at
=a
cgtataccccccc ---------------.---.-.----.---------------------.~~~g~~~g~ggg~ggac-tc~g
cgratacccccct.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
~ ~ ~ g ~ ~ ~ g ~ g g g ~ g g ~ ~ - t ~ g g
ctatcatcacactcactaacctc~gct~tc~~~tcaaaccccccc~t~~c~t~gtgtgggggggagggggggaaaggaaaaaaaaaaaaaaaggggggtt
210
220
230
240
250
260
270
290
290
I001
aacgggtaatggagacaCcacaaatccgactgataactcct-a--~ttgtcccggctcgataatggtgg~~gccacacaaaagaacatt-------Ctca
aacgggCaatggagatatcacaaatccgaCCgaCaactcctaa--attgccccggCCcgataatggtggacgcCaCacaaaagaacatt-------ttCa
aacgggtaatggagatatcacaaatccgattgataactcccaa--actgctccggctcgataatggcggacgctacacaaaagaacatt-------ttta
aacgggtaaCggagatatcacaaatccgattgaCaacCcct-a--aCtgCtccggCccgataaCggtggacgctatacaaaagaacatC-------ttta
aacgggtaatggagacaCcacaaatccgatcgataactcct-a--~ctgttccggtccgataatggc~gacgctatacaaaagaacatt-------ttta
ggggggcaatggggacgCcgcCaatccgatcgacaactcctaacctccgttccggtccgataatggcggacgctatacaaaaCaaaatt----------a
ggg~ggtaatggggaCgCcgctaacccgaccgacaactcctaatctctgctccggtccgataaCggtggacgctatacaaaaCaaaatt----------a
tgttgacaaCggggatgtaNctaatccggcctacgtctcctaa--actgtaccggtsccataaCg~tggacNctatacaaaaaattatcacaacaattaC
340
150
360
170
190
190
4001
110
320
310
tattaac~gtttag---aaagtg-~a~~aCgCtgcgactcga---cgctcgtcttatcacgat--CcgcgC---cg-agtCtctCcgCtcgcatCctaaa
taCcaacggttCag---aaagtg-aa~aacgtCg~g~cCcga---cgctcgttttactacgaC--ccgcgt---cg-~gtttcttcgttcgc~Ctctaaa
tattaacggtttag---aaagtg-aacaaCgtCgcgactcga---cgcccgctttattacgac--ccgcgt---cg-agCCtcttcgttcgcattctaaa
tattaacggtttag---aaagtg-a~caatgtcgcgacccgacgccg~t~gctccatcacgacCcgcgcgt---cg-agtttcttcgttcgcattctaaa
tattaacggtttag---aaagtg-aacaatgttgcgacC~g~~gccgctcgcttCatta~gactcgcgcgt---cg-agCCtcCtcgtt~g~~ttctaaa
_.
aacggtCCag--aaaagtgaaataacgtcgctacgcgacg-c~cgtg-tatgtgtctacatacgcgttagcgtactCcgtCttttcgcattctaag
._
_.
aacggttcag--aaaagtgaaataatgtcgctacgcgacg-~gcgcg-c~t~tgcccatata~gcgttagcgtacttcgttctttcgcattctaag
..
CgCtgacggtttagatgatgatgaaaaaatCagaNgcgcc~ctaagaggNNtaatarta~~gNgt~~tccgtCNCtttatattattaaaaaCataacgt
410
420
410
440
4501
tt~~~tcttCtaataaaaaaataaaataaaaatat~~t~~~~tta~a~~~~c
ataaatcctataatgaa-aaataaaatacaaataCaataaaatCaaaacaat
ataaatcttataatgaa-aaataaaatac~aatacaataa~actaaaacaac
ttaaatcttataataaa-aaataaaacaaaac~at~at~aa~tt~aaa~~at
ttaaatcttataataaa-aaataaaataaaataataacaaaactaaaacaat
tcaaataatacgacaaataaaatatttatataaaa~atcct~aacaat
tCaaacaataCgacaaaCaaaaCacttat~tat~taaa~a~t~~t~aa~~at
tcttacgtgaacacaaaaaaaacca~cctgacaatttta~tttgaa~~~~at
Figure 3. Sequence of thc ITS-I region for P durdanus races and closely related species. The first four
and the last four base pairs are part of the 18s and 5.8s rRNA coding region, respectively.
,1
64 (29)
7 (2)
r
I
14 (3)
P d. merionesl
l? d. meriones2
P d. tibullusl
P d. tibullus2
3 (1)
l? d. humbloti
F! constantinus
Figure 4. Phylogenctic hypothesis for the thrcc P phorcuc group species based on thr 11s rrgion 1,
with number of charactcr changes given on each branch. Numbers in parentheses represent branch
lengths whcn gaps are coded as missing characters.
KEIATIONSHII’S O F PAt‘ff2f0 UARDAVl S‘
223
the view that P dardanus and I? phorcas are sister species, and that together they form
the sister group of fl constantinuJ. The last was found to be more distant, due to
accumulation of a large number of base pairs without obvious similarity to the other
taxa.
A comparison of the ITS-1 region of the other species in our study revealed
extremely high levels of variation, with sequences differing in length by several
hundred base pairs (data not shown). There was very little obvious similarity between
most of the sequences obtained, not permitting alignment between them. We also
found substantial variation in PCR products obtained from a single individual,
apparent from polymorphic tracks in sequencing gels after direct sequencing from
PCR products. This intra-individual variation was apparently due to the extreme
repetition of single or di-nucleotide repeats which were usually the starting point
for polymorphic sequences. In contrast to these findings, we found no (P dardanus
and fl phorcas), or little (I? constantinus) variation within an individual, and sequences
could be obtained reliably by direct sequencing.
D I scu ss1 0n.
Orzgin
of mimetic pattern
and pattern control in Papilio dardanus and P. phorcas
No phylogenetic hypothesis links Papilio dardanus closely with other mimetic African
Papilio species (such as members of the cynorta Fabricius group; see Hancock, 1993).
Before mimicry evolved in the Mocker Swallowtail, did the females look like the
tailed yellow males, or did they have some other, quite different pattern?
The naturalist Roland Trimen (1869) was the first to propose that what we now
know as Papilio dardanus was a single polytypic, polymorphic species, and that the
various forms of the female were explicable as a series of Batesian mimics of a
variety of protected species. Trimen also suggested that, because in Madagascar
(unlike central and southern areas of Africa) the females of Papilio dardanuJ all look
very similar to the males, these mimetic patterns probably evolved from a male-like
ancestor. Geneticists have followed Trimen and usually regard the male-like female
pattern as the most likely starting point for the evolution of mimicry (e.g. Poulton,
1924; Ford, 1936; Clarke & Sheppard, 1963; Turner, 1963; O’Donald & Barrett,
1973; Clarke et al., 1985). O n the other hand, comparative anatomists, developmental
biologists and systematists (e.g. van Bemmelen, 1922; Bernardi, 1963; Vane-Wright
& Smith, 1991) have never been happy with this aspect of Trimen’s hypothesis,
mainly because the male-like form of Papilio dardanus seems so implausible as a
primitive colour pattern. The largely plain yellow pattern of the male appears to
have evolved by expansion and confluence of the discal and post-discal pale areas
of the ‘ground-plan’ swallowtail pattern (Schwanwitsch, 1943). The mimetic female
patterns exhibit several more pattern elements, modified to correspond to the
relatively complex patterns of their models. Thus Nijhout (199 l), apparently unaware
of any alternative to the Trimen hypothesis, talks of mimicry in female dardanuJ
apparently being achieved by “an evolutionary reversal, or atavism”.
When Trimen proposed his andromorphic origin theory, male-like females of
dardanus were only known from Madagascar (ssp. meriones). Since then, fully-tailed
andromorphic females have been found on Grande Comore (ssp. humblotz), and in
224
R. 1. VANE-U‘RIGHT ETiIL.
three continental subspecies (ssp. batti Poulton in Somalia, ssp. antinorii Oberthur
in Ethiopia, and ssp. jginii Storace in Eritrea). Two of these northern mainland
races (antinorii and jginiz) are polymorphic, with tailed mimetic forms occurring
together with the tailed andromorphs. Partially andromorphic females (pattern with
fluorescent yellow areas, and without tails or only very short tails) also occur
occasionally in most of the mimetic races, especially the Pemba island population
of ssp. tibullus, and in mountainous areas (e.g. the local population of ssp. dardanus
in Rwanda, and ssp. pohtrophus Rothschild and Jordan in Kenya highlands cast of
the Rift Valley). The last named subspecies is exceptionally variable (Ford, 1936),
the females varying from highly andromorphic forms with short tails (f.‘trimeni’),to
‘perfect’ mimics (e.g. f. ‘hippocoonides’). The variation of d. pohtrophus was seen by
Ford and others as direct evidence of a transformation process from male-like to
mimetic. However, thc more recent discoveries of similar polymorphic populations
in other subspecies (e.g. d. tibullus on Pemba, d. dardanus in Rwanda) question this
interpretation. Leaving aside ad hoc hypotheses of gene flow or migration, and
making the assumption that, because of their disjunct distribution and occurrence
within several subspecies, these partially andromorphic populations do not themselves
form a monophyletic group, either mimicry has evolved and is still evolving in
parallel in these various isolated locations (and thus the alleles determining the
female patterns are of multiple origin), or andromorphism has evolved independently
several times, and the alleles responsible for the expression of male patterns in
females have been acquired on several separate occasions. Ideally this would be
tested directly, at the level of gene action, but currently we have no idea about
where the pattern-controlling genes are located within the dardanus genome, nor do
we have much idea abdut gene products or mode of action (Nijhout, 1991). At this
stage we can only appeal to indirect mcthods, through increasingly rcfincd knowledge
of the phylogenetic relationships of Papilio dardanus with other African swallowtail
species, and the mutual relationships among the various races and populations of
dardanus itself.
At the species level, confirmation of Papilio phorcas as the sister species of dardanus
is potentially of great significance. Papilio phorcas is the only other African swallowtail
to share the same type of pattern polymorphism as dardanus (class 3, partial femalelimited: Vane-Wright, 1975), and the evidence from females produced in species
hybrids (Clarke et al., 1991) is consistent with some fundamental level of similarity
(homolo<gy)of pattern control. It may also be significant that the andromorphic
female forms, although so radically different in appearance in the two species, are
dominant in both.
In addition to yellow-pigmented wing scales, Pphorcasproduces at least two different
and potentially identifiable products to make its colour pattern. All individuals of
phorcas have a blue pigment (phorcabilin: Choussy & Barbier, 1975) in the wing
veins which, in the male and male-like female morphs only, spreads out between
the upper and lower wing membranes, to occupy the areas beneath the green
pattern elements. The second substance, which has not been investigated chemically,
forms a sticky layer on the upper wing surface corresponding to these green areas.
Yellow wing scales, which arise in and are restricted to these areas, become embedded
in this glue-like layer (unlike constantinus-like females, in which these scales stand frce
of the wing surface, in the normal way). This results in a layer of yellow pigment
closely adpressed over a layer of blue pigment, separated only by the clear wing
membrane. Apparently this allows the two colours to combine optically, to give the
even, apple-green pigmentary colour uniquely characteristic of this species (John
Huxley and R.I. Vane-M’right, unpublished).
Thus, if the basic polymorphism is homologous in the two species, because phorcas
has these two potentially identifiable biosynthetic products controlled by what
appears to be a single locus (phorcabilin released into wing membrane
‘glue’ on,
versus phorcabilin not released into wing membrane
‘glue’ off ), it might offer the
best starting point to unravel the complexities of gene action and pattern control in
dardanus. In the case of phorcas, the observations reported here suggest either close
coupling of two separate genes (as in a supergene), or primary action of a single
gene controlling phorcabilin release, with secondary induction affecting an unlinked
gene responsible for ‘glue’ production. The very close correspondence of the areas
of phorcabilin within the wing membranes and the sticky areas on the upper wing
surface is pcrhaps more suggestive of the latter (RIVW, pen. observ.).
+
+
Phlogenetic relationshvhips at species level
The combined mtDNA plus EF-la tree (Fig. 2) groups the mainland dardanu.r
tibullus and Madagascan d. rneriones togcther, dardanus together with phorcas as sister
taxa, and then these t\vo together with constantinus, exactly in the relationships
proposed by Vane-Wright & Smith (1991). This is also consistent with the results
of hybridization studies (Clarke et al., 1985, 1991; Clarke & Gill, 1996), in which
the ready production of F, females as well as malcs (which, however, have very low
fertility) is considered indicative of close relationship among swallowtail butterfly
species (Ae, 1979). The focal group then links with demodocus on a long branch,
consistcnt with the fact that dardanus and demodocus are readily hybridized in the
laboratory, but only infertile F, males can be produced (Clarke & Gill, 1996). Papilio
nobilis and l? nireus appear on rcmotc, long branchcs (consistcnt, in the case of nobilis,
with its failure to produce laboratory hybrids with dardanus: Clarke et al., 1985) but,
as noted above, their grouping together in this analysis could be a result of longbranch attraction.
Classical studies indicate that nobilis belongs with four other African swallowtails,
forming the hesperus M’estwood group, while nireus belongs with a dozen or more
other African swallowtail taxa, in the nireus group (Berger, 1951; Hancock, 1983).
Hancock’s (1 993) classification implies that we should expect nobilis to group with
(constantinus (dardanus phorcas)) before grouping with demodocus, and that all of these
would group together before grouping with nireus-but these expectations are not
upheld. Vane-Wright & Smith (199 1j suggested that the hesperus and phorcas groups
were remote from each other, a view supported by the molecular data. Hancock
(1993) has also suggested, based on evidence from the female genitalia, that the
€? delalandei Godart) group
Madagascan sister-species pair (P mangoura Hewitson
with constantinus, before this group of three links with (dardanus phorcas). This is an
interesting proposal that nccds to be checked, although Hancock seems to have
been unaware of the data assembled by Clarke et al. (1991) and Vane-Wright &
Smith (1991). If Hancock should prove correct about this, it will not materially
affect the current argument about the origin of patterns in Papilio dardanus, because
both sexes of l? delalandei, and the female of P mangoura, share an essentially
comparable narrow ycllow-banded phenotype to that displayed by both sexes of I!
constantinus, and the non-male-like females of I! phorcas (see below).
+
+
+
226
K. I. \'ANE-\VKIGHI' ETAAL.
ITS sequences and phylogenetic relationships amongst phorcas group species and subspecies
Noting the overall similarity of the yellow banded phenotype fixed in both sexes
of Papilio constantinus and the alternative non-male-like female of P phorcas, VaneWright & Smith (1991) argued that a morph of this type was the most plausible
starting point for evolution of mimicry in I!dardanus. O n the assumption that it would
eventually be possible to construct well-supported cladograms for the subspecies of
Papilio dardanus, Vane-Wright & Smith (1991: figs 20-23) went on to suggest how
the various possible results would help to decide between the andromorphic (Trimen)
hypothesis, or the constantinus-like hypothesis, for the origin of mimicry in dardanu r.
In an attempt to use the I T S 1 sequences for such intraspecific phylogenetic
analysis, we observed very high sequence variation in the Papilio species investigated,
with length variation between more distantly related taxa of several hundred base
pairs, and no apparent similarity. Variation was concentrated in 'simple sequences',
accumulated homo- and di-nucleotide repeats, an observation consistent with the
presumption that variation is generated primarily by slippage replication. We also
found that sequences from several taxa were impossible to determine by direct
sequencing, presumably due to the high level of intra-individual variation. Whereas
this result is similar to findings from sequencing studies in several other groups of
arthropods (Fenton et al., 1997; Voglcr & DeSalle, 1994), we did not observe this
problem in P dardanus and its closest relative P phorcm. This fact greatly increases
the utility of the ITS-1 as a nuclear marker for examining biogeographic and
population level variation in this intriguing group of insects, and for an analysis of
relationships of subspecies of P dardanuJ.
The inferences about phylogenetic relationships based on the I T S 1 region in
part depends on the presumed mode of evolution of these sequences. In our analysis
we treated each base change and each indel as a single character change, implying
that they are all of independent origin and equally likely to occur. This assumption
is not supported by current knowledge about the evolution of such sequences.
Phylogenetic analysis of slippage-like variation in rRNA coding sequences suggests
that mutational events are complex, involving suites of base pairs, rather than
stepwise changes affecting single nucleotides (Nunn et al., 1996; Vogler et al., 1997).
l? dardanus) is
The length of the branch separating P constantinus and ( P phorcas
strongly affected by such repetition (Figs 3, 4), and the large distance may not
necessarily reflect a larger number of mutational events since the separation from
other taxa in the group. However, the conclusion about the greater evolutionary
distance of El constantinus from the two other taxa is corroborated by its phylogenetic
dardanus) species pair on the combined mtDNA EFposition basal to the bhorcas
1a tree.
Returning to the initial question, what did the females of P durdanus look like
before mimicry evolved-the tailed yellow males?- or did they have some other
appearance (in particular, constantinus-like)? In the preferred tree (Fig. 4) for the
three dardanuJ subspecies investigated here, mimetic mainland d. tibullur links with
monomorphic Madagascan d. meriones, with the monomorphic Grande Comore d.
humbloti as outgroup. Leaving aside the challenge of explaining how the Grande
Comore rather than Madagascan race could occupy this position (Grande Comore,
which has a number of interesting endemics, is estimated to be no more than
112 000 years old: Emeric & Duncan, 1982; see also Vane-Wright, 1997), this could
be interpreted as evidence in favour of the first of these possibilities, as originally
+
+
+
suggested by Trimen. However, as indicated by Vane-Wright & Smith (1 991), such
trees will only provide real insight into the evolutionary origin of the mimetic
patterns of dardanus when the relationships of several non-mimetic and several
mimetic races have been analysed together. A more broadly-based molecular analysis,
encompassing mitochondria1 and nuclear genes for all major lineages of African
Papilio at species level, plus an ITS-1 analysis for all 13 putative races of Papilio
dardanus and the eight named subspecies of El phorcas (Ackery et al., 1995; Canu,
1994), is now feasible. We hope to undertake such a study in the future.
This study was supported by Nuffield Foundation Undergraduate Research
Bursary AT/ 100/96/0356, and the Museum Research Fund of Thc Natural History
Museum, London. Alexandra Welsh carried out some of the DNA sequencing, and
Malcolm Scoble and Campbell Smith commented on the first draft. David Smith
and an anonymous referee made valuable suggestions for further improvement. We
are also deeply indebted to Sir Cyril and the late Lady Fto Clarke, Alison Gill,
Alex Freeman, Steve Collins, Richard Bennett, Michael Boppri., Ian Kitching and
David Lees for help with obtaining fresh material suitable for molecular work.
Without their support, knowledge and enthusiasm, this study would not have been
possible.
REFERENCES
Ackery PR, Smith CR, Vane-Wright RI (eds). 1995. (iarca.aonS ilfiican buttelflips: an annotated catalogue
ofthe Papilionoidea and He.qerioidea ofthe Ajrotropical Region. East Melbourne: CSIRO.
Ae SA. 1979. The ph)-logeny of some Papilio species based o n intcrspccific hybridization data. Sy.,tematic
Entorn010~~
4: 1 - 16.
Aurivillius [PO] C. 1898-89. Rhopalocera Actliiopica. Kungl[a S~lenska Vetenskapsakademim Handlingar
31(5): 1L561: 6 PIS.
Berger LA. 1951. Systematique des Papilionidae de la fa me Ethiopicnne (Lep. Rhop.). Compte Rendu,
3rd C:Ongr>.\,Vational de.r Science.s, Rruxelles 1950 8: 47- 50.
Bernardi G. 1963. Quelques asprcts zoogkographiques du mimktisme chez les Lkpidoptkres. ProceedingJ,
16th International (hgre.u Of<oology, Washington 4: 16 1 166.
Bremer K. 1988. The limits of amino-acid sequence data in angiosperm phylogcnetic reconstruction.
Ezdutio,i 42: 795-803.
Canu J-G. 1994. Souvenirs entomologiqucs d’Afriquc ct dcs iles voisines. Lumbillionea 94: 3 11-320.
Charlesworth D, Charlesworth B. 1976. Theoretical genetics of Ratesian mimicry. 111. Evolution
of dominance. J O U V M
if Z
?heoretical
~
Biology 55: 325 327.
Choussy M, Barbier M. 1975. Ptkrobiline ct nCopti.robilincs, rkactivitk et structures. Helzietica Chimica
A& 58: 2651-2661.
Clarke CA. 1980. Papilio nandina, a probable hybrid bcbvccn Papilio dardanus and Papilio phorcas.
Ajsteniatic Entomology 5: 49-57, 1 pl.
Clarke CA, Gill ACL. 1996. Guide to the Clarke/Stieppard/Gill Collection of buttelflie\ (4th updating
Septembcr 1996). Privately circulated, CA Clarkc and The Natural History Museum, London.
Clarke CA, Sheppard PM. 1963. Interactions between major genes and polygenes in the dctrrmination of the mimetic patterns of Papilio dardanus. EL’olution 17: 404--413.
Clarke CA, Clarke FMM, Collins SC, Gill ACL, Turner JRG. 1985. Male-like females, mimicry
and transvcstisrn in swallowtail butterflies. .$.rtematic Entomology 10: 257- 283.
Clarke Sir Cyril, Gordon IJ, Vane-Wright RI, Smith CR. 1991. Phylogenetic relationships of
228
K. I. ITi\NE-\1'KIC;H'T RTAL.
three African swallowtail butterflies, Papilio dardanus, P phorca.c and I? constautinus: new data from
hybrids (Lepidoptera: Papilionidac). $.ctematic Entomolog~ 16: 257-273.
Clarke CA, Clarke FMM, Gordon IJ. 1996. Mimicry and other controversial topics in East African
Lepidoptera. Jnurnal ofEa.rt &iican Xatural K s t o n , 84: 3- 18.
Clary DO, Wolstenholme DR. 1985. The mitochondria1 DNA molecule of Dm.cophila ynkuba:
nucleotidc sequence, gene organization, arid genetic rode. Journal ~ l L l o l e c u l a rBolution 22: 252 -27 1 .
Cook SE, Vernon JG, Bateson M, Guilford T. 1994. Mate choice in the polymorphic African
swallowtail butterfly, Pupilin dardams: male-like females may avoid sexual harassment. Animal Behariour
47: 389 397.
Crozier RH, Crozier YC. 1992. 'Ihe cytochrome b and AI'Pasc genes of honeybee mitochoIidrial
DNA. .\lolecular Biohgy and Eriohit~nn9: 474-482.
Darwin C. 1 8 7 1 . n ~dexent ofinan and selection in relation to JPX (in two volumes). Idondon:John Murray.
de Jong R, Vane-Wright RI, Ackery PR. 1996. The higher classification of IiuttcrHics: problems
and prospects. Entoniolngiea Seandinar~ica27: 1-37.
Eltringham H. 1910. ;Ifiican mimetic hutte?flie.c. Oxford: Oxford Uni
rchipclago, \.Vestern
Emeric CM, Duncan RA. 1982. Age progrrssivr ldranism in th
Indian Ocean and implications for Somali plate tectonics. Earth and planetan, science Ltter~(Am.cterdarn)
60: 415-428.
Felsenstein J. 1978. Cases in which parsimony and compatibility methods will be positively misleading.
Sjstevmtir <nology 27: 401-4 10.
Fenton B, Malloch G, Moxley E. 1997. Analysis of eriophyid mite rDNA internal transcribrd
spacer sequences reveals variable simple sequence repeats. 1n.srct ,2lukcular Biolqgy 6: 23 32.
Ford EB. 1936. The genetics of Papilio dnrdanu.c Brown (1sp.j. Tran.\artion.c ( f the Rval Entomological
Sociep uf London 85: 435 ~466.
Hancock DG. 1983. Classification of the Papilionidac (Lcpidoptera): a phylogenetic approach.
Smithersia, Bulawayo 2: 1--48.
Hancock DG. 1993. Origins and evolution of the Afrotropical Papilionidac (Lepidoptera). Arrtnldia,
(<inihahwe) 9: 557-583.
Huxley J. 1963.E~olutior1,
the modem synthesis (2nd cdn). 1,ondon: Allen & Unwin.
Nijhout HF. 1991. Thr der~ek(~p?nent
and ez~olutionoj'butledly ulingpa/tems. it'ashington: Smithsonian Institution
Press.
Normark BB. 1994. Phylogeny and evolution of parthenogenesis in the [email protected] te.\.relatus complex
(Colcoptcra: Curculionidae). PhD thesis, Cornell University, Ithaca, N.Y..
Nunn GB, Theisen BF, Christensen B, Arctander P. 1996. Simplicity-correlated size growth of
the nuclear 28s ribosomal RNA D3 expansion segment in the Crustacean order Isopoda. Journal
of,llnlecular Biolution 42: 21 1 223.
O'Donald P, Barrett JA. 1973. Evolution of dominance in polymorphic Batesian mimicry. Theoretical
Population Biolo,~4: 173-192.
Poulton EB. 1890. The co1our.s oj'animaO, their meaning and use. London: Kegan Paul, Trench, Trubiier
and Co.
Poulton EB. 1924. I'a/din dnrdanu.~The most interesting butterfly in the world. Jonrnal oj' the East
Afii1.a and Iianda ;\atid Histnn, SorieQ (20): 4-22, 3 pls.
Punnett RC. 1915. .2/limicn, in buttegies. Cambridge: Chmbridge University Prcss.
Schwanwitsch BN. 1943. Wing-pattern in papilionid Lepidoptera. Entomologist 76: 20 I - 203.
Sheppard PM. 1975. .Vaturn[ selertinn and heredig (4th cdn). London: Hutchinson.
Simon C, Franke A, Martin A. 1991. The polymerase chain reaction: DNA extraction and
amplification. In: Hcwitt Ghl,Johnston A, YoungJ, cds. ~li'nlecnlartaxonowy. Berlin: NATO Ad\,anccd
Studies Institute, Springer Verlag, 329-355.
Swofford DL. 1993. ElL'P: phylagenetic ana!vsi.s rising parrimony, version 3.1.1. Illinois Natural History
Sumey, Champaign, Illinois.
Trimen R. 1869. O n some remarkable mimetic analogies among African butterflies. 7ran.taction.c oj'
the Linnean Socieo ofLondon 26: 497-522.
Turner JRG. 1963. Geographical variation and evolution in the males of the butterfly Papilia dardanu
Brown (Lcpidoptera: Papilionidac). Transactions ofthe Royal Entornologml Soci~pn f l m d o n 115: 239- 259.
Turner JRG. 1984. Mimicry: the palatability spectrum and its consequences. Synipoxia OJ' the Ryal
Entomologiral SocieQ of'london (11): 14 1 16 1.
van Bemmelen JF. 1922. The wing-design of mimctic buttcrflics. Prncwdiiigs, Section OJScknces, kuniriklzj"e
,Vederlandse ilkadmiie IGtrnJJchappm 23: 87 7-886.
Vane-Wright RI. 1975. An integrated classification for polymorphism and sexual dimorphism in
butterflies. Journal o f < o o l o ~ (London) 177: 877-886.
Vane-Wright RI. 1978. Ecological and hchavioural origins of diversity in butterflies. LQmpo.iia of thr
R p l Entomological Sociep of London (9): 56-70.
Vane-Wright RI. 1979. Toivards a theor)- of the evolution of butterfly colour patterns under
directional and disruptive sclcction. Biolo,~icalJoumul of'linnmri Socirp 11: 14 1 152.
Vane-Wright RI. 1981. hlimicry and its unknoivn ecological consequences. In: Forcy PL, ed. 'The
Er~oL~ing
Bio.iphen. London: BhISH/Cambridgc LP, 157 168.
Vane-Wright RI. 1984. The role of pseudosexual selection in the evolution of Iluttcrfly colour
pattcrns. $rnposia of'thr Roq'al Entornological Socir!y of Imdorr (11): 25 1 253.
Vane-Wright RI. 1997. hlode and tempo in the c\.olution of mimicry in African tmttcrflics a
research pro,qamnie
tnmorpho.si.\ Suppl 3: 133- 138.
Vane-Wright RI, Boppre M. 1993. \'isual and chcmical signalling in butterflies: functional and
phylogcnctic pcrsprcti\~s.P/ii/o.wphiml 7ran.mfion\ ~fflir Roq'al Sot.ie~j~
B340: 197-205, 2 pls.
Vane-Wright RI, Smith CR. 1991. Phylogenetic relationships of three African s\vallo\vtail butterflies,
f'apilio dardunus, f? pliorcah and P c.onstantinu: a cladistic analysis (1,cpidoptcra: Papilionidac). L$utertiatzc
Entornolog 16: 2755291.
Vogler AP, DeSalle R. 1994. Evolution and phylogenetic information content of the ITS- 1 region
in the tiger beetle c'icindda dorsnh. .\lolecular Biology and B,olution 11: 393-405.
Vogler AP, DeSalle R, Assmann T, Knisley CB, Schultz TD. 1993. hlolecular population
genetics of the endaiigered tiger beetle, (,'icindel~i doi:\ali.\ (Coleoptera: Cicindelidae). iinna1.r of' thr
Entomological Socir!~~
of Amrrica 86: 142-1 52.
Vogler AP, Welsh A, Hancock JM. 1997. Ph)-logenetic analysis of slippage-like sequence variation
in the \'4 rRNA expansion segment in rigcr lieetles (Cicindclidac). L \ f o l m h r Riolog and Er,olution
14: 6-19.
Wheeler WC, Gladstein DS. 1994. hIALIGN: h multiple sequence alignment program. ,journal of
Hertdio 85: 4 1 7-4 18.
~
~
-