The role of the cytoskeleton in respiratory
syncytial virus assembly
James Francis Gordon
B AppSc, University of Canberra
Centre for Research in Therapeutic Solutions
(CResTS)
University of Canberra ACT 2601
A thesis submitted in partial fulfilment of the requirements
for the degree of Bachelor of Applied Science (Honours) at
the University of Canberra
Submitted 2nd March 2012
I
Abstract Respiratory syncytial virus (RSV) is a leading cause of respiratory tract infections in
neonates and the elderly. Pharmaceutical options for the prevention or treatment of
RSV are limited with treatment normally restricted to supportive care. A better
understanding of the pathogenesis of RSV, including RSV assembly, might aid in the
development of safe and effective pharmaceuticals. We examined the role of the
cytoskeleton in the assembly of RSV by investigating the effect inhibition of the
cytoskeleton had on the subcellular localisation of RSV matrix (M) protein; the chief
mediator of assembly. Using cytochalasin D and nocodazole it was found that the
chemical disruption of the cytoskeleton during in vitro infection of Vero E6 cells
resulted in a change in subcellular localisation of M protein at 10 hours post infection.
This correlates with the time of assembly. Inhibition of the cytoskeleton was also found
to alter the subcellular localisation of transfected GFP-M in COS-7 cells, suggesting a
direct interaction between M protein and the cytoskeleton. We have shown for the first
time that the cytoskeleton interacts directly with M protein to facilitate assembly.
II
Certificate of Authorship of Thesis Except as specifically indicated in footnotes and quotations, I certify that I am the sole
author of the thesis submitted today entitled The role of the cytoskeleton in respiratory
syncytial virus, in terms of the Statement of Requirements for a thesis issued by the
University Research Degrees Committee.
Signature ___________________________
Date ___________________________
III
Acknowledgements
First and foremost I would like to thank my supervisors Reena Ghildyal and Michelle
Gahan for giving me the opportunity to perform real biomedical research and for all the
time and effort they have invested in me over the past year. This project would not have
been possible without their input and guidance. It has been a fantastic learning
experience and the laboratory skills and communications skills I have gained through
this project have made it more than worthwhile.
I would also like to thank everyone in the Faculty of Applied Science who has
contributed to this project in any way. This includes technical staff members Erin
Walker and Parisa Younessi and all my fellow students too numerous to name.
Finally, I would like to thank my family for their love and support. Specifically, my
wife and partner Rachelle who always urges me to do whatever will make me happy,
my son Isaac who is a constant joy and both sets of parents for all the free nanny-care.
IV
Table of contents
Abstract .............................................................................................................................. i
Certificate of Authorship of Thesis ................................................................................... ii
Acknowledgements ..........................................................................................................iii
I.
List of abbreviations ................................................................................................ vii
II. List of figures ............................................................................................................ ix
Chapter 1
General Introduction ............................................................................... 1
1.1
Introduction ........................................................................................................ 1
1.2
RSV disease ........................................................................................................ 1
1.3
Treatment and vaccines ...................................................................................... 2
1.4
RSV taxonomy and genome ............................................................................... 3
1.5
Viron Structure ................................................................................................... 3
1.6
RSV Proteins ...................................................................................................... 4
1.6.1
Surface glycoproteins .................................................................................. 5
1.6.2
Nucleocapsid proteins ................................................................................. 5
1.6.3
Non-essential proteins ................................................................................. 6
1.6.4
M protein ..................................................................................................... 6
1.7
1.6.4.1
Nuclear trafficking of M ...................................................................... 7
1.6.4.2
Interaction of M with cell membrane .................................................. 7
1.6.4.3
Interaction of M with nucleocapsid ..................................................... 7
1.6.4.4
Interaction of M with glycoproteins .................................................... 8
Infectious lifecycle ............................................................................................. 8
1.7.1
Entry ............................................................................................................ 8
1.7.2
Transcription ............................................................................................... 9
1.7.3
Replication .................................................................................................. 9
1.7.4
Budding ....................................................................................................... 9
1.8
The cytoskeleton............................................................................................... 10
1.8.1
Actin .......................................................................................................... 11
1.8.2
Microtubules ............................................................................................. 11
1.8.3
Intermediate filaments............................................................................... 12
1.9
Molecular motors ............................................................................................. 12
V
1.10
Viral interaction with the cytoskeleton ......................................................... 13
1.10.1
Vaccinia virus and herpesviruses .............................................................. 13
1.10.2
Influenza viruses ....................................................................................... 14
1.10.3
Sendai virus ............................................................................................... 14
1.10.4
Vesicular stomatitis virus .......................................................................... 14
1.10.5
RSV ........................................................................................................... 15
1.10.5.1
Role of RhoA in RSV pathogenesis .................................................. 15
1.10.5.2
Role of actin in viral transcription ..................................................... 16
1.10.5.3
Cytoskeleton facilitated transport ...................................................... 16
1.10.5.4
Effect of cytoskeleton inhibitors on RSV lifecycle ........................... 17
1.10.5.5
The role of the cytoskeleton in the assembly of RSV ....................... 17
1.11
Conclusion .................................................................................................... 18
1.12
Hypothesis and aims ..................................................................................... 18
1.12.1
Hypothesis ................................................................................................. 18
1.12.2
Aims .......................................................................................................... 19
Chapter 2 Materials and Methods .............................................................................. 20
2.1
Materials ........................................................................................................... 20
2.2
Methods ............................................................................................................ 23
2.2.1
Mammalian cell culture............................................................................. 23
2.2.1.1
Mycoplasma testing ........................................................................... 23
2.2.2
Transfections ............................................................................................. 24
2.2.3
Application of cytoskeleton inhibitors ...................................................... 25
2.2.4
Propagation of RSV .................................................................................. 25
2.2.5
Immuno plaque assay ................................................................................ 25
2.2.6
Plasmid DNA extraction and purification ................................................. 26
2.2.7
DNA quantitation ...................................................................................... 27
2.2.8
Gel electrophoresis .................................................................................... 27
2.2.9
Electroporation .......................................................................................... 27
2.2.10
Preparation electrocompetent E. coli ........................................................ 27
2.2.11
Confocal laser scanning microscopy ......................................................... 28
2.2.12
Image analysis ........................................................................................... 28
2.2.13
Statistical analysis ..................................................................................... 28
VI
Chapter 3 The effect of cytoskeleton inhibitors on RSV replication kinetics......... 30
3.1
Introduction ...................................................................................................... 30
3.2
Use of destabilising drugs to study cytoskeleton interactions .......................... 31
3.3
Optimisation of inhibitors................................................................................. 31
3.4
Method.............................................................................................................. 33
3.5
Results .............................................................................................................. 33
3.6
Discussion ........................................................................................................ 35
3.6.1
Total virus titre .......................................................................................... 35
3.6.2
Percentage of virus released from cells ..................................................... 35
3.6.3
Summary ................................................................................................... 35
Chapter 4 Effect of cytoskeleton inhibitors on subcellular localisation of matrix
protein ............................................................................................................................ 36
4.1
Introduction ...................................................................................................... 36
4.2
Method.............................................................................................................. 37
4.2.1
Fn/c of M protein in infected Vero E6 cells .............................................. 37
4.2.2
Fn/c of GFP-M in transfected cells ........................................................... 38
4.3
Results .............................................................................................................. 38
4.3.1
Cytoskeleton inhibition alters sub-cellular localisation of M protein in
infected cells ............................................................................................................ 38
4.3.2
Cytoskeleton inhibition alters sub-cellular localisation of M protein in
transfected cells ....................................................................................................... 41
4.4
Discussion ........................................................................................................ 44
4.4.1
M protein in infected cells......................................................................... 44
4.4.2
GFP-M in transfected cells ....................................................................... 44
4.4.3
Summary ................................................................................................... 45
Chapter 5 General Discussion ..................................................................................... 46
5.1
Introduction ...................................................................................................... 46
5.2
Microtubules and F-actin interact with M protein for the assembly of RSV ... 46
5.3
Model of cytoskeleton participation in the lifecycle of RSV ........................... 47
5.4
Future directions ............................................................................................... 49
5.5
Conclusion ........................................................................................................ 50
VII
References ....................................................................................................................... 51 I. List of abbreviations
ARE
Apical recycling endosome
ATCC
American type culture collections
ATP
Adenosine triphosphate
CLSM
Confocal laser scanning microscope/microscopy
dNTP
Deoxyribosenucleoside triphosphate
F
Fusion protein
G
Attachment glycoprotein
GFP
Green fluorescent protein
HPI
Hours post infection
L
Polymerase protein
LRTI
Lower respiratory tract infection
M
Matrix protein
M2-1
Transcription anti-termination protein
M2-2
Transcription regulation protein
MOI
Multiplicity of infection
MTOC
Microtubule organising centre
N
Nucleocapsid protein
NS1
Non-structural protein 1
NS2
Non-structural protein 2
OD
Optical density
P
Phosphoprotein
PBS
Phosphate buffered saline solution
RPM
Revolutions per minute
RSV
Respiratory syncytial virus
SEM
Standard error of the mean
SH
Short hydrophobic protein
SOB
Super optimal broth
SOC
Super optimal broth with catabolite repression
URTI
Upper respiratory tract infection
VSV
Vesicular stomatitis virus
VIII
IX
II. List of figures
Figure
Title
Page
Figure 1.1
Diagram of RSV A2 genome from 3’ to 5’
3
Figure 1.2
Diagram of RSV virion
4
Figure 1.2
Diagram depicting the lifecycle of RSV within a
10
polarised, ciliated epithelial cell
Figure 3.1
Timeline of 30 hour RSV replication kinetics
29
experiment
Figure 3.2
The effect of cytochalasin D on the actin
31
cytoskeleton
Figure 3.3
The effect of cytochalasin D and nocodazole
33
treatment on RSV replication
Figure 3.1
Overview of the protocol for investigating the effect
36
of cytoskeleton inhibitors on subcellular localisation
of M protein
Figure 4.2
Subcellular localisation of M protein in RSV infected
38
cells treated with cytochalasin D, nocodazole or
vehicle at 6 and 10 hours post infection
Figure 4.3
Proportion of nuclear M in relation to cytosolic M
39
Figure 4.4
CLSM images of GFP-M in transfected cells treated
41
with cytochalasin D, nocodazole or vehicle
Figure 4.5
Proportion of nuclear GFP-M in relation to cytosolic
42
GFP-M
Figure 5.1
A model of cytoskeleton involvement in the lifecycle
of RSV
47
1
Chapter 1 General Introduction 1.1 Introduction Respiratory syncytial virus (RSV) is the most important cause of lower respiratory
disease in infants and young children worldwide [2]. In recent years, RSV has also
been shown to be a major cause of morbidity and mortality in the elderly [3]. There are
no effective pharmaceuticals licensed for use in RSV disease and vaccine development
has been hampered due to the results of a previous trial of formalin inactivated RSV that
resulted in enhanced disease on subsequent natural infection [4]. Given its worldwide
impact and the associated socioeconomic costs, there is an urgent need to investigate
new paths to vaccine and therapeutic development. A detailed understanding of the
assembly processes used by RSV is essential to enable identification of new targets.
1.2 RSV disease RSV contributes substantially to the number of upper respiratory tract infections (URTI)
for all people but it is in neonates, the elderly and the immunocompromised that
infection is most dangerous, often progressing to lower respiratory tract infection
(LRTI) with the potential for severe cardiopulmonary complications [5]. In 2009, the
World Health Organisation estimated that globally there are 64 million RSV cases
leading to 160,000 deaths annually [2]. RSV is the leading cause of bronchiolitis
related hospitalisations in infants, with typically 0.5% to 2% of all infants requiring
hospitalisation, although this range varies widely in different populations [6-8]. An
added concern for infants who develop an RSV LRI is that they are subsequently at
greater risk of developing allergies and recurrent wheeze up until 13 years of age [9,
10]. It is unclear whether this correlation is due to some lasting effect of RSV infection
or whether these children have an underlying predisposition to lung pathologies [10].
RSV is a seasonal illness and outbreaks occur mainly in winter/early spring in temperate
regions and during rainy seasons in tropical regions [6]. Reinfections occur throughout
life but adults are often asymptomatic [11]. Person to person transmission of RSV is
through inoculation of the nose, eyes or mouth by either direct contact or inhalation of
infectious airborne droplets. Infection is normally restricted to the ciliated epithelial
cells of the nasopharynx with symptoms that include sinus congestion, cough and low
2
grade fever. After an incubation period of 4 – 5 days, the infection can spread to the
ciliated epithelial cells of small bronchioles and type 1 pneumocytes of the lower
respiratory tract [11]. RSV LRI manifest mainly as bronchiolitis. Complications
associated with bronchiolitis include airway resistance and air trapping, which in
neonates create difficulties in breathing, eating and sleeping. Severe bronchiolitis can
lead to acute respiratory failure characterised by hypoxia and bronchospasms [6].
Considerable airway obstruction is caused by the sloughing of dead cells, mucous
secretion and accumulation of immune cells [11]. There is debate as to what proportion
of RSV disease can be attributed to the direct cytopathic effect of RSV infection and
what proportion can be attributed to the host immune response to RSV infection [11].
1.3 Treatment and vaccines RSV infection of the upper respiratory tract is a self-limiting condition. Treatment of
neonates hospitalised due to RSV infection of the lower respiratory tract is mainly
limited to supportive care such as humidified oxygen and intravenous fluids.
Bronchodilators and corticosteroids, whilst providing some transient improvement in
symptoms, do not alter disease progression and are therefore not usually recommended
[12, 13]. The antiviral drug Ribavirin is the only pharmaceutical approved for the
treatment of RSV. Ribavirin is a RNA nucleotide analogue administered as an aerosol
directly to the lungs [14]. However, Ribavirin is rarely used due to its limited efficacy,
high cost, concerns over occupational exposure to care-givers and side effects which
include haemolytic anaemia [15]. Passive immunity can be partially achieved through
the use of the humanized monoclonal antibody Palivizumab (brand name Synagis by
MedImmune) which targets the RSV fusion (F) protein. Selective use of Palivizumab
in neonates can reduce RSV hospitalisations by between 45 and 55 percent [16]. The
use of Palivizumab is limited by its high cost and exact guidelines for use differ by
country. In the United Kingdom, a meta-analysis of the available literature
recommended that Palivizumab was cost effective in infants with chronic lung disease,
congenital heart disease or two or more other risk factors [17]. Risk factors include
RSV season (cold months), premature birth, pulmonary dysplasia, immunodeficiency,
school age siblings or siblings in day care.
There is no licensed RSV vaccine available although at least two vaccine
candidates are presently undergoing human trials [18]. After the discovery of RSV in
1956 [19], the first attempt at vaccination in the 1960s was performed using formalin
3
inactivated virus [20]. The vaccine was well tolerated initially but upon natural
infection had the paradoxical effect of exacerbating RSV disease resulting in two deaths
[21]. There are some researchers who believe that achieving permanent immunity to
RSV within the next few years is unlikely due to our seeming inability to permanently
vaccinate against any disease which the human body itself cannot permanently protect
against [14]. Other researchers though, remain optimistic that a safe and effective
vaccine will be developed via approaches that include live attenuated virus, protein subunits or vector based [4].
1.4 RSV taxonomy and genome RSV belongs to the Pneumovirus genus within the Paramyxoviridae family and
Mononegavirales order. RSV is divided into subgroups, A and B, based on reactivity
patterns of monoclonal antibodies [22]. Other viruses within the Paramyxoviridae
family include mumps, measles, hendra and nipah virus. There is no known animal
reservoir for human RSV although bovine RSV is an animal analogue. The genome is a
single stranded negative sense RNA genome of 15.2 kilobases which contains 10 genes
(figure 1).
5’
3’ 1
P 914 N 1203 NS1 NS2
Leader 532 503 44 2
1
M
958 9
SH
410 9
4
G
923 M2 961 F
1903 5
4
L 6578 Trailer
155 6
Figure 4.1 Diagram of RSV A2 genome from 3’ to 5’. Numbers underneath gene names refer
to nucleotide length. Genes are shown as coloured rectangles according to the place of their gene
product in the virion. Blue indicates non-structural genes 1 and 2 (NS1 and NS2). Red indicates
nucleocapsid genes; nucleocapsid protein (N), phosphoprotein (P), regulator of transcription
(M2), polymerase protein (L). Orange indicates surface glycoprotein genes; short hydrophobic
(SH), glycoprotein (G) and fusion (F). The green indicates the matrix protein gene (M). Length
of intergenic regions are shown ( ) as is the overlap between M2 and L ( ). Adapted from
Fields Virology, P Collins and J Crow [1].
1.5 Viron Structure The RSV virion is pleomorphic, being either spherical or filamentous with a diameter
between 100 and 350 nm in the spherical virion and between 60 and 200 nm diameter in
the filamentous virion with a length of up to 10 µm [1]. The inner nucleocapsid consists
of the RNA genome tightly encapsidated by nucleocapsid protein (N) as well as the
4
polymerase protein (L), phosphoprotein (P) and the transcriptional regulator M2-1
(figure 2). External to this is a layer of matrix (M) protein which interacts with both the
nucleocapsid and the viral envelope, holding them together (figure 2). Embedded in the
envelope is the glycoprotein (G), fusion (F) glycoprotein, and the short hydrophobic
(SH) protein (figure 2). The roles of these proteins are discussed in the next section.
Figure 1.5 Diagram of RSV virion. Virion can also occur as a filamentous particle. G protein =
attachment glycoprotein, F protein = fusion glycoprotein, SH protein = short hydrophobic protein, M
protein = matrix protein, L protein = large polymerase enzyme, P protein = phosphoprotein, N protein =
nucleocapsid protein. Adapted from Fields Virology, P Collins and J Crow [1].
1.6 RSV Proteins The RSV genome codes for 11 proteins, that can be classified based on their location in
the virion and role in infection. The virion consists of an outer phospho-lipid envelope,
a nucleocapsid core and a layer of M protein bringing the two together [1]. F protein, G
protein and SH protein are transmembrane proteins embedded in the lipid envelope,
which is derived from the infected host cell plasma membrane [1]. The nucleocapsid
contains the viral polymerase protein (L), M2-1 protein, nucleocapsid (N) protein and
phosphoprotein (P). M2-2 and two non-structural proteins NS1 and NS2 are not found
in the virion in any significant amount but have important roles in the RSV infection.
The two M2 proteins are translated from the same mRNA transcript through a process
called coupled translation. Originally thought to be a second type of matrix protein [1],
5
they are now known to be important regulators of transcription, but whereas M2-1 is
essential for viability, M2-2 ablated virus is only moderately attenuated [23].
1.6.1 Surface glycoproteins F and G are important antigens in RSV immunity with the majority of neutralising
antibodies being directed to them. G is important but not essential in initiating entry via
attachment to the receptor molecule heparin-like glycosaminoglycan in cell culture [24].
G has several important roles in immune evasion which include being secreted as a
soluble N-truncated (trans-membrane region) form that acts as a decoy to shield the
virus from neutralisation from RSV-specific antibodies [25]. G is noted for exhibiting
greater genetic variation than any other RSV protein both within and between
subgroups [26] and has extensive glycosylation which may shield the polypeptide
backbone from immune recognition [27]. F directs viral entry via membrane fusion
and also mediates fusion of infected cells to form syncytia [28]. An N-terminal signal
sequence (residues 1-22) directs F to the rough endoplasmic reticulum and from there F
utilises the secretory pathway for its transport to the apical membrane [1, 29]. Newly
translated F is initially inactive (F0) and becomes activated within the trans-Golgi
complex by cleavage at two sites by a host cell protease yielding F1, F2 and p27.
Disulfide linkage of F1 and F2 completes the post-translational modification of F with
the remaining short p27 peptide of unknown function [30]. The trans-membrane
domain of F was found to target F to the apical membrane of polarised epithelial cells
using the secretory pathway while in non-polarised cells F was evenly distributed
throughout the membrane [31]. SH protein is not essential for RSV infectivity as its
deletion does not significantly diminish infectivity in vitro or in vivo [11]. The
formation of SH pentamers and the ability of SH to alter membrane permeability in
bacteria suggest SH may be an ion-channel forming viroporin [32, 33]. Viroporins are a
group of proteins found in some viruses that alter membrane permeability and facilitate
virus release [34].
1.6.2 Nucleocapsid proteins N protein is the most abundant of the nucleocapsid proteins. N tightly encapsidates the
RNA genome as well as the positive sense anti-genome and may partly conceal these
viral transcripts from aspects of innate immunity [35]. Encapsidation also prevents
genomes and anti-genomes from forming secondary structures, eliminating the need for
6
helicase activity [36]. P protein is an essential component of the polymerase complex
[37]. L protein is the catalytic protein of the polymerase complex and is the largest
RSV protein at almost four times larger than the next largest protein; F protein (figure
1). The anti-termination protein M2-1 is an important regulator of transcription because
in the absence of M2-1, only NS1 and NS2 are transcribed due to polymerase drop off
[38] (sequential transcription is explained in section 1.7.2).
1.6.3 Non­essential proteins M2-2, NS1 and NS2 proteins are not required for RSV viability although mutant RSV
strains without these genes are attenuated in vivo [11]. The coupled translation of M2
mRNA is a process whereby after translation of M2-1, the ribosome moves back
upstream 32 nucleotides where it initiates translation of M2-2 in a second open reading
frame [39]. Compared to wild type, cells infected with M2-2 deleted RSV exhibited 3
to 4 fold less genomic RNA and 2 to 4 fold more mRNA, suggesting that M2-2 might
mediate the ‘switch’ from transcription to replication [40]. The primary purpose of
NS1and NS2 is to suppress interferon [41]. NS1 and NS2 have also been shown to have
an anti-apoptotic effect which may benefit the virus by giving it more time to replicate
[42]. Recently, NS1 has also been shown to skew the adaptive immune response via its
suppressive effect on the maturation of dendritic cells that was only partly dependent on
the release of interferon [43].
1.6.4 M protein As with the matrix proteins of Orthomyxoviruses [44], RSV M protein plays an
essential role in assembly and interacts with a number of both viral and host cell
proteins [45]. It is the only RSV protein to traffic into and out of the nucleus. Nuclear
extracts of RSV infected cells had less transcriptional activity than nuclear extracts from
mock infected cells showing that RSV M inhibits host cell transcription [46]. M also
inhibits viral transcription as evidenced by antibodies to M enhancing the transcriptional
activity of purified viral ribonucleoproteins [47]. The position of M in the mature virion
puts it in contact with all components of the virion (figure 2). In the infected cell, M
interacts with glycoproteins, nucleocapsid proteins and the host cell membranes in order
to direct viral assembly [47-50].
7
1.6.4.1 Nuclear trafficking of M M is known to traffic into and out of the nucleus by way of specific nuclear import and
export pathways in cell culture [51, 52]. During the early stage of infection (6 hours
post infection), M is seen predominantly in the nucleus while at late stage infection (20
hours post infection), it is seen mainly within cytoplasmic inclusions and is almost
completely absent from the nucleus [46]. As previously mentioned, the role of M in the
nucleus is proposed to be inhibition of host cell transcription [46]. It is not known
whether certain genes are targeted or whether M non-specifically down regulates all
transcription. It has also been suggested that sequestering M protein (an inhibitor of
viral transcription) in the nucleus early in infection may allow for greater production of
viral components. Late in infection, M then traffics out of the nucleus, inhibits viral
transcription and orchestrates assembly and budding [45].
1.6.4.2 Interaction of M with cell membrane As with the matrix proteins of other negative strand RNA viruses, RSV M protein has
been found to associate with the plasma membrane of host cells [44, 49, 53]. When
expressed in cells without viral glycoprotein, M was found to associate with plasma
membranes but with different characteristics than M in naturally infected cells [54]. M
was more diffuse and did not localise to lipid rafts. When co-expressed with
glycoprotein F, M was found to associate with lipid rafts [54]. Lipid rafts are areas of
plasma membrane rich in cholesterol, sphingolipids and protein receptors [55] and are
areas that RSV is known to bud from [56]. As previously mentioned in section 1.6.1, F
is targeted toward the apical membrane. The implication is that F is necessary to direct
M to the site of assembly and budding.
1.6.4.3 Interaction of M with nucleocapsid M co-localisation with cytoplasmic inclusions containing the nucleocapsid proteins N, P
and M2-1 has been observed using double-labelled immunofluorescent confocal
microscopy [47]. Using co-transfection methods, it was shown that M only associates
with these cytoplasmic inclusions in the presence of M2-1 [50]. Further investigation
using truncated M mutants revealed the N-terminal 110 amino acids of M were
necessary for the interaction with M2-1and hence the nucleocapsid [50]. In addition to
transcriptional inhibition, M protein may be necessary for the uptake of the
nucleocapsid into the virion during assembly in a similar fashion to that of vesicular
8
stomatitis virus (VSV) matrix protein. VSV matrix protein will, under specific
conditions that presumably correspond to the time of assembly, self-aggregate or
oligomerise [57]. This oligomerisation has also been observed in RSV M protein
dialysed into phosphate buffered saline solution PBS [54]. Oligomerisation of M could
be what drives or helps to drive virus assembly and budding.
1.6.4.4 Interaction of M with glycoproteins The cytoplasmic tails of envelope glycoproteins are logical places to look for interaction
with the internal M protein. The cytoplasmic domain of glycoprotein G has been shown
to interact with M protein and specifically amino acids 2 and 6 are necessary for this
interaction as evidenced by observation of co-localisation of full length G and M but not
co-localisation of M and N-truncated G mutants [48]. A similar technique was used to
show that the membrane distribution of F glycoprotein was less focussed and more
diffuse when expressed without the cytoplasmic tail [58]. As previously mentioned in
section 1.6.4.2, F has been shown to not only interact with M protein but may also
direct M to the site of assembly [54].
1.7 Infectious lifecycle Inoculation of the nose or eyes can occur through direct contact or inhalation of airborne
infectious particles and results in viral replication in the nasopharynx over 4 -5 days
occasionally spreading to the lower respiratory tract over the next few days [11].
Infection is highly restricted to the superficial cells of the respiratory epithelium [59].
Within the cell, all events of the viral lifecycle take place outside the nucleus with the
exception of M protein nuclear trafficking. The infectious lifecycle of RSV can be
described in four parts; entry, transcription, replication and budding (illustrated in figure
3).
1.7.1 Entry F is the only envelope glycoprotein essential for attachment and entry although G
deleted strains are highly attenuated in vivo [60]. Glycosaminoglycans (GAGs) are cell
surface receptors implicated in RSV attachment, as well as for many other viruses [61,
62]. Entry has been described as F mediated fusion of envelope and membrane, though
newer evidence strongly implicates clathrin mediated endocytosis in the entry process
[63, 64].
9
1.7.2 Transcription The minimum proteins required for transcription are N, P and L. In infected cells, these
nucleocapsid proteins are found in cytoplasmic inclusions, which are presumed to be
sites of transcription [36]. Transcription results in 10 capped, methylated and
polyadenylated mRNAs which are translated by host cell machinery. Each gene is
flanked by a gene-start and gene-end sequence [65, 66]. The 3’ end of the genome
contains a promoter that is the only place the polymerase complex is able to attach [1].
Genes are then transcribed sequentially from 3’ to 5’. However, due to polymerase drop
off at intergenic regions, there is a gradient of expression, with genes at the 3’ end
expressed at higher levels than genes at the 5’ end. Hence, proteins that the virus needs
in greater numbers such as the interferon inhibitors NS1 and NS2 are produced much
more than proteins needed in small supply such as the polymerase L protein [36]. The
5’ end of the M2 gene and 3’ of the L gene overlap by 68 nucleotides (refer to figure 1).
The polymerase complex overcomes this difficulty by backtracking to the start of the L
gene after completing transcription of M2 [67]. This means that to complete
transcription of L, the polymerase complex must “read through” the gene-end sequence
of M2, something that it does not do in 90 % of cases [1]. The benefit of this added
complexity, if any, is uncertain.
1.7.3 Replication Replication of new negative sense genomes requires the production of a complete
positive sense anti-genome as an intermediate. This is accomplished with the same
polymerase complex used for mRNA transcription but operating in “read through”
mode where gene-start and gene-end signals are not recognised. Aside from the
involvement of M2-2 (section 1.6.3), little is known of how the switch from
transcription mode to replication mode occurs.
1.7.4 Budding As mentioned previously mentioned in section 1.2, infection is highly restricted to the
superficial cells of the respiratory epithelium. In accordance with this, budding in
polarised epithelial cells occurs at the apical membrane [68, 69] and preferentially from
lipid rafts [56]. Video microscopy has been used to show viral filaments budding from
the same region of cell membrane at a rate of several virions per minute [70].
10
1. Entry
4. Assembly and egress at lipid raft
2. Transcription
and translation
3. Replication
Genome
F protein utilises the
secretory pathway
Anti-genome
Golgi
ER
Nucleus
Figure 1.6 Diagram depicting the lifecycle of RSV within a polarised, ciliated epithelial cell. 1.
Entry via clathrin mediated endocytosis or fusion (F) protein mediated fusion of membrane and envelope.
2. Transcription of genomic material into mRNA by the viral polymerase complex followed by translation
using host cell machinery. 3. Polymerase complex switches to ‘read through’ mode for transcription of
anti-genome then replication of genome. Both genome and anti-genome remain encapsidated by
nucleoprotein (N). 4. Assembly occurs preferentially at lipid rafts in the membrane. Viral envelope is
acquired from the plasma membrane when budding. The endoplasmic reticulum is denoted by ER.
1.8 The cytoskeleton The host cell cytoskeleton plays an important role in assembly and budding of several
viruses. Before discussing some of the ways in which viruses are known to utilise the
cytoskeleton, a brief description of the cytoskeleton is required. The cytoskeleton is
composed of three different types of protein filaments which in order of smallest to
largest are actin, intermediate filaments and microtubules. Apart from being the
scaffolding that gives the cell its shape and strength, the cytoskeleton has other
important functions. The cytoskeleton is organises the layout of the cell with organelles
positioned and held in place by the cytoskeleton. The cytoskeleton is important in cell
junctions and cell signalling. Cell locomotion can be achieved through the extension of
actin on one side of the cell and retraction of actin on the opposite side [71]. This swift
remodelling is possible because of the dynamic nature of the cytoskeleton and actin and
microtubules in particular. Actin and microtubules are formed by the polymerisation of
actin monomers and tubulin monomers respectively.
11
Polymerisation is key to several important characteristics of actin and microtubules.
Filaments have a fast growing end that generally points outward and a slow growing
end that generally points inward, creating phenomena called treadmilling [72]. The
polarity of filaments is also important for the molecular motors that use actin and
microtubules as tracks to carry cargo. Some molecular motors travel in one direction
and others travel in the opposite direction. Events such as cytokinesis and the
movement of vesicles and organelles rely on the cytoskeleton and its associated
molecular motors [72].
1.8.1 Actin Actin is the most abundant cytoskeletal protein typically accounting for 5 to 10% of
total protein in eukaryotic cells [72]. Actin monomers are often referred to as globular
or G-actin and the filamentous form is often referred to as F-actin. Actin filaments can
be arranged into a variety of linear bundles, two-dimensional arrays, or threedimensional gels [73]. Numerous actin binding proteins regulate the polymerisation
and organisation of F-actin and it is these proteins that are sometimes the target of viral
manipulation, such as actin related protein 2/3 (Arp2/3) with vaccinia [74] or the
interaction of profilin with RSV [75]. Actin is present throughout the cytoplasm but is
most abundant at the periphery of the cell (cortical actin) where actin extensions such as
filopodia, lamellipodia and pseudopodia occur [76]. The actin cortex has been
proposed to be an obstacle to viral entry [77] and this might be why some viruses use
the endocytic pathway which easily crosses the actin cortex [73]. Regulated binding to
actin filaments has been known to affect the localisation of viral proteins such as the
nucleoprotein of influenza virus [78].
1.8.2 Microtubules Microtubules are composed of dimers of α-tubulin and β-tubulin arranged head to tail
lengthwise and 13 side by side around a hollow core [72]. Most of the microtubules in
a cell radiate outward from a microtubule organising centre (MTOC) or centrosome
which is usually located near the nucleus. Microtubules extend from the MTOC with
the faster growing plus ends facing outward. Different cell types, such as polarised
epithelial cells and neurons, can have specialised microtubule networks. Microtubules
in axons are longitudinally arranged with the plus ends pointing toward the axon
terminal and minus ends pointing toward the soma [79] while in polarised epithelial
12
cells microtubules are arranged with plus ends pointing toward basal membrane and
minus ends pointing toward the apical membrane [73]. As a consequence, the transport
of factors needed for the maintenance of the basal and apical membranes becomes
simpler. Microtubule transport is divided into retrograde movement (toward the
nucleus) and anterograde movement (away from the nucleus), each requiring a different
set of motor proteins (section 1.9) that generally only move cargo in one direction. A
recurring theme in viral infections is the role of microtubules and molecular motors
(section 1.9) in moving virus particles from one location in the cell to another (reviewed
in [80-83] and section 1.11).
1.8.3 Intermediate filaments Intermediate filaments have several important differences to actin filaments and
microtubules. They exhibit no treadmilling behaviour and have no polarity [72]. The
general role of intermediate filaments is more of a structural support role and provide
the scaffolding for the localisation of cellular processes, especially the nucleus, around
which intermediate filaments form a ring [72]. There are fewer examples of viruses
interacting with intermediate filaments than with actin or microtubules although
adenovirus and vaccinia virus have been shown to disassemble or rearrange the
intermediate network. This may serve the virus by removing a barrier to diffusion or it
may weaken the cell enough to enhance cell lysis and release of viral progeny [84, 85].
1.9 Molecular motors Motor proteins are necessary for the movement of macromolecules, membrane vesicles
and organelles through the cytoplasm. Motor proteins are also responsible for the
movement of cilia and flagella, the movement of chromosomes during mitosis/meiosis,
cytokinesis and cell locomotion [72]. The various motor proteins used to transport an
assortment of cargo can be grouped into three main groups; myosin, dynein and kinesin.
Myosins operate on actin filaments, whereas kinesin and dynein move along
microtubules. There are 18 classes of myosin grouped according to homologous
sequences in the tail domain which is also the area that determines cargo specificity
[73]. The most studied and well known is myosin II, the motor protein responsible for
muscle contraction [72]. Kinesins and dyneins transport cargo toward the plus end and
minus end, respectively, of microtubules [72].
13
1.10 Viral interaction with the cytoskeleton It is likely that most if not all viruses utilise the cytoskeleton in some way. An effective
argument to support this is that while salts and gases are small enough to diffuse freely
through the cytoplasm, larger entities such as nucleoprotein cores, travel through the
cytoplasm much more efficiently with the aid of the cytoskeleton transport system [81].
Early support for this came from work examining the viscosity and diffusion properties
of the cytoplasm. It was found that the diffusion of hydrophilic, electroneutral beads of
80 nm in radius was between 500 and 1000 fold lower in the cytoplasm than in aqueous
solution [86]. Data from the same study was used to estimate that a vaccinia virus
virion would take 5 hours to diffuse a 10 µm in the cytoplasm [83], when in fact
vaccinia virions are known to move much faster than this [87] (section 1.10.1).
Evidence of viral interaction with the cytoskeleton has been shown for vaccinia,
herpesviruses, influenza A, Sendai virus, vesicular stomatitis virus and RSV.
1.10.1 Vaccinia virus and herpesviruses Recombinant vaccinia virus has been observed moving through the cytoplasm of
infected cells when tagged with green fluorescent protein (GFP) at a rate consistent with
microtubule transport [87, 88]. The active nature of the movement is similar to that of
the bacterium Listeria monocytogenes. However, while L. monocytogenes is propelled
by the force of actin polymerisation [89], vaccinia virus uses retrograde microtubule
transport upon entry [87], anterograde microtubule transport prior to budding [88] and
finally the induction of actin tails at the cell periphery [90]. Actin tails are protrusions
of actin that facilitate cell to cell spread by pushing the exposed progeny virions into
adjacent cells.
Herperviruses have long been known to use facilitated transport owing to the long
distances the virus must travel along the axon to get to the nucleus and then back the
same way [91]. After entry, capsids associate with dynein to move toward the soma
[92] with at least 3 nucleocapsid proteins known to associate with the minus end
directed motor protein [93, 94].
Once inside the nucleus, where replication and
assembly occur, there is significant involvement of the cytoskeleton. Actin filaments
are assembled even in cells that do not normally contain nuclear actin, possibly for the
purpose of organising and maintaining assembly domains [95]. Before exiting the
nucleus, herpesviruses must cross the nuclear lamina, a network of intermediate
14
filaments roughly 20 to 80 nm wide [96]. Herpes simplex virus type 1 proteins have
been shown to induce conformational changes in the nuclear lamina that may facilitate
nuclear egress [97, 98]. Transport of progeny enveloped virions use the secretory
pathway for anterograde transport during the egression stage of infection [99]. Vaccinia
virus and herpesviruses are examples of how thoroughly some viruses depend on the
cytoskeleton to survive.
1.10.2 Influenza viruses Similarly to RSV, influenza viruses have single stranded negative sense RNA genomes.
Live cell microscopy of transfected fluorescently labelled antibodies to a nucleocapsid
protein showed movement of nucleocapsids toward, and concentration around, the
MTOC, an effect which could be reversed with the application of nocodazole [100].
Further investigation revealed the host factor Rab11A was necessary for the transport of
nucleocapsids from the MTOC to the apical membrane [101, 102]. Rab11A is a
GTPase associated with apical recycling endosomes (ARE). Interestingly, RSV may
also use a member of the Rab11 family during the assembly and budding stages of the
RSV lifecycle (section 1.10.5.3) [103].
1.10.3 Sendai virus Similarly to RSV, it was found the cytoskeleton has an important role in regulation of
viral transcription [104, 105]. However, while actin is the regulator of RSV
transcription, tubulin is a regulator of Sendai virus transcription. An in vitro binding
analysis showed that the Sendai virus matrix protein interacts directly with monomeric
tubulin and microtubules. It was further shown that tubulin dissociates the matrix
protein (a negative regulator of transcription) from the nucleocapsid allowing
transcription to take place [104].
1.10.4 Vesicular stomatitis virus VSV, a negative strand RNA virus, also exhibits parallels with RSV in its interactions
with the cytoskeleton. The internalisation of VSV is a clathrin mediated process
involving the actin cytoskeleton [106]. Actin polymerisation is not normally needed in
clathrin mediated endocytosis though it is known to happen in circumstances involving
the internalisation of large pathogens such as L. monocytogenes [107]. Fluorescent
microscopy was used to confirm that actin and actin associated proteins Arp3 and
15
cortactin were recruited to the site of VSV internalisation [106]. It was also shown that
drug induced inhibition of actin polymerisation using cytochalasin D and latrunculin B
stalled the internalisation of VSV [106]. It could be that RSV is similarly dependent on
the actin cytoskeleton for internalisation.
1.10.5 RSV There are numerous studies that show interactions between RSV and the cytoskeleton.
Aspects of this process which have been examined include the role of RhoA in RSV
pathogenesis, the role of actin in RSV transcription, cytoskeleton facilitated transport in
RSV pathogenesis, the use of cytoskeleton inhibitors in studying the RSV lifecycle and
the role of the cytoskeleton in RSV assembly.
1.10.5.1
Role of RhoA in RSV pathogenesis In a study using microarrays to examine host gene expression in cells infected with
RSV, it was found that five genes associated with organisation of the cytoskeleton were
upregulated, in addition to 80 other genes related to functions such as immunity, cellular
proliferation and protein metabolism [108]. One of the most strongly up-regulated of
the cytoskeleton associated genes was ARHGEF2 (GEF-H1). GEF-H1is a microtubule
regulated activator of RhoA [109]. RhoA, a signalling GTPase involved in several
cellular processes including organisation of the actin cytoskeleton [110], had already
been implicated in the RSV lifecycle [111]. RSV F protein had been shown to interact
directly with RhoA and the overexpression of RhoA correlated with higher syncytia
formation in HEp-2 cells [112]. A follow up study revealed that greater amounts of
RhoA were present in RSV infected cells compared to unifected cells and that chemical
inhibition of RhoA using Clostridium botulinum C3 exotoxin prevented the formation
of RSV induced actin stress fibers [111]. It was later shown that C3 treatment shifted
the morphogenesis of RSV virions from spherical to filamentous, implicating RhoA
signaling in the assembly and/or budding processes [113]. It is not known how RSV
up-regulates the expression of RhoA or the significance of the F protein interaction with
RhoA. Regardless, the role of RhoA in RSV infection is dispensable in vitro, with
RhoA inhibited cells producing similar virus titers and similar viral protein expression
than in non-inhibited cells [113].
16
1.10.5.2
Role of actin in viral transcription The actin cytoskeleton has been shown to be an important regulator of RSV
transcription. First, antibodies to actin were shown to inhibit viral transcription in vitro
[114] and second the addition of purified actin was found to greatly increase
transcriptional activity of RSV in a cell free system [105]. The depolymerisation of the
actin cytoskeleton had little effect on viral protein production despite greatly reducing
the production of infectious virus particles and it was therefore concluded that either
monomeric or filamentous actin can activate viral transcription while filamentous actin
was necessary for the assembly and/or budding of RSV [105]. The domains of actin
necessary for activating transcription were determined using actin mutants in a cell free
transcription assay. Three actin mutants with non-functional divalent-cation-binding
domains failed to stimulate transcription and were also the only mutants found not to
bind the N encapsidated RNA genome in a co-immunoprecipitation assay [115]. This
suggests that one or more of these sites are required for the interaction of actin with the
nucleocapsid. The role of actin as an RNA transcription factor is unusual because it is
distinctly unlike any of the regular roles of actin within the cell.
1.10.5.3
Cytoskeleton facilitated transport As previously mentioned, F protein utilises AREs for its targeted transport to lipid rafts
of the apical membrane [31, 103]. By definition, this involves the participation of the
cytoskeleton because vesicles travel along microtubules with the aid of motor proteins
[72]. It has been suggested that F protein is targeted to lipid rafts using the same
mechanism as lipid raft components [31], however, the determinants of incorporation
into lipid rafts are not well understood [116]. It is not known whether other RSV
components, such as individual proteins or the nucleocapsid, utilise cytoskeleton
facilitated transport, though live video microscopy showing filamentous virus budding
from the same region of cell membrane at a rate of several virions per minute is
suggestive of active transport [70]. In a study investigating the ability of 17
polypeptides of viral origin to bind the light chain of dynein, a segment of G protein
was found to bind the light chain of dynein [94], though further study is needed to
confirm this finding as there have been no studies that have clearly shown why G
protein might require active retrograde transport.
17
1.10.5.4
Effect of cytoskeleton inhibitors on RSV lifecycle The role of F-actin and microtubules on the RSV lifecycle was investigated in a study
assessing the use of a panel of cytoskeleton inhibitors applied to HEp-2 cells and
measured by fluorescent microscopy for early lifecycle events and plaque assay for later
lifecycle events [117]. Inhibitors of actin polymerisation used were cytochalasin D and
latrunculin A while the F-actin stabiliser jasplakinolide was also used. Inhibition of
microtubules was achieved with nocodazole and microtubule stabilisation was achieved
using paclitaxel [117]. The impacts of the pharmaceuticals at early stages of the RSV
lifecycle were investigated with the aid of a genetically modified RSV strain that
encodes GFP as the first gene in the genome [61]. The drugs were applied at three, six
or 12 hours pre infection or one hour post infection and remained on the cells until 14
hours post infection when fluorescent microscopy was used to calculate fluorescent
focal units per millilitre. The results showed that both nocodazole and cytochalasin D
inhibited the entry and early replication events of RSV in a time dependent manner. The
greatest decrease was seen in the 12 hour pre infection group with a 10 fold reduction in
the cytochalasin D group and a 9 fold reduction in the nocodazole group [117]. To
assess the impact of cytoskeleton inhibition at later stages of infection, inhibitors were
added at one hour post infection and samples were collected on day one, two and three.
Supernatant and cell fraction were collected separately for the purpose of investigating
viral egress and virus titre was measured by plaque assay. In a comparison of the ratio
of supernatant associated virus to cell associated virus, actin inhibitors showed a greater
proportion of virus particles were cell associated than in the microtubule inhibiter
groups. This led to the conclusion that F-actin has a greater role on viral egress while
microtubules have a greater effect on viral assembly [117]. It was also observed that
both F-actin inhibitors blocked the formation of syncytia [117]. The significance of this
study is that it shows microtubules are as important as actin in the lifecycle of RSV as
well as reinforcing the theory that actin is important in the assembly and/or budding of
RSV.
1.10.5.5
The role of the cytoskeleton in the assembly of RSV There is as yet no well-defined role of the cytoskeleton in the assembly of RSV.
However, there is circumstantial evidence that the cytoskeleton, and actin in particular,
plays a role in the assembly of RSV. In common with other members of the
Paramyxoviridae family such as mumps, measles and Sendai virus, purified virions of
18
RSV have been shown to contain actin as an internal component [118-121]. This shows
that a component within the virion engages actin at the time of assembly and budding.
Whilst the mechanism of this is unknown, it may be conserved within the
Paramyxoviridae family. In the case of RSV, a possible explanation is the role of actin
as a transcription factor, binding directly to the N encapsidated genome; however this
explanation cannot be extended to the other viruses which include actin as an internal
component. Also, in light of the effect actin has on RSV morphology (section 1.10.5.1),
formation of syncytia (sections 1.10.5.1 and 1.10.5.4) and the release of virus particles
(1.10.5.4), it seems likely that the inclusion of actin in RSV virions is a result of active
participation in the assembly and/or budding of RSV.
1.11 Conclusion RSV is a virus of significant medical importance with limited treatment options. M
protein associates with all the components necessary for assembly including the
nucleocapsid, envelope glycoproteins and host cell membranes. As with other viruses,
RSV M protein is the common factor that brings these components together during
assembly. The cytoskeleton has been shown to be of great importance for many
viruses, often at multiple steps in the lifecycle. In RSV, disruption of the cytoskeleton
has been shown to significantly impair the normal functioning of RSV including the
processes of attachment and entry, transcription, assembly and budding. The next step
in elucidating the role of the cytoskeleton in these processes is determining what
protein/protein interactions are taking place. Given the known importance of M in
assembly and the evidence linking actin to assembly, it is logical to start with these two
proteins when investigating the role of the cytoskeleton in assembly. A better
understanding of the assembly process may provide targets for the development of antivirals, or aid in the development of a safe and effective attenuated vaccine.
1.12 Hypothesis and aims 1.12.1 Hypothesis RSV M protein is recognised as being of fundamental importance in the assembly of
RSV. It acts as a bridge between the nucleocapsid and the glycoprotein studded
envelope, bringing together the structural components of the virion. It is found in
cytoplasmic inclusions, the nucleus and in the cytoplasm. Based on the current state of
19
knowledge, it is highly likely that the cytoskeleton and actin in particular is involved in
assembly. Given the role of M as a co-ordinator of assembly, it is likely that the
cytoskeleton influences assembly through an interaction with M.
The hypothesis is that RSV M protein interacts directly with the cytoskeleton to
facilitate virus assembly.
1.12.2 Aims The overall aim of this project is to characterise the role of the cytoskeleton in RSV
assembly with specific respect to M protein.
The specific aims of this project are:
Aim 1:
To determine the importance of microtubules and F-actin at individual
stages of the RSV lifecycle.
Aim 2.
To investigate the interaction of M protein with the cytoskeleton.
The identification of a direct interaction between M protein and the cytoskeleton would
considerably further our understanding of the assembly process of RSV which may
ultimately aid in the strategic development of pharmaceuticals.
20
2.
Chapter 2 Materials and Methods 2.1 Materials Item
Description
Cell culture
Vero E6
ATCC CRL-1586. African green monkey (Cercopithecus
aethiops) kidney fibroblast-like cells
Cos-7
ATCC CRL-1651. African green monkey kidney
fibroblast-like cells.
Dulbeccos modified
Sigma-Aldrich, D6429
eagles medium DMEM
Foetal bovine serum
Bovogen, Chile. SFBS-C
FBS
Trypsin EDTA
0.05 % trypsin in 0.53 mM EDTA buffer. Trypsin from
Sigma-Aldrich, T4799-5G
Methylcellulose media
82 % DMEM, 23 % HBSS, 2 % methylcellulose, 2 % FBS
and 1:1000 PSN antibiotic solution
Penicillin +
Penicillin (5 mg/ml) + streptomycin (5 mg/ml) + neomycin
streptomycin +
solution (10 mg/ml). Australian National University tissue
neomycin solution
culture facility
PSN
Alkaline phosphatase
Vector Laboratories, SK-5200
substrate kit II
Buffers
Phosphate buffered
137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 2 mM
saline solution PBS
KH2PO4, pH 7.4
Hanks balanced salt
Sigma-Aldrich, H9269
solution HBSS
Tris-acetate-EDTA
40mM Tris, 20mM acetic acid, and 1mM EDTA. Stock
TAE
solution made to 50 x
21
Antibodies
Mouse anti-RSV
As previously described [122]
matrix protein
Goat anti-mouse IgG,
Invitrogen, A11001
conjugated to Alexa
fluor 488
Mouse anti-RSV
Millipore Laboratories, MAB8599
fusion protein
Goat anti-mouse IgG
Sigma-Aldrich, 079K6034
conjugated to alkaline
phosphatase
Gel electrophoresis
DNA ladder
Bioline hyperladder 1, Bio-33025
Ethidium bromide
Stock solution 10 µg/ml
Working with bacteria
Luria broth (LB)
1 % tryptone, 0.5 % yeast extract, 1 % NaCl
LB agar
LB + 1.5 % agar
Super optimal broth
2 % casein hydrolysate, 0.5 % yeast extract, 10 mM NaCl,
(SOB) without Mg
2.5 mM KCl
Super optimal broth
0.5 % yeast extract, 2 % tryptone, 10 mM NaCl, 2.5 mM
with catabolite
KCl, 10 mM MgSO4, 20 mM glucose
repression (SOC)
ElectroMAX
Invitrogen 18290-015. Electrocompetent Escherichia coli
DH10BTM
Kanamycin
Sigma-Aldrich, B5264. 50 mg/ml
Other
Nocodazole
Sapphire Bioscience, 520-1800. Reconstituted in DMSO
(10 mg/ml)
Cytochalasin D
Sapphire Biosciences, 365-10054. Reconstituted in DMSO
(2 mg/ml)
22
GFP-M plasmid DNA
Bacteria containing the plasmid stored at -80°. As
previously describe [122]
Prolong Gold antifade
Invitrogen, P36931
reagent with DAPI
Lipofectamine 2000
Invitrogen, 11668-019
Acti-stain 555
Cytoskeleton Incorporated, PHDH1
Fluorescent Phalloidin
Mycoplasma PCR
Mango Taq
Bioline, BIO-21083. Kit includes 5 x reaction buffer as
well as 50 mM MgCl2 solution.
Deoxyribosenucleoside
Bioline, BIO-39028.
triphosphate (dNTP)
mix
Myco F1 primer
From Geneworks, catalogue code 851677. Forward primer
for primary PCR of mycoplasma test.
5’ – ACACCAJGGGAGCTGGTAAT – 3’
Myco R1 primer
From Geneworks, catalogue code 851678. Reverse primer
for primary PCR of mycoplasma test.
5’ – GTTCATCGACTTTCAGACCCAAGG – 3’
Myco F2 primer
From Geneworks, catalogue code 851679. Forward primer
for secondary PCR of mycoplasma test.
5’ – GTTCTTTGAAAACTGAAT – 3’
Myco R2 primer
From Geneworks, catalogue code 851680. Reverse primer
for secondary PCR of mycoplasma test.
5’ – GCATCCACCAAAAACTCT – 3’
23
2.2 Methods 2.2.1 Mammalian cell culture Vero E6 and Cos-7 cells were grown in Corning T25, T75 and T150 flasks with
ventilated caps at 37° and 5 % CO2. Growth medium used was DMEM with 5 % FBS.
Cells were sub-cultured upon reaching 90 – 100 % confluency approximately every 4
days. To harvest, old media was discarded, cells were washed with phosphate buffered
solution (PBS), detached with trypsin EDTA and seeded into a new flask with
prewarmed media at a ratio of typically 1:5. Cells were passaged roughly 25 times
before thawing earlier passage cells. Long term storage of cells was in cryovials in
liquid nitrogen. To freeze, cells were centrifuged and roughly 5 x 106 cells per ml were
resuspended in DMEM + 5 % FBS + 5 % DMSO and placed in -80° freezer overnight
before transferring to liquid nitrogen.
2.2.1.1 Mycoplasma testing Cell lines were tested for mycoplasma contamination using a PCR detection method.
Cells were grown in a T25 flask in antibiotic free media, detached with 400 µl trypsin
then 2 ml warm DMEM as previously described. A 250 µl aliquot was centrifuged at
10000x g for 10 minutes at 4° then cells were washed twice with 1 ml of PBS with same
centrifuge settings as before. Pellet was resuspended in 240 µl of sterile nanopure H2O
containing proteinase K 50 µg/ml. Sample was vortexed, incubated at 50° for one hour
then boiled at 100° for 10 minutes. Sample was spun down at maximum speed at room
temperature and used for PCR. Conditions for the PCR are given in the table below.
24
Table 2.2. PCR conditions for mycoplasma testing.
PCR reagents
Sterile nanopure H2O
5 x mango buffer
Quantities
Final concentrations
10.1 µl
4 µl
50 mM MgCl2
0.6 µl
1.5 mM
2 mM dNTPs
2 µl
5 x 10-2 mM
5 pmol forward primer
1 µl
5 x 10-3 mM
1 µl
5 x 10-3 mM
(Myco F1)
5 pmol reverse primer
(Myco F2)
Mango taq polymerase
0.3 µl
Test sample
1 µl
Total
20 µl
PCR settings
94°
3 minutes
94°
30 seconds
54°
2 minutes
72°
1 minute
72°
5 minutes
4°
Hold
30 cycles
15 µl of PCR product was electrophoresed (refer to section 2.2.8) with a positive result
showing a band of between 370 and 691 base pairs. If no band was visible, a second
PCR was performed on the primary PCR product to confirm the results of the first
round of PCRt. All quantities and settings were the same as in the first PCR except for
the primers (Myco F2 and Myco R2) and the test sample. A positive result gave a
product of between 145 and 237 base pairs as determined by gel electrophoresis while
no band was considered a negative result.
2.2.2 Transfections Transfections were performed using LipofectamineTM 2000 (Invitrogen) reagent
according to manufacturers’ instructions using the following parameters. COS-7 cells
were grown to 50 % confluency on glass coverslips. DNA was mixed with
25
LipofectamineTM 2000 at a ratio of 1 µg DNA to 3.5 µl of LipofectamineTM. The
addition of cytoskeleton inhibitors took place at 12 hours post transfection and removed
1 hour prior to fixing cells at 23 hours post infection (see section 2.2.3). Cells were
fixed using 4 % formaldehyde in PBS for 10 minutes at room temperature, rinsed 3
times and mounted onto slides using prolong Gold antifade reagent with DAPI
(Invitrogen).
2.2.3 Application of cytoskeleton inhibitors Cytochalasin D was diluted in DMEM + 5 % FBS to a final concentration of 2 µg/ml
and nocodazole was diluted into DMEM + 5 % FBS to a final concentration of 2.5
µg/ml. Negative controls received the solvent for both inhibitors; DMSO, diluted in
DMEM + 5 % FBS at a ratio of 1:1000. Inhibitor solutions were applied to cells (either
COS-7 or Vero E6) after rinsing with pre-warmed (37° water bath) PBS. Inhibitor
solutions were removed and cells rinsed with PBS followed by addition of pre warmed
DMEM + 5 % FBS.
2.2.4 Propagation of RSV Vero E6 cells were grown to ~80 % confluency in a T150 flask. All incubations were
done at 37°, 5 % CO2 unless otherwise stated. Cells were rinsed with 10 ml of HBSS
and infected at a multiplicity of infection (MOI) of 0.5 in a total volume of 6 ml plain
DMEM. Flask was incubated for 2 hours for viral absorption. 8 ml of DMEM + 5 %
FBS was added and cells were incubated for 2 to 3 days until syncytia covered 25 to 50
% of the flask. At time of harvest, all but 2 ml of media was removed, cells were
scraped off and collected in a pre-chilled 50 ml tube. Cells were chilled on ice for 10
minutes prior to sonication 5 times at 90 % for 5 seconds each with a 2 minute wait on
ice between sonications. The sonicator used was the Vibra-Cell, model code VCX
130PB, by Sonics and Materials Incorporated. Cell debris was removed by
centrifugation at 2000 x g for 7 minutes at 4°. Supernatant was stored at -80°.
Measurement of virus titre is described in section 2.2.5.
2.2.5 Immuno plaque assay Vero E6 cells were seeded into a 24 well plate to obtain 80 – 90 percent confluency.
Stepwise 10 fold dilutions of the virus sample in DMEM were prepared. Cells were
infected in quadruplicate with 200 µl of each virus dilution. After a 1 hour incubation at
26
37° C in 5 % CO2 for viral attachment, cells were overlaid with 1 ml of pre-warmed
methylcellulose media. Cells were then incubated at 5 % C02 and 37°C for 6 days.
Media was removed using an aspirator and cells were fixed using ice cold
acetone/methanol 60:40 for ten minutes at room temperature then inverted until
completely dry. Wells were blocked with 5 % skim milk powder in PBS for 30 minutes
at room temperature with rocking then treated with primary antibody (mouse anti-RSV
F protein) diluted in blocking solution (1:1000) for 2 hours at 37°. Cells were rinsed
once and washed twice for five minutes with rocking with 0.5 % tween20 in PBS. Cells
were then incubated with secondary antibody (goat anti-mouse conjugated to alkaline
phosphatase) diluted in blocking solution (1:1000) for 1 hour at 37°. Cells were washed
as before. Cells were then treated with alkaline phosphatase substrate kit II as per
manufacturers’ protocol and plaques counted under a microscope. Virus titre in plaque
forming units per ml (PFU/ml) was calculated by multiplying the average number of
plaques per well by the dilution factor and then adjusting to take into account the initial
volume of virus added to the well.
2.2.6 Plasmid DNA extraction and purification Plasmid DNA was extracted and purified using the PureYield Plasmid Miniprep System
(Promega Corporation, A1222) according to manufacturer’s instructions. All
centrifugation steps were carried out using the Spectrafuge 24D by Labnet International
at the maximum speed of 16300 x g. Bacterial suspensions were grown in LB
containing kanamycin (50 µg/ml) overnight at 37° with shaking. 3 ml of bacterial
suspension was spun down, supernatant removed and pellet resuspended in 600 µl of
sterile nanopure H2O. 100 µl of cell lysis buffer was added and tube was mixed by
inverting 6 times. 350 µl of neutralisation solution was added and mixed thoroughly by
inverting then spun for 3 minutes. Supernatant was transferred to a PureYield
Minicolumn, placed in a collection tube and spun for 30 seconds. The flow through was
discarded and 200 µl of endotoxin removal wash buffer was centrifuged for 30 seconds
followed by column wash solution for 30 seconds. The mincolumn was transferred to a
sterile 1.5 ml tube, 30 µl of elution buffer was added directly to the minicolumn matrix
and incubated for 1 minute at room temperature. Following centrifugation for 30
seconds the eluted DNA was stored at -20°.
27
2.2.7 DNA quantitation Plasmid DNA quantitation was carried out using the Nanodrop 1000 spectrophotometer.
2 µl of sample was loaded, measured twice then repeated with a second sample. The
mean of the 4 readings was recorded as the concentration. DNA concentration was
calculated on the basis that an optical density (OD) of 1 equals a DNA concentration of
50 µg/ml when measured at 260 nm and thus the formula:
Sample µg/ml = measured A260 x 50 µg/ml
DNA was considered pure when the 260:280 ratio was roughly 1.8.
2.2.8 Gel electrophoresis All agarose gels used were 1 % agarose in TAE with ethidium bromide (4 x 10-4 µg/ml).
Gels were prepared by dissolving 0.5 g powdered agarose in 50 ml TAE by boiling in a
microwave. 2 µl of the Bioline Hyperladder 1 was mixed with 8 µl of TAE while 2 µl
of sample DNA were mixed with 2 µl loading dye and 6 µl of TAE. Gels were run at
80 Volts for 60 minutes then visualised under UV light using a Transilluminator
Universal Hood II (BioRad).
2.2.9 Electroporation Transformation of plasmid DNA into electrocompetent E. coli cells was done using the
Bio Rad Gene Pulser II Electroporation System. Cells were thawed on ice and 40 µl
was transferred to a 1.5 ml tube with 2 µl of DNA, gently mixed and allowed to stand
for 1 minute. Cells were then electroporated at 25 µF capacitance, 200 Ω resistance and
2.5 kV. 500 µl of SOC media was added to the cells then transferred to a 15 ml culture
tube. Cells were incubated at 37° with shaking for 1 hour to allow expression of
antibiotic resistance. Cells were plated onto pre-warmed agar plates containing 0.1 %
kanomycin and incubated overnight at 37° to obtain single colonies. A single colony
was used to inoculate another 0.1 % kanomycin plate which after overnight incubation
at 37° was scraped off, mixed with 30 % glycerol and stored at -80° in cryovials.
2.2.10 Preparation electrocompetent E. coli Invitrogen DH10B cells were spread onto a LB plate and incubated overnight at 37°. A
single colony was used to inoculate 5 ml of SOB –Mg starter culture and incubated
overnight at 37°. 4 ml of starter culture was used to inoculate 200 ml of SOB and
grown until OD600 was between 0.8- 1 (2 to 3 hours). Bacteria were transferred to 50 ml
28
tubes, incubated on ice for 15 min then spun down at 2500 x g for 10 minutes at 4°.
Supernatant was discarded and pellets resuspended in 100 ml of chilled 10 % glycerol.
Bacteria were spun down as before, pellet resuspended in 200 ml chilled 10 % glycerol
and spun down as before. The majority of supernatant was discarded leaving behind
approximately 2 ml. Cells were resuspended in the remaining supernatant and
distributed into 1.5 ml tubes in 50 µl aliquots. Cells were stored at -80°.
2.2.11 Confocal laser scanning microscopy Cells were imaged using a 60 x oil immersion lens of a Nikon C1 confocal laser
scanning microscope (CLSM). Cells grown on 13 mm diameter coverslips were fixed
with 4 % formaldehyde in PBS for 10 minutes at room temperature, washed three times
with PBS, mounted onto slides using ~6 µl of Prolong Gold antifade reagent with
DAPI, then left to cure overnight as per the manufacturers’ recommendation. When
recording images of cells, scan speed was set to 1, ‘line’ was turned off, thickness of
optical slice was 0.4 microns and averaging was turned on to 8 x. The ratio (Fn/c) of
nuclear (Fn) to cytosolic (Fc) fluorescence while adjusting for noise by factoring in
background (Fb) was determined in the following way:
Fn/c = (Fn – Fb) / (Fc – Fb)
2.2.12 Image analysis The public domain program ImageJ [123] was used for the quantitative analysis of cell
images. To analyse the sub-cellular localisation of the source of fluorescence, a small
area of the cytosol, the nucleus and the background were sampled, giving a numeric
value for each that is proportional to the signal intensity in the area sampled. For each
cell, the surface area of the sample was the same for cytosol, nucleus and background.
Results were imported into Microsoft Excel.
2.2.13 Statistical analysis Most statistical analysis of data imported from ImageJ was performed in Microsoft
Excel 2010 with the exception of the 2 tailed, equal variance T-Tests which were
performed using Graphpad Prism version 5.03.
29
The standard error of the mean (SEM) was determined for the mean Fn/c value of each
group according to the formula:
SEM = Standard deviation / square root of number of cells analysed.
30
3.
Chapter 3 The effect of cytoskeleton inhibitors on RSV replication kinetics 3.1 Introduction The importance of the cytoskeleton at different stages of the RSV lifecycle was
investigated by disrupting specific host cell cytoskeleton networks at times that
correspond to different stages of the lifecycle and measuring the effect on replication as
determined by immunostaining plaque assay (figure 1). This experiment closely
resembles a study by Kallewaard, Bowen and Crowe (2005) [117], which also used
cytoskeleton inhibitors to determine the lifecycle stages in which the cytoskeleton is
most important (section 1.10.5.4). The main findings from the previous study were that
the cytoskeleton is important during the entire infectious cycle and that actin plays a
dominant role in release while microtubules play a dominant role in assembly [117].
This experiment seeks to add value to earlier findings through variations in
experimental design. The Kallewaard study applied inhibitors at the beginning of the
viral incubation and left them on for the duration. In this experiment, inhibitors are
used in a more targeted way at discreet intervals (figure 3.1) in an effort to isolate the
effect of the cytoskeleton at times corresponding to the lifecycle stages of attachment
and entry (-4-0), transcription and translation (1-5), assembly (10-14) and peak release
(20-24) [1].
Figure 3.1. Timeline of 30 hour RSV replication kinetics experiment. Timeline shows the times that
inhibitors or solvent alone were applied then removed from cells. Overnight subconfluent cultures of
VeroE6 cells were infected with RSV at MOI=3 and treated with Cytochalasin D or Nocodazole or
vehicle for 4h immediately before, or after infection at the indicated times. Cells were collected at 30h
p.i., lysates prepared as described in section 3.4 and used to estimate infectious virus titre using
immunostaining plaque assay (section 2.2.5).
31
3.2 Use of destabilising drugs to study cytoskeleton interactions A useful tool for the study of viral interaction with the cytoskeleton is the use of
pharmacological agents that reversibly block cytoskeleton polymerisation. Two often
used drugs are nocodazole which inhibits microtubule polymerisation by binding βtubulin and the fungal toxin cytochalasin D which causes F-actin depolymerisation by
binding the barbed end of actin filaments. Treating virus infected cells with these
depolymerising drugs will usually reduce virus replication and changes in subcellular
localisation of viral particles can sometimes be observed [80, 81]. There are some
limitations of these pharmacological agents. Although these drugs are highly specific
for a certain type of cytoskeletal filament, the inhibition of one type of filament will
influence many different cellular processes which mean that any observed changes in
the virus lifecycle are not necessarily the direct result of inhibition of that particular
filament. Also, both drugs are cytotoxic and will trigger apoptosis in a time and dose
dependent manner [124, 125]. Even so, these drugs have been successfully used to
determine the role of the cytoskeleton in entry, replication, assembly and budding of
Sendai virus, VSV, Influenza virus and Measles virus, among others [100, 104, 106,
126].
3.3 Optimisation of inhibitors For experiments using the inhibitors cytochalasin D and nocodazole, it is important to
disrupt the cytoskeleton whilst changing as little else in the cell as possible, hence the
optimisation of inhibitor concentrations. Vero E6 cells were treated with various
concentrations of inhibitor and observations were recorded at certain times with the aid
of a conventional light microscope (figure 3.4). The aim was to find concentrations that
provide good balance between effectiveness and cytotoxicity and to assess the ability of
cells to recover after the removal of inhibitor after 1 hour and 1 day. Effectiveness of
Cytochalasin D could be determined via the major rounding of cells, however,
nocodazole does not cause a major change in cell morphology and effectiveness could
only be determined through longer term observation of cell cycle arrest (cells fail to
replicate). It was already known from previous observations that concentrations of 2
µg/ml cytochalasin D and 2.5 µg/ml nocodazole were effective inhibitors of the
cytoskeleton so these were chosen as the highest concentrations. Based on the results in
table 3.1, consideration of commonly used concentrations [117, 126] and consideration
32
of the typical length of time inhibitors would be applied to cells, concentrations of 2
µg/ml cytochalasin D and 2.5 µg/ml nocodazole were chosen for all experiments using
these inhibitors. The depolymerisation of the actin cytoskeleton was confirmed using
Acti-stainTM 555 fluorescent phalloidin to visualise actin stress fibres in cytochalasin D
(2 µg/ml) treated Vero E6 cells compared to untreated cells (figure 3.2).
Table 3.1. Optimisation of cytoskeleton inhibitor working concentrations.
Cytochalasin D
Duplicate 1
Nocodazole
Duplicate 2
Duplicate 1
Duplicate 2
Hours PI
16
17
48
16
17
48
16
17
48
16
17
48
2 µg/ml
+++
+
+
+++
+++
X
+
+
+
+
+
X
2.5 µg/ml
1 µg/ml
++
+
+
++
++
X
+
+
+
+
+
X
1.25 µg/ml
0.5 µg/ml
+
+
+
+
+
+
+
+
+
+
+
X
0.62 µg/ml
0.25 µg/ml
+
+
+
+
+
+
+
+
+
+
+
+
0.31 µg/ml
0 µg/ml
+
+
+
+
+
+
+
+
+
+
+
+
0 µg/ml
Vero E6 cells were treated in duplicate with varying concentrations of cytochalasin D and nocodazole. At
16 hours post infection, inhibitor was removed from duplicate 1, cells washed and medium added;
inhibitors were not removed from duplicate 2. Cell monolayers were observed under a tissue culture
inverted microscope for changes in cell morphology and cell death as compared to untreated controls.
Observations were made at 16 hours, 17 hours and 48 hours with + denoting little or no change, ++
denoting moderate change in cell morphology, +++ denoting major change in cell morphology and X
denoting excessive cell death.
Untreated
Cytochalasin D
Figure 3.2. The effect of cytochalasin D on the actin cytoskeleton. Vero E6 cells were treated with
cytochalasin D (2 µg/ml) or vehicle for 5 hours prior to fixing with 4 % formaldehyde in PBS followed
by treatment with Acti-stainTM 555 phalloidin (red) and DAPI for the nuclei (blue). Cells were imaged
with CLSM.
33
3.4 Method Cytoskeleton inhibitors were applied to RSV infected Vero E6 cells at 4 specific
standalone intervals. The experiment was carried out in duplicate in 6 well plates. For
a description of the application and removal of inhibitors see section 2.2.3. The
cytoskeleton inhibitors nocodazole (2.5 µl/ml) or cytochalasin D (2 µl/ml) were used in
the experimental groups and dimethyl sulfoxide (DMSO, 1:1000) was used in the
control group. DMSO is the solvent for both cytoskeleton inhibitors and the amount
delivered is equivalent to the higher amount present in the cytoskeleton inhibitors. The
treatment times were the 4 hours prior to infection to time of infection, 1 hour post
infection (HPI) to 5 HPI, 10 to 14 HPI and 20 to 24 HPI and samples were collected and
frozen at 30 HPI. Cell associated virus and free floating virus in the supernatant was
collected separately. Supernatant was transferred to a test tube and stored at -80° until
virus titration by immunostaining plaque assay (section 2.2.5). Cell associated virus
required further steps to release the virus from the cell monolayer. At the time of
collection, an equal quantity of DMEM + 5 % FBS to that of the removed supernatant
was added, the cells were frozen at -80° then thawed. The flat end of a 1 ml pipette tip
was used to thoroughly scrape the cells from the bottom of the wells. Sample was
transferred to a falcon tube and vortexed for 10 seconds then used for plaque assay.
3.5 Results Mean total virus titre for untreated, cytochalasin D treated and nocodazole treated cells
are displayed in log10 in figure 3.3A. The four treatment times are found on the
horizontal axis of the graph below. Mean total virus titre was calculated according to
the formula below:
Mean total virus titre in log 10 = log10 ((C1 + S1 + C2 + S2) / 2)
Where:
C1 = cell associated virus titre of duplicate 1
S1 = supernatant associated virus titre of duplicate 1
C2 = cell associated virus titre of duplicate 2
S2 = supernatant associated virus titre of duplicate 2
Error bars are the range between duplicate 1 and duplicate 2, meaning the end of each
error bar represents total virus titre of each duplicate.
Figure 3.3B displays the percentage of total virus released from cells as per the
calculation: Percentage of total virus released from cells = (S1 + S2) / (C1 + C2) X 100
34
7.0
A
6.0
5.0
Mean total virus titre
(log 10)
Untreated
4.0
Cytochalasin D
3.0
Nocodazole
2.0
1.0
0.0
15
B
12
Percentage of 9
total virus released from cells
6
Untreated
Cytochalasin D
Nocodazole
3
0
‐4 ‐ 0
1 ‐ 5
10 ‐ 14
20 ‐ 24
Treatment times
Figure 3.3. The effect of cytochalasin D and nocodazole treatment on RSV replication. VeroE6
cells were infected with RSV at MOI 3 and treated with cytochalasin D or nocodazole or vehicle.
(A) The virus titres (log10 PFU / ml) of untreated, cytochalasin D treated and nocodazole treated Vero
E6 cells are shown. Virus titres were calculated by addition of cell associated virus titre and supernatant
associated virus titre, then taking the mean of the duplicates and displaying the range as error bars.
(B) The percentage of total virus released from cells is calculated dividing supernatant associated virus
titre by cell associated virus titre and multiplying by 100.
35
3.6 Discussion 3.6.1 Total virus titre These results must be considered with the understanding that because the experiment
was carried out in duplicate, the sample size is not large enough for tests of statistical
significance. However, given the lack of overlap between untreated groups and
nocodazole groups, it seems likely that depolymerising microtubules had an adverse
effect on viral replication. The decreased replication in all nocodazole time-points
would suggest that the microtubule network is equally important at all stages of the
RSV lifecycle. This is supportive of the Kallewaard study in which both actin and
microtubule inhibitors decreased viral replication. In contrast though, actin
depolymerisation did not decrease viral replication or may even have increased viral
replication.
3.6.2 Percentage of virus released from cells The increased proportion of supernatant associated virus to cell associated virus in some
nocodazole groups may indicate that microtubule depolymerisation either increases the
rate of virus release or inhibits the rate of attachment and entry. The latter would be
consistent with the findings of the Kallewaard study. The previous finding by
Kallewaard when comparing supernatant associated virus to cell associated virus was
that actin was important for release. We found little difference between cytochalasin D
groups and untreated groups when comparing viral release however that would be
expected based on the lack of impact that cytochalasin D had on total virus titre.
3.6.3 Summary Why nocodazole but not cytochalasin D inhibited RSV replication is unclear, it could be
due to the different pharmacokinetics of the drugs; nocodazole is effective over a wider
range of concentrations, is slower acting and takes longer to wear off than cytochalasin
D. From the lack of any change in the cytochalasin D treated groups, it can only be
concluded that like the host cell which can resume normal functioning after the removal
of cytochalasin D, so too can RSV resume normal functioning. Targeting individual
stages of the viral lifecycle in this type of experiment may be too difficult in practice.
36
4.
Chapter 4 Effect of cytoskeleton inhibitors on subcellular localisation of matrix protein 4.1 Introduction An important step in characterising the role of the cytoskeleton in RSV assembly is the
identification of direct interactions between specific viral proteins and specific
cytoskeleton components. The cytoskeleton is implicated in the assembly of RSV as
discussed in section 1.10.5.5. These reasons include the presence of actin within
purified RSV virions [118] and the effects of inhibiting actin such as altered viral
morphology [113] and decreased release of progeny virus [117]. M protein is a chief
mediator of assembly. Therefore, the hypothesis is that M interacts directly with the
cytoskeleton to facilitate viral assembly. This experiment takes advantage of the well
characterised nucleocytoplasmic trafficking of M protein. M protein localises to the
nucleus early in infection and over the course of infection becomes gradually more
cytoplasmic (section 1.6.4.1). Should inhibition of the cytoskeleton disrupt the
nucleocytoplasmic trafficking of M protein, it could be assumed that either M protein
utilises the cytoskeleton for intracellular transport or that M protein has been denied a
source of attachment. The general structure of the experiment is the treatment of cells
with the cytoskeleton inhibitors cytochalasin D (2 µg/ml) and nocodazole (2.5 µg/ml) or
vehicle in concurrence with the expression of M protein. Changes in the
nucleocytoplasmic trafficking of M protein could be revealed by comparisons of the
ratio of nuclear M protein to cytosolic M protein (Fn/c). This general method was
followed twice (figure 4.1); once using indirect immunofluorescence to visualise M
protein in cells infected with RSV A2 and once using GFP-M protein in transfected
cells. The benefit of conducting the experiment using both infection and transfection
methods is that it can be determined what influence, if any, other viral components have
in the subcellular localisation of M protein. The infection experiment was stopped at 6
HPI and 10 HPI. Change in Fn/c at 6 hours may indicate an inhibition in retrograde
transport while change in Fn/c at 10 hours may indicate an inhibition of anterograde
transport.
37
Grow cells on microscope coverslips
Infect cells with RSV. Add
Transfect cells with GFP-M. Add
cytoskeleton inhibitors. Allow 23
cytoskeleton inhibitors or vehicle.
Fix 6 and 10 hours post infection.
hours for gene expression. Fix
cells.
Secondary immunofluorescence
treatment with mouse anti-M and
goat anti-mouse Alexa fluor 488.
Mount coverslips and record images of cells using CLSM.
Assess treatment groups for change in subcellular localisation of M protein.
Figure 7.1. Overview of the protocol for investigating the effect of cytoskeleton inhibitors on
subcellular localisation of M protein. Overnight subconfluent monolayers of VeroE6 cells were either
infected with RSV or transfected to express GFP-M. Infected cells were fixed at various times p.i. and
immunofluorescence assay performed using monoclonal antibody to M protein (section 4.2.1). Transfected
cells were fixed at 23 hours post transfection (section 2.2.2). Coverslips mounted with DAPI containing
antifade were analysed by quantitative confocal microscopy (section 2.2.11).
4.2 Method 4.2.1 Fn/c of M protein in infected Vero E6 cells Subconfluent Vero E6 cells were infected at MOI of 3 with RSV A2 and treated with
inhibitors at 1 hour p.i. followed by removal of inhibitors 1 hour prior to fixing (section
2.2.3). Cells were fixed with 4 % formaldehyde in PBS for 10 minutes at room
temperature (RT) at 6 hours and 10 hours p.i. (figure 4.1). Cells were then
permeabilised using 0.2 % Triton X-100 in PBS before 1 hour RT incubation with
mouse anti-M IgG antibody and 3 washes with PBS. Goat anti-mouse Alexa fluor 488
was incubated as before with 3 washes. Slides were mounted to coverslips using
Prolong gold antifade reagent and imaged with the CLSM (section 2.2.11). Image
analysis and statistical analysis of cells is described in sections 2.2.12 and 2.2.13.
38
4.2.2 Fn/c of GFP­M in transfected cells Due to problems with transfection efficiency, the cell type for this experiment was
changed to COS-7. A chemical transfection method using LipofectamineTM 2000 was
used to introduce the plasmid DNA containing the GFP-M gene. Details of the
transfection method including application of inhibitors at 12 hours post transfection and
are found in section 2.2.2. The imaging, processing and statistical analyses of cells can
be found in sections 2.2.11, 2.2.12 and 2.2.13 respectively.
4.3 Results 4.3.1 Cytoskeleton inhibition alters sub­cellular localisation of M protein in infected cells Figure 4.2 shows images of RSV infected cells treated with secondary
immunofluorescence for M protein as detailed in section 4.2.1. The images on the left
show cells from the 6 hour virus incubation and the images on the right show cells from
the 10 hour virus incubation. The top row cells were treated with vehicle only (DMSO),
the middle row with cytochalasin D and the bottom row with nocodazole.
Figure 5.3 pools the results of the quantification analysis of the subcellular localisation
of M protein. Treated cells are compared to untreated cells of the basis of Fn/c, the
proportion of nuclear M to cytosolic M, meaning the greater the value, the greater the
proportion of M found in the nucleus.
The Fn/c of M protein for both inhibitors at 6 hours post infection was not significantly
different to that of the untreated group. The Fn/c of M protein in the cytochalasin D
treated group was significantly higher than the untreated group at 10 hours post
infection (P = 0.023). The Fn/c of M protein in the nocodazole treated group was
significantly lower than the untreated group at 10 hours post infection (P = 0.021).
39
Untreated
Cytochalasin D
Nocodazole
6 hours post infection
10 hours post infection
Figure 4.2. Subcellular localisation of M protein in RSV infected cells treated with cytochalasin D,
nocodazole or vehicle at 6 and 10 hours post infection. CLSM images of Vero E6 cells probed with
mouse anti-M and goat anti-mouse Alexa fluor 488 conjugate. Inhibitors or vehicle were applied one
hour post infection and removed one hour prior to fixation with 4 % formaldehyde in PBS. Red lines
show scale of 10 micrometres.
40
3.5
3.0
**
2.5
*
2.0
Untreated
Mean Fn/c
Cytochalasin D
1.5
Nocodazole
1.0
0.5
0.0
6 Hours post infection
10 Hours post infection
Figure 4.3. Proportion of nuclear M in relation to cytosolic M. Infected Vero E6 cells were infected
with RSV A2 and treated with cytochalasin D (2 µg/ml), nocodazole (2.5 µg/ml) or vehicle one hour post
infection and removed one hour prior to fixing. Nuclear to cytoplasmic ratio (Fn/c) was determined from
CLSM images such as those in figure 4.2. * = P value of 0.023, ** = P value of 0.021 (42<n<50). Error
bars are standard error of the mean (SEM), calculated by dividing the standard deviation by the square
root of the sample size.
41
4.3.2 Cytoskeleton inhibition alters sub­cellular localisation of M protein in transfected cells Figure 4.4 shows images of cells expressing GFP-M at 23 hours post transfection as
described in section 4.2.2. The top image shows a cell treated with vehicle only
(DMSO), the middle image is a cell treated with cytochalasin D and the bottom image is
a cell treated with nocodazole.
Figure 4.5 is a quantitative analysis of all cells imaged from each group. Fn/c is the
proportion of GFP-M found in the nucleus compared to the cytosol. The Fn/c of GFPM was significantly lower in both the cytochalasin D and nocodazole treated groups to
that of the untreated groups (P < 0.05). A mean Fn/c below 1 indicates a greater
concentration of M in the cytosol than in the nucleus.
42
Untreated
Cytochalasin D
Nocodazole
Figure 4.4. CLSM images of GFP-M in transfected cells treated with cytochalasin D, nocodazole or
vehicle. Subconfluent COS-7 cells were transfected with GFP-M plasmid DNA using the
LipofectamineTM 2000 reagent and treated with inhibitor or vehicle 12 hours post transfection and
removed one hour prior to fixing with 4 % formaldehyde in PBS. Cells were fixed at 23 hours post
transfection. Red lines indicate a scale of 10 micrometres.
43
*
1.2
*
1
0.8
Mean Fn/c of GFP‐M
0.6
0.4
0.2
0
Untreated
Cytochalasin D
Nocodazole
Figure 4.5. Proportion of nuclear GFP-M in relation to cytosolic GFP-M. Transfected COS-7 cells
such as those in figure 4.4 were treated with cyotochalasin D (2 µg/ml), nocodazole (2.5 µg/ml) or
vehicle, imaged by CLSM and analysed for the ratio of nuclear GFP-M to cytosolic GFP-M (Fn/c). P <
0.05 (7<n<17). Error bars are standard error of the mean (SEM), calculated by dividing the standard
deviation by the square root of the sample size.
44
4.4 Discussion 4.4.1 M protein in infected cells In the context of an in vitro infection system, inhibition of both actin and microtubules
affect the subcellular localisation of M protein but not in the early stage of infection.
Inhibition of actin filaments and microtubules had opposite effects. The inhibition of
actin reduced the transport of M out of the nucleus while inhibition of microtubules
increased the proportion of M protein transported out of the nucleus. From this, it might
be suggested that actin is involved in the anterograde transport of M and microtubules
are involved in the retrograde transport of M. However, if this were true, it would be
reflected in the results of the 6 hour infection. The differences in Fn/c at 10 HPI is more
likely to do with factors associated with the later stage of infection. A possible
confounding factor in this type of analysis is the effect the inhibitors have on cell shape
and size. Increased nuclear M protein in the cytochalasin D treated group could be a
product of cells shrinking thereby forcing more M protein into the nucleus. Conversely,
many nocodazole treated cells seemed enlarged, which might account for a more diffuse
distribution of M. Again though, this was not reflected in the results of the 6 hour
infection groups.
4.4.2 GFP­M in transfected cells The statistically significant decrease in nuclear GFP-M in the transfection experiment
shows that the relationship between M protein and the cytoskeleton is not necessarily
mediated by any other RSV components. However, the actin inhibited group showed an
opposite effect (cytosolic retention) than the 10 HPI infection actin inhibited group
(nuclear retention). This could be an effect of missing RSV components in the
transfection group but it is more likely a result of increased total GFP-M in the
transfection group. A comparatively low mean Fn/c value of 0.96 in the untreated
transfection group compared to the untreated 10 HPI group of 1.60 indicates that the
total amount of GFP-M would be more similar to conditions at 20 HPI than 10 HPI.
This difference in total M protein makes any comparisons between the two groups
largely irrelevant. Exactly what causes the balance of GFP-M to shift toward cytosolic
localisation in cytoskeleton inhibited cells is not clear. It may simply be that the
removal of a barrier to diffusion favours the accumulation of GFP-M in the cytosol. An
uncertainty in the transfection experiment is whether the addition of GFP alters the
45
interaction between M and the cytoskeleton. This could be tested by transfecting M
protein without GFP then using the same indirect immunofluorescence technique as in
the infection experiment.
4.4.3 Summary The significant finding from this experiment is that cytoskeleton associated changes in
subcellular localisation of M protein are dependent on the stage of the lifecycle. To put
the 10 hour mark into context, viral mRNA and proteins can first be detected at 4 – 6
HPI, accumulation of mRNA plateaus at 14 – 18 HPI, release of progeny virus begins
between 10 – 12 hours and peaks after 24 hours [1]. When viewed in this context,
inhibition of the cytoskeleton has no effect on the localisation of M until the time of
assembly. Deciphering the exact mechanism of the altered subcellular localisation of M
is currently not possible. The mechanism may not be simple, it may be multifactorial; a
situation of competing influences whereby all the host cell and viral components that M
protein interacts with influence the subcellular localisation of M. Whether one of these
influences is a direct interaction with the cytoskeleton has received contradictory
evidence from this experiment. One explanation is that the cytoskeleton interacts not
with M directly but with a protein that M is known to associate with such as F or M2-1.
However, localisation of GFP-M in isolation was shown to be influenced by both actin
and microtubules suggesting a direct interaction but then no direct interactions were
detected in the 6 hour infection experiment. This could all be explained by a molecular
change in M protein; such as a phosphorylation site that once phosphorylated or
dephosphorylated, causes M protein to interact directly with the cytoskeleton. The
phosphorylation of M protein as a means of regulation has been proposed previously,
along with several predicted phosphorylation sites and could also serve as the signal to
begin assembly [45].
46
5.
Chapter 5 General Discussion 5.1 Introduction RSV is a leading cause of upper and lower respiratory tract infections in neonates and
the elderly worldwide. Better pharmaceuticals than what is currently available are
needed to reduce the global burden of RSV. A better understanding of the pathogenesis
of RSV may aid in the development of pharmaceuticals. Toward this end, the role of
the cytoskeleton was investigated in the assembly of RSV. We hypothesised that due to
the central role of M protein in assembly and the implication of actin in assembly, the
cytoskeleton interacts directly with M protein to facilitate viral assembly. The
experiment using cytoskeleton inhibitors at four hour intervals to gauge the effect of the
cytoskeleton at those times showed little change between treated and untreated groups.
We therefore concluded that four hours of cytoskeleton inhibition out of thirty was too
short to see any effect on virus titre. It is likely that if virus production was slowed
during those times, then after removal of inhibitor, virus production was continued as
from before without very much disruption. The experiments gauging the effect of Factin and microtubule inhibition on sub-cellular localisation of M protein supported the
hypothesis that the cytoskeleton interacts directly with M protein to facilitate assembly.
5.2 Microtubules and F­actin interact with M protein for the assembly of RSV Several significant findings were made as a result of the M protein subcellular
localisation experiments. Firstly, that the sub-cellular localisation of transfected GFPM in isolation from other RSV components is altered by inhibition of the cytoskeleton.
This suggests a possible direct interaction between M protein and both F-actin and
microtubules. Secondly, that in vitro disruption of actin and microtubules alters the
sub-cellular localisation of M protein at 10 HPI but not at 6 HPI. This fact lead to the
conclusion that M protein does interact with both actin filaments and microtubules but
not until the time of assembly, supporting the hypothesis that the cytoskeleton interacts
with M protein to facilitate assembly. This is in accordance with the literature.
Depolymerisation of actin has been shown to have several in vitro effects; it greatly
reduces the production of infectious particles [117], it almost totally blocks the
formation of syncytia and it reduces the proportion of infectious virus particles released
47
from the cell [117]. Furthermore, actin, through the RSV induced up-regulation of
RhoA, has been shown to affect the morphology of budding virions [113]. These
findings strongly indicate that actin is involved in the assembly of RSV. Our
conclusion builds on this concept by providing the necessary direct interaction between
virus and host cell.
The microtubule network has not been strongly linked with any particular stage of the
RSV lifecycle although microtubule inhibition was found to inhibit both attachment and
entry and the assembly stages [117]. RSV F protein utilises microtubule facilitated
transport by way of the secretory pathway but there are no other known roles of
microtubules in RSV pathogenesis. The finding that microtubule inhibition alters the
sub-cellular localisation of M protein could be due to a direct interaction between
microtubules and M protein as is the case with the matrix protein of Sendai virus [104]
or it could be a bi-product of inhibiting vesicular transport along microtubules. M
protein is known to bind internal membranes such as mitochondria and vesicles [49]. It
is possible that the nocodazole induced change in sub-cellular M protein localisation is
due to blocking the transport of vesicles and therefore M protein by association.
The conclusion that the sub-cellular localisation of M protein depends on direct
interactions with the cytoskeleton suffers from the fact that no change in sub-cellular
localisation was observed in the six HPI group. This might be because the function of
M protein is changed later in infection via phosphorylation at one or more of several
suggested phosphorylation sites [45]. Phosphorylation of RSV M protein has been
widely reported as with other matrix proteins [45, 104, 127].
5.3 Model of cytoskeleton participation in the lifecycle of RSV The cytoskeleton has been shown to be actively involved in the lifecycle of RSV at all
stages of infection. Based on what is known of the interactions between the
cytoskeleton and RSV as well as a consideration of the typical roles of microtubules and
actin in other virus lifecycles, a suggested model of cytoskeleton participation in the
lifecycle of RSV is proposed (figure 5.1).
F protein contains an intrinsic lipid raft targeting signal to reach the area of assembly
via the secretory pathway [31]. F protein has also been credited with transporting M
protein to the site of assembly [54]. However, in F deletion mutants of RSV, apical
targeting of nucleocapsid proteins and apical maturation still occurred, suggesting at
least one additional apical targeting signal [128]. The only known role of microtubules
48
in RSV infection is for transport and typically, when most viruses commandeer
microtubules, it is for the purpose of transport. In light of this, the nucleocapsid is
possibly transported to the site of assembly using microtubules (figure 5.1) and the lack
of active transport in RSV infected cells treated with nocodazole can explain the
drastically decreased efficiency in replication. Active directed transport is not essential
for virus viability. It is common for virus proteins and host cell vesicles to reach target
sites in microtubule inhibited cells but with reduced targeting specificity [129, 130].
In addition to the role of actin as an RSV transcription factor, there is strong evidence
linking the actin cytoskeleton to RSV assembly (figure 5.1). Details of the actin
contribution to RSV assembly remain undetermined but possible roles include bringing
viral components together, stabilising the nascent bud during the budding process,
pushing the nucleocapsid into the bud and the process of bud closing and pinching off.
All of these processes have been described as energy-dependent and in influenza virus,
metabolic inhibitors have been shown to inhibit the budding process [131]. The
dynamic nature of actin is an energetic activity that could drive some of these processes
and further, the RSV manipulation of actin modulating factors such as profilin [75] and
RhoA [113] suggest that RSV is exerting fine control over the actin network. This is
supported by the finding that both inhibitors and stabilisers of the actin network had a
similar effect on viral replication and viral release [117], which suggests that disrupting
the dynamic nature of actin is the detrimental factor for RSV.
49
3
2
1
Microtubules
MTOC
Nucleus
Cortical actin
Figure 5.1. A model of cytoskeleton involvement in the lifecycle of RSV. A polarised, ciliated
epithelial cell showing nucleus, cortical actin and microtubules emerging from the microtubule organising
centre (MTOC). 1. RSV F protein utilises the secretory pathway to reach the site of infection due to
intrinsic lipid raft targeting signals [31]. 2. Nucleocapsid proteins may also be targeted to lipid rafts. 3.
Actin participates in the assembly and budding of RSV.
5.4 Future directions The interactions that take place between RSV proteins and the cytoskeleton at the time
of assembly remain largely unexplored. Interactions between RSV proteins and the
cytoskeleton need to be investigated, particularly nucleocapsid proteins, as it is not clear
how the nucleocapsid is targeted to the site of assembly. RSV is known to manipulate
at least two actin modulating factors. It is possible that there are still unknown RSV
interactions with actin binding proteins which need to be determined. Here we have
shown an interaction between M protein and F-actin and microtubules. This interaction
could be confirmed through the use of co-immunoprecipitation assays between M
protein and actin and tubulin. Truncated mutants of M protein, actin and tubulin can be
used to determine the relevant binding sites, in both sub-cellular localisation
experiments and co-immunoprecipitation assays.
This could be improved by using a polarised cell line, the normal target of natural
infection. Some aspects of the RSV lifecycle depend on specific attributes of polarised
cells and therefore future in vitro studies should use polarised cell lines.
50
5.5 Conclusion Previously there had been some evidence that the cytoskeleton is involved the assembly
of RSV. Due to the central role of M protein in assembly, it was hypothesised that the
cytoskeleton interacts directly with M protein to facilitate virus assembly. We were
unable to isolate the assembly process using cytoskeleton inhibitors at 4 hour intervals
over a 30 hour infectious period. However, we were able to show that inhibiting F-actin
and microtubules alters the sub-cellular localisation of M protein but not until the time
of assembly. This supports the hypothesis that RSV M protein interacts directly with
the cytoskeleton to facilitate virus assembly. In the context of cytoskeleton facilitated
assembly of RSV, this is the first time that a direct interaction has been shown between
the cytoskeleton and an RSV protein. Based on the current level of knowledge, a model
of cytoskeleton interaction with RSV is proposed with microtubules handling the
transport and targeting needs of the virus and actin handling the energy-dependent
events of assembly and budding. There is still much that is unknown about the
assembly of RSV, but this finding and future efforts such as those outlined above may
lead to the development of safe and effective therapeutics.
51
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
Collins, P. and J. Crowe, Respiratory syncytial virus and metapneumovirus.
Fields Virology, 5th Edition, ed. D. Knipe and P. Howley. Vol. 2. 2007:
Lippincott Williams & Wilkins.
World Health Organisation. Respiratory syncytial virus and parainfluenza
viruses. 2009 [cited 2011 27 June]; Available from:
http://www.who.int/vaccine_research/diseases/ari/en/index2.html.
Schildgen, O., The lack of protective immunity against RSV in the elderly.
Epidemiology of Infectious Disease, 2009. 137(12): p. 1687-90.
Chang, J., Current progress on development of respiratory syncytial virus
vaccine. BMB Reports, 2011. 44(4): p. 232-237.
Hashem, M. and C. Hall, Respiratory syncytial virus in healthy adults: the cost
of a cold. Journal of Clinical Virology, 2003. 27(1): p. 14-21.
McNamara, P. and R. Smyth, The pathogenesis of respiratory syncytial virus
disease in childhood. British Medical Bulletin, 2002. 61: p. 13-28.
Garzon, L.S. and L. Wiles, Management of respiratory syncytial virus with
lower respiratory tract infection in infants and children. AACN Clinical Issues,
2002. 13(3): p. 421-430.
Resch, B., S. Kurath, and P. Manzoni, Epidemiology of respiratory syncytial
virus infection in preterm infants. The Open Microbiology Journal, 2011. 5: p.
135-143.
Stein, R., et al., Respiratory syncytial virus in early life and risk of wheeze and
allergy by age 13 years. Lancet, 1999. 354(9178): p. 541-545.
Sigurs, N., et al., Severe respiratory syncytial virus bronchiolitis in infancy and
asthma and allergy at age 13. American journal of respiratory and critical care
medicine, 2005. 171(2): p. 137-41.
Collins, P.L. and B.S. Graham, Viral and Host Factors in Human Respiratory
Syncytial Virus Pathogenesis. Journal of Virology, 2008. 82(5): p. 2040-2055.
Patel, H., S. Gouin, and R. Platt, Randomized, double-blind, placebo-controlled
trial of oral albuterol in infants with mild-to-moderate acute viral bronchiolitis.
Journal of Pediatrics, 2003. 142(5): p. 509-514.
Corneli, H., et al., A multicenter, randomized, controlled trial of dexamethasone
for bronchiolitis. New England Journal of Medicine, 2007. 357(4): p. 331-339.
Krilov, L., Respiratory syncytial virus disease: update on treatment and
prevention. Expert Review of Anti-infective Therapy, 2011. 9(1): p. 27-32.
Ventre, K. and A. Randolph, Ribavirin for respiratory syncytial virus infection
of the lower respiratory tract in infants and young children. Cochrane Database
Systematic Reviews, 2007(1): p. CD000181.
Krilov, L., et al., The 2009 COID recommendations for RSV prophylaxis: issues
of efficacy, cost, and evidence-based medicine. Pediatrics, 2009. 124(6): p.
1682-4.
Wang, D., S. Bayliss, and C. Meads, Palivizumab for immunoprophylaxis of
respiratory syncytial virus (RSV) bronchiolitis in high-risk infants and young
children: a systematic review and additional economic modelling of subgroup
analyses. Health Technology Assessment, 2002. 15(5): p. 1-124.
Health, U.S.N.I.o. ClinicalTrials.gov. 2011 [cited 2011 26 March]; Available
from: http://clinicaltrials.gov/ct2/results?term=RSV&pg=1.
52
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
Langley, G. and L. Anderson, Epidemiology and prevention of respiratory
syncytial virus infections among infants and young children. The Pediatric
Infectious Disease Journal, 2011. 30(6): p. 510-517.
Groothuis, J.R., J.M. Hoopes, and V.G. Jessie, Prevention of serious respiratory
syncytial virus-related illness. I: Disease pathogenesis and early attempts at
prevention. Advances in Therapy, 2011. 28(2): p. 91-109.
Kapikian, A., et al., An epidemiologic study of altered clinical reactivity to
respiratory syncytial (RS) virus infection in children previously vaccinated with
an inactivated RS virus vaccine. American Journal of Epidemiology, 1969.
89(4): p. 405-21.
Mufson, M., et al., Two distinct subtypes of human respiratory syncytial virus.
Journal of General Virology, 1985. 66(10): p. 2111-24.
Buchholz, U., et al., Deletion of M2 gene open reading frames 1 and 2 of human
metapneumovirus: effects on RNA synthesis, attenuation, and immunogenicity.
Journal of Virology, 2005. 79(11): p. 6588-97.
Feldman, S., R. Hendry, and J. Beeler, Identification of a linear heparin binding
domain for human respiratory syncytial virus attachment glycoprotein G.
Journal of Virology, 1999. 73(8): p. 6610-7.
Bukreyev, A., et al., The secreted form of respiratory syncytial virus G
glycoprotein helps the virus evade antibody-mediated restriction of replication
by acting as an antigen decoy and through effects on Fc receptor-bearing
leukocytes. Journal of Virology, 2008. 82(24): p. 12191-204.
Johnson, P.R., et al., The G glycoprotein of human respiratory syncytial viruses
of subgroups A and B: extensive sequence divergence between antigenically
related proteins. Proceedings of the National Academy of Science in the U.S.A.,
1987. 84(16): p. 5625-9.
Melero, J., et al., Antigenic structure, evolution and immunobiology of human
respiratory syncytial virus attachment (G) protein. Journal of General Virology,
1997. 78 ( Pt 10): p. 2411-8.
Techaarpornkul, S., N. Barretto, and M. Peeples, Functional analysis of
recombinant respiratory syncytial virus deletion mutants lacking the small
hydrophobic and/or attachment glycoprotein gene. Journal of Virology, 2001.
75(15): p. 6825-6834.
Collins, P., Y. Huang, and G. Wertz, Nucleotide sequence of the gene encoding
the fusion (F) glycoprotein of human respiratory syncytial virus. Proceeding of
the National Academy of Science U.S.A., 1984. 81(24): p. 7683-7687.
Scheid, A. and P. Choppin, Two disulfide-linked polypeptide chains constitute
the active F protein of paramyxoviruses. Virology, 1977. 80(1): p. 54-66.
Brock, S., et al., The transmembrane domain of the respiratory syncytial virus F
protein is an orientation-independent apical plasma membrane sorting
sequence. Journal of Virology, 2005. 79(19): p. 12528-12535.
Kochva, U., H. Leonov, and I. Arkin, Modeling the structure of the respiratory
syncytial virus small hydrophobic protein by silent-mutation analysis of global
searching molecular dynamics. Protein science: A publication of the protein
society, 2003. 12(12): p. 2668-74.
Perez, M., et al., Membrane permeability changes induced in Escherichia coli by
the SH protein of human respiratory syncytial virus. Virology, 1997. 235(2): p.
342-51.
Gonzalez, M. and L. Carrasco, Viroporins. FEBS Letters, 2003. 552(1): p. 2834.
53
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
Liu, P., et al., Retinoic acid-inducible gene I mediates early antiviral response
and Toll-like receptor 3 expression in respiratory syncytial virus-infected airway
epithelial cells. Journal of Virology, 2007. 81(3): p. 1401-11.
Cowton, V., D. McGivern, and R. Fearns, Unravelling the complexities of
respiratory syncytial virus RNA synthesis. Journal of General Virology, 2006.
87(7): p. 1805-1821.
Dupuy, L., et al., Casein kinase 2-mediated phosphorylation of respiratory
syncytial virus phosphoprotein P is essential for the transcription elongation
activity of the viral polymerase; phosphorylation by casein kinase 1 occurs
mainly at Ser(215) and is without effect. Journal of Virology, 1999. 73(10): p.
8384-92.
Fearns, R. and P.L. Collins, Role of the M2-1 transcription antitermination
protein of respiratory syncytial virus in sequential transcription. Journal of
Virology, 1999. 73(7): p. 5852-64.
Gould, P. and A. Easton, Coupled translation of the second open reading frame
of M2 mRNA is sequence dependent and differs significantly within the
subfamily Pneumovirinae. Journal of Virology, 2007. 81(16): p. 8488-96.
Bermingham, A. and P.L. Collins, The M2-2 protein of human respiratory
syncytial virus is a regulatory factor involved in the balance between RNA
replication and transcription. Proceedings of the National Academy of Sciences
of the U.S.A, 1999. 96(20): p. 11259-11264.
Lo, M., R. Brazas, and M. Holtzman, Respiratory syncytial virus nonstructural
proteins NS1 and NS2 mediate inhibition of Stat2 expression and alpha/beta
interferon responsiveness. Journal of Virology, 2005. 79(14): p. 9315-9.
Bitko, V., et al., Nonstructural proteins of respiratory syncytial virus suppress
premature apoptosis by an NF-kappaB-dependent, interferon-independent
mechanism and facilitate virus growth. Journal of Virology, 2007. 81(4): p.
1786-95.
Munir, S., et al., Respiratory syncytial virus interferon antagonist NS1 protein
suppresses and skews the human T lymphocyte response. PLoS Pathog, 2011.
7(4): p. e1001336.
Ali, A., et al., Influenza virus assembly: effect of influenza virus glycoproteins
on the membrane association of M1 protein. Journal of Virology, 2000. 74(18):
p. 8709-19.
Ghildyal, R., A. Ho, and D.A. Jans, Central role of the respiratory syncytial
virus matrix protein in infection. FEMS Microbiol Rev, 2006. 30(5): p. 692-705.
Ghildyal, R., et al., The matrix protein of Human respiratory syncytial virus
localises to the nucleus of infected cells and inhibits transcription. Archives of
Virology, 2003. 148(7): p. 1419-1429.
Ghildyal, R., et al., Respiratory syncytial virus matrix protein associates with
nucleocapsids in infected cells. Journal of General Virology, 2002. 83(Pt 4): p.
753-7.
Ghildyal, R., et al., Interaction between the respiratory syncytial virus G
glycoprotein cytoplasmic domain and the matrix protein. Journal of General
Virology, 2005. 86(Pt 7): p. 1879-84.
Marty, A., et al., Association of matrix protein of respiratory syncytial virus with
the host cell membrane of infected cells. Archives of Virology, 2004. 149(1): p.
199-210.
Li, D., et al., Association of respiratory syncytial virus M protein with viral
nucleocapsids is mediated by the M2-1 protein. Journal of Virology, 2008.
82(17): p. 8863-70.
54
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
67.
Ghildyal, R., et al., Nuclear import of the respiratory syncytial virus matrix
protein is mediated by importin beta1 independent of importin alpha.
Biochemistry, 2005. 44(38): p. 12887-12895.
Ghildyal, R., et al., The respiratory syncytial virus matrix protein possesses a
Crm1-mediated nuclear export mechanism. Journal of Virology, 2009. 83(11):
p. 5353-5362.
Chong, L. and J. Rose, Interactions of normal and mutant vesicular stomatitis
virus matrix proteins with the plasma membrane and nucleocapsids. Journal of
Virology, 1994. 68(1): p. 441-7.
Henderson, G., J. Murray, and R.P. Yeo, Sorting of the respiratory syncytial
virus matrix protein into detergent-resistant structures is dependent on cellsurface expression of the glycoproteins. Virology, 2002. 300(2): p. 244-54.
Harder, T. and K. Simons, Caveolae, DIGs, and the dynamics of sphingolipidcholesterol microdomains. Current opinion in cell biology, 1997. 9(4): p. 53442.
McCurdy, L. and B. Graham, Role of plasma membrane lipid microdomains in
respiratory syncytial virus filament formation. Journal of Virology, 2003. 77(3):
p. 1747-56.
Gaudin, Y., et al., Aggregation of VSV M protein is reversible and mediated by
nucleation sites: implications for viral assembly. Virology, 1995. 206(1): p. 2837.
Lyles, D.S. and M.O. McKenzie, Activity of vesicular stomatitis virus M protein
mutants in cell rounding is correlated with the ability to inhibit host gene
expression and is not correlated with virus assembly function. Virology, 1997.
229(1): p. 77-89.
Johnson, J., et al., The histopathology of fatal untreated human respiratory
syncytial virus infection. Modern Pathology, 2007. 20(1): p. 108-19.
Teng, M., S. Whitehead, and P. Collins, Contribution of the respiratory
syncytial virus G glycoprotein and its secreted and membrane-bound forms to
virus replication in vitro and in vivo. Virology, 2001. 289(2): p. 283-96.
Hallak, L., et al., Glycosaminoglycan sulfation requirements for respiratory
syncytial virus infection. Journal of Virology, 2000. 74(22): p. 10508-13.
Hallak, L., S. Kwilas, and M. Peeples, Interaction between respiratory syncytial
virus and glycosaminoglycans, including heparan sulfate. Methods in molecular
biology, 2007. 379: p. 15-34.
Gutierrez-Ortega, A., C. Sanchez-Hernandez, and B. Gomez-Garcia, Respiratory
syncytial virus glycoproteins uptake occurs through clathrin-mediated
endocytosis in a human epithelial cell line. Virology Journal, 2008. 5: p. 127.
Kolokoltsov, A., et al., Small interfering RNA profiling reveals key role of
clathrin-mediated endocytosis and early endosome formation for infection by
respiratory syncytial virus. Journal of Virology, 2007. 81(14): p. 7786-800.
Collins, P., et al., Nucleotide sequences for the gene junctions of human
respiratory syncytial virus reveal distinctive features of intergenic structure and
gene order. Proceedings of the National Academy of Science in the U.S.A.,
1986. 83(13): p. 4594-8.
Kuo, L., R. Fearns, and P. Collins, Analysis of the gene start and gene end
signals of human respiratory syncytial virus: quasi-templated initiation at
position 1 of the encoded mRNA. Journal of Virology, 1997. 71(7): p. 4944-53.
Fearns, R. and P. Collins, Model for polymerase access to the overlapped L gene
of respiratory syncytial virus. Journal of Virology, 1999. 73(1): p. 388-97.
55
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
Roberts, S., R. Compans, and G. Wertz, Respiratory syncytial virus matures at
the apical surfaces of polarized epithelial cells. Journal of Virology, 1995.
69(4): p. 2667-73.
Zhang, L., et al., Respiratory syncytial virus infection of human airway
epithelial cells is polarized, specific to ciliated cells, and without obvious
cytopathology. Journal of Virology, 2002. 76(11): p. 5654-66.
Bachi, T., Direct observation of the budding and fusion of an enveloped virus by
video microscopy of viable cells. The Journal of Cell Biology, 1988. 107(5): p.
1689-95.
Carlier, M., et al., Actin-based motility as a self-organized system: mechanism
and reconstitution in vitro. Comptes Rendus Biology, 2003. 326(2): p. 161-70.
Cooper, G. and R. Hausman, eds. The Cell: A Molecular Approach. 5 ed. 2009,
ASM Press, Washington, D.C. and Sinauer Associates, Inc, Sunderland,
Massachusetts.
Dohner, K. and B. Sodeik, The role of the cytoskeleton during viral infection.
Current Topics in Microbiology and Immunology, 2004. 285: p. 67-108.
Komano, J., et al., Inhibiting the Arp2/3 complex limits infection of both
intracellular mature vaccinia virus and primate lentiviruses. Molecular Biology
of the Cell, 2004. 15(12): p. 5197-5207.
Bitko, V., et al., Profilin is required for viral morphogenesis, syncytium
formation, and cell-specific stress fiber induction by respiratory syncytial virus.
BMC Microbiology, 2003. 3: p. 9.
Cramer, L., Organization and polarity of actin filament networks in cells:
implications for the mechanism of myosin-based cell motility. Biochemical
Society Symposium, 1999. 65: p. 173-205.
Marsh, M. and R. Bron, SFV infection in CHO cells: cell-type specific
restrictions to productive virus entry at the cell surface. Journal of Cell Science,
1997. 110(1): p. 95-103.
Digard, P., et al., Modulation of nuclear localization of the influenza virus
nucleoprotein through interaction with actin filaments. Journal of Virology,
1999. 73(3): p. 2222-31.
Goldstein, L.S. and Z. Yang, Microtubule-based transport systems in neurons:
the roles of kinesins and dyneins. Annual Review of Neuroscience, 2000. 23: p.
39-71.
Greber, U.F. and M. Way, A superhighway to virus infection. Cell, 2006. 124(4):
p. 741-54.
Ward, B.M., The taking of the cytoskeleton one two three: How viruses utilize
the cytoskeleton during egress. Virology, 2011.
Dohner, K., C.H. Nagel, and B. Sodeik, Viral stop-and-go along microtubules:
taking a ride with dynein and kinesins. Trends in Microbiology, 2005. 13(7): p.
320-327.
Sodeik, B., Mechanisms of viral transport in the cytoplasm. Trends in
Microbiology, 2000. 8(10): p. 465-72.
Chen, P., D. Ornelles, and T. Shenk, The adenovirus L3 23-kilodalton
proteinase cleaves the amino-terminal head domain from cytokeratin 18 and
disrupts the cytokeratin network of HeLa cells. Journal of Virology, 1993. 67(6):
p. 3507-14.
Ferreira, L.R., N. Moussatche, and V. Moura Neto, Rearrangement of
intermediate filament network of BHK-21 cells infected with vaccinia virus.
Archives of Virology, 1994. 138(3): p. 273-285.
56
86.
87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
97.
98.
99.
100.
101.
102.
103.
104.
Luby-Phelps, K., Cytoarchitecture and physical properties of cytoplasm:
volume, viscosity, diffusion, intracellular surface area. International Review of
Cytololgy, 2000. 192: p. 189-221.
Carter, G., et al., Vaccinia virus cores are transported on microtubules. Journal
of General Virology, 2003. 84(9): p. 2443-58.
Geada, M.M., et al., Movements of vaccinia virus intracellular enveloped virions
with GFP tagged to the F13L envelope protein. J Gen Virol, 2001. 82(Pt 11): p.
2747-60.
Grenklo, S., et al., A crucial role for profilin-actin in the intracellular motility of
Listeria monocytogenes. EMBO Rep, 2003. 4(5): p. 523-9.
Cudmore, S., et al., Actin-based motility of vaccinia virus. Nature, 1995.
378(6557): p. 636-8.
Lycke, E., et al., Uptake and transport of herpes simplex virus in neurites of rat
dorsal root ganglia cells in culture. Journal of General Virology, 1984. 65(1): p.
55-64.
Sodeik, B., M. Ebersold, and A. Helenius, Microtubule-mediated transport of
incoming herpes simplex virus 1 capsids to the nucleus. The Journal of Cell
Biology, 1997. 136(5): p. 1007-21.
Ye, G., et al., The herpes simplex virus 1 U(L)34 protein interacts with a
cytoplasmic dynein intermediate chain and targets nuclear membrane. Journal
of Virology, 2000. 74(3): p. 1355-63.
Martinez-Moreno, M., et al., Recognition of novel viral sequences that associate
with the dynein light chain LC8 identified through a pepscan technique. FEBS
Letters, 2003. 544(1-3): p. 262-7.
Feierbach, B., et al., Alpha-herpesvirus infection induces the formation of
nuclear actin filaments. PLoS Pathogens, 2006. 2(8): p. 85.
Lyman, M.G. and L.W. Enquist, Herpesvirus interactions with the host
cytoskeleton. Journal of Virology, 2009. 83(5): p. 2058-2066.
Reynolds, A., L. Liang, and J. Baines, Conformational changes in the nuclear
lamina induced by herpes simplex virus type 1 require genes U(L)31 and
U(L)34. Journal of Virology, 2004. 78(11): p. 5564-75.
Bjerke, S. and R. Roller, Roles for herpes simplex virus type 1 UL34 and US3
proteins in disrupting the nuclear lamina during herpes simplex virus type 1
egress. Virology, 2006. 347(2): p. 261-76.
Antinone, S., S. Zaichick, and G. Smith, Resolving the assembly state of herpes
simplex virus during axon transport by live-cell imaging. Journal of Virology,
2010. 84(24): p. 13019-13030.
Momose, F., et al., Visualization of microtubule-mediated transport of influenza
viral progeny ribonucleoprotein. Microbes and Infection, 2007. 9(12-13): p.
1422-1433.
Eisfeld, A., et al., RAB11A is essential for transport of the influenza virus
genome to the plasma membrane. Journal of Virology, 2011. 85(13): p. 61176126.
Momose, F., et al., Apical transport of influenza A virus ribonucleoprotein
requires Rab11-positive recycling endosome. PLoS, 2011. 6(6): p. e21123.
Utley, T., et al., Respiratory syncytial virus uses a Vps4-independent budding
mechanism controlled by Rab11-FIP2. Proceedings of the National Academy of
Science in the U.S.A., 2008. 105(29): p. 10209-14.
Ogino, T., et al., Interaction of cellular tubulin with Sendai virus M protein
regulates transcription of viral genome. Biochemcal and Biophysical Research
Communications, 2003. 311(2): p. 283-293.
57
105.
106.
107.
108.
109.
110.
111.
112.
113.
114.
115.
116.
117.
118.
119.
120.
121.
122.
123.
124.
Burke, E., et al., Role of cellular actin in the gene expression and
morphogenesis of human respiratory syncytial virus. Virology, 1998. 252(1): p.
137-48.
Cureton, D., et al., Vesicular stomatitis virus enters cells through vesicles
incompletely coated with clathrin that depend upon actin for internalization.
PLoS Pathogens, 2009. 5(4): p. e1000394.
Veiga, E., et al., Invasive and adherent bacterial pathogens co-Opt host clathrin
for infection. Cell Host & Microbe, 2007. 2(5): p. 340-351.
Martinez, I., et al., Distinct gene subsets are induced at different time points
after human respiratory syncytial virus infection of A549 cells. Journal of
General Virology, 2007. 88: p. 570 - 581.
Chang, Y., et al., GEF-H1 couples nocodazole-induced microtubule disassembly
to cell contractility via RhoA. Molecular Biology of the Cell, 2008. 19(5): p.
2147-2153.
Ridley, A., Rho family proteins: coordinating cell responses. Trends in Cellular
Biology, 2001. 11(12): p. 471-477.
Gower, T.L., et al., RhoA is activated during respiratory syncytial virus
infection. Virology, 2001. 283(2): p. 188-96.
Pastey, M., J. Crowe, and B. Graham, RhoA interacts with the fusion
glycoprotein of respiratory syncytial virus and facilitates virus-induced
syncytium formation. Journal of Virology, 1999. 73(9): p. 7262-7270.
Gower, T.L., et al., RhoA signaling is required for respiratory syncytial virusinduced syncytium formation and filamentous virion morphology. Journal of
Virology, 2005. 79(9): p. 5326-36.
Barik, S., Transcription of human respiratory syncytial virus genome RNA in
vitro: requirement of cellular factor(s). Journal of Virology, 1992. 66(11): p.
6813-6818.
Harpen, M., et al., Mutational analysis reveals a noncontractile but interactive
role of actin and profilin in viral RNA-dependent RNA synthesis. Journal of
Virology, 2009. 83(21): p. 10869-10876.
Lingwood, D. and K. Simons, Lipid rafts as a membrane-organizing principle.
Science, 2010. 327(5961): p. 46-50.
Kallewaard, N.L., A.L. Bowen, and J.E. Crowe, Jr., Cooperativity of actin and
microtubule elements during replication of respiratory syncytial virus. Virology,
2005. 331(1): p. 73-81.
Ulloa, L., et al., Interactions between cellular actin and human respiratory
syncytial virus (HRSV). Virus Research, 1998. 53: p. 13-25.
Orvell, C., Structural polypeptides of mumps virus. Journal of General Virology,
1978. 41(3): p. 527-539.
Lamb, R., B. Mahy, and P. Choppin, The synthesis of sendai virus polypeptides
in infected cells. Virology, 1976. 69(1): p. 116-131.
Stallcup, K., S. Wechsler, and B. Fields, Purification of measles virus and
characterization of subviral components. Journal of Virology, 1979. 30(1): p.
166-176.
Ghildyal, R., et al., The respiratory syncytial virus matrix protein possesses a
Crm1-mediated nuclear export mechanism. Journal of Virology, 2009. 83(11):
p. 5353-5362.
ImageJ. 20 February [2012]; Available from: http://rsbweb.nih.gov/ij/.
Rieder, C. and H. Maiato, Stuck in division or passing through: what happens
when cells cannot satisfy the spindle assembly checkpoint. Developmental Cell.,
2004. 7(5): p. 637-51.
58
125.
126.
127.
128.
129.
130.
131.
Endo, K., et al., Nocodazole induces mitotic cell death with apoptotic-like
features in Saccharomyces cerevisiae. FEBS Letters, 2010. 584(11): p. 23872392.
Berghall, H., et al., Role of cytoskeleton components in measles virus
replication. Archives of Virology, 2004. 149(5): p. 891-901.
Levine, S., Polypeptides of respiratory syncytial virus. Journal of Virology,
1977. 21(1): p. 427-431.
Batonick, M., A. Oomens, and G. Wertz, Human respiratory syncytial virus
glycoproteins are not required for apical targeting and release from polarized
epithelial cells. Journal of Virology, 2008. 82(17): p. 8664-8672.
Rogalski, A., J. Bergmann, and S. Singer, Effect of microtubule assembly status
on the intracellular processing and surface expression of an integral protein of
the plasma membrane. The Journal of Cell Biology, 1984. 99(3): p. 1101-1109.
Glotzer, J., et al., Microtubule-independent motility and nuclear targeting of
adenoviruses with fluorescently labeled genomes. Journal of Virology, 2001.
75(5): p. 2421-2434.
Hui, E. and D. Nayak, Role of ATP in influenza virus budding. Virology, 2001.
290(2): p. 329-341.