Expression of CD44 and Variant Isoforms in Cultured
Human Retinal Pigment Epithelial Cells
Ning-Pu Liu* Wendy L. Roberts* Laura P. Hale,-\ Marc C. Levesque,%
Dhavalkumar D. Patel,% Chun-Lin Lu,% and Glenn J. Jaffe*
Purpose. CD44 is a major hyaluronic acid receptor that exists as a number of isoforms, generated by alternative splicing of 9 "variant" exons in humans (v2 to vlO) and 10 exons in
rodents. Little is known about the expression and function of CD44 in human retinal pigment
epithelium (RPE) cells. Therefore, the authors determined whether human RPE cells express
CD44, and whether the expression differs depending on the proliferative status of the cells.
Methods. Human RPE cells were harvested from normal donor eyes and propagated in culture.
Total RNA was extracted from cultured cells. mRNA expression of CD44 was determined by
reverse transcription-polymerase chain reaction (RT-PCR), followed by cloning and sequencing of the PCR products, and by Southern hybridization. CD44 cell surface expression was
measured by flow cytometry. Western hybridization and immunohistochemistry were used to
determine the CD44 immunoreactivity of cultured human RPE cells and normal human RPE
cells in situ.
Results. The standard form of CD44 mRNA and variant isoforms containing exon v6 or vlO
were expressed in cultured human RPE cells. CD44 mRNA and protein levels were increased
in proliferating human RPE cells compared with density-arrested counterparts. Addition of
1 /JM retinoic acid enhanced the cell density-induced downregulation of CD44 mRNA, but
did not significantly affect the CD44 cell surface protein expression. As previously reported,
CD44 immunoreactivity was not detected in normal human RPE cells in situ.
Conclusions. Cultured human RPE cells express CD44 standard form and variant isoforms
containing exon v6 or vlO, which are preferentially expressed by proliferating human RPE
cells. Invest Ophthalmol Vis Sci. 1997;38:2027-2037.
L he cell surface glycoprotein CD44 is a transmembrane glycoprotein expressed by a variety of hematopoietic and nonhematopoietic tissues.1"3 It comprises
a large family of molecules encoded by a single gene
on the short arm of chromosome 11 in humans.4'5
The predominant form of CD44 has an approximate
molecular weight of 80 to 95 kDa, and has been denoted as CD44 standard form (CD44s). In addition,
a large number of higher molecular weight variant
isoforms (CD44v) exist. These isoforms contain addiFrom the Departments of * Ophthalmology, ^Pathology, %lmmunology, and %Cell
Biology, Duke University Medical Center, Durham, North Carolina.
Presented in part at the annual meeting of the Association for Research in Vision
and Ophthalmology, Fort Lauderdale, Florida, April 1996.
Supported by National Institute of Health grants EY09106 (GJf) and CA61227
(LPH).
Submitted for publication November 22, 1996; revised March 18, 1997; accepted
May 5, 1997.
Profmetary interest category: N.
Reprint requests: Glenn f. fajfe, Department of Ophthalmology, Duke University
Medical Center, Enuin Road, Box 3802, Durham, NC 27710.
tional peptide sequences of varying length inserted
into a single site within the extracellular domain of
the molecule proximal to the membrane-spanning domain. They arise from alternative splicing of a series
of 10 contiguous exons (vl to vlO) presented within
the CD44 gene (Fig. I). 5 " 8 In humans, however, exon
vl contains a stop codon and is not used.7'8 Variability
of the CD44 molecule is further generated by differential glycosylation, glycosaminoglycan modification,
and phosphorylation.5'9"11 The cytoplasmic domain of
CD44 has been shown to bind directly to ankyrin,
which links to the actin cytoskeleton within the
cell.1112 The CD44 extracellular domain binds hyaluronic acid,13"16 collagen types I and VI, and fibronectin.17'18
CD44 is thought to play important roles in a diverse range of physiological processes. Originally described as a homing receptor of lymphocytes, it is now
also credited with functions involving cell motility,
Investigative Ophthalmology & Visual Science, September 1997, Vol. 38, No. 10
Copyright © Association for Research in Vision and Ophthalmology
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933196/ on 06/17/2017
2027
2028
Investigative Ophthalmology & Visual Science, September 1997, Vol. 38, No. 10
5 ?
67
6
7
8
9
10 11 12 13 14 15 16 17 18 19
166 134 69 231
204
63
72
79
898 947
exon
CD44 gene
bp
v1 v2 v3 v4 v5 v6 v7 v8 v9 v10
I
variant exons
'
PCR primers
cartilage-link homology
membrane proximal variable domain
cytoplasmic
extracellular region
B
I
A3D8
CD44
protein
region
antibody
reactivity
'
FIGURE l. A schematic representation of the CD44 gene and protein domains. The CD44
genomic structure, as described by Screaton and associates,7 is shown at the top. The exons
encoding the standard and the variant regions have been consecutively numbered and the
specific sizes of respective exons are noted in italics below each exon. Specific regions of
CD44 associated with functional characteristics are also noted, including a region with
significant cartilage-link homology, a membrane proximal variable domain, a transmembrane region, and a cytoplasmic region. CD44 may have short (exon 18) or long (exon 19)
cytoplasmic domains. The human CD44 gene has 9 variant exons (exons 6 to 14 or v2 to
vlO) that can be alternatively spliced into mRNA to form higher molecular weight variant
isoforms, whereas the rodent CD44 gene contains an additional variant exon (vl) between
human CD44 exons 5 and 6.7'8 The location of PCR primers and the reactivity of the CD44
antibody A3D8, used in this study, are also shown.
lymphopoiesis, T-cell activation, and cell-cell and
cell-matrix adhesion.1'519 Ligand binding to the
CD44 molecule promotes cytokine release by T cells,
macrophages, and monocytes.20'21 The expression of
CD44 is upregulated in diseases such as rheumatoid
arthritis.20 Expression of certain variants or alterations
in the pattern of variant expression have been correlated with altered cellular function. For example, in
both humans and rodents, expression of variant isoforms of CD44 containing exon v6 has been associated
with a metastatic phenotype of epithelial cell malignancies.22"27 Expression of epitopes encoded by exon
v6 in human breast cancer and colon cancer is also
correlated with poor patient survival.28'29
The role of CD44 in the posterior segment of
normal and diseased eyes is poorly understood. In the
neural retina, CD44 has been identified in Milller cells
by immunohistochemistry and irnmunogold labeling
and is thought to play a role in retinal adhesion to
the interphotoreceptor matrix.30'31 Using these same
techniques, CD44 has not been identified on normal
retinal pigment epithelium (RPE) cells.30'31 Normally,
RPE cells form a quiescent monolayer interposed between the neural retina and the choriocapillaris. Un-
der pathologic conditions, such as proliferative vitreoretinopathy, RPE cells actively proliferate in the
subretinal space, on the surface and undersurface of
the retina, and into the vitreous cavity.32"34 Frequently,
surface receptor expression differs depending on the
proliferative state of the cell. Indeed, in skin and other
nonocular tissues CD44 is expressed predominantly
on actively dividing cells.35"37 Herein we report the
results of experiments to determine whether CD44
and variant isoforms are expressed by cultured human
RPE, and if so, whether they are preferentially expressed by actively dividing cells.
MATERIALS AND METHODS
Cell Culture
Human donor eyes were obtained from the North
Carolina Organ Donor and Eye Bank within 24 hours
of death. The methods for acquiring the human tissue
included proper consent and approval and complied
with the tenets of the Declaration of Helsinki. RPE
cells were harvested from these eyes as previously described.38 Cells were grown in 75-cm2 flasks in Eagle's
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933196/ on 06/17/2017
CD44 in Cultured Human Retinal Pigment Epithelial Cells
2029
FIGURE 2. Retinal pigment epithelium (RPE) cells from a representative cell line (ARPE-19)
demonstrating morphologic changes at different stages of culture. (A) Sparse cells; (B)
preconfluent cells; (C) visually confluent cells; (D) 4-week postconfluent cells.
minimal essential medium (MEM; Lineberger Cancer
Institute, Chapel Hill, NC) with 10% fetal bovine serum (FBS; HyClone Laboratories, Logan, UT) at 37°C
in a moist 5% CO2 atmosphere. The culture medium
was changed at 3- to 4-day intervals. For experiments,
second to fifth passage cells were plated at a density
of 30,000 cells/ml in 60-mm culture dishes (Falcon,
Becton Dickson Labware, Lincoln Park, NJ) and
grown to various degrees of confluency. In this study,
cultures were considered sparse when they consisted
of small islands of contiguous cells or individual cells.
Cells were denoted dense when they were tightly
packed, had a polygonal morphology, and had been
grown at least 4 weeks after they reached visual confluence. Purity of RPE cell cultures was confirmed by
cytokeratin staining as previously described.38 The cell
line ARPE-19 used in this study (at passage 10) was
kindly given by Dr. Leonard M. Hjelmeland (Fig. 2) .39
RNA Extraction
After removal of the medium, cells were rinsed with
phosphate buffered saline (PBS) and lysed directly
in the culture dishes with 1.2 ml RNAzol B (Biotecx
Laboratories, Houston, TX). RNA was extracted by
adding 120 fj\ chloroform, shaking for 15 seconds,
then cooling at 4°C for 5 minutes. The suspension was
centrifuged at 12,000g-for 15 minutes at 4°C and the
aqueous phase was transferred to a new tube. The
RNA was precipitated by adding 600 fA isopropanol,
incubating on ice for 15 minutes, and centrifuging at
12,000g for 15 minutes at 4°C. The RNA pellets were
washed once with 1 ml 75% ethanol, dried, resuspended in 20 /A diethyl pyrocarbonate (DEPQtreated water, and incubated for 10 minutes at 60°C.
The RNA was stored frozen at —80°C. RNA purity was
determined by the ratio of optical density (OD) measured at 260 and 280 nm (OD26o/OD28o) and RNA
quantity was estimated from OD2eocDNA Synthesis
Total RNA was converted to cDNA using a modification of a previously described technique.40 One microgram of total RNA in 10 /A of DEPC-treated water was
added to 10 jA reverse transcription mixture consisting of 2 fA 10X polymerase chain reaction (PCR)
buffer (500 mM KC1, 100 mM Tris-HCl pH 9, 15 mM
MgCl2> 0.01% [wt/vol] gelatin), 4 fi\ 5 mM dNTP
(Pharmacia LKB Biotech, Inc, Piscataway, NJ), 1 fi\
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933196/ on 06/17/2017
2030
Investigative Ophthalmology & Visual Science, September 1997, Vol. 38, No. 10
Maloney Murine Leukemia virus reverse transcriptase
(200 V/fil, BRL, Gaithersberg, MD), 1 fil random hexamers (100 pmol/^1, Pharmacia LKB Biotech, Inc),
0.5 II\ RNasin (33 U//il, Promega, Madison, WI), and
1.5 (j,\ DEPC-treated water. This mixture was incubated
for 45 minutes at 37°C, and then for 5 minutes at
90°C. cDNA was stored frozen at -80°C.
Polymerase Chain Reaction Amplification
One microliter of cDNA mixture was added to a PCR
reaction mixture consisting of 5 /A 10X PCR buffer, 1
(A 2.5 mM dNTP, 0.5 (A 10 fiM CD44-specific primer
pairs, 1.25 unit Taq polymerase (Promega), and distilled water in a total volume of 50 y\. The sequences
of the CD44 primer pairs, 5'AGATCAGTCACAGACCTGCC3' (forward primer located in exon 4) and
5'GCAAACTGCAAGAATCAAAGCC3' (reverse primer
located in exon 17), were chosen to span the variant
exons of the CD44 gene.7 Depending on the composition and number of variant exons expressed, products
of different lengths were produced. The predicted size
of CD44s was 471 base pairs (bp). Variant isoforms were
of higher molecular weight, as indicated below.
The PCR reaction mixture was overlaid with mineral oil and incubated in a PCR thermal cycler (PerkinElmer/Cetus, Norwalk, CT) according to the following
profile: denaturation at 94°C for 1.5 minutes, annealing
at 56°C for 1 minute, and extension at 72°C for 3 minutes. The final extension step was lengthened to 7 minutes. Positive control cDNA template was serially diluted and amplified with CD44-specific primers in parallel with unknown samples. PCR reaction mixture
without the addition of cDNA template was used as a
negative control. To verify that equivalent quantities of
mRNA in unknown samples were reverse transcribed
to cDNA, samples were also incubated with glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-primer
pairs as previously described.41 To ensure that PCR
products were evaluated during the exponential phase
of the amplification process, 10-/il aliquots were removed from the reaction mixture at varying numbers
of cycles. PCR products from the unknown samples
and dilution series were run on a 2% agarose gel (Ultrapure, BRL) at 100 V for 40 to 45 minutes. Gels were
stained with ethidium bromide, visualized under ultraviolet light, and photographed with Polaroid film type
55 (Cambridge, MA). The intensity of the bands was
quantified from the photographic negatives, with NIH
densitometric software (NIH Image, version 1.55,
Bethesda, MD). Relative differences in mRNA expression among samples were determined by comparison
with the standard dilution curve as previously described.38
Restriction Enzyme Analysis
Restriction enzyme analysis was used to confirm the
identity of PCR products as previously described.41
The PCR product of CD44s has a unique restriction
site for BstXl. Accordingly, 9.8 //I PCR product and
1.2 fil 10X enzyme buffer were incubated with 1 [A
BsiKl (total volume = 12 //I) at 37°C overnight. The
restriction digests were then run on 2% agarose gels
and bands were visualized with ethidium bromide to
verify that the actual size of the bands corresponded
to the predicted size.
Cloning and Sequencing of the Polymerase
Chain Reaction Products
The DNA bands were excised from the agarose gel
and extracted using QIAEX II agarose gel extraction
kit (QIAGEN, Chatsworth, CA). DNA was ligated to
PT7 blue(R) T-vector (Novagen, Madison, WI) and
transformed into bacteria DH5a. The recombinant
plasmid was isolated and sequenced using Sequenase
version 2.0 DNA sequencing kit according to the manufacturer's protocol (Amersham, Cleveland, OH).
Southern Hybridization
For these experiments, oligonucleotide probes were
designed that would hybridize to the PCR product
internal to the CD44-specific exons.42 Ten microliters
of PCR products were run for 4 to 5 hours on 2%
agarose gel containing ethidium bromide, and then
photographed under ultraviolet light. The gels were
equilibrated in 0.5 N NaOH and blotted overnight to
positively charged nylon membranes (NEN Research
Products, MA). The blots were crosslinked with ultraviolet light and prehybridized under stringent conditions (55°C) for at least 1 hour in hybridization solution (5X SSC [750 mM sodium chloride, 75 mM sodium citrate], 0.1% [wt/vol] sodium dodecyl sulfate
[SDS],0.5% [wt/vol] blocking reagent [DuPontNEN,
Boston, MA], 5% dextran sulfate). Fluorescein-12ddUTP 3'-end-labeled CD44 oligonucleotide probe
was then added to a final concentration of 10 pmol/
ml, and hybridization was carried out at 55°C overnight. The blots were washed twice for 10 minutes
with prewarmed wash buffer (0.9 M NaCl, 0.25% SDS)
at 55°C and twice for 5 minutes in buffer 1 (100 mM
Tris-HCl, 150 mM NaCl, pH 7.5) at room temperature.
The blots were then incubated for 1 hour at room
temperature in buffer 2 (buffer 1 with 0.5% blocking
reagent). Anti-fluorescein-HRP conjugate antibody
diluted 1:1000 in buffer 2 was then added and the
incubation continued for an additional 1 hour. The
blots were washed 4 times for 5 minutes each in buffer
1, and soaked for 1 minute in chemiluminescence
reagent solution (DuPont NEN, Boston, MA). The
bands were visualized by exposing the membrane to
BioMax Kodak Scientific Imaging Film (Eastman Kodak, Rochester, NY).
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933196/ on 06/17/2017
CD44 in Cultured Human Retinal Pigment Epithelial Cells
2031
Flow Cytometry
For immunofluorescence staining, RPE cells were
grown to varying degrees of confluency in 60-mm
dishes. Cells were rinsed twice, incubated with 1.0 mM
ethylenediaminetetraacetic acid (EDTA) for 5 minutes, removed from dishes, counted, and resuspended
in wash buffer (PBS containing 2% bovine serum albumin and 0.1% sodium azide) to a final concentration
of 107 cells/ml. A 50-//1 aliquot of cells was added
to an equal volume of A3D8 (1:100), a monoclonal
antibody (mAb) that recognizes most known isoforms
of CD44. The mixture was incubated for 30 minutes
at 4°C. Cells were then washed twice in wash buffer,
resuspended in 50 (A fluorescein isothiocyanate
(FITC)-goat anti-mouse IgG (1:10) (Kirkegaard &
Perry Laboratories, Gaithersburg, MD), and incubated for 30 minutes at 4°C in the dark. The cells were
washed twice in wash buffer, resuspended in 0.5 ml
wash buffer containing 50 /^l 4% paraformaldehyde,
and stored at 4°C until flow cytometric analysis. Negative controls consisted of cells grown in tandem and
treated identically except that P3 was substituted for
A3D8 as the primary antibody. P3 is a control ascitescontaining antibody from the parent myeloma line
used to create the A3D8 hybridoma; P3 antibody does
not bind to human cells. Both A3D8 and P3 antibodies
were gifts from Dr. B. F. Haynes at Duke University.43
Lane 1
2
3
4
5
6
7 123 bo
Lane 1
B
FIGURE 3. mRNA expression of CD44 standard form by human RPE cells. (A) Reverse transcription—polymerase chain
reaction (RT-PCR) gel showing the expression of CD44s
mRNA by six different RPE cell lines (lanes 1 to 6). RPE
cells were visually confluent at the time of RNA extraction.
PCR amplification was 35 cycles. Lane 7 is negative control
(123 denotes 123-bp lane marker). (B) Digestion of CD44s
PCR product by resuiction enzyme BslXl. Lane 1 = CD44s
PCR product; lane 2 = after digestion by restriction enzyme).
Western Hybridization
Retinal pigment epithelial cells were grown to varying
degrees of confluency in 60-mm dishes and lysed in a
buffer containing 50 mM Tris (pH 7.4), 250 mM NaCl,
5 mM EDTA, 0.1% Nonidet P-40, 50 mM sodium fluoride, 1 mM phenylmethyl sulfonyl fluoride, 0.05 mg/
ml aprotinin, and 0.05 mM leupeptin. Soluble proteins were extracted by centrifugation at lO.OOOg (10
minutes, 4°C) and the protein levels determined by
Bio-Rad protein assay (Bio-Rad Laboratories, Hercules, CA). For each sample, 10 //g protein was separated by electrophoresis on 6% polyacrylamide gels
under nonreducing conditions and electrophoretically transferred to nitrocellulose membranes as previously described.'14 The membranes were incubated
for 2 hours in blocking solution (Tris-buffered saline
[TBS], 10% nonfat dry milk, 0.2% Tween-20) at room
temperature, then with primary antibodies A3D8
(1:500) or P3 in blocking solution for 1 hour, followed
by extensive washing in TBS-T (TBS, 0.2% Tween-20).
Membranes were then incubated with HRP-conjugated secondary antibodies in blocking solution
(1:7500) for 1 hour, washed extensively in TBS-T, and
detected with the enhanced chemiluminescent system
(ECL, Amersham) according to the manufacturer's
instructions.
Immunohistochemistry
Ocular tissues with no known eye diseases were embedded in O.C.T. compound (MilesInc., Elkhart, IN),
cut into 4-fim sections, and fixed in acetone for 5
minutes at — 70°C. Indirect immunofluorescence with
mAbs A3D8 (1:500, against CD44), P3 (1:500, isotypematched negative control), or 4F2 (1:500, Na+-K+ ATPase, positive control) was performed as previously
described.'10 Briefly, fixed frozen sections were incubated with saturating amounts of antibody for 30 minutes, washed with PBS, incubated with fluorescein-conjugated goat anti-mouse IgG for 30 minutes, washed,
and analyzed by fluorescence microscopy.
RESULTS
Expression of CD44s mRNA in Human Retinal
Pigment Epithelial Cells
Expression of CD44 mRNA was determined by RTPCR in six human RPE cell lines. In all cell lines,
CD44s mRNA was expressed constitudvely (Fig. 3A).
A signal was not observed in negative controls containing reaction mixture without template. By restriction enzyme analysis produced by BstXl digestion, the
size of the fragments corresponded to the predicted
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933196/ on 06/17/2017
Investigative Ophthalmology 8c Visual Science, September 1997, Vol. 38, No. 10
2032
1
Larw( -
2
+){-
3
+ )<-
4
+ )<-
+ ) 123bp
Serial Dilutions
A CD44
2.9
FIGURE 4. Effect of cell density
and retinoic acid on the expression of CD44 standard in a representative human RPE cell line
(ARPE-19). (A) RT-PCR gel showing mRNA expression of CD44s
B GAPDH
at various cell densities (1 = preconfluent cultures; 2 = visually confluent cultures; 3 = 4-week postconfluent cultures; 4 = 9-week postconfluent cultures)
without (—) or with (+) retinoic acid (1 fj.M). Amplification was 25 cycles. CD44s mRNA
expression decreases with increasing cell density. Retinoic acid downregulated CD44 mRNA
expression in all but the most dense (group 4) cells. The mean gray value of each band
measured by densitometry (relative to lane 4+) is shown below each lane. (Serial Dilutions
refers to serial threefold dilutions of CD44s cDNA template [first lane = 2 ng/^tl cDNA].)
The mean gray values determined from these bands were used to derive a standard curve
from which the relative mean gray values corresponding to CD44s mRNA expression were
determined. (B) PCR products with glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
primers corresponding to each of the above CD44 bands.
sizes, confirming that the amplified product was
CD44s (Fig. 3B). The products were also cloned and
sequenced to verify the result obtained with restriction
enzyme analysis. The sequencing results confirmed
that the amplified bands were CD44s.
Effect of Cell Density on CD44s mRNA
Expression
The expression of CD44s mRNA was assessed on 3
RPE cell lines grown to varying levels of confluency.
Preconfluent cells were spindle-shaped; however, as
they became density-arrested, they developed typical
epithelial-tike polygonal morphology (Fig. 2). In all
three cell lines, the level of mRNA expression was
inversely related to cell density. Addition of 1 fiM retinoic acid enhanced the downregulation of CD44s in
cells of varying densities except in the most highly
differentiated dense cells (Fig. 4).
exon v6 only (600 bp) or CD44s plus exon vlO only
(675 bp). In addition to these two variants, larger variants containing v6 or vlO in combination with other
variant exons (approximately 1100 bp and 870 bp,
respectively) were detected in the ARPE-19 cell line
(Fig. 6). The effect of cell density on CD44 variant
expression was similar to that observed on CD44s expression. There was a density-dependent decrease in
expression of all CD44 variants with increasing cell
density. Retinoic acid enhanced the downregulation
of CD44 variants, but this effect was lost on the most
highly differentiated dense cells (Fig. 6). As shown in
Figure 6, the effect of retinoic acid on the main v6
and vlO bands was most apparent in group 3 and less
prominent in the other groups.
Lana( -
123bp
Expression and Density-Dependent Modulation
of CD44 Variant mRNA in Human Retinal
Pigment Epithelial Cells
On ethidium bromide-stained RT-PCR gels, several
faint PCR products wiuh higher molecular weight than
that of CD44s were observed when the amplification
went to 35 cycles (Fig. 5). This suggested that RPE
cells might express CD44 variant isoforms in addition
to CD44s. To test this hypothesis, Southern hybridization of the PCR products was performed using probes
specific for CD44 variant exon v6 or vlO.42 Five of five
cell lines expressed variants containing CD44s plus
FIGURE 5. Samples from Fig. 4A were amplified to 35 cycles.
Note extra bands above the CD44 standard band (arroiv).
Note that at this cycle number, CD44s is in plateau phase
and corresponding band intensities are approximately equal
(compare with Fig. 4 in which amplification was performed
at lower cycle number during the exponential amplification
phase).
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933196/ on 06/17/2017
2033
CD44 in Cultured Human Retinal Pigment Epithelial Cells
1
2
3
4
P3
A
V6+
A3D8
984
V6
B
10"
102
103
10*
Fluorescence intensity
V10+
V1O
492
FIGURE 6. Detection of CD44 variant isoforms by Southern
hybridization. CD44 PCR products from cells of varying densities without (-) or with ( + ) retinoic acid (1 fiM) (from
same samples used in Fig. 5) were separated on 2% agarose
gel, blotted onto positively charged nylon membrane, and
subsequently hybridized with an exon v6 internal oligonucleotide probe that is specific for variant isoforms containing
exon v6 (A), or an exon vlO internal oligonucleotide probe
(B). Expression of both v6- and vlO-containing variants decreased with cell density, and retinoic acid enhanced the
cell density-induced downregulation (v6 or vlO represents
CD44s plus exon v6 or vlO; v6+ or vlO+ represents CD44s
plus exon v6 or vlO plus other exons).
Expression and Density-Dependent Modulation
of CD44 Protein in Human Retinal Pigment
Epithelial Cells
Flow cytometry was used to determine whether CD44
cell surface protein was expressed by human RPE cells.
CD44 cell surface protein was strongly expressed on
3 of 3 RPE cell lines (Fig. 7). Mean fluorescent intensity, a measure of CD44 cell surface expression, decreased with increased cell density (Fig. 8), confirming
the findings suggested by RT-PCR. The mean fluorescence intensity on sparse cells was 1016.10 ± 55.31
and was 193.58 ± 96.93 on dense cells (mean ± SD
of the 3 cell lines). This difference was statistically
significant (P < 0.01 by Student's paired <-test). Addition of retinoic acid, however, did not significandy
affect the expression of CD44 cell surface protein on
either the sparse or dense cell cultures (data not
shown).
To confirm the flow cytometiy results, CD44 protein expression was determined by Western hybridization of RPE whole-cell lysates. Incubation of lysates
with A3D8 produced an intense 80-kDa band. The size
of this band is consistent widi that of the CD44 standard form found in other tissues.11020'45 Several larger
FIGURE 7. Flow cytometric analysis of cell surface expression
of CD44. Fluorescence intensity, expressed as a 4-decade log
scale, is plotted versus cell number. The cells were incubated
with CD44 antibody A3D8 and analyzed by indirect immunofluorescence and flow cytometiy. The profile of negative
control IgG P3 preparation is also shown in the panel. Data
are representative of three separate experiments performed
on three different cell lines.
molecular weight isoforms ranging from 120 to 170
kDa were also observed. It was not possible to determine the identity of these isoforms, because the antibody used in these studies, A3D8, recognizes all forms
of CD44. Aldiough monoclonal antibodies against
CD44v6, 11.9 and 11.31 (from Charles Mackay, Basel,
Switzerland),37 were available to us, they did not work
well when used for Western hybridization (data not
shown). By semiquantitative Western blot analysis, the
levels of the 80-kDa form of CD44 dramatically decreased with increasing cell density. This effect was
102
Fluorescence intensity
FIGURE 8. Flow cytometric analysis of cell surface expression
of CD44 at various cell densities. (A) sparse cells (mean
fluorescent intensity = 964); (B) preconfluent cultured cells
(mean = 649); (C) 4-week postconfluent cultured cells
(mean = 406); and (D) 9-week postconfluent cultured cells
(mean = 264). Mean fluorescence decreased significantly
as cells became increasingly dense. Data are representative
of three separate experiments performed on three different
cell lines.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933196/ on 06/17/2017
Investigative Ophthalmology 8c Visual Science, September 1997, Vol. 38, No. 10
2034
kDa
205
!
mm
m -
I
117
—80
-50
O
r- t- (fi
CO
N
m m
(VJ <M r-
S
M
T-
f\J
W
ifl
G)
CM
r-
(£
M
co co oo ro m
U5
t
N
FIGURE 9. Detection of CD44 proteins immobilized on nitrocellulose filters by Western blot. Protein extracts (10 j/g)
from RPE cells at different stages of culture (1 = sparse
cells; 2 = preconfluent cells; 3 = visually confluent cells; 4
= 2-week postconfluent cells; 5 = 4-week postconfluent cells;
and 6 = 9-week postconfluent cells) without (—) or with
( + ) retinoic acid (1 //M) were separated by polyacrylamide
gel electrophoresis, transferred to nitrocellulose, and reacted with mAb A3D8. mAb was visualized by indirect immunoperoxidase and chemiluminescence. Note a major 80-kDa
band and several higher molecular weight bands. The absolute mean gray value for each of the 80-kDa bands measured
by NIH densitometric software (NIH Image, version 1.55,
Bethesda, MD) is shown at the bottom of the figure.
enhanced by retinoic acid in 4-week postconfluent
cells (Fig. 9). No staining was observed with control
mAb P3 (not shown).
a malignant metastatic phenotype. For example, the
expression of exon v6-containing variants has been
shown to correlate with advanced stages of human
breast and colon cancers and aggressive metastatic human lymphoma.24'28'29'47 Metastatic rat pancreas and
breast cancer cell lines also express exon v6.22 However, certain normal tissues also express variants containing exons v6 or vlO, or both. For example, splenic
B cells and activated T lymphocytes and lymph nodes
express CD44 variants containing only exon v6 or
vlO.48'49 Moreover, normal epithelial tissues, such as
human gastric mucosa, cervical epithelium, and urothelium, express exon v6- or vlO-containing variants.23'50"52 In normal tissues, however, the functions
of CD44 variants are unknown. It is likely that CD44
variants in nonmalignant epithelium cells serve an adhesive function relating to the interaction and migration of these cells.37
In all RPE cell lines examined, CD44s mRNA expression and CD44 protein were downregulated as
cells became increasingly dense and proliferation
slowed. Furthermore, mRNA expression of the variants containing exons v6 and vlO also decreased with
increased cell density and decreased cell proliferation.
Similarly, we (current report) and others30'31 did not
detect CD44 in normal, nondividing contact-inhibited
RPE cells in situ. These results suggest that CD44s and
variant expression is regulated by cell proliferation
or cell-cell contact. This hypothesis is supported by
observations made on several other epithelial tissues.
In small intestine and colon, by immunohistochemical
Immunohistochemistiy
IgGl
Results of CD44 mRNA expression, flow cytometry,
and Western hybridization suggested that CD44 was
preferentially expressed in proliferating RPE cells. To
further support this observation, immunohistochemical staining was performed on normal adult and fetal
human retinal sections to determine whether RPE expressed CD44 in situ. RPE cells in situ normally have
a low proliferation rate.46 No CD44 reactivity was detected in either fetal (Fig. 10) or adult (not shown)
human RPE cells in situ.
4F2
A3D8
DISCUSSION
In the current study, we have shown that cultured
human RPE cells express the standard form of CD44
mRNA and its cell surface protein. In addition, these
cells express CD44 variant mRNA containing exon v6
or vlO. CD44s expression has also been observed on
a wide variety of cells and tissues.1'2'19 The tissue distribution of cells that express CD44 variants containing
exon v6 and vlO is more restricted. In some tissues
expression of these variants has been correlated with
FIGURE 10. Immunohistochemical staining of normal human
retinal pigment epithelium. Shown are photomicrographs
of frozen sections of 20-week fetal human retinal pigment
epithelium stained by indirect immunofluorescence with
(A) negative control mAb P3, (B) 4F2 (antibody directed
against Na+-K+ ATPase) as a positive control, or (C) A3D8
(antibody directed against CD44). Note that Muller cells in
the fetal retina do not express CD44. RE = neural retina;
RPE = retinal pigment epithelium; CH = choroid).
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933196/ on 06/17/2017
CD44 in Cultured Human Retinal Pigment Epithelial Cells
2035
staining, CD44 is readily apparent on dividing epithelial cells in the base of crypts, but absent from nondividing epithelial cells near the mouth of the crypts
and on the villi.35'53 In a variety of stratified squamous
epithelia (for example, epidermis, tongue, cheek, and
esophagus), CD44 is present on cells in the basal layers
in which most of the cell division occurs, but is absent
from the more superficial layers that contain primarily
nondividing cells.35 Similarly, in cultured 3T3 cells,
actively proliferating cells express greater amounts of
CD44 than their nonproliferating counterparts.35 During human mucosal wound healing, CD44 is expressed
on migrating keratinocytes at all stages.54 Terpe et al36
and Mackay et al37 also reported that the region of
epithelia expressing the highest levels of the CD44
variant isoforms were those with a high rate of cell
division, particularly the basal cells of stratified squamous epithelium and glandular epithelium. Taken together, these data and those reported in the current
study suggest that CD44 is preferentially expressed in
actively dividing cells.
We observed differences in variant expression
among RPE cell lines. In ARPE-19 cells larger variants
with sizes of approximately 870 bp and 1100 bp were
identified, which were not clearly observed on other
RPE cell lines. According to the size and hybridization
pattern with exon-specific probes, the 870-bp variant
containing exon vlO is most likely the "epithelial variant" comprising exons v8 to vlO, which exhibits a
theoretical length of 867 bp (471 bp for CD44s plus
396 bp).27'37'51'55'56 The 1100-bp variant containing
exon v6 probably represents exons v3 to v7 (theoretical length of 1089 bp).51 This pattern of variant expression is similar to that of splenic B cells and diffuse
large-cell lymphomas, in which four variants containing exon v6 only, vlO only, v8 to vlO, or v6 to vlO
(1086 bp), respectively, were expressed.48 Cells from
the ARPE-19 line grow much more rapidly compared
with the other cell lines used in this study. When the
cells became dense and the cell proliferation slowed,
the larger variants disappeared. We hypothesize that
expression of these two larger variants is closely related to RPE cell proliferation. In cells from all the
other tested lines, which grew more slowly than ARPE19 cells, the larger variants were not detected.
Retinoic acid, which induces differentiation in a
variety of epithelial cell types, promotes RPE cell density arrest and cell differentiation.57"59 We found that
retinoic acid enhanced the density-induced downregulation of CD44 standard and variant mRNA expression. However, this effect was lost as cells became increasingly dense and well-differentiated. In contrast,
retinoic acid induces CD44 expression in human neuroblastoma cells and does not affect CD44 expression
in ovarian carcinoma cell lines.60'61 In human thymic
epithelial cells, standard CD44 is downregulated and
variant CD44 is upregulated with density-arrested cell
differentiation, and variant CD44 expression is induced by retinoic acid.45
Although retinoic acid consistently enhanced the
downregulation of CD44 mRNA expression and decreased soluble CD44s protein in 4-week postconfluent cells, it did not influence cell surface CD44 expression as determined by flow cytometry. The effect of
retinoic acid on soluble CD44s protein is difficult to
interpret because the data were obtained from a single
cell line and the result was observed in only one cell
density group. Dissociation between mRNA expression and protein production has been described previously. For example, we have previously shown that
interleukin-1 receptor antagonist (IL1-RA) mRNA is
upregulated by cytokines, but that IL1-RA protein production is unaffected by cytokine treatment.38 The reason that retinoic acid downregulated CD44 mRNA expression but not cell surface protein remains unknown. Further investigation will be needed to clarify
this phenomenon.
The significance of CD44 upregulation on dividing RPE cells is unknown. In eyes with rhegmatogenous retinal detachment and proliferative vitreoretinopathy, normally quiescent density-arrested cells in the
RPE monolayer begin to migrate and proliferate into
the subretinal space onto the undersurface and surface of the retina and into the vitreous cavity.32"34 The
cells adhere to the retina and secrete collagen, forming a fibrocellular scar. Furthermore, the cells are suddenly exposed to high concentrations of hyaluronic
acid, which passes from the vitreous cavity into the
subretinal space.62 We have previously shown that RPE
cell cytokine expression is influenced by hyaluronic
acid.63 We hypothesize that upregulation of CD44, a
major hyaluronic acid-binding protein, may render
RPE cells sensitive to the cytokine-modulating activity
of hyaluronic acid in the subretinal space or vitreous
cavity. Alternatively, CD44 expression could modulate
RPE cell adhesion on the retina or in fibrocellular
membranes. Experiments to test these hypotheses are
currently underway in our laboratory.
Key Words
cell density, CD44, culture, retinal pigment epithelium, retinoic acid
Acknowledgment
The authors thank Paula K. Greer for her excellent technical
assistance.
References
1. Haynes BF, Telen MJ, Hale LP, Denning SM. CD44—
a molecule involved in leukocyte adherence and Tcell activation. Immunol Today. 1989; 10:423-428.
2. Picker LJ, Nakache M, Butcher EC. Monoclonal and-
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933196/ on 06/17/2017
2036
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Investigative Ophthalmology 8c Visual Science, September 1997, Vol. 38, No. 10
bodies to human lymphocyte homing receptors define
a novel class of adhesion molecule on diverse cell
types. / Cell Biol. 1989; 109:927-937.
Salmi M, Gron-Virta K, Sointu P, Grenman R, Kalimo
H, Jalkanen S. Regulated expression of exon v6 containing isoforms of CD44 in man: Down-regulation
during malignant transformation of tumors of squamocellular origin. / Cell Biol. 1993; 122:431-442.
Goodfellow PN, Banting G, Wiles MV, et al. The gene,
MIC4, which controls expression of the antigen defined by monoclonal antibody F10-44-2 is on human
chromosome 11. EurJImmunol. 1982; 12:659-663.
Lesley J, Hyman R, Kincade PW. CD44 and its interaction with extracellular matrix. Adv Immunol. 1993;
54:271-335.
Jackson DG, Buckley J, Bell JI. Multiple variants of the
human lymphocyte homing receptor CD44 generated
by insertions at a single site in the extracellular domain. JBiol Chem. 1992;267:4732-4739.
Screaton GR, Bell MV, Jackson DG, Cornelis FB, Gerth
U, Bell JI. Genomic structure of DNA encoding the
lymphocyte homing receptor CD44 reveals at least 12
alternatively spliced exons. Proc Natl Acad Sci USA.
1992;89:12160-12164.
Gimthert U. CD44—a multitude of isoforms with diverse functions. Curr Top Microbiol Immunol. 1993;184:
47-63.
Underhill C. CD44: The hyaluronan receptor. / Cell
Sci. 1992; 103:293-298.
Jackson DG, Bell JI, Dickinson R, Timans J, Shields
J, Whitde N. Proteoglycan forms of the lymphocyte
homing receptor CD44 are alternatively spliced variants containing the v3 exon. / Cell Biol. 1995;128:673685.
Lokeshwar VB, Bourguignon LYW. Post-translational
protein modification and expression of ankyrin-binding site(s) in GP85 (Pgp-1/CD44) and its biosynthetic
precursors during T-lymphoma membrane biosynthesis. JBiol Chem. 1991;266:17983-17989.
Kalomiris EL, Bourguignon LYW. Mouse T lymphoma
cells contain a transmembrane glycoprotein (GP85)
that binds ankynn. J Cell Biol. 1988; 106:319-327.
Aruffo A, Stamenkovic E, Meinick M, Underhill CB,
Seed B. CD44 is the principal cell surface receptor for
hyaluronate. Cell. 1990;61:1303-1313.
Culty M, Miyake K, Kincade PW, et al. The hyaluronate
receptor is a member of the CD44 (H-CAM) family of
cell surface glycoproteins. / Cell Biol. 1990; 111:27652774.
Miyake K, Underhill CB, LesleyJ, Kincade PM. Hyaluronate can function as a cell adhesion molecule and
CD44 participates in hyaluronate recognition. / Exp
Med. 1990; 172:69-75.
Peach RJ, Hollenbaugh D, Stamenkovic I, Aruffo A.
Identification of hyaluronic acid binding sites in the
extracellular domain of CD44. / Cell Biol. 1993;122:
257-264.
Carter WG, Wayner EA. Characterization of die class
III collagen receptor, a phosphorylated transmembrane glycoprotein expressed in nucleated human
cells. JBiol Chem. 1988;263:4193-4201.
18. Jalkanen S, Jalkanen M. Lymphocyte CD44 binds the
COOH-terminal heparin-binding domain of fibronectin. / Cell Biol. 1992; 116:817-825.
19. Haynes BF, Liao HX, Patton KL. The transmembrane
hyaluronate receptor (CD44): Multiple functions,
multiple forms. Cancer Cells. 1991;3:347-350.
20. Haynes BF, Hale LP, Patton KL, Martin ME, McCallum RM. Measurement of an adhesion molecule as
an indicator of inflammatory disease activity: Up-regulation of the receptor for hyaluronate (CD44) in rheumatoid arthritis. Arthritis Rheum. 1991;34:1434-1443.
21. Noble PW, Lake FR, Henson PM, Riches DW. Hyaluronate activation of CD44 induces insulin-like growth
factor-1 expression by a tumor necrosis factor-alphadependent mechanism in murine macrophages. JClin
Invest. 1993; 91:2368-2377.
22. Giinthert U, Hofmann M, Rudy W, et al. A new variant
of glycoprotein CD44 confers metastatic potential to
rat carcinoma cells. Cell. 1991;65:13-24.
23. Heider KH, Dammrich J, Skroch-Angel P, et al. Differential expression of CD44 splice variants in intestinaland diffuse-type human gastric carcinomas and normal gastric mucosa. Cancer Res. 1993; 53:4197-4203.
24. Heider KH, Hofmann M, Horst E, et al. A human
homologue of the rat metastasis-associated variant of
CD44 is expressed in colorectal carcinomas and adenomatous polyps. / Cell Biol. 1993; 120:227-233.
25. Rudy W, Hofmann M, Schwartz-Albiez R, et al. Two
major CD44 proteins expressed on a metastatic rat
tumor cell line are derived from different splice variants: Each one individually suffices to confer metastatic behavior. Cancer Res. 1993;53:1262-1268.
26. Seiter S, Arch R, Reber S, et al. Prevention of tumor
metastasis formation by anti-variant CD44. J Exp Med.
1993; 177:443-455.
27. Rail CJN, Rustgi AK. CD44 isoform expression in primary and metastatic pancreatic adenocarcinoma. Cancer Res. 1995;55:1831-1835.
28. Dall P, Heider KH, Sinn HP, et al. Comparison of
immunohistochemistry and RT-PCR for detection of
CD44v-expression, a new prognostic factor in human
breast cancer. IntJ Cancer. 1995; 60:471-477.
29. Herrlich P, Pals S, Ponta H. CD44 in colon cancer
(review). Eur J Cancer. 1995;31A:1110-1112.
30. Duguid IG, Boyd AW, Mandel TE. The expression of
adhesion molecules in the human retina and choroid.
Aust N ZJ Ophthalmol. 1991; 19:309-316.
31. Chaitin MH, Wortham HS, Brun-Zinkernagel AM. Immunocytochemical localization of CD44 in the mouse
retina. Exp Eye Res. 1994; 58:359-365.
32. Machemer R, Laqua H. Pigment epithelial proliferation in retinal detachment (massive periretinal proliferation). Am J Ophthalmol. 1975;80:l-23.
33. Machemer R, von Horn D, Aaberg TM. Pigment epithelial proliferation in human retinal detachment. Am
J Ophthalmol. 1978;85:181-191.
34. Hilton G, Machemer R, Michels R, Okun E, Schepens
C, Schwartz A. The classification of retinal detachment
with proliferative vitreoretinopathy. Ophthalmology.
1983;90:121-125.
35. Alho AM, Underhill CB. The hyaluronate receptor
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933196/ on 06/17/2017
CD44 in Cultured Human Retinal Pigment Epithelial Cells
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
is preferentially expressed on proliferating epithelial
cells. J Cell Biol. 1989; 108:1557-1565.
Terpe A, Franke F, Stark H, et al. Occurrence of CD44
and its isoforms under orthological and pathological
conditions. Verh Dtsch Ges Pathol. 1993;77:276-281.
Mackay CR, Terpe HJ, Stauder R, Marston WL, Stark
H, Gunthert U. Expression and modulation of CD44
variant isoforms in humans. J Cell Biol. 1994; 124:7182.
Jaffe GJ, Van Le L, Valea F, et al. Expression of interleukin-1 alpha, interleukin-1 beta, and interleukin1 receptor antagonist in human retinal pigment epithelial cells. ExpEyeRes. 1992;55:325-335.
Dunn KC, Aotaki-Keen AE, Putkey FR, Hjelmeland
LM. ARPE-19, a human retinal pigment epithelial cell
line with differentiated properties. Exp Eye Res. 1996;
62:155-169.
Kawasaki ES. Amplification of RNA. In: Innis MA, Gelfand DN, SninskyJJ, White TJ, eds. PCR Protocols. London: Academic Press; 1990:21-27.
Jaffe GJ, Roberts WL, Wong HL, Yurochko AD, Cianciolo GJ. Monocyte-induced cytokine expression in cultured human retinal pigment epithelial cells. Exp Eye
Res. 1995; 60:533-543.
Hale LP, Haynes BF, McCachren SS. Expression of
CD44 variants in human inflammatory synovitis. J Clin
Immunol. 1995; 15:300-311.
Telen MJ, Eisenbarth GS, Haynes BF. Human erythrocyte antigens: Regulation of expression of a novel
erythrocyte surface antigen by the inhibitor Lutheran
In(Lu) gene./ Clin Invest. 1983;71:1878-1886.
Burnette WN. "Western blotting": Electrophoretic
transfer of proteins from sodium dodecyl sulfate—
polyacrylamide gels to unmodified nitrocellulose and
radiographic detection with antibody and radioiodinated protein A. Anal Biochem. 1981; 112:195-203.
Patel DD, Hale LP, Whichard LP, Radcliff G, Mackay
CR, Haynes BF. Expression of CD44 molecules and
CD44 ligands during human thymic fetal development: Expression of CD44 isoforms is developmentally regulated. Int Immunol. 1995; 7:277-286.
Nagai H, Kalnins VI. Normally occurring loss of single
cells and repair of resulting defects in retinal pigment
epithelium in situ. ExpEyeRes. 1996;62:55-61.
Koopmann G, Heider KH, Horst E, et al. Activated
human lymphocytes and aggressive non-Hodgkin
lymphomas express a homologue of the rat metastasisassociated variant of CD44. J Exp Med. 1993; 177:897904.
Salles G, Zain M, Jiang WM, Boussiotis VA, Shipp MA.
Alternatively spliced CD44 transcripts in diffuse largecell lymphomas: Characterization and comparison
with normal activated B cells and epithelial malignancies. Blood. 1993; 82:3539-3547.
Stauder R, Eisterer W, Thaler J, Gunthert U. CD44
2037
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
variant isoforms in non-Hodgkin's lymphoma: A new
independent prognostic factor. Blood. 1995; 85:28852899.
Mirecka J, Marx D, Schauer A. Immunohistochemical
localization of CD44 variants 5 and 6 in human gastric
mucosa and gastric cancer. Anticancer Res. 1995;15:
1459-1465.
Dall P, Heider KH, Hekele A, et al. Surface protein
expression and messenger RNA-splicing analysis of
CD44 in uterine cervical cancer and normal cervical
epithelium. Cancer Res. 1994;54:3337-3341.
Southgate J, Trejdosiewicz LK, Smith B, Selby PJ. Patterns of splice variant CD44 expression by normal human urothelium in situ and in vitro and by bladdercarcinoma cell lines. Int J Cancer. 1995; 62:449-456.
Abbasi AM, Chester KA, Talbot IC, et al. CD44 is associated with proliferation in normal and neoplastic human colorectal epithelial cells. EurJ Cancer. 1993;29A:
1995-2002.
Oksala O, Salo T, Tammi R, et al. Expression of proteoglycans and hyaluronan during wound healing. J
Histochem Cytochem. 1995;43:125-135.
Brown TA, Bouchard T, St John T, Wayner E, Carter
WG. Human keratinocytes express a new CD44 core
protein (CD44E) as a heparan-sulfate intrinsic membrane proteoglycan with additional exons. / Cell Biol.
1991;113:207-221.
Cooper DL, Dougherty G, Ham HJ, et al. The complex
CD44 transcriptional unit: Alternative splicing of three
internal exons generates the epithelial form of CD44.
Biochem Biophys Res Commun. 1992; 182:569-578.
Peehl DM, Wong ST, Stamey TA. Vitamin A regulates
proliferation and differentiation of human prostatic
epithelial cells. Prostate. 1993; 23:69-78.
Choi Y, Fuchs E. TGF-beta and retinoic acid: Regulators of growth and modifiers of differentiation in human epidermal cells. Cell Regul. 1990; 1:791-809.
Campochiaro PA, Hackett SF, Conway BP. Retinoic
acid promotes density-dependent growth arrest in human retinal pigment epithelial cells. Invest Ophthalmol
VisSci. 1991;32:65-72.
Gross N, Beck D, Beretta C, Jackson D, Perruisseau
G. CD44 expression and modulation on human neuroblastoma tumours and cell lines. Eur J Cancer. 1995;
31A:47l-475.
Uhl-Steidl M, Muller-Holzner E, Zeimet AG, et al.
Prognostic value of CD44 splice variant expression in
ovarian cancer. Oncology. 1995;52:400-406.
Kirchhof B, Kirchhof E, Ryan SJ, Sorgente N. Vitreous
modulation of migration and proliferation of retinal
pigment epithelial cells in vitro. Invest Ophthalmol Vis
Sci. 1989;30:1951-1957.
Berger AS, Jaffe GJ. Hyaluronic acid modulates cytokine expression by human RPE cells. Invest Ophthalmol
Vis Sci. 1995; 36:204. Abstract.
Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/journals/iovs/933196/ on 06/17/2017