AGRICULTURAL RESEARCH COMMUNICATION CENTRE Asian J. Dairy & Food Res, 34(4) 2015:280-284 www.arccjournals.com Print ISSN:0971-4456 / Online ISSN:0976-0563 Isolation of exopolysaccharides producing lactic acid bacteria from dairy products Prasad Patil*, Akanksha Wadehra1, Kanchan Munjal and Pradip Behare Dairy Microbiology Division, ICAR- National Dairy Research Institute, Karnal-132 001, India. Received: 25-08-2015 Accepted: 10-09-2015 DOI: 10.18805/ajdfr.v34i4.6878 ABSTRACT Currently, much attention is being paid for improving the texture of food by screening the new exopolysaccharides (EPS) producing strains. The aim of the present work was to isolate EPS producing Lactic acid bacteria (LAB) strains from raw milk and milk products samples. Total of thirty eight dahi, lassi and raw milk samples were collected from different villages and towns of Karnal and Delhi District. The samples were plated on milk agar and colonies showing ropy polysaccharides production were subjected to biochemical test. After molecular identification 2 were found as S. thermophilus, 2 were Lb. rhamnosus and 2 were confirmed as Lb. fermentum. Two S. thermophilus strains (PD7 and PD11) and Lb. fermentum strains (AL6 and AD3) showed better curdling pattern, acidity, exopolysaccharides production, and sensory properties. These cultures can be used for manufacture of indigenous fermented milk products. Key words: Dahi, Exopolysaccharides, Lb. fermentum, Lb. rhamnosus, S. thermophilus. INTRODUCTION Lactic acid bacteria (LAB) are gram-positive microorganisms that play an essential role in the industrial production of fermented dairy products. The metabolic products they generate during fermentation and ripening confer the rheological and organoleptic qualities desired by these products (Bennama et al., 2012). Some strains are known to produce exopolysaccharide (EPS), which play an important role in the development of the texture of yoghurt and other fermented milks, cheeses and low fat dairy desserts (Hassan, 2008). EPS from LAB are divided into two groups, homo- and hetero-EPS. Homo-EPS are composed of one type monosaccharide, whereas hetero-EPS consist of regular repeating units of 3-8 different carbohydrate molecules. EPS imparts highly desirable rheological changes in the food matrix such as increased viscosity, improved texture and reduced syneresis (Badel et al., 2011). Incorporation of EPS or EPS-producing starters in dairy foods can provide viscosifying, stabilizing, and water-binding functions. In situ production of EPS is very important in the manufacture of fermented dairy products, such as yogurt, drinking yogurt, cheese, cultured cream and milk-based desserts. EPSproducing LAB has a greater ability to withstand technological stresses (Stack et al., 2010) and survive the passage through the gastrointestinal tract compared to their non-producing bacteria. In recent times, EPS produced by LAB have received mounting attention; mainly because of their health benefits. EPSs have been proved to show important health benefits like antioxidant, cholesterol lowering, antitumor, antiviral, and immunomodulatory activities (Madhuri and Prabhakar, 2014). Also, they reduce formation of pathogenic biofilms, help in modulation of adhesion to epithelial cells and increase levels of bifidobacteria showing a prebiotic potential (Hongpattarakere et al., 2012). Hence, the choice of EPS- producing starter cultures seems to give several advantages over non- producing ones. Also, LAB possess generally regarded as safe (GRAS) status which allows them to be incorporated in food without labeling. Most of the EPSproducing LAB can be isolated from different fermented foods such as dahi, lassi, yoghurt, cultured buttermilk, cheeses, yoghurt, kefir, and other fermented dairy products (Bunkoed and Thaniyavarn, 2014). Furthermore, EPSproducing strains can be also found in other environments such as gut of different animals and humans. Selection for LAB strains with newer properties can be used as new, functional starter cultures may lead to improved fermentation process and an enhanced quality of the end product. As information regarding isolation of EPS producing cultures from dairy products in Indian condition is scanty. The present study was undertaken to isolate EPS producing LAB from fermented dairy food for application in fermented milk products. MATERIALS AND METHODS Collection of samples: In an attempt to isolate some potential strains of EPS producing LAB, total 38 different *Corresponding author’s e-mail: [email protected]; 1Dairy Technology Division, ICAR-NDRI, Karnal. Volume 34 Issue 4 (2015) 281 samples of milk and milk products comprising of raw milk (12), dahi (16), and lassi (10) were collected in sterile plastic bottles from local market and rural and urban areas near Karnal and Delhi. formation of long, ropy and viscous strand. The symbols for ropy polysaccharide production as observed visually was given as less ropy (+), medium ropy (++) and highly ropy (+++). Reference strains and media: The standard cultures of Lactobacillus fermentum NCDC-141, Lactobacillus rhamnosus NCDC-24 and Streptococcus thermophillus NCDC-144 were procured from National Collection of Dairy Cultures (NCDC), National Dairy Research Institute (NDRI), Karnal. Lactobacillus strains were isolated on Man, Rogosa and Sharpe (MRS) agar and modified MRS agar (Messens et al., 2002). The addition of a reducing agent such as cysteine 0.05% to MRS improves the specificity of this medium for Lactobacillus isolation (Shah, 2000). M17 and skim milk agar were used for S. thermophillus strains (Birollo et al., 2000). Skim milk agar medium was used for EPS producing strains. All strains were stored at -20 °C in their corresponding isolation medium, containing 30% (vol/vol) glycerol as a cryoprotectant. Identification of LAB : The isolates were streaked on MRS and M17 with 4% sucrose medium for examination of morphological characteristics. The mucoid and ropy colonies on agar plate were observed by touching colonies with a sterile loop. The ropy colonies, formed a long filament when extended with a loop whereas the mucoid colonies have a slimy appearance on agar plates and were not able to produce strands by this method (RuasMadiedo and De Los Reyes-Gavilán, 2005). All isolates were tested for catalase and oxidase activity, Gram staining and spore formation. All Gram positive and catalase negative rods and cocci were tested for the growth in MRS and M17 broth respectively at 10, 37 and 45 ºC (Abbas and Mahasneh, 2014). The suspected colonies were subjected to biochemical tests by using API 50 CH kit and CHL media ( Biomérieux, France). Further, confirmation of Lactobacillus spp. ( Lb. fermentum and Lb. rhamnosus) and S. thermophillus were done by molecular methods with some modification in PCR steps using reported primers by Song et al. (2000); Lick et al. (1996). The sequence of primers and the corresponding PCR cycle is given in Table 1. PCR was performed in a Biorad PCR System (S1000 Thermal cycler,Singapore). The amplified PCR products were then separated by agarose gel electrophoresis, stained with ethidium bromide and were subsequently visualized by UV transilluminator. Isolation of LAB: Appropriate dilutions of the samples were plated on the MRS and M17 agar. Viable counts were enumerated after incubation at 37 ºC and 42 ºC for 48-72 h. The individual colonies with different morphology were picked using tooth pick and grown in MRS and M17 broth. Further it was plated to check for purity. A total 80 presumptive LAB were isolated. Screening for EPS production Capsule formation: The ability of cultures to form a capsule was evaluated by capsule staining method (Anthony, 1931). A thin smear was prepared from actively grown culture in skim milk followed by air drying without hit fixing. Few drop of crystal violet were added for 2 min and smear rinsed with 20 % (w/v) copper sulphate solution. The slides were air dried and examined under oil immersion lens, the capsules could be observed layer around the cell surface. Ropy polysaccharide production: Production of ropy polysaccharide was observed visually. The culture were grown in skim milk tubes and after the curdling, tubes were vigorously shaken to break the curd. The broken curd was picked up with sterile loop or glass rod and observed for Technological screening: The milk (12% reconstituted skim milk) was fermented with identified EPS producing LAB strains at 37°C till curd is settled down. Technological parameters such as titratable acidity, curdling time, flavour, body and texture were evaluated. Titratable acidity of fermented milk was evaluated by titration method, while curdling time, flavour, body and texture simply by sensory method. RESULTS AND DISCUSSION Isolation of EPS producing LAB: Milk is the favourable environment for secretion of extracellular polysaccharide from several strains of LAB. In this study, total 80 isolates TABLE 1: Species-specific primers and PCR cycle of LAB isolates Organisms Primer sequence Polymerase chain reaction cycle Lactobacillus rhamnosus Lactobacillus fermentum Streptococcus thermophillus F- 5' CTAGCGGGTGCGACTTTGTT 3' R-5' GCGATGCGAATTTCTATTATT 3' F- 5' ACTAACTTGACTGATCTACGA 3' R-5' TTCACTGCTCAAGTAATCATC 3' F-5' CAC TAT GCT CAG AAT ACA 3' R-5' CGA ACA GCA ITG ATG ITA3' 95C 4 min, 95C 4 min, 62C 2 min, 62C 2 min, 74C 5 min; 35 Cycles 95C 4 min, 95C 20 s, 60C 2 min, 60C 2 min, 74C 5 min; 35 Cycles 95C 4min, 95C 30 s, 54C 45 s, 72C 45 s; 30 Cycles Amplicon size 113 bp 192 bp 968 bp References Song et al. (2000) Song et al. (2000) Lick et al. (1996) 282 ASIAN JOURNAL OF DAIRY AND FOOD RESEARCH were obtained from milk and milk products collected from different sources. Based on morphological evaluation, some cocci and rod shaped isolates were selected (Fig. 1). Total 34 isolates were showed mucoid colonies on milk agar medium. All these EPS producing bacteria were of gram positive and catalase negative, which is a typical characteristic of LAB. These colonies showed clean lactic fermentation without any defects. The isolates with EPS were able to grow in milk and gave positive litmus milk test in 24 h as illustrated in Fig. 2. Repetitive streaking method was followed to purify all the suspected cultures. Previously, the numbers of EPS producing LAB were isolated from milk and milk products (Lavanya et al., 2011; Bennama et al., 2012). Screening for EPS production: There are 2 types of EPS i.e. capsular polysaccharides (CPS) and ropy polysaccharides (RPS). CPS formation was evaluated by the Indian ink negative staining technique on the cells of LAB. Capsule staining revealed that around 14 isolates shown large capsule surrounding the cell surface while rest exhibited small or no capsule. Among the 14 isolates, PD11, AR2, AL6 produced larger and thick capsule (Fig.3). Isolate AD14 and PR5 did not show capsular polysaccharides production. Generally, FIG 1: Morphology of LAB isolates [(a) & (b) – rods; (c)- cocci] FIG 2: Litmus milk test: left- control, right- positive test by strain DP 11 capsular and ropy polysaccharides production greatly differs from culture to culture and certain strains were able to produce both types. Both CPS and RPS strains have been found in lactic acid bacteria (Mozzi et al., 2009). However, eighteen cultures showed the ropy polysaccharides production although long strand formation varied from strain to strain. Isolates AL6, AD3, AL18, AR2, PD11, PL7, PR3 shown highly ropy strand formation in curd, while isolates AD14, PD7, PD16, PD19, AL2, PD1 shown medium ropy strand in curd, and isolate PL5, PL6, AR5 shown less ropy strand in curd (Table 2). Figure 4 showed the ropy polysaccharide production by PD11 strain. As dairy industry point of view, the RPS producing strains were found to be more relevant as they are considered to be providing natural FIG 3: Capsule formation by isolates (a) PD11, (b) AR2, (c) AL6. TABLE 2: Technological Screening of EPS producing LAB strains EPS producing LAB strains AL6 AD3 AL18 PD7 AR2 PR5 PD19 PD11 Type of EPS CPS RPS + + + + + + + +++ +++ +++ ++ +++ + ++ +++ Acidity (% Lactic Acid) 0.72 0.78 0.67 0.82 0.70 0.66 0.69 0.84 Curdling time (h) 7 7 9 6 8 8 9 6 Flavor, body and texture Good body and texture, pleasant flavor Good body and texture, pleasant flavor Poor body and texture and flavor Good body and texture, pleasant flavor Good body and texture but acidic Good body and texture, poor flavo Good body and texture, poor flavo Good body and texture, pleasant flavor Volume 34 Issue 4 (2015) biothickness to the dairy product which enhances its technological properties. The use of yoghurt starter cultures that contain strains that produce EPS is a promising alternative. These polymers have been reported to improve the rheological behavior and texture of various fermented milk products (Badel et al., 2011). Even though both RPS and CPS increases the viscosity of the fermented product but only RPS can beneath a stretchable character provided by slime polysaccharides. The same was noticed in our isolates as well because the RPS producing cultures were found to be giving ropiness in the fermented milk therefore shown better technological attributes. FIG 4: Ropy polysaccharide produced by DP11 strain in fermented skim milk Identification of EPS producing LAB: The tentative isolates (n= 18) of LAB selected on the basis of microscopic and EPS production were further subjected to biochemical characterization. All isolates were tested for catalase and oxidase activity, Gram staining, spore formation and growth at 10, 37 and 45 ºC (Abbas and Mahasneh, 2014). After biochemical test by using API 50 CH kit and CHL media (Biomérieux, France), 5 cultures were identified as S. thermophillus and 8 were Lactobacillus spp. Further, confirmation of Lactobacillus spp. (Lb. fermentum and Lb. rhamnosus) and S. thermophillus were done by molecular methods. Thirteen isolates were examined for their species specificity by using PCR reaction with reported primers (Table 1). A quite appreciable quality and amount of amplicons were observed in all isolates (Figure 5). The amplicons of all the 8 isolates showed the reported PCR product size along with the positive controls. Out of 13, 8 biochemically identified isolates were confirmed as LAB strains. Out of 8 isolates, 4 isolates (AR2, PR5, PD19 AND PD11) were confirmed as S. thermophillus , 2 isolates (AL6 and AD3) were confirmed as Lb. fermentum and 2 isolates (AL18 and PD7) were confirmed as Lb. rhamnosus. 283 FIG 5: Identification of LAB by PCR (a)Lactobacillus fermentum, Lane1: AL6, Lane 2: AD3, Lane 3: + ve control (Lactobacillus fermentum NCDC-141), Lane 5: ladder ; (b) Lactobacillus rhamnosus, Lane 1: ladder, Lane 2: AL18, Lane 3: AD7, Lane 4: + ve control (Lactobacillus rhamnosus NCDC 24), Lane 5: ladder; (c) Sreptococcus thermophillus: Lane 1: ladder, Lane 2:AR2, Lane 3: PR5, Lane 4: PD19, Lane 5: PL6 Lane 7: + ve control (Sreptococcus thermophillus NCDC 144). Technological screening of EPS producing LAB: For the evaluation of technological properties of selected EPS producing LAB strains, acidity, curdling time and body and texture were used as indicator to select best strains. Table 2 shows result of technological properties and it was observed that four cultures AL6, AD3, PD7, and PD11 gave better results as compared to other four cultures. EPS production did not have effect on titratable acidity and curdling time hence clear cut relationship could not be established. The technological parameters which are greatly affected by EPS were flavour, body and texture and production of EPS improved these parameters. The effect of EPS cultures in improvement of properties of yoghurt, cheeses, dahi, lassi etc. are well demonstrated by rheological, sensory, and electron microscopic studies (Awad et al., 2005; Duboc and Mollet, 2001). CONCLUSIONS EPS producing LAB strains can be isolated from milk and traditionally made fermented milk products like dahi and lassi. These EPS producing cultures play important role in improvement of flavour and textural attributes. EPS also contributes to the mouth-feel, texture, and taste perception of fermented dairy products. However, EPS producing cultures should be initially screened for technological properties. The increasing demand for fat-free or reduced fat products is also raising interest in the use of EPS-producing LAB as natural bio-thickeners. There is need to establish specific EPS producing cultures for particular type of indigenous fermented milk products. ACKNOWLEDGMENTS The authors thankfully acknowledge the financial support from Indian Council of Agricultural Research, New Delhi and The Director, National Dairy Research Institute Karnal, India for providing cultures. Ms. Akanksha Wadehra is also thankful to DST for providing fellowship in the form of INSPIRE. 284 ASIAN JOURNAL OF DAIRY AND FOOD RESEARCH REFERENCES Abbas, M. M. and Mahasneh, A. M. (2014). Isolation of Lactobacillus strains with probiotic potential from camel’s milk. African Journal of Microbiology Research. 8:1645-1655. Anthony, E. E. (1931). A note on capsule staining. Science. 73: 319-320. Awad, S., Hassan, N. and Muthukumarappan, K. (2005). Application of exopolysaccharide-producing cultures in reduced fat cheddar cheese: texture and melting properties. Journal of Dairy Science. 88: 4204-4213. Badel, S., Bernardi, T. and Michaud, P. (2011). New perspectives for Lactobacilli exopolysaccharides. Biotechnology Advances. 29: 54-66. Bennama, R., Fernandez, M., Ladero, V., Alvarez, M.A., Rechidi- Sidhoum, N. and Bensoltane, A. (2012). Isolation of an exopolysaccharide- producing Streptococcus thermophilusfrom Algerian raw cow milk. European Food Research and Technology. 234: 119-125. Birollo, G. A., Reinheimer, J. A. and Vinderola, C.G. (2000). Viability of lactic acid microflora in different types of yoghurt. Food Research International. 33: 799-805. Bunkoed, O. and Thaniyavarn, S. (2014). Isolation of exopolysaccharides producing-lactic acid bacteria for fermented milks products. In the 26th Annual Meeting of the Thai Society for Biotechnology and International Conference - TSB2014".26–29 November 2014, Mae Fah Luang University, Chiang Rai, Thailand. Duboc, P. and Mollet, B. (2001). Applications of exopolysaccharides in dairy industry. International Dairy Journal. 11: 759-768. Hassan, A. N. (2008). ADSA Foundation Scholar Award: Possibilities and challenges of exopolysaccharide- producing lactic cultures in dairy foods. Journal of Dairy Science. 91:1282-1298. Hongpattarakere, T., Cherntong, N., Wichienchot, S., Kolida, S. and Rastall, R. A. (2012). In vitro prebiotic evaluation of exopolysaccharides produced by marine isolated lactic acid bacteria. Carbohydrate Polymers. 87: 846-852. Lavanya, B., Sowmiya, S., Balaji, S. and Muthuvelan, B. (2011). Screening and characterization of lactic acid bacteria from fermented milk. British. Journal of Dairy Science. 2: 5-10. Lick, S., Keller, M., Bockelmann, W. and Heller, J. (1996). Rapid identification of Streptococcus thermophilus by primerspecific PCR amplification based on its lacZ gene. Systematic and Applied Microbiology. 19: 74-77. Madhuri, K. V. and Prabhakar, K. V. (2014). Microbial Exopolysaccharides: Biosynthesis and Potential Applications. Oriental Journal of Chemistry. 30: 1401-1410. Messens, W., Neysens, P., Vansieleghem, W., Vanderhoeven, J. and De Vuyst, L. (2002). Modeling growth and bacteriocin production by Lactobacillus amylovorus DCE 471 in response to temperature and pH values used for sourdough fermentations. Applied and Environmental Microbiology. 68:1431-1435. Mozzi, F., Gerbino, E., Font de Valdez, G. and Torino, M. I. (2009). Functionality of exopolysaccharides produced by lactic acid bacteria in an in vitro gastric system. Journal of Applied Microbiology. 107: 56-64. Ruas-Madiedo, P. and De Los Reyes-Gavilán, C. G. (2005). Invited review: methods for the screening, isolation, and characterization of exopolysaccharides produced by lactic acid bacteria. Journal of Dairy Science, 88: 843-856. Shah, N. P. (2000). Probiotic bacteria: selective enumeration and survival in dairy foods. Journal of Dairy Science. 83 : 894-907. Song, Y., Kato, N., Liu, C. X., Matsumiua, Y., Kato, H. and Watanabe, K. (2000). Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group and species specific primers derived from 16S and 23S rRNA intergenic spacer region and its flanking 23S r RNA. FEMS Microbiology Letter. 187:167-173. Stack, H. M., Kearney, N., Stanton, C., Fitzgerald, G. F. and Ross, R. P. (2010). Association of beta-glucan endogenous production with increased stress tolerance of intestinal Lactobacilli. Applied and Environmental Microbiology. 76: 500-507.
© Copyright 2026 Paperzz