The EMBO Journal Vol.17 No.15 pp.4491–4502, 1998
Importin β, transportin, RanBP5 and RanBP7
mediate nuclear import of ribosomal proteins in
mammalian cells
Stefan Jäkel and Dirk Görlich1
Zentrum für Molekulare Biologie der Universität Heidelberg,
Im Neuenheimer Feld 282, 69120 Heidelberg, Germany
1Corresponding author
e-mail: [email protected]
The assembly of eukaryotic ribosomal subunits takes
place in the nucleolus and requires nuclear import of
ribosomal proteins. We have studied this import in a
mammalian system and found that the classical nuclear
import pathway using the importin α/β heterodimer
apparently plays only a minor role. Instead, at least four
importin β-like transport receptors, namely importin β
itself, transportin, RanBP5 and RanBP7, directly bind
and import ribosomal proteins. We found that the
ribosomal proteins L23a, S7 and L5 can each be
imported alternatively by any of the four receptors.
We have studied rpL23a in detail and identified a very
basic region to which each of the four import receptors
bind avidly. This domain might be considered as an
archetypal import signal that evolved before import
receptors diverged in evolution. The presence of distinct
binding sites for rpL23a and the M9 import signal in
transportin, and for rpL23a and importin α in importin
β might explain how a single receptor can recognize
very different import signals.
Keywords: importin β/nuclear transport/RanBP7/
ribosomes/transportin
Introduction
Transport between the cell nucleus and cytoplasm proceeds
through the nuclear pore complexes (NPCs) and comprises
a multitude of substrates (for recent reviews, see Corbett
and Silver, 1997; Görlich, 1997; Nigg, 1997; Mattaj and
Englmeier, 1998). Not only do all nuclear proteins need
to be imported from the cytoplasm, but tRNA, rRNA and
mRNA, which are synthesized in the nucleus, need to be
exported to the cytoplasm where they function in translation. Indeed, the biogenesis of ribosomes even involves
multiple crossings of the nuclear envelope; ribosomal
proteins are first imported into the nucleus, assemble in
the nucleolus with rRNA and finally are exported as
ribosomal subunits to the cytoplasm (reviewed in Scheer
and Weisenberger, 1994; Melese and Xue, 1995). In
quantitative terms, this is a major activity. For a growing
HeLa cell, one can estimate that each NPC has to import
100 ribosomal proteins and to export three ribosomal
subunits per minute (see Görlich and Mattaj, 1996).
NPCs can accommodate active transport of particles as
large as 25 nm in diameter or several million Daltons in
molecular weight (Feldherr et al., 1984). This active
transport is generally energy dependent and receptor
© Oxford University Press
mediated. In addition, NPCs provide a 9 nm diffusion
channel for ions, metabolites and, in principle, also for
macromolecules smaller than μ60 kDa (Bonner, 1978).
However, the transport of small RNAs such as tRNA and
small proteins such as histones is normally active and
carrier mediated (Zasloff, 1983; Breeuwer and Goldfarb,
1990).
Active transport across the NPC requires nuclear transport factors which fall into three categories: namely,
transport receptors, adaptor molecules and the constituents
of the RanGTPase system (reviewed in Görlich, 1997;
Ullmann et al., 1997; Izaurralde and Adam, 1998; Mattaj
and Englmeier, 1998). Transport receptors interact directly
with NPCs, shuttle continuously between nucleus and
cytoplasm, bind cargo molecules and carry them through
the NPCs. In some cases, adaptors such as importin α
have to bridge the interaction between a transport receptor
and a substrate. Transport receptors form a protein superfamily whose members are of similar size (90–130 kDa)
and have an importin β-like RanGTP-binding motif (Fornerod et al., 1997a; Görlich et al., 1997). Transport
receptors use RanGTP binding as a means to regulate
their interactions with cargoes or adaptor molecules.
According to the direction in which they carry a cargo,
they can be grouped into import receptors (importins) or
export receptors (exportins).
Ran’s nucleotide-bound state is controlled by the nucleotide exchange factor RCC1, which can charge Ran with
GTP (Bischoff and Ponstingl, 1991), and the GTPaseactivating protein RanGAP1, which converts RanGTP into
RanGDP (Bischoff et al., 1994, 1995; Becker et al., 1995).
The nuclear localization of RCC1 (Ohtsubo et al., 1989)
and the nuclear exclusion of RanGAP1 (Hopper et al.,
1990; Melchior et al., 1993b; Matunis et al., 1996;
Mahajan et al., 1997) should result in a very low cytoplasmic RanGTP concentration and high levels in the
nucleus. This RanGTP gradient across the nuclear envelope
has been proposed to control transport receptor–substrate
interactions in a compartment-specific manner (Görlich
et al., 1996b,c).
The import receptors such as importin β or transportin
bind their substrates only in the absence of RanGTP, i.e.
in the cytoplasm, and release them upon interaction with
RanGTP which should happen in the nucleus where the
RanGTP concentration is predicted to be high (Rexach
and Blobel, 1995; Chi et al., 1996; Görlich et al., 1996b;
Izaurralde et al., 1997; Siomi et al., 1997). Importin β
and transportin are probably exported to the cytoplasm as
RanGTP complexes (Izaurralde et al., 1997). This should
preclude re-export of the cargoes they just carried in.
Finally, cytoplasmic RanBP1 (Coutavas et al., 1993;
Schlenstedt et al., 1995; Richards, et al., 1996) and
RanGAP1 remove RanGTP from the import receptors and
restore them to an import-competent form (Bischoff and
4491
S.Jäkel and D.Görlich
Görlich, 1997; Floer et al., 1997; Lounsbury and
Macara, 1997).
Substrate binding to the exportins (CRM1/exportin 1,
CAS, exportin-t) appears to be regulated in exactly the
opposite way, in being greatly enhanced by simultaneous
RanGTP binding (Fornerod et al., 1997b; Kutay et al.,
1997b; Arts et al., 1998; Kutay et al., 1998). This should
happen in the nucleus where the RanGTP concentration
is predicted to be high. The trimeric substrate–exportin–
RanGTP complex is then transferred to the cytoplasm.
There, RanGTP needs to dissociate from the complex to
allow the exportin to release the substrate, to re-enter the
nucleus and to bind and export the next cargo molecule.
Import into the nucleus can proceed by several distinct
pathways. The importin α/β heterodimer mediates import
of proteins with a classical nuclear localization signal
(NLS) (Adam and Adam, 1994; Görlich et al., 1994,
1995a; Chi et al., 1995; Imamoto et al., 1995a,b; Radu
et al., 1995). The classical NLS contains either one cluster
of basic amino acids (SV40-type NLS, Kalderon et al.,
1984) or two basic clusters (bipartite NLS, Robbins et al.,
1991; Makkerh et al., 1996). We can distinguish the
following steps in this pathway. The initial cytoplasmic
event is the binding of the import substrate to the importin
α/β heterodimer. Importin α provides the NLS-binding
site (Adam and Adam, 1994) and interacts via its importin
beta-binding domain (IBB domain) with the β-subunit
(Görlich et al., 1996a; Weis et al., 1996). Importin β in
turn interacts with the NPC (Görlich et al., 1995b;
Moroianu et al., 1995). The subsequent events include
Ran-dependent steps (Melchior et al., 1993a, Moore and
Blobel, 1993). The trimeric NLS–importin α/β complex
is transferred into the nucleus where it meets an environment with a high RanGTP concentration. Direct binding
of RanGTP to importin β displaces the α-subunit (Rexach
and Blobel, 1995; Chi et al., 1996; Görlich et al., 1996b).
The NLS protein dissociates from importin α, and importin
α gets re-exported with the aid of its exportin CAS
(Kutay et al., 1997b). The RanGTP–importin β complex
is probably returned directly to the cytoplasm (Izaurralde
et al., 1997).
Importin β can also bind to and import proteins independently of the importin α adaptor. This was first
demonstrated for a fusion protein containing the IBB
domain from importin α (Görlich et al., 1996a; Weis
et al., 1996). Similarly, transportin, an importin β-related
receptor, binds its import substrates (hnRNP proteins)
directly (Pollard et al., 1996; Fridell et al., 1997). The
hitherto best characterized import signal for transportindependent nuclear import is the glycine-rich M9 domain
from hnRNP A1 (Siomi and Dreyfuss, 1995; Weighardt
et al., 1995).
Further candidates for being import receptors are
RanBP7 (Görlich et al., 1997) and RanBP5 (Deane et al.,
1997; Yaseen and Blobel, 1997). RanBP5 is in sequence
clearly related to importin β and to transportin. RanBP7
is more distantly related, and significant homology to
importin β is restricted to the N-terminal Ran-binding
domain. RanBP7 was identified originally as a protein from
Xenopus that forms a stable heterodimer with importin β.
The function of this heterodimer is still unknown. Both
RanBP5 and RanBP7 bind NPCs; however, none of them
has so far been shown to be a functional transport receptor.
4492
Ribosomal proteins (rps) are a very abundant class of
import substrates. They are usually small and very basic
proteins with apparently complex nuclear import signals
(Schaap et al., 1991; Schmidt et al., 1995; Russo et al.,
1997). Mechanistic aspects of their import so far have
only been studied in yeast, where two importin β-like
transport receptors have been implicated in rpL25 import,
namely Yrb4p (also called Kap123p) and Pse1p, the
homologue of RanBP5 (Rout et al., 1997; Schlenstedt
et al., 1997).
Here we show that importin β, transportin, RanBP5 and
RanBP7 mediate import of ribosomal proteins into nuclei
of mammalian cells. This establishes first that RanBP5 and
RanBP7 are functional importins, second that transportin’s
range of substrates is not restricted to hnRNP proteins,
and third that importin α-independent import is a major
activity of importin β. Surprisingly, the three ribosomal
proteins we tested, rpS7, rpL5 and rpL23a, can each be
imported alternatively by any of the four import receptors.
We have identified a 32 amino acid domain in rpL23a
which confers direct binding to and import by either
importin β, transportin, RanBP5 or RanBP7. This domain
might thus be considered as an archetypal import signal
that evolved before these import receptors diverged in
evolution. Furthermore, it points to a remarkable and
unexpected functional conservation of these import
receptors.
Results
We wanted to investigate by which import route(s) ribosomal proteins enter the nucleus in higher eukaryotes. For
this purpose, we purified ribosomes from canine pancreas,
modified the ribosomal proteins with fluorescein 5⬘ maleimide and extracted them from the rRNA (see Materials
and methods). We then used this mixture of fluorescent
ribosomal proteins as a substrate for import into nuclei
of permeabilized HeLa cells (Figure 1). An energyregenerating system was present in all incubations. Without
addition of soluble transport factors, only a low level of
import was evident. However, with reticulocyte lysate as
a source of soluble transport factors, the ribosomal proteins
efficiently entered the nuclei and accumulated as bright
spots in the nucleoli, and the nucleoli even enlarged (see
corresponding panels in Figure 1). Import was blocked
completely by addition of the GTPase-deficient RanQ69L
mutant (3 μM final). This was the expected result if import
was mediated by importin β-like import receptors. RanGTP
binding to importin β, for example, triggers substrate
release. As detailed in the Introduction, RanGTP normally
should only be available and stable in the nucleus, making
this release normally a specific nuclear event that terminates import. RanQ69L, however, remains GTP-bound even
in the presence of cytoplasmic RanGAP1 (Bischoff et al.,
1994) and, therefore, acts as a dominant-negative mutant
by promoting premature substrate release in the cytoplasm.
Importin β, transportin, RanBP5 and RanBP7 are
import receptors for ribosomal proteins
We then tested if import of the ribosomal proteins can
be reconstituted with recombinant transport factors (see
corresponding panels in Figure 1). The addition of Ran
alone already stimulated import weakly, probably because
Nuclear import of ribosomal proteins
Fig. 1. Nuclear import receptors for ribosomal proteins. Total, fluorescein-labelled ribosomal proteins were prepared from canine ribosomes as
described in Materials and methods and used as the substrate for import into nuclei of permeabilized HeLa cells. Import was for 15 min at room
temperature in the presence of an energy-regenerating system. Where indicated, the import reaction contained the following additions: reticulocyte
lysate (Retic); 3 μM RanQ69L; a Ran-mix (Ran) containing 4 μM RanGDP, 0.4 μM RanBP1, 0.4 μM Schizosaccharomyces pombe Rna1p and
0.4 μM NTF2 (each final concentrations); 2 μM importin β; 2 μM importin β ⫹ 6 μM importin α; 3 μM transportin; 3 μM RanBP5; or 3 μM
RanBP7. The reactions were stopped by fixation and import was analysed by confocal fluorescence microscopy. Note that efficient nucleolar
accumulation of the ribosomal proteins occurred in the presence of either reticulocyte lysate, importin β, transportin, RanBP5 or RanBP7. The
RanQ69L mutant had a strong dominant-negative effect.
the permeabilized cells still contain a significant amount
of transport receptors. If importin β was also added, then
very efficient import was observed. The classical NLS
import pathway requires importin α. However, in this
case, exogenous importin α significantly reduced the
capacity of importin β to promote import, suggesting that
ribosomal proteins can bind importin β directly and
without importin α.
Surprisingly, transportin also stimulated nuclear import
of the ribosomal proteins (Figure 1), suggesting that
transportin’s range of substrates is not restricted to hnRNP
proteins. To our knowledge, this is the first case of nonhnRNP proteins shown to be imported by transportin.
Moreover, RanBP5 and RanBP7 also promoted import of
ribosomal proteins into human cell nuclei, which is the first
direct demonstration that RanBP5 and RanBP7 function as
nuclear import receptors. It should be noted that import
by importin β, transportin, RanBP5 or RanBP7 is Ran
dependent and was much weaker if no exogenous Ran
had been added.
It might also be worth mentioning that import of
ribosomal proteins is not an intrinsic activity of all importin
β-like transport factors. The export receptors CAS and
exportin-t, for example, do not import ribosomal proteins
detectably (data not shown, but see Figure 2 below.).
Interactions of ribosomal proteins with nuclear
transport receptors
The existence of four import carriers for ribosomal proteins
raises two immediate questions. First, can a given ribosomal protein be imported by any of the four factors, or
alternatively are there distinct populations each absolutely
depending on one of the import receptors? Secondly,
which import signals confer direct binding to and import
by importin β, transportin, RanBP5 or RanBP7? In Figure
1, we analysed the import of a mixture of ribosomal
proteins. To address the two questions, we decided to study
a number of individual ribosomal proteins in more detail.
We expressed the ribosomal proteins S7, L5 and L23a
in Escherichia coli, immobilized them and tested which
factors from a Xenopus egg extract they would bind. The
bound fractions were analysed by SDS–PAGE followed by
Coomassie staining and by immunoblotting with various
specific antibodies. We had included the following con-
4493
S.Jäkel and D.Görlich
Fig. 2. Ribosomal proteins interact with multiple cytosolic transport
receptors. The ribosomal proteins S7, L5 and L23a were immobilized
and tested for binding of nuclear transport receptors from a Xenopus
egg extract. Positive controls were binding to an immobilized SV40
NLS peptide–BSA conjugate (specific for the importin α/β
heterodimer) or to the IBB domain from importin α (specific for
importin β and the importin β–RanBP7 heterodimer). Each 20 μl of
the resins was incubated with 500 μl of egg extract (HSS). After
extensive washing, bound proteins were eluted with 1.5 M MgCl2,
precipitated and analysed by SDS–PAGE followed by immunoblotting
with specific antibodies or by Coomassie staining. The load in the
bound fractions corresponds to 25 times the starting material. The
positions of RanBP5, RanBP7 and importin β in the Coomassie gel
are indicated. Transportin would co-migrate with importin β.
trols. First, CAS did not bind significantly to any of the
immobilized ribosomal proteins. Secondly, an immobilized
bovine serum albumin (BSA)–SV40 NLS conjugate (a
substrate of the classical import pathway) bound specifically the importin α/β heterodimer, but not transportin,
RanBP5 or RanBP7. Thirdly, the IBB domain (from
importin α) efficiently bound importin β and the importin
β–RanBP7 heterodimer, as reported before (Görlich et al.,
1997), but it did not bind importin α, transportin or
RanBP5.
Each of the ribosomal proteins S7, L5 and L23a
efficiently bound importin β and RanBP7 (Figure 2).
Importin α was recovered with rpS7 and rpL23a, but not
with rpL5. Significant transportin binding was detected
only for rpL23a. It should be noted, however, that transportin binding is here probably underestimated because in
a Xenopus egg extract most transportin appears inactive
(see also below). Finally, RanBP5 bound very efficiently
to rpL23a, more weakly to rpS7 and to a low, but still
significant, extent to rpL5.
4494
Fig. 3. Direct interaction of rpL23a with nuclear transport receptors.
Immobilized rpL23a was used to bind either (A) recombinant
importin β, (B) transportin, (C) RanBP5 or (D) RanBP7 out of total
E.coli lysates. Where indicated, 10 μM RanQ69L GTP or 5 μM
Xenopus importin α had also been added. Analysis of the starting
material and bound fraction was by SDS–PAGE followed by
Coomassie staining. The load in the bound fractions corresponds to 15
times the starting material. Note that importin β, the importin α/β
heterodimer, transportin, RanBP5 and RanBP7 all bound specifically to
rpL23a. RanQ69L strongly reduced binding of all these factors, except
for RanBP7 where the effect was weaker. It should also be noted that
the (minor) background bands in the bound fractions in (A) and (C)
are mainly proteolysis products from importin β (A) or RanBP5 (C).
In conclusion, each of the ribosomal proteins apparently
can interact with several of the transport receptors. The
apparently extreme example was rpL23a to which
importin α, importin β, transportin, RanBP5 and RanBP7
had bound efficiently. However, this binding activity from
the egg extract did not yet prove direct interactions with
rpL23a. First, because additional (mainly low molecular
weight) proteins were also bound which could as well
account for the recovery of the transport receptors. Secondly, importin β and RanBP7 can form a heterodimer
and importin β could mediate the rpL23a binding of
RanBP7, or vice versa. It was therefore crucial to test
which of the transport receptors would bind individually
to the ribosomal protein. For this purpose, we expressed
importin β, transportin, RanBP5 and RanBP7 in E.coli
and used the bacterial lysates as a starting material for
the next binding experiments.
Importin β alone bound to rpL23a very efficiently
Nuclear import of ribosomal proteins
Fig. 4. rpL23a can be imported into the nucleus via four distinct pathways. Nuclear import of the indicated fluorescein-labelled import substrates
(μ4 μM each) was performed in the presence of a Ran mix (see Figure 1), an energy-regenerating system and either buffer, 1.5 μM importin β,
1.5 μM importin β ⫹ 4.5 μM importin α, 4 μM transportin, 4 μM RanBP5 or 2.5 μM RanBP7. Reactions were stopped after 15 min by fixation,
and import was analysed by confocal fluorescence microscopy. Note that efficient import of nucleoplasmin was only observed with importin α ⫹ β,
that of the IBB fusion only with importin β, and that of the M9 fusion only with transportin. In contrast, import of the ribosomal protein L23a was
efficient either with importin β, transportin, RanBP5 or with RanBP7.
(Figure 3A). The presence of 10 μM RanQ69L (GTP)
essentially abolished binding. This was not only a stringent
specificity control, it also established that RanGTP regulates the importin β–rpL23a interaction in the same way
as that between importin α and β. When importin α was
added to the importin β lysate, then importin α was
recovered with the immobilized rpL23a stoichiometrically
with the β subunit. It should be noted that importin α
binding was strictly dependent on the presence of importin
β (not shown), as if the importin α/β heterodimer would
bind rpL23a only via the β subunit. Consistent with this,
RanQ69L reduced the recovery of both importin β and α
to the same low level (Figure 3A).
Transportin, RanBP5 and RanBP7 could each bind
efficiently to rpL23a (Figure 3B and C). RanQ69L completely abolished the binding of transportin and RanBP5.
However, in the case of RanBP7, RanQ69L caused only
a slight reduction in the binding. The affinity of RanBP7
4495
S.Jäkel and D.Görlich
Table I. Mapping the binding site in rpL23a for nuclear import
receptors
rpL23a fragment
1–156 (full-length)
32–156
43–156
75–156
1–31
1–42
1–74
32–74
43–74
52–74
62–74
52–64
42–52
Binding to
Importin β Transportin RanBP5
RanBP7
⫹⫹⫹⫹⫹
⫹⫹⫹⫹⫹
⫹⫹
–
–
–
⫹⫹⫹⫹⫹
⫹⫹⫹⫹⫹
⫹⫹⫹
⫹
–
–
–
⫹⫹⫹⫹⫹
⫹⫹⫹⫹⫹
⫹⫹⫹⫹
–
–
⫹
⫹⫹⫹⫹⫹
⫹⫹⫹⫹⫹
⫹⫹⫹
–
–
–
–
⫹⫹⫹⫹⫹
⫹⫹⫹⫹⫹
⫹⫹
–
–
(⫹)
⫹⫹⫹⫹⫹
⫹⫹⫹⫹⫹
⫹⫹⫹
⫹
–
–
–
⫹⫹⫹⫹⫹
⫹⫹⫹⫹⫹
⫹⫹⫹
–
–
⫹⫹
⫹⫹⫹⫹⫹
⫹⫹⫹⫹⫹
⫹⫹⫹
⫹⫹
–
–
–
The rpL23a N-terminal domain is IPPKAKKEAP10 APPKAEAKAK20
ALKAKKAVLK30 GVHSHKKKKI40 RTSPTFRRPK50
TLRLRRQPKY60 PRKSAPRRNK70 LDHY......
The indicated rpL23a fragments were expressed as 2z-tagged fusions
in E.coli, immobilized and used to bind recombinant importin β,
transportin, RanBP5 or RanBP7 out of bacterial lysates as in Figure 4.
Binding was scored from ‘⫹⫹⫹⫹⫹’ (binding equally efficient as to
full-length rpL23a) to ‘–’ (no detectable binding).
for RanGTP (Kd ⫽ 25 nM) is ~30-fold lower than that of
importin β (Kd ⫽ 0.8 nM) (Görlich et al., 1997). Thus
RanGTP might not bind RanBP7 strongly enough to
counteract the interaction with the avidly binding substrate
(for discussion see below).
importin β and that of the M9 fusion only with transportin.
RanBP5 and RanBP7 had no effect on import of any of
these three control substrates. In contrast, import of rpL23a
was efficient either with importin β, transportin, RanBP5
or RanBP7 (Figure 4). Importin α did not stimulate, but
instead reduced the effect of importin β. Thus, although
the importin α/β heterodimer can bind rpL23a (Figures 2
and 3A), it is in this case apparently not an active species
in import.
It is indeed remarkable that rpL23a can ‘choose’
between at least four nuclear import receptors. Figure 5
shows that this phenomenon is not limited to rpL23a.
Import of rpS7 was evident with either importin β,
RanBP5, RanBP7 or transportin, despite the observation
that transportin binding was weak when tested in egg
extract (Figure 2). In addition, rpS7 apparently can also
use the importin α/β heterodimer for nuclear entry.
rpL5 behaved somewhat differently. RanBP7 allowed
efficient import, such that rpL5 accumulated evenly in all
nuclei and the cytoplasmic signal was completely lost.
Import was also efficient with RanBP5. With importin β,
however, nuclear accumulation was heterogeneous in that
some nuclei stained very brightly but others only faintly.
The reason for this heterogeneity is unclear, but different
cell cycle positions of the individual nuclei might have
caused the effect. rpL5 import with transportin was weak,
but still above background.
RanBP7, RanBP5, transportin and importin β can
each mediate nuclear import of rpL23a, rpS7 or
rpL5
Having established that rpL23a can bind several importin
β-like factors directly, we wanted to compare its import
with that of well-characterized import substrates (Figure
4). The controls behaved as expected, and efficient import
of nucleoplasmin was observed only with the importin
α/β heterodimer, that of the IBB fusion only with
A ‘universal’ NLS in rpL23a that accesses multiple
import pathways
There are two extreme possible explanations for how the
interaction between rpL23a and four different import
receptors can be explained. First, there could be several
distinct binding sites in rpL23a, each specific for one of
the receptors. Secondly, there could be one ‘universal’
binding site for all the receptors. To distinguish between
the possibilities, we expressed fragments of rpL23a in
Fig. 5. Nuclear import of ribosomal proteins S7 and L5. Import in the
presence of energy and Ran was performed and analysed as in Figure
4, using fluorescent fusions with rpS7 and rpL5 as substrates.
4496
Nuclear import of ribosomal proteins
Fig. 6. Residues 32–74 of rpL23a constitute a universal NLS that accesses multiple import pathways. Import was performed and analysed essentially
as in Figure 4, using a fluorescent fusion with residues 32–74 from rpL23a (i.e. the BIB domain) as a substrate.
E.coli, immobilized them and tested their capacity to bind
importin β, transportin, RanBP5 or RanBP7. The results
are summarized in Table I. rpL23a is 156 amino acids
long and consists of two domains. The C-terminal domain
(residues 75–156), which is conserved between eukaryotes,
eu- and archaebacteria, did not bind any of the nuclear
import receptors detectably. The N-terminal half (residues
1–74), which is absent in bacteria, but conserved between
rpL23a in higher eukaryotes and yeast rpL25, accounts
for all the interactions with the four import receptors. The
binding region could be narrowed down to further residues
32–74. Further truncations resulted in a partial or complete
loss of binding. However, at this resolution, the effects
were slightly different for the different import receptors.
For example, residues 52–74 still bound RanBP5 to some
extent, but RanBP7 binding was already lost.
In conclusion, rpL23a does not have separate binding
sites for each of the four import receptors. Instead,
importin β, transportin, RanBP5 and RanBP7 bind to the
same region in rpL23a. We will refer to this region as the
BIB domain (beta-like import receptor binding domain).
Figure 6 shows that the BIB domain is not only sufficient
for binding to the four receptors, but also confers import
by any of these factors. Import signals have been mapped
for a number of ribosomal proteins, such as for human
rpS6 (Schmidt et al. 1995) or human rpL7a (Russo et al.,
1997). A common feature is their very basic nature and a
greater complexity as compared with the classical NLS.
Considering this and extrapolating from our results with
rpL5, rpL23a, rpS7 and total ribosomal proteins, we would
suspect that rpS6, rpL7a and the bulk of ribosomal proteins
also use non-classical pathways for nuclear entry.
Transportin has two distinct substrate-binding
sites
Transportin can bind the M9 domain of hnRNP A1
and the BIB domain of rpL23a. The BIB domain is
exceptionally basic (IP 12.2), whereas the M9 domain is
not basic but instead is rich in glycine. This raises the
question as to how transportin can recognize such very
different signals. Does it have one very ‘flexible’ binding
site for both types of signal, or distinct binding sites each
specific for one of the signals? To distinguish between the
two possibilities, we tested whether the M9 and BIB
domain compete for each others binding to transportin.
The BIB domain from rpL23a was immobilized and used
to bind transportin out of an E.coli lysate. As can be seen
from Figure 7 (left panel), an excess of a GST–M9 fusion
did not compete transportin binding. Instead, the M9
fusion appeared in the bound fraction, indicating the
formation of a trimeric M9–transportin–rpL23a complex.
The recovery of the GST–M9 fusion on the rpL23a beads
was dependent on the specific M9–transportin interaction,
as verified by two controls: First, the GST–M9 fusion was
not bound if transportin was replaced by importin β
(Figure 7, right panel). Secondly, the G274A M9 mutant
(Michael et al., 1995), which is deficient in transportin
binding (Pollard et al., 1996), did not engage into the
4497
S.Jäkel and D.Görlich
1997; Kutay et al., 1997a). Thus the IBB and BIB domains
do not bind to identical sites on importin β.
Discussion
Fig. 7. Transportin has distinct binding sites for the M9 domain and
the L23a interaction domain. Binding of transportin or importin β to
residues 32–74 of rpL23a (BIB domain) was performed as described
in Figure 4. Note that the addition of 5 μM of the GST–M9 fusion did
not compete the rpL23a–transportin interaction. Instead, GST–M9 was
recovered in the bound fraction, indicating the formation of a trimeric
L23a–transportin–M9 complex. As a control, GST–M9 was not bound
if transportin was replaced by importin β (right panel). The asterisk
denotes 2z–BIB fusion protein that had leaked from the column.
trimeric complex (not shown). Thus one can conclude that
transportin simultaneously can bind an M9 domain and
the BIB domain from rpL23a. The binding sites for the
two signals in transportin are, therefore, distinct and nonoverlapping.
Even though transportin can bind an M9 signal and
the BIB domain simultaneously, it appears unlikely that
transportin normally would import the two substrates at
the same time: import of the trimeric M9–transportin–
BIB complex is apparently much less efficient than import
of, for example, an M9–transportin complex (not shown).
Importin α and rpL23a bind to different parts of
importin β
Importin β also binds two types of import signals, the
BIB domain from rpL23a and the IBB domain from
importin α. Both are very basic, but otherwise unrelated
in sequence, and so we also wondered in this case if the
binding sites on importin β are distinct or the same. We
therefore tested various importin β fragments for their
capacity to bind rpL23a. As seen from Figure 8, residues
1–462 of importin β bound equally efficiently as the fulllength protein (residues 1–876). A further C-terminal
deletion of 53 amino acids (1–409) essentially abolished
binding and thus defined a C-terminal border of the
binding domain. A deletion of the N-terminal 285 residues
(286–876) had no effect on the importin β–L23a interaction; binding to the 331–876 fragment of importin β
was, however, significantly less efficient. In conclusion,
approximately residues 286–462 of importin β are essential
for high affinity binding to rpL23a. This is in clear contrast
to the IBB–importin β interaction which requires importin
β’s intact C-terminus (residues 286–876, Chi and Adam,
4498
Import into the cell nucleus can occur through several,
distinct pathways. The classical import pathway is mediated by the importin α/β heterodimer, where importin α
recognizes NLSs such as those found in the SV40 large
T antigen with one cluster of basic amino acids, or the
bipartite NLS from nucleoplasmin with two stretches of
basic residues. A distinct pathway is mediated by transportin which imports hnRNP proteins such as A1. The
import signal of hnRNP A1 is the glycine-rich M9 domain.
Here, we have investigated the import of ribosomal
proteins into mammalian cell nuclei. Ribosomal proteins
are evolutionary ancient, normally very basic (average IP
for human ribosomal proteins is 10.1) and most of them
would be small enough to diffuse through the NPC into
the nucleus. However, nuclear import of ribosomal proteins
is active and receptor mediated (see, for example, Figure
1). This is similar to histone H1 which is also small and
where active import into the nucleus dominates over
diffusion (Breeuwer and Goldfarb, 1990). Binding to an
import receptor might not only make nuclear entry more
rapid, it could also help to prevent undesired interactions
in the cytoplasm.
We show here that at least four importin β-like import
receptors mediate nuclear import of ribosomal proteins,
namely importin β, transportin, RanBP5 and RanBP7
(Figures 1, 4 and 5). All of them, even importin β, bind
ribosomal proteins directly without an adaptor. The ability
of importin β to function without an α-subunit was
first observed for an artificial substrate, namely a fusion
containing the IBB domain from importin α (Görlich
et al., 1996a; Weis et al., 1996). Likewise, it has been
shown that human importin β can bind and import yeast
Nab2p directly (Truant et al., 1998). A more physiological
substrate for direct, importin β-dependent import might
be the HIV Rev protein (Henderson and Percipalle, 1997).
Our data now suggest that importin α-independent import
is a major activity of importin β. This more simple mode
of import appears evolutionarily ancient, and it seems
very likely that importin β had already played a role in
nuclear import of ribosomal proteins before importin α
evolved. That transportin also imports ribosomal proteins
came as quite a surprise. To our knowledge, rpL23a and
rpS7 are the first non-hnRNP proteins shown to be
imported by transportin. RanBP7 has been known to
interact specifically with NPCs and with RanGTP, and on
these grounds was proposed to be a nuclear transport
receptor (Görlich et al., 1997). Here we show that RanBP7
is indeed a functional importin. We therefore suggest to
refer to RanBP7 as importin 7. RanBP5 previously has
been shown to interact with NPCs, RanGTP and denatured
ribosomal proteins (Deane et al., 1997; Yaseen and Blobel,
1997). We provide here the functional import data that
demonstrate that RanBP5 is an import receptor for ribosomal proteins.
RanBP5 and transportin show significant overall
sequence homology to importin β (Pollard et al., 1996;
Deane et al., 1997; Yaseen and Blobel, 1997). Importin 7
(RanBP7) is evolutionarily more distant, and the recogniz-
Nuclear import of ribosomal proteins
Fig. 8. Definition of a binding domain in importin β for rpL23a. The importin β fragments, as indicated above the lanes, were tested for binding to
the immobilized BIB domain from rpL23a (residues 32–74). f.l. stands for full-length importin β, i.e. residues 1–876. Starting materials and bound
fractions were analysed by SDS–PAGE and Coomassie staining. The load in the bound fractions corresponds to 10 times the starting material. Note
that residues 286–462 of importin β are essential for high-affinity interaction with the rpL23a import signal.
able homology is restricted to the N-terminal RanGTPbinding motif (Görlich et al., 1997). The functional
conservation, however, is quite remarkable in that any of
the four import receptors can accomplish import of rpL23a,
rpS7 and rpL5. Moreover, at least in the case of rpL23a,
the receptors recognize essentially the same import signal,
which we will refer to as the BIB domain. The BIB
domain is more complex than a classical NLS, is extremely
basic and might be considered as an archetypal import
signal that evolved before these import receptors have
diverged in evolution. Ribosomal proteins most likely
were already import substrates of the progenitor of present
importin β-like import receptors. While these receptors
diversified in evolution, they acquired specialized binding
sites such as that for the M9 domain in transportin, or
that for importin α in the case of importin β; but obviously
they also maintained their capacity to bind and import
ribosomal proteins.
The binding sites in transportin for the M9 domain and
for rpL23a are distinct. Transportin is also the import
receptor for the hnRNP F protein, and possibly also for
hnRNP D and E (Siomi et al., 1997). These proteins have
no obvious sequence similarity to either the M9 domain
or to rpL23a. This raises the question as to what range of
substrates a single import receptor potentially can import.
In principle, one could imagine that any substrate that binds
specifically the Ran-free conformation of the receptor can
be imported, provided it does not interfere with the NPC
passage or disturb the interaction with RanGTP. Thus, the
number of import signals recognized by a given receptor
potentially might be great.
Nuclear import of S.cerevisiae rpL25, the yeast homologue of rpL23a, previously had been studied in yeast.
Efficient import of a reporter protein containing the rpL25
NLS (Schaap et al., 1991) was found to require the Yrb4
protein which binds the rpL25 signal directly (Rout et al.,
1997; Schlenstedt et al., 1997). No immediate human
homologue of Yrb4p has been reported so far; however,
the protein shows clear overall similarity to importin β,
transportin and RanBP5. An obvious parallel between the
yeast and the mammalian system is that yeast rpL25 can
also be imported via at least two parallel pathways using
either Yrb4p or Pse1p, the yeast homologue of RanBP5:
Yrb4p is not essential for viability, and the import defect
in a Yrb4 deletion strain can be largely suppressed by
overexpression of Pse1p (Rout et al., 1997; Schlenstedt
et al., 1997).
To mediate multiple rounds of import, import receptors
need to shuttle continuously between nucleus and cytoplasm. They bind their cargoes initially in the cytoplasm
and take them into the nucleus. Nuclear RanGTP then
causes cargo release by direct binding to the import
receptors. The receptors then finally return to the cytoplasm
without the cargo they just carried in. RanGTP released
rpL23a very efficiently from importin β, transportin or
RanBP5 (Figure 3). However, release from importin 7
(RanBP7) was not very efficient, probably because of the
low affinity of importin 7 (RanBP7) for RanGTP. In this
case, it is possible that substrate release needs to be
facilitated by a co-operating, nuclear factor. For example,
the nucleoporin at which import is terminated might
stabilize the RanGTP-bound conformation of importin 7
(RanBP7), facilitating substrate release. Alternatively, it
is quite possible that ribosomal proteins are not released
immediately after NPC passage. Indeed, a delayed release
from the receptor might be an advantage. Ribosomal
proteins are very sticky, and importin 7 (RanBP7) could
also shield them from undesired interactions on the way
from the NPC to the nucleolus. The ribosomal protein
could then be passed from the import receptor to an
assembly factor (chaperonin), or be transferred directly to
the rRNA. We currently are investigating these possibilities.
Materials and methods
Plasmids and constructs
For recombinant expression of ribosomal proteins, we have used the
following vectors: p2z60 is a pQE60 (Qiagen) derivative for the
expression of fusions with two consecutive z tags (IgG-binding domain
from protein A) at the N-terminus and a C-terminal His tag (Görlich
et al., 1997). p4zCys is analogous to p2z60, but provides four N-terminal
z tags, a C-terminal cysteine for covalent modification, followed by a
His tag. p6zCys is identical to p4zCys, except that six z tags are fused
to the N-terminus. It is important to note that the z domains alone
neither bind to any of the transport receptors nor get imported by them
(not shown).
The expression constructs for ribosomal proteins were generated as
follows. The coding sequences for rpS7, rpL5 and rpL23a, or fragments
from rpL23a were amplified from HeLa cDNA using the Boehringer
4499
S.Jäkel and D.Görlich
high fidelity PCR system and specific primer pairs that each introduced
a 5⬘ NcoI and a 3⬘ BamHI site. The amplified fragments were cloned
into the NcoI–BamHI sites of the expression vectors. Expression of
ribosomal proteins was from p2z60 for all binding experiments (Figures
2, 3, 7 and 8) and to prepare the rpL5 import substrate. p4zCys was
used to express rpL23a for import assays and p6zCys was used
to express rpS7 and the 32–74 rpL23a fragment (BIB domain) for
import assays.
RanBP5 was amplified by PCR from HeLa cDNA using the primers
AGCGGTACCGCAGCAGCAGCAGCAGAGCAGCAACAGTTC
(upstream) and GCGCTCGAGTGGAGTTAGTTTTCTGGTGGGTGACATTAAGG (downstream). The coding sequence was cloned as a KpnI–
XhoI fragment into the KpnI–SalI sites of pQE32 (Qiagen), allowing
expression with an N-terminal His tag. Note that the upstream primer
changed the codon usage of the five N-terminal alanines. Xenopus
RanBP7 was cloned into the BamHI–HindIII sites of pQE9 (Qiagen)
allowing expression with an N-terminal His tag.
Recombinant protein expression and protein purification
The following proteins were expressed in E.coli BLR/Rep4 and purified
as previously described: Xenopus importin α (Görlich et al., 1994),
human importin β (Görlich et al., 1996b), importin β fragments (Kutay
et al., 1997a) and transportin (Izaurralde et al., 1997). RanBP7 and
RanBP5 were expressed with an N-terminal His tag from pQE9 and
pQE32, respectively. Purification was with nickel-NTA agarose (Qiagen),
followed by precipitation with ammonium sulfate (35% saturation) and
chromatography on Superdex 200 (Pharmacia).
Ribosomal proteins and fragments of ribosomal proteins were
expressed in E.coli with a C-terminal His tag, and with N-terminal z tags
(for details, see Plasmids and constructs). Disruption of cells and
purification on nickel agarose was in the presence of 1 M lithium chloride.
Preparation of labelled recombinant import substrates
The preparation of fluorescent nucleoplasmin (Görlich et al., 1994),
IBB–nucleoplasmin core fusion (Görlich et al., 1996a) and core M9
fusion (Kutay et al., 1997a) has been described previously. Labelling
with fluorescein 5⬘ maleimide (Calbiochem) of 4z-rpL23a, 6z-S7,
6z-32–74 rpL23a (6z-BIB) was performed in 50 mM HEPES–KOH
pH 7.5, 300 mM potassium acetate, 5 mM magnesium acetate. Free
label was removed by gel filtration on an NAP5 column equilibrated in
20 mM potassium phosphate pH 7.2, 300 mM potassium acetate, 5 mM
magnesium acetate.
Labelling with FLUOS (Boehringer) of 2z-rpL5 was performed in
50 mM HEPES–KOH pH 7.5, 1 M lithium chloride, 5 mM magnesium
acetate. Free label was removed with an NAP5 column equilibrated in
50 mM HEPES–KOH pH 7.0, 300 mM potassium acetate, 5 mM
magnesium acetate.
Preparation of fluorescein-labelled total ribosomal proteins
Ribosomes were purified by stripping them from an rER preparation
from canine pancreas. A total of 50 000 equivalents of rER membranes
(for definition, see Walter and Blobel, 1983) were adjusted to 500 mM
potassium acetate, 5 mM magnesium acetate, 1 mM puromycin, 1 mM
GTP, layered on top of a 10 ml cushion containing 1.2 M sucrose,
50 mM HEPES–KOH pH 7.5, 500 mM potassium acetate, 5 mM
magnesium acetate and spun in a Ti50.2 rotor for 6 h at 50 000 r.p.m.,
15°C. The clear ribosome pellet was resuspended in 50 mM HEPES–
KOH pH 7.5 and spun for 3 h at 100 000 r.p.m., 15°C in a TLA100.3
rotor through a cushion containing 1.6 M sucrose, 50 mM HEPES–KOH
pH 7.5, 5 mM magnesium chloride. The ribosome pellet was resuspended
as before and the concentration of ribosomes was determined from the
UV absorption at 260 nm, assuming a molar extinction coefficient of
108. Fluorescein 5⬘ maleimide was added in a 200-fold molar excess
over ribosomes and the mixture was incubated overnight on ice.
Ribosomes were recovered by sedimenting them through 0.5 M sucrose,
50 mM HEPES–KOH pH 7.5. The pellet was resuspended and adjusted
to 1 M lithium chloride, which dissociates the bulk of ribosomal proteins
from the rRNA. The rRNA was pelleted by ultracentrifugation and the
supernatant containing the labelled proteins was dialysed against 50 mM
HEPES–KOH pH 7.5, 300 mM potassium acetate, 5 mM magnesium
acetate.
Import assays
Permeabilized cells were prepared similarly to the method described by
Adam et al. (1990). Briefly, HeLa cells (# 85060701, European Collection
of Cell Cultures) were grown on 12 mm coverslips to 30–80% confluence,
washed once in ice-cold phosphate-buffrered saline (PBS) and permeabil-
4500
ized for 8 min in ice-cold 20 mM HEPES–KOH pH 7.5, 110 mM
potassium acetate, 5 mM magnesium acetate, 250 mM sucrose,
40 μg/ml digitonin (Sigma #D5628). The coverslips were washed three
times in permeabilization buffer minus digitonin. Each coverslip was
then incubated with 20 μl of import mixture for the indicated time
periods at room temperature. Reactions were stopped by fixation with
2% paraformaldehyde (w/v) in PBS, washed in PBS and water, and
mounted with 2 μl of vectorshield mounting medium (Vector).
The energy-regenerating system consists of the following components:
0.5 mM ATP, 0.5 mM GTP, 10 mM creatine phosphate, 50 μg/ml
creatine kinase.
It turned out that the optimum import buffer was different for different
substrates. All buffers contained 250 mM sucrose and 5 mM magnesium
acetate. The import buffers for the various substrates contained, in
addition, the following salts: for total ribosomal proteins (Figure 1),
20 mM potassium phosphate pH 7.2, 200 mM potassium acetate; for
4z-rpL23a and 6z-rpS7 (Figures 4 and 5), 20 mM HEPES–KOH pH
7.5, potassium acetate 250 mM; for 2z-rpL5 (Figure 5), 50 mM potassium
phosphate pH 7.2, 250 mM potassium acetate; for nucleoplasmin, IBB
core and M9 core, 20 mM HEPES–KOH pH 7.5, 150 mM potassium
acetate (Figure 4); for the 6z-32–74 rpL23a fragment (6z-BIB, Figure
6), 20 mM potassium phosphate pH 7.2, 150 mM potassium acetate.
Because nucleoplasmin core binds avidly to ribosomal proteins and
inhibits their import, it was omitted in the import reactions for ribosomal proteins.
Antibodies
Antibodies against the following antigens have been described previously:
Xenopus importin α, human importin β (Görlich et al., 1995b) and
Xenopus RanBP7 (Görlich et al., 1997). Antibodies against recombinant
human CAS, human transportin and human RanBP5 were raised in
rabbits. Affinity purification was on sulfoLink (Pierce) to which the
antigens had been coupled.
Binding assays
The following affinity matrices were used: a biotinylated BSA–NLS
conjugate bound to streptavidin–agarose (Görlich et al., 1995a), a
synthetic peptide corresponding to the IBB domain from Xenopus
importin α (Görlich et al., 1996a) and 2z-tagged ribosomal proteins or
fragments of rpL23a pre-bound to IgG–Sepharose 4B. The z domain is
the IgG-binding domain from Staphylococcus aureus protein A. The
ligands were immobilized at a concentration of ~2 mg/ ml of resin.
Binding to the BSA–NLS conjugate was in 50 mM Tris–HCl pH 7.5,
80 mM NaCl, 5 mM magnesium acetate. All other bindings were
performed in 50 mM Tris–HCl pH 7.5, 300 mM NaCl, 5 mM magnesium
acetate. Each 20 μl of affinity matrix was rotated with 500–1000 μl of
starting material for 3 h at 4°C. The beads were recovered by gentle
centrifugation and washed four times with 1 ml of binding buffer. Elution
was with 150 μl of 1.5M magnesium chloride, 50 mM Tris–HCl pH 7.5.
Proteins were precipitated with 90% isopropanol (final), dissolved in
SDS sample buffer and analysed as described in the figure legends.
Acknowledgements
We wish to thank Petra Schwarzmaier for excellent technical help, Ulrike
Kutay for the importin β fragments, Froso Pareskeva for purifying
the anti-RanBP5 antibody, Ulrike Kutay and F.R.Bischoff for many
stimulating discussions, Martin Pool, Elisa Izaurralde and the members
of our laboratory for critical reading of the manuscript, and the Deutsche
Forschungsgemeinschaft (SFB 352) for financial support.
References
Adam,E.J.H. and Adam,S.A. (1994) Identification of cytosolic factors
required for nuclear location sequence-mediated binding to the nuclear
envelope. J. Cell Biol., 125, 547–555.
Adam,S.A., Sterne Marr,R. and Gerace,L. (1990) Nuclear protein import
in permeabilized mammalian cells requires soluble cytoplasmic factors.
J. Cell Biol., 111, 807–816.
Arts,G.-J., Fornerod,M. and Mattaj,I.W. (1998) Identification of a nuclear
export receptor for tRNA. Curr. Biol., 8, 305–314.
Becker,J., Melchior,F., Gerke,V., Bischoff,F.R., Ponstingl,H. and
Wittinghofer,A. (1995) RNA1 encodes a GTPase-activating protein
specific for Gsp1p, the Ran/TC4 homologue of Saccharomyces
cerevisiae. J. Biol. Chem., 270, 11860–11865.
Nuclear import of ribosomal proteins
Bischoff,F.R. and Görlich,D. (1997) RanBP1 is crucial for the the release
of RanGTP from importin β-related nuclear transport factors. FEBS
Lett., 419, 249–254.
Bischoff,F.R. and Ponstingl,H. (1991) Catalysis of guanine nucleotide
exchange on Ran by the mitotic regulator RCC1. Nature, 354, 80–82.
Bischoff,F.R., Klebe,C., Kretschmer,J., Wittinghofer,A. and Ponstingl,H.
(1994) RanGAP1 induces GTPase activity of nuclear ras-related Ran.
Proc. Natl Acad. Sci. USA, 91, 2587–2591.
Bischoff,F.R., Krebber,H., Kempf,T., Hermes,I. and Ponstingl,H. (1995)
Human RanGTPase activating protein RanGAP1 is a homolog of
yeast RNA1p involved in messenger RNA processing and transport.
Proc. Natl Acad. Sci. USA, 92, 1749–1753.
Bonner,W.M. (1978) Protein migration and accumulation in nuclei. In
Busch,H. (ed.), The Cell Nucleus. Academic Press, New York, Vol.
6, part C, pp. 97–148.
Breeuwer,M. and Goldfarb,D. (1990) Facilitated nuclear transport of
histone H1 and other small nucleophilic proteins. Cell, 60, 999–1008.
Chi,N.C. and Adam,S.A. (1997) Functional domains in nuclear import
factor p97 for binding the nuclear localization sequence receptor and
the nuclear pore. Mol. Biol. Cell, 8, 945–956.
Chi,N.C., Adam,E.J.H. and Adam,S.A. (1995) Sequence and
characterization of cytoplasmic nuclear import factor p97. J. Cell
Biol., 130, 265–274.
Chi,N.C., Adam, E.J.H., Visser,G.D. and Adam,S.A. (1996) RanBP1
stabilises the interaction of Ran with p97 in nuclear protein import.
J. Cell Biol., 135, 559–569.
Corbett,A.H. and Silver,P.A. (1997) Nucleocytoplasmic transport of
macromolecules. Microbiol. Mol. Biol. Rev., 61, 193–211.
Coutavas,E., Ren,M., Oppenheim,J.D., D’Eustachio,P. and Rush,M.G.
(1993) Characterization of proteins that interact with the cell-cycle
regulatory protein Ran/TC4. Nature, 366, 585–587.
Deane,R., Schafer,W., Zimmermann,H.P., Mueller,L., Görlich,D.,
Prehn,S., Ponstingl,H. and Bischoff,F.R. (1997) Ran binding protein
5 (RanBP5) is related to the nuclear transport factor importin beta but
interacts differently with RanBP1. Mol. Cell. Biol., 17, 5087–5096.
Feldherr,C.M., Kallenbach,E. and Schultz,N. (1984) Movement of
karyophilic protein through the nuclear pores of oocytes. J. Cell Biol.,
99, 2216–2222.
Floer,M., Blobel,G. and Rexach,M. (1997) Disassembly of RanGTP–
karyopherin beta complex, an intermediate in nuclear protein import.
J. Biol. Chem., 272, 19538–19546.
Fornerod,M., Vandeursen,J., Vanbaal,S., Reynolds,A., Davis,D.,
Murti,K.G., Fransen,J. and Grosveld,G. (1997a) The human
homologue of yeast Crm1 is in a dynamic subcomplex with Can/
Nup214 and a novel nuclear pore component Nup88. EMBO J., 16,
807–816.
Fornerod,M., Ohno,M., Yoshida,M. and Mattaj,I.W. (1997b) Crm1 is an
export receptor for leucine rich nuclear export signals. Cell, 90,
1051–1060.
Fridell,R.A., Truant,R., Thorne,L., Benson,R.E. and Cullen,B.R. (1997)
Nuclear import of hnRNP A1 is mediated by a novel cellular cofactor
related to karyopherin-β. J. Cell Sci., 110, 1325–1331.
Görlich,D. (1997) Nuclear protein import. Curr. Opin. Cell Biol., 9,
412–419.
Görlich,D. and Mattaj,I.W. (1996) Nucleocytoplasmic transport. Science,
271, 1513–1518.
Görlich,D., Prehn,S., Laskey,R.A. and Hartmann,E. (1994) Isolation of
a protein that is essential for the first step of nuclear protein import.
Cell, 79, 767–778.
Görlich,D., Kostka,S., Kraft,R., Dingwall,C., Laskey,R.A., Hartmann,E.
and Prehn,S. (1995a) Two different subunits of importin cooperate to
recognize nuclear localization signals and bind them to the nuclear
envelope. Curr. Biol., 5, 383–392.
Görlich,D., Vogel,F., Mills,A.D., Hartmann,E. and Laskey,R.A. (1995b)
Distinct functions for the two importin subunits in nuclear protein
import. Nature, 377, 246–248.
Görlich,D., Henklein,P., Laskey,R A. and Hartmann,E. (1996a) A 41
amino acid motif in importin alpha confers binding to importin beta
and hence transit into the nucleus. EMBO J., 15, 1810–1817.
Görlich,D., Panté,N., Kutay,U., Aebi,U. and Bischoff,F.R. (1996b)
Identification of different roles for RanGDP and RanGTP in nuclear
protein import. EMBO J., 15, 5584–5594.
Görlich,D., Kraft,R., Kostka,S., Vogel,F., Hartmann,E., Laskey,R.A.,
Mattaj,I.W. and Izaurralde,E. (1996c) Importin provides a link between
nuclear protein import and U snRNA export. Cell, 87, 21–32.
Görlich,D.,
Dabrowski,M.,
Bischoff,F.R.,
Kutay,U.,
Bork,P.,
Hartmann,E., Prehn,S. and Izaurralde,E. (1997) A novel class of
RanGTP binding proteins. J. Cell Biol., 138, 65–80.
Henderson,B.R. and Percipalle,P. (1997) Interactions between HIV Rev.
and nuclear import and export factors: the Rev. nuclear localisation
signal mediates specific binding to human importin-beta. J. Mol. Biol.,
274, 693–707.
Hopper,A., Traglia,H.M. and Dunst,R.W. (1990) The yeast RNA1 gene
product necessary for RNA processing is located in the cytosol and
apparently excluded from the nucleus. J. Cell Biol., 111, 309–321.
Imamoto,N., Tachibana,T., Matsubae,M. and Yoneda,Y. (1995a) A
karyophilic protein forms a stable complex with cytoplasmic
components prior to nuclear pore binding. J. Biol. Chem., 270,
8559–8565.
Imamoto,N., Shimamoto,T., Takao,T., Tachibana,T., Kose,S.,
Matsubae,M., Sekimoto,T., Shimonishi,Y. and Yoneda,Y. (1995b) In
vivo evidence for involvement of a 58 kDa component of nuclear
pore targeting complex in nuclear protein import. EMBO J., 14,
3617–3626.
Izaurralde,E. and Adam,S.A. (1998) Transport of macromolecules
between the nucleus and the cytoplasm. RNA, 4, 351–364.
Izaurralde,E., Kutay,U., von Kobbe,C., Mattaj,I.W. and Görlich,D. (1997)
The asymmetric distribution of the constituents of the Ran system is
essential for transport into and out of the nucleus. EMBO J., 16,
6535–6547.
Kalderon,D., Richardson,W.D., Markham,A.F. and Smith,A.E. (1984)
Sequence requirements for nuclear location of simian virus 40 large
T antigen. Nature, 311, 33–38.
Kutay,U., Izaurralde,E., Bischoff,F.R., Mattaj,I.W. and Görlich,D.
(1997a) Dominant-negative mutants of importin-β block multiple
pathways of import and export through the nuclear pore complex.
EMBO J., 16, 1153–1163.
Kutay,U., Bischoff,F.R., Kostka,S., Kraft,R. and Görlich,D. (1997b)
Export of importin α from the nucleus is mediated by a specific
nuclear transport factor. Cell, 90, 1061–1071.
Kutay,U., Lipowsky,G., Izaurralde,E., Bischoff,F.R., Schwarzmaier,P.,
Hartmann,E. and Görlich,D. (1998) Identification of a tRNA specific
nuclear export receptor. Mol. Cell, 1, 359–369.
Lounsbury,K.M. and Macara,I.G. (1997) Ran-binding protein 1 (RanBP1)
forms a ternary complex with Ran and karyopherin beta and reduces
GTPase-activating protein (RanGAP) inhibition by karyopherin beta.
J. Biol. Chem., 272, 551–555.
Mahajan,R., Delphin,C., Guan,T., Gerace,L. and Melchior,F. (1997) A
small ubiquitin-related polypeptide involved in targeting RanGAP1 to
nuclear pore complex protein RanBP2. Cell, 88, 97–107.
Makkerh,J.P.S., Dingwall,C. and Laskey,R.A. (1996) Comparative
mutagenesis of nuclear localization signals reveals the importance of
neutral and acidic amino acids. Curr. Biol., 6, 1025–1027.
Mattaj,I.W. and Englmeier,L. (1998) Nucleocytoplasmic transport: the
soluble phase. Annu. Rev. Biochem., 67, 265–306.
Matunis,M.J., Coutavas,E. and Blobel,G. (1996) A novel ubiquitin-like
modification modulates the partitioning of the Ran-GTPase-activating
protein between cytosol and nuclear pore complex. J. Cell Biol., 135,
1457–1470.
Melchior,F., Paschal,B., Evans,E. and Gerace,L. (1993a) Inhibition of
nuclear protein import by nonhydrolyzable analogs of GTP and
identification of the small GTPase Ran/TC4 as an essential transport
factor. J. Cell Biol., 123, 1649–1659.
Melchior,F., Weber,K. and Gerke,V. (1993b) A functional homologue of
the RNA1 gene product in Schizosaccharomyces pombe: purification,
biochemical characterization, and identification of a leucine-rich repeat
motif. Mol. Biol. Cell, 4, 569–581.
Melese,T. and Xue,Z. (1995) The nucleolus: an organelle formed by the
act of building a ribosome. Curr. Opin. Cell Biol., 7, 319–324.
Michael,W.M., Choi,M. and Dreyfuss,G. (1995) A nuclear export signal
in hnRNP A1: a signal-mediated, temperature-dependent nuclear
protein export pathway. Cell, 83, 415–422.
Moore,M.S. and Blobel,G. (1993) The GTP-binding protein Ran/TC4 is
required for protein import into the nucleus. Nature, 365, 661–663.
Moroianu,J., Hijikata,M., Blobel,G. and Radu,A. (1995) Mammalian
karyopherin a1b and a2b heterodimers: a1 or a2 subunit binds nuclear
localization sequence and b subunit interacts with peptide repeat
containing nucleoporins. Proc. Natl Acad. Sci. USA, 92, 6532–6536.
Nigg,E.A. (1997) Nucleocytoplasmic transport: signals, mechanisms and
regulation. Nature, 386, 779–787.
Ohtsubo,M., Okazaki,H. and Nishimoto,T. (1989) The RCC1 protein, a
regulator for the onset of chromosome condensation locates in the
nucleus and binds to DNA. J. Cell Biol., 109, 1389–1397.
4501
S.Jäkel and D.Görlich
Pollard,V.W., Michael,W.M., Nakielny,S., Siomi,M.C., Wang,F. and
Dreyfuss,G. (1996) A novel receptor mediated nuclear protein import
pathway. Cell, 88, 985–994.
Radu,A., Blobel,G. and Moore,M.S. (1995) Identification of a protein
complex that is required for nuclear protein import and mediates
docking of import substrate to distinct nucleoporins. Proc. Natl Acad.
Sci. USA, 92, 1769–1773.
Rexach,M. and Blobel,G. (1995) Protein import into nuclei: association
and dissociation reactions involving transport substrate, transport
factors, and nucleoporins. Cell, 83, 683–692.
Richards,S.A., Lounsbury,K.M., Carey,K.L. and Macara,I.G. (1996) A
nuclear export signal is essential for the cytosolic localisation of the
Ran binding protein, RanBP1. J. Cell Biol., 134, 1157–1168.
Robbins,J., Dilworth,S.M., Laskey,R.A. and Dingwall,C. (1991) Two
interdependent basic domains in nucleoplasmin nuclear targeting
sequence: identification of a class of bipartite nuclear targeting
sequence. Cell, 64, 615–623.
Rout,M.P., Blobel,G. and Aitchison,J.D. (1997) A distinct nuclear import
pathway used by ribosomal proteins. Cell, 89, 715–725.
Russo,G., Ricciardelli,G. and Pietropaolo,C. (1997) Different domains
cooperate to target the human ribosomal L7a protein to the nucleus
and to the nucleoli. J. Biol. Chem., 272, 5229–5235.
Schaap,P.J., van’t Riet,J., Woldringh,C.L. and Raue,H.A. (1991)
Identification and functional analysis of the nuclear localization signals
of ribosomal protein L25 from Saccharomyces cerevisiae. J. Mol.
Biol., 221, 225–237.
Scheer,U. and Weisenberger,D. (1994) The nucleolus. Curr. Opin. Cell
Biol., 6, 354–359.
Schlenstedt,G., Wong,D.H., Koepp,D.M. and Silver,P.A. (1995) Mutants
in a yeast Ran binding protein are defective in nuclear transport.
EMBO J., 14, 5367–5378.
Schlenstedt,G., Smirnova,E., Deane,R., Solsbacher,J., Kutay,U.,
Görlich,D., Ponstingl,H. and Bischoff,F.R. (1997) Yrb4p, a yeast Ran
GTP binding protein involved in import of ribosomal protein L25 into
the nucleus. EMBO J., 16, 6237–6249.
Schmidt,C., Lipsius,E. and Kruppa,J. (1995) Nuclear and nucleolar
targeting of human ribosomal protein S6. Mol. Biol. Cell, 6,
1875–1885.
Siomi,H. and Dreyfuss,G. (1995) A nuclear localization domain in the
hnRNP A1 protein. J. Cell Biol., 129, 551–560.
Siomi,M.C., Eder,P.S., Kataoka,N., Wan,L., Liu,Q. and Dreyfuss,G.
(1997) Transportin-mediated nuclear import of heterogenous RNP
proteins. J. Cell Biol., 138, 1181–1192.
Truant,R., Fridell,R.A., Benson,R.E., Bogerd,H. and Cullen,B.R. (1998)
Identification and functional characterization of a novel nuclear
localization signal present in the yeast Nab2 poly(A)⫹ RNA binding
protein. Mol. Cell. Biol., 18, 1449–1458.
Ullmann,K.S., Powers,M.A. and Forbes,D.J. (1997) Nuclear export
receptors: from importin to exportin. Cell, 90, 967–970.
Walter,P. and Blobel,G. (1983) Preparation of microsomal membranes
for cotranslational protein translocation. Methods Enzymol., 96, 84–93.
Weighardt,F., Biamonti,G. and Riva,S. (1995) Nucleo-cytoplasmic
distribution of human hnRNP proteins: a search for the targeting
domains of hnRNP A1. J. Cell Sci., 108, 545–555.
Weis,K., Ryder,U. and Lamond,A.I. (1996) The conserved amino terminal
domain of hSRP1α is essential for nuclear protein import. EMBO J.,
15, 1818–1825.
Yaseen,N.R. and Blobel,G. (1997) Cloning and characterization of human
karyopherin beta3. Proc. Natl Acad. Sci. USA, 94, 4451–4456.
Zasloff,M. (1983) tRNA transport from the nucleus in a eukaryotic cell:
carrier-mediated translocation process. Proc. Natl Acad. Sci. USA, 80,
6436–6440.
Received April 30, 1998; revised May 29, 1998;
accepted June 4, 1998
4502