Journal of Applied Ecology 2014, 51, 1357–1365
doi: 10.1111/1365-2664.12299
Flower-visiting insects and their potential impact on
transgene flow in rice
De-qiang Pu1, Min Shi1, Qiong Wu1, Ming-qing Gao1, Jia-Fu Liu1, Shao-peng Ren1, Fan
Yang1, Pu Tang1, Gong-yin Ye1, Zhi-cheng Shen1, Jun-hua He1, Ding Yang2, Wen-Jun Bu3,
Chun-tian Zhang4, Qisheng Song5, Dong Xu6, Michael R. Strand7 and Xue-xin Chen1*
1
State Key Laboratory of Rice Biology and Ministry of Agriculture Key Laboratory of Agricultural Entomology, Institute
of Insect Sciences, Zhejiang University, Hangzhou 310058, China; 2Department of Entomology, China Agricultural
University, Beijing 100193, China; 3Institute of Entomology, College of Life Sciences, Nankai University, 94 Weijin
Road, Tianjin 300071, China; 4Liaoning Key Laboratory of Evolution and Biodiversity, Shenyang Normal University,
Shenyang 110034, China; 5Molecular Insect Physiology, Division of Plant Sciences, University of Missouri, Columbia,
MO 65211, USA; 6Computer Science Department and Christopher S. Bond Life Sciences Center, University of
Missouri, Columbia, MO 65211, USA; and 7Department of Entomology, University of Georgia, Athens, GA 30602, USA
Summary
1. Rice is one of the most important crops in the world. Several transgenic varieties of rice
have been developed, and some have recently entered pre-production trials. One concern with
genetically modified (GM) crops is transgene escape, but prior studies suggest this risk is low
for rice because it is self-pollinated and the dispersal of pollen by wind is limited.
2. Little is known about the impact of pollen transport by insects. We characterized the insects
visiting rice plants during anthesis and considered the effects of insect pollination on gene flow.
3. We conducted a 2-year nationwide survey in China and identified more than 510 insect
species that visited rice flowers. Honeybees, hoverflies and several other species carried large
amounts of pollen. The European honeybee Apis mellifera visited rice flowers regularly with
daily foraging activity peaking between 12.00 and 13.00 h.
4. We monitored 20 European honeybee colonies located 100–1000 metres away from rice
fields in mixed agricultural landscapes and found the honeybees carried viable pollen at least
500 m away from the rice pollen source.
5. We used four GM rice lines as pollen donors, their non-GM parental varieties as pollen
recipients and the European honeybee as the pollinator in field-cage experiments to assess
whether honeybees increase the frequency of gene flow in rice. Results from screening over
15 million germinated offspring seeds over a 3-year study period showed that honeybees significantly increase transgene flow in rice.
6. Synthesis and applications. Our results indicate that a remarkably high diversity of insects
visit rice flowers in China and that hundreds of species including honeybees carry large
amounts of rice pollen. European honeybees carry viable pollen over long distances, forage
on rice flowers regularly and increase the frequency of transgene flow. Insects mediate gene
flow in rice more than previously assumed, and this should be taken into consideration during
the ecological risk assessment of transgene flow in self-pollinated and/or anemophilous crops.
Key-words: anemophilous crop, Apis mellifera L., flower-visiting insects, gene flow, genetic
modification, honeybee, Oryza sativa L., pollen, transgene escape
Introduction
Rice Oryza sativa L. is one of the most important crops
in the world, serving as a food stable for more than half
*Correspondence author. E-mail: [email protected]
of the human population (Stone 2008). It has played a
central role in human nutrition and civilization for the
past 10000 years. Rice (Tsunoda & Takahashi 1984) and
other cereal crops, such as wheat (de Vries 1971), are selfpollinated plants that produce large quantities of small
pollen grains in flowers with exposed stamens. These
© 2014 The Authors. Journal of Applied Ecology © 2014 British Ecological Society
1358 D.-Q. Pu et al.
features are traditionally associated with anemophily, or
wind pollination (Proctor, Yeo & Lack 2006). Simultaneous flowering combined with high seed production provides the opportunity for cross-pollination between
cultivated rice plants or between cultivated and weedy rice
(Lu & Snow 2005). Two factors, however, have led to the
general conclusion that wind dispersal of rice pollen poses
a low risk of gene flow between cultivated rice plants or
cultivated rice plants and wild rice. First, rice exhibits
high rates of self-pollination before flower opening, which
reduces the frequency of cross-pollination (Messeguer
et al. 2001; Vogel 2006). Secondly, rice pollen is shortlived, and estimates of wind dispersal suggest pollen densities rapidly decline with distance from source plants
(Tsunoda & Takahashi 1984). In turn, measures of gene
flow frequencies are <1% between cultivated rice and
below 3% between cultivated and wild rice (Chen et al.
2004).
Researchers have dedicated considerable effort to
enhancing the quality, reproduction and pest-defence
capacity of rice. Genes from the bacterium Bacillus thuringiensis (Bt) that code for insecticidal crystal (Cry) proteins
were first engineered into rice in the mid-1980s (Vaeck
et al. 1987). Several additional transgenic rice varieties
have since been developed including a few that have
entered into farm-scale pre-production trials (Chen, Shelton & Ye 2011). Several biosafety concerns have been
raised about transgenic crops, including the potential risk
of unwanted transgene flow (Ellstrand 2001; Snow 2002).
Gene flow always happens (Burke & Rieseberg 2003;
Chapman & Burke 2006), but predicting ecological
impacts of introduced transgenes is difficult (Wolfenbarger & Phifer 2000). Nonetheless, an understanding of the
factors that affect transgene flow in different crops
remains a crucial component of risk assessment as well as
a consideration in biosafety and trade policies (Huang
et al. 2005; Lu & Snow 2005).
Many studies focus on wind-mediated gene flow of selfand wind-pollinated crops such as rice (Chen et al. 2004;
Messeguer et al. 2004; Rong et al. 2005, 2007, 2010; Jia
et al. 2008) and wheat (Gatford et al. 2006; Rieben et al.
2011). In contrast, gene flow due to flower-visiting insects
of these plants has received surprisingly little attention.
Insects are the most species-rich animals on Earth, and
many are well-known pollinators of cross-pollinated
plants. Insects also visit plants with anemophilous flowers
(Rose, Dively & Pettis 2007; Wallander 2008; Giovanetti
& Aronne 2011), but their impact on pollination has largely been ignored. Here, we present a 3-year, large-scale
assessment of flower-visiting insects on gene escape in rice.
We examined whether: (i) flower-visiting insects are present on rice during inflorescence and, if so, the amount of
pollen grains they carry, (ii) the dominant foragers visit
both GM and non-GM rice and (iii) the dominant foragers promote transgene flow from GM to non-GM rice.
Materials and methods
COLLECTION AND IDENTIFICATION OF FLOWERVISITING INSECTS
Insects were collected in 42 (in 2010) and 43 (in 2011) locations
in the main rice-cultivating regions in China (Fig. 1). Collection
occurred between 10 a.m. and 3 p.m. in good weather conditions
when rice flowers were open. We captured medium-sized insects,
such as honeybees, with sticky card traps fixed to a bracket. The
Fig. 1. Rice-growing regions (I–VI) for
rice flower-visiting arthropods during 2010
and 2011. The numbers on the map indicate the 57 sampling locations.
© 2014 The Authors. Journal of Applied Ecology © 2014 British Ecological Society, Journal of Applied Ecology, 51, 1357–1365
Impact of insects on transgene flow
1359
clumped pollen from the pollen baskets (corbiculae) on the hind
leg of each captured bee was removed with forceps and placed in
a 2-ml centrifuge tube. Sticky cards were discarded when contaminated. We collected large insects, such as butterflies, individually
using a sweep net. Small insects such as thrips were collected by
covering new flowers with a transparent plastic bag and then
transferring the insects into 2-ml centrifuge tubes. All insects were
placed individually into tubes and dipped in solution I (3 : 1 ethanol absolute: acetic acid) on the day of collection. We recorded
the dominant taxa of flower-visiting insects at each location and
the density of foraging honeybees at locations where the majority
taxa were honeybees.
All specimens were identified to the lowest taxonomic level
(species or genus) as far as possible by insect taxonomists.
(Wuyunjing 7, Xiushui 134 and Jiazao 935) as pollen recipients
for cage studies. G8-7 rice contains the insect resistance synthetic
fusion gene cry1Ab-vip3DA and the glyphosate-resistant gene
G170; 223F-S21 (S2) rice includes the glyphosate-resistant gene
G10evo-EPSPS (G10) and the insect resistance synthetic fusion
gene (Cry1Ab-Cry1Ie); B1 and B6 rice both include the insect
resistance Bt gene (cry1Ab) and the hygromycin resistance gene
(hph). For experiments A, B, C and D, GM rice G8-7 and nonGM parental variety Wuyunjing 7 (Wy), GM rice B1 and nonGM parental variety Jiaozao 935 (JZ), GM rice B6 and non-GM
parental variety Jiaozao 935 (JZ), and GM rice 223F-S21 (S2)
and non-GM parental variety Xiushui 134 (XS) were planted,
respectively. For experiments E and F, GM rice G8-7 and nonGM rice variety Xiushui 134 (XS) were planted.
IDENTIFICATION AND COUNT OF POLLEN GRAINS
Field experiment design
Pollen grains carried by each insect were washed off twice using
solutions I and II (70% ethanol) before transferring the specimen
to solution III (70% ethanol) for storage and identification. The
pollen grains in solutions I and II were air-dried on paper in a
fume hood (SunLab). Pollen grains were identified and recorded
as rice and/or another species by visual inspection using a stereomicroscope (980, ZESS Discovery V8, Germany). Subsets of rice
and pollen from unknown species were also randomly selected,
and their identification confirmed by scanning electron microscopy. For some specimens of bees, hoverflies and damselflies, a
small number of pollen grains remained on their bodies after
washing in solution II. For these specimens, we counted the pollen grains of each insect under stereomicroscope directly before
which placing in solution III. The total number of pollen grains
was then calculated as the sum total of grains in solutions I and
II plus the number of grains on the insect’s body.
Field experiments A–F were conducted during 2010–2012 on
farms located at Zhejiang University, Changxing and Hangzhou,
respectively. For each experiment, six plots were planted in a
straight line. The area of each plot was 50 9 20 m (experiment
A), 100 9 20 m (experiments B, C, E, F) or 65 9 20 m (experiment D). Each plot was divided into two subplots containing
either GM rice or non-GM rice. The proportion of GM and nonGM rice in each plot was 4: 5 in each experiment except D where
the proportion was 3: 3. Rice plants were individually transplanted with distances of 05 m (experiments A and D) or 10 m
(experiment B, C, E and F) between the GM and non-GM subplots, 025 m between rows and 025 m between hills within rows.
During the flowering stage, each plot was covered by one cage
(20 m high) with 05 9 05 mm openings. European honeybees
were then placed in three of the plots (one colony per plot), while
the other three plots had no honeybees.
HONEYBEE-MEDIATED RICE POLLEN FLOW OVER
FORAGING ACTIVITIES OF HONEYBEES
DIFFERENT DISTANCES AND VIABILITY TEST OF RICE
POLLENS
Ten colonies of European honeybee Apis mellifera were set at different distances (100, 200, 300, 400, 500, 600,700, 800, 900 and
1000 m) from the paddy fields during rice anthesis (29 June–19
July; 31 August–8 October 2011) at Huajiachi and (20 June–16
July; 16 August–29 September 2012) the Zijingang farms of
Zhejiang University, Hangzhou. During these periods, the nearest
other blooming paddy fields were >5 km away. We collected the
pollen-carrying honeybees in each colony from 11.00 to 14.00 h
and then determined the total number of rice pollen grains by
randomly selecting 10% of the collected individuals as described
above. Pollen grains from non-rice plants were not counted. The
rice pollen grains carried by honeybees were also examined for
viability using MTT (2,5-diphenyl tetrazolium bromide or thiazolyl blue) as described previously (Khatun & Flowers 1995).
GM RICE VARIETIES AND CAGE STUDIES ASSESSING
TRANSGENE FLOW
Plant materials
Genetically modified (GM) rice lines (G8-7, 223F-S21, B1/B6)
were used as pollen donors and non-transgenic rice varieties
In all experiments except A, the number of foraging honeybees in
each plot with a colony was recorded daily at 09.00, 10.00, 11.00,
12.00, 13.00, 14.00, 15.00 and 16.00 h, respectively. Meanwhile,
the number of foraging honeybees in six plots (each measuring
100 9 20 m) in rice fields without cages was recorded at the
Huajiachi (July 2011) and Zijingang (June 2012) farms. On the
Changxing farm (September 2012), we observed a focal honeybee
(n = 30) for 2 min on rice without cages and recorded the length
of time (seconds) spent on a rice plant panicle, the time interval
(seconds) between foraging visits from one panicle to another
and the total number of panicles visited. All these observations
were carried out between 11.00 and 13.00 h.
COLLECTION OF RICE SEEDS AND HYBRID DETECTION
Only seeds from the non-GM subplots of each experiment were
harvested. One-third or the entire row (if seeds were less than
3000) of non-GM rice plants of experiments A, B, C and E were
harvested at different distance intervals from the GM rice subplots. All seeds from the non-GM subplots of experiments D and
F were harvested. All harvested seeds were then used for detection of transgenic hybrids.
The harvested seeds were soaked in fresh water for 3 days at
37–39 °C and placed in a seed germination dish at 37–39° C for
© 2014 The Authors. Journal of Applied Ecology © 2014 British Ecological Society, Journal of Applied Ecology, 51, 1357–1365
1360 D.-Q. Pu et al.
1–2 days. The germinated seeds were cultured in dishes containing nutrient solution (Yoshida et al. 1976) in an illuminated
growth chamber at 28–30 °C.
Hybrids from experiments A, D, E and F were detected as
described previously (Lin et al. 2010) using glyphosate at a concentration of 205 g l 1 followed by confirmation using the polymerase chain reaction (PCR) with the specific primer pairs
designed for G170 (forward: GGGCCAACGACCTGAT
CTTCCTG; reverse: AGCTCTTGCCCTCCTCGGCCA) and
G10evo-EPSPS(G10) (forward: ACGGCTAGAGCCATCCCA;
reverse: TTTCCCACCGCTCCTTCG). Hybrid detection in
experiments B and C was performed as described by Rong et al.
(2005) using hygromycin B at the rate of 50 mg l 1 and PCR
with the specific primer pairs designed for hph (forward:
CCGAATTCATGAAAAAGCCTGAACTCACC; reverse: CACTCGAGCTATTTCTTTGCCCTCGGAC) and cry1Ab (forward:
TTCCTTGGACGAAATCCCACC; reverse: GCCAGAATTGA
ACACATGAGCGC).
Total genomic DNA was extracted from leaf samples of individual seedlings following the method of Dellaporta, Wood and
Hicks (1983). PCR products were visualized by electrophoresis on
10% agarose gels.
(a)
(b)
Results
MANY FLOWER-VISITING INSECTS ON RICE CARRY
POLLEN GRAINS
To assess the diversity of insects that visit rice flowers
during anthesis, we conducted a 2-year study that sampled
locations in the rice-growing regions of southern
(Lingshui of Hainan, 18.50°N, 110.03°E), north-eastern
(Jiamushi of Heilongjiang, 46.25°N, 130.52°E) and western (Jinghong of Yunnan, 21.95°N, 100.75°E) China
(Fig. 1; see Table S1 in Supporting Information). A total
of 6132 insects were collected in 2010 in fields from 42
locations. Identification of these specimens indicated they
consisted of 425 species in 102 families and 12 orders (see
Table S2). Sampling in 2011 yielded 7443 specimens consisting of 510 species in 107 families and 14 orders (see
Table S2). Pollinators included 40 species of bees (Apoidea) and 28 species of hoverflies (Syrphidae). Two species
of honeybees (Apis mellifera L. or A. cerana cerana Fabricius) were the most abundant insects collected at 15 of the
57 locations we sampled, while sweat bees (Halictus spp.)
were the most abundant insects at three locations.
To access whether flower-visiting insects carry rice pollen, we washed off pollen grains from each specimen and
determined that approximately half (3535 specimens of 342
species in 2010; 3386 specimens of 356 species in 2011) of
the insects we collected had rice pollen on their bodies.
However, particular species carried especially large
amounts of rice pollen (Fig. 2). The leafcutter bee
(Megachile sp. nr. spissula Cockerell), sweat bees (Halictus
spp., Lasioglossum subopacum Smith and Nomia chalybeata
Smith) and honeybees (A. dorsata Fabricius, A. florea
Fabricius, A. cerana cerana and A. mellifera) carried on
average more than 400 grains of pollen (Fig. 2).
Fig. 2. Bees and associated pollen loads collected in 2010 (a) and
2011 (b). ac, Apis cerana cerana F.; ad, Apis dorsata F.; af, Apis
florea Fabricius; am, Apis mellifera L.; as, Augochlorella sp.; hs,
Halictus sp.; ss, Halictus (Seladonia) sp.; ds, Lasioglossum (Dialictus) sp.; ls, Lasioglossum subopacum Smith; sm, Sceliphron
madraspatanum madraspatanum (F.); cs, Cerceris sp.. Bar graphs
are mean SEM. n honeybees carried rice pollen grains shown
in top of columns. The species (labelled as number) shown in this
graph were those with or more than three individuals.
The Asiatic bee Pithitis smaragdula Smith, the sweat bee
Halictus simplex Bl€
uthgen and several hoverfly species
(Eristalis arbustorum (L.), Eristalinus sp., Eristalinus sepulchralis (Linnaeus), Mesembrius sp., Eristalinus aeneus (Scopoli)) carried on average more than 100 rice pollen grains.
EUROPEAN HONEYBEES CARRY RICE POLLEN LONG
DISTANCES
The abundance of European honeybees, A. mellifera, in
many sampling sites prompted us to assess daily activity
patterns of foragers in rice flowers. These studies indicated that honeybees appear in rice fields as soon as flowers open and continue to forage until flowers wither
(Fig. 3 and Fig. 4). Sampling in rice fields near Hangzhou
showed that daily activity peaked between 12.00 and
13.00 h with up to 93 98 (n = 36) honeybees per 20
square metres. Large numbers of honeybees were also
found on rice flowers in Yunnan, Guangdong, Guangxi,
Hunan, Fujian, Jiangsu, Shandong, Hebei and Tianjin
© 2014 The Authors. Journal of Applied Ecology © 2014 British Ecological Society, Journal of Applied Ecology, 51, 1357–1365
Impact of insects on transgene flow
1361
(a)
(b)
Fig. 3. Honeybee foraging on rice flowers. The arrow indicates
the falling pollen grains.
(see Table S2). Focal observations indicated that honeybees rapidly moved from one panicle to another and
avidly collected pollen grains by rolling their legs and
vibrating their wings (see Movie S1). Foragers spent
494 418 sec (n = 30) completing a foraging event on a
panicle. The average time interval of moving from one
panicle to another was 333 116 sec (n = 30), and averaging foraging frequencies were 185 30 panicles in
2 min (n = 30).
Among the 5061 foragers collected, 275 honeybees from
colonies up to 500 m away from the rice field carried 400
or more rice pollen grains (Fig. 5). Subsampling of foragers from a colony located 500 metres from the rice field
further indicated 8111 218% (n = 6) of rice pollen
grains the honeybees carried was viable.
HONEYBEE-MEDIATED GENE FLOW IN RICE
To assess the impact of honeybees on gene flow, we conducted field-cage experiments (A–D) during three growing
seasons (2010–2012) using transgenic rice lines (G8-7,
223F-S21, B1/B6) as pollen donors and non-transgenic,
parental varieties (Wuyunjing 7, Xiushui 134 and Jiazao
935) as pollen recipients (see Table S3). The transgenic
and non-transgenic plants in these experiments flowered
synchronously. Monitoring of honeybee activity in the
three cages with colonies confirmed that the number of
active foragers in each cage per square metre was equivalent to the natural densities of honeybees we observed foraging in rice fields (Fig. 4).
Over the four experiments A–D, transgene flow frequencies in plots with and without honeybees averaged
<1% (Fig. 6a) as determined by screening a total of
Fig. 4. Foraging activity of honeybees on rice. (a) The numbers
of foraging honeybees at different times in Hangzhou and
Changxing in 2011 (HI, Hangzhou, in cages of experiments B
and C, n = 36; HN, Hangzhou, no cages, n = 36; CI, Changxing,
in cages of experiment E, n = 9). (b) The numbers of foraging
honeybees at different times in Hangzhou and Changxing in 2012
(HI, Hangzhou, in cages of experiment D, n = 18; HN, Hangzhou, no cages, n = 36; CI, Changxing, in cages of experiment F,
n = 18). Bar graphs are mean SEM.
385 979 seeds. However, when examined in relation to the
presence of pollinators, transgene flow frequencies were
075 022 in plots with honeybees and 006 003 in
plots without honeybees (n = 21). This difference between
treatments was significantly different (P < 0001,
Wilcoxon two-sample test) and indicated that transgene
flow was 4–25 times higher in plots with honeybees (see
Table S3). Inspection of the data for each experiment in
relation to the distance between the transgenic and nontransgenic plants indicated the highest levels of hybrid
seed production (1033–1465%) occurred primarily in
cages with honeybees. We also noted that hybrid seeds
occur unpredictably at different distances, indicating that
pollen flow mediated by honeybees does not correlate
with distance (see Table S3).
The importance of insects for cross-pollination was further underscored in two other trials (experiments E and
F) where transgenic rice flowered a week earlier than the
non-transgenic variety, which resulted in almost no hybrid
© 2014 The Authors. Journal of Applied Ecology © 2014 British Ecological Society, Journal of Applied Ecology, 51, 1357–1365
1362 D.-Q. Pu et al.
(a)
(b)
Fig. 5. Honeybee-mediated rice pollen flow over different distances. Mean number of rice pollen grains from honeybees collected at different distances away from paddy fields in 2011 (a)
and 2012 (b). Values shown in the upper left of each bar indicate
the number of honeybees that carried rice pollen grains, and the
distances indicated along the x axis, while the average number of
pollen per bee is indicated along the y axis. Bar graphs are
mean SEM.
seed being formed in cages with or without honeybees by
screening a total of 547 672 offspring seeds (see Table
S3). This finding indicated that an interval of more than a
week between flowering periods is an effective way to control gene flow in rice.
Discussion
Rice has been cultivated in China for more than
7000 years (Zong et al. 2007) and today is grown in six
major regions (I–VI, Fig. 1) (Gong et al. 2007). In this
study, we travelled over 50 000 km from the south to the
north-east and the west, covering the main rice-growing
regions of China. To our knowledge, this study represents
both the first nationwide survey of the insect fauna that
visits flowering rice and is also among the largest surveys
of pollinating insects ever conducted in terms of area.
Surprisingly, our results indicated that a remarkably high
diversity of insects visited rice flowers in all growing
regions of China and that this diversity exceeded plant–
insect pollinating networks studied previously (Gomez
et al. 2007; Chacoff et al. 2012).
Our results show that the European honeybee A. mellifera and other domestic and feral bees forage regularly
during the rice florescence. Unlike the spinulose pollen
grains produced by many anthophilous plants, rice produces granular pollen (Chaturvedi, Datta & Nair 1998),
which is normally less adapted for transport on insects
(Poppy & Wilkinson 2005). Nonetheless, our results also
show that hundreds of flower-visiting insect species carried rice pollen grains. Among them, honeybees and sweat
bees carry the largest numbers of rice pollen grains, followed by hoverflies. These types of insects have been
noted to visit other anthophilous plants (Fægri & van der
Pijl 1979; Real 1983). However, we also noted that the
number of rice pollen grains carried by several bee species
on average exceeded pollen loads for A. mellifera from
other anemophilous plants (Alarc
on 2010). The number
of pollen grains carried by several hoverfly species on
average was equivalent to the loads of viable Brassica
rapa L. pollen that hoverflies were previously shown to
carry 400 m (Rader et al. 2011). Most importantly, our
results show that A. mellifera carries a large number of
viable rice pollen grains at least 500 m away from the pollen source, which is a much longer distance than measured previously for wind dispersal (Rong et al. 2010).
Given that European honeybees forage at least 136 km
from their hive (Eckert 1933) and pollen grains can spread
by nest-mate mixing (Free & Williams 1972; Poppy &
Wilkinson 2005; Ahmed et al. 2009; Jha & Dick 2010), we
think it is likely that honeybees transport rice pollen further than measured in this study. Synchronous foraging
by native pollinator species and European honeybees
could further increase cross-pollination as previously
noted in sunflowers (Greenleaf & Kremen 2006). Longdistance gene escape has been observed in outcrossing
transgenic crops, such as canola Brassica napus L. with
hybrids detected as far away as 3 km (Rieger et al. 2002;
Wilkinson et al. 2002), and bentgrass Agrostis stolonifera
L. with the maximal gene flow distances of 21 km and
14 km in sentinel and resident plants, respectively
(Watrud et al. 2004).
Over all the cage experiments in which the transgenic
and non-transgenic rice lines flowered synchronously,
transgene flow frequencies in plots without honeybees
were fully consistent with high levels of self-pollination
and previous measures of transgene flow from genetically
modified (GM) to conventional varieties of cultivated rice
(Rong et al. 2005, 2007). These data are also similar to
those for other self- and wind-pollinated plants such as
wheat (Gatford et al. 2006; Rieben et al. 2011). However,
our results also show for the first time that gene flow frequencies were much higher in plots with honeybees than
without, which suggests insect pollinators play a more
important role in cross-pollination of cultivated rice than
previously recognized. In insect-mediated oilseed rape,
honeybees released airborne pollen from the anthers and
© 2014 The Authors. Journal of Applied Ecology © 2014 British Ecological Society, Journal of Applied Ecology, 51, 1357–1365
Impact of insects on transgene flow
1363
(a)
Fig. 6. Detection of hybrids produced by
honeybee pollination. (a) Variation in
transgene flow frequencies in paddy fields
in experiments A–D (also see Table S3).
Bar graphs are mean SEM. (b) Detected
hybrids (the green seedlings survived in a
solution of glyphosate at the concentration
of 205 g l 1) from insect- and glyphosateresistant GM rice G8-7 and non-GM
parental rice variety Wuyunjing 7 (Wy).
(c) Confirmed results of G170 and G10
genes. H1-H2, hybrids; G8-7, S2, M, control. (d) Detected hybrid (H) from insectresistant GM rice (B1 and B6) and nonGM parental rice variety Jiazao 935 (ZJ)
with hygromycin B. (e) Confirmed results
of hph and cry1Ab genes of d. H1-H2,
hybrids; B1, B6 and M, control.
(b)
(d)
(c)
(e)
increased fruit and seed set 7 and 34 times, respectively
(Pierre et al. 2010). In cotton, another anthophilous crop,
pollen-mediated gene flow was independent of direction
from the source plot and declined exponentially with
increasing distance from 765% at 03 m to <1% beyond
9 m when there was high honeybee activity, while in the
absence of high honeybee populations, gene flow was
<1% beyond 1 m (Van Deynze, Sundstrom & Bradford
2005). The contribution of pollinator activity to gene flow
in our study is thus consistent with those found in other
studies (Albrecht et al. 2009; Heuberger et al. 2010),
although the high levels of outcrossing found might be
elevated beyond what would likely occur in free-range situations since bees were added into the cages and so had
restricted movement potential.
Rice produces high-anther but low-style flowers, which
are slightly protandrous and have plumose stigmas. These
features collectively are adapted to easily receive pollen
grains. Rice anthers also hang outside the flowers which
allow bees to collect pollen grains easily. Pollen grains
carried by bees from other flowers can also fall from their
bodies (as indicated by the red arrowhead in Fig. 3),
which in turn allows lower-hanging flowers to receive
pollen grains. The stigma is occasionally touched by bee
legs during bee’s flower visitation. These characteristics
collectively indicate that cross-pollination of rice can
occur by either wind or insect activity. In our cage experiments, wind speed was greatly reduced by the netting
used, which likely reduced wind-mediated cross-pollination. Thus, the gene flow we detected was most likely due
to the activity of the foraging honeybees we placed in the
cages. In addition, our results show that rice plants at
variable distances had extremely large (~10%) levels of
hybrid seeds, which indicates that high hybrid seed production in the presence of honeybees does not correlate
with distance between GM and non-GM plants. This
likely reflects foraging behaviour as honeybees fly freely
and visit rice flowers stochastically. Foragers locate rice
flowers in relation to their maturity and usually forage on
in a given location before flying away to visit another at
varying distances.
The current results have several implications for future
ecological risk assessment of GM crops. First, our results
suggest the potential exists for long-distance gene escape
due to the abundance of insects that carry rice pollen.
Thus, the risk of transgene flow mediated by flower-visiting insects must be considered in GM rice. Although
long-distance pollen flow is difficult to assess directly, we
© 2014 The Authors. Journal of Applied Ecology © 2014 British Ecological Society, Journal of Applied Ecology, 51, 1357–1365
1364 D.-Q. Pu et al.
estimated pollen flow indirectly by analysing the foraging
range of honeybees. Secondly, gene flow mediated by
insects is less affected by distance than wind pollination.
Thirdly, our results also have implications for other anemophilous plants as they suggest the importance of insects
in pollination may be underestimated. In China, the safety
assessment for agricultural GMOs, including GM rice, is
conducted on a case-by-case scientific examination using
safety regulations appropriate to the testing stage, which
includes five stages: (1) laboratory research, (2) pilot field
testing, (3) environmental release field testing, (4) preproduction testing and (5) application for biosafety certificates (Chen, Shelton & Ye 2011). The results from this
study could be integrated into the risk assessment at least
the stage 2 to 4 to evaluate the outcrossing by insects.
Acknowledgements
The authors thank Shu-sheng Liu, Mirab-balou Majid and Shu-jun Wei
for their discussions and suggestions on an early draft of the manuscript.
We acknowledge Xu-dong Fei, Guo-fang Jiang, Hou-hun Li, Qiang Li,
Shu-qiang Li, Yan Li, Zhu Li, Jing-xian Liu, Qi-fei Liu, Xiao-yan Liu,
Mirab-balou Majid, Jian-chu Mo, Li Ren, Ming-Fu Wang, Xin-hua
Wang, Jun-chao Wang, Meng-qing Wang, Mei-cai Wei, Zai-fu Xu, Wanqi Xue, Guo-yue Yu, Jie Zeng, Zu-wei Zha, Dong Zhang, Li-li Zhang,
Run-zhi Zhang, Ting-ting Zhang, Ya-lin Zhang, Fa-ke Zheng, Zhe-ming
Zheng, Chang-fa Zhou, Dan Zhou and Shan-yi Zhou for their identifying
part of insects. The authors thank Ru-min Ren and Song-kun Su for their
providing colonies of European honeybees. We thank Dong Ai, Lei-ming
Chen, Yu-zhou Du, Jun Gao, Yu Liu, Tong-ping Luo, Hui Ma, Zhengqiang Peng, Zheng-lin Tang, Chun-rong Wang, Tao Zeng, Zhu-hua
Zhang and Ping Zhou for their assistance in collecting insects. The
authors thank Yi-kai Chen, Qing-dian Chen, Zheng Chen, Wei He,
Shou-peng Hou, Kai Huang, Lan Huang, Jian Jiang, Chao-yang Lin,
Ming-chao Li, Ming-tian Li, Jin-wen Liu, Qing-kai Meng, Chen-yun
Qiao, Yong Sun and Xiong Zhang for their assistance in collecting
insects, harvesting rice, counting pollen grains and detecting hybrids. This
study was supported by the 973 Program (2013CB127600) to X.X.C., the
National Program of Development of Transgenic New Species of China
(2009ZX08011-008B, 2008ZX08011-006, 2011ZX08011-006) to XXC and
MS, 973 Program (2007CB109202) to XXC and GYY, the National Science Fund for Innovative Research Groups (31021003) to XXC, GYY
and Shen ZC.
Data accessibility
All data are available in the Supporting Information.
References
Ahmed, S., Compton, S.G., Butlin, R.K. & Gilmartin, P.M. (2009) Wind-borne insects mediate directional pollen transfer between desert fig trees
160 kilometers apart. Proceedings of the National Academy of Sciences
of the United States of America, 106, 20342–20347.
Alarc
on, R. (2010) Congruence between visitation and pollen-transport
networks in a California plant-pollinator community. Oikos, 119, 35–44.
Albrecht, M., Duelli, P., Obrist, M.K., Kleijn, D. & Schmid, B. (2009)
Effective dong-distance pollen dispersal in Centaurea jacea. PLoS ONE,
4, e6751.
Burke, J.M. & Rieseberg, L.H. (2003) Fitness effects of transgenic disease
resistance in sunflowers. Science, 300, 1250–1250.
Chacoff, N.P., V
azquez, D.P., Lomascolo, S.B., Stevani, E.L., Dorado, J.
& Padr
on, B. (2012) Evaluating sampling completeness in a desert
plant–pollinator network. Journal of Animal Ecology, 81, 190–200.
Chapman, M.A. & Burke, J.M. (2006) Letting the gene out of the bottle:
the population genetics of genetically modified crops. New Phytologist,
170, 429–443.
Chaturvedi, M., Datta, K. & Nair, P.K.K. (1998) Pollen morphology of
Oryza (Poaceae). Grana, 37, 79–86.
Chen, M., Shelton, A. & Ye, G.Y. (2011) Insect-resistant genetically modified rice in China: from research to commercialization. Annual Review
of Entomology, 56, 81–101.
Chen, L.J., Lee, D.S., Song, Z.P., Suh, H.S. & Lu, B.R. (2004) Gene flow
from cultivated rice (Oryza sativa) to its weedy and wild relatives.
Annals of Botany, 93, 67–73.
Dellaporta, S., Wood, J. & Hicks, J. (1983) A plant DNA minipreparation:
Version II. Plant Molecular Biology Reporter, 1, 19–21.
Eckert, J.E. (1933) The flight range of the honeybee. Journal of Agricultural Research, 47, 257–285.
Ellstrand, N.C. (2001) When transgenes wander, should we worry? Plant
Physiology, 125, 1543–154.
Fægri, K. & van der Pijl, L. (1979) The Principles of Pollination Ecology,
pp. 102–115. Pergamon Press, Oxford, UK.
Free, J.B. & Williams, I.H. (1972) The transport of pollen on the body
hairs of honeybees (Apis mellifera L.) and bumblebees (Bombus spp. L.).
Journal of Applied Ecology, 9, 609–615.
Gatford, K.T., Basri, Z., Edlington, J., Lloyd, J., Qureshi, J.A., Brettell,
R. et al. (2006) Gene flow from transgenic wheat and barley under field
conditions. Euphytica, 151, 383–391.
Giovanetti, M. & Aronne, G. (2011) Honey bee interest in flowers
with anemophilous characteristics: first notes on handling time and routine on Fraxinus ornus and Castanea sativa. Bulletin of Insectology, 64,
77–82.
Gomez, J.M., Bosch, J., Perfectti, F., Fernandez, J. & Abdelaziz, M.
(2007) Pollinator diversity affects plant reproduction and recruitment:
the tradeoffs of generalization. Oecologia, 153, 597–605.
Gong, Z.T., Chen, H.Z., Yuan, D.G., Zhao, Y.G., Wu, Y.J. & Zhang,
G.L. (2007) The temporal and spatial distribution of ancient rice in
China and its implications. Chinese Science Bulletin, 52, 1071–1079.
Greenleaf, S.S. & Kremen, C. (2006) Wild bees enhance honey bees’ pollination of hybrid sunflower. Proceedings of the National Academy of
Sciences of the United States of America, 103, 13890–13895.
Heuberger, S., Ellers-Kirk, C., Tabashnik, B.E. & Carriere, Y. (2010)
Pollen- and seed-mediated transgene flow in commercial cotton seed
production fields. PLoS ONE, 5, e14128.
Huang, J.K., Hu, R.F., Rozelle, S. & Pray, C. (2005) Insect-resistant GM
rice in farmers’ fields: assessing productivity and health effects in China.
Science, 308, 688–690.
Jha, S. & Dick, C.W. (2010) Native bees mediate long-distance pollen dispersal in a shade coffee landscape mosaic. Proceedings of the National
Academy of Sciences of the United States of America, 1376, 0–13764.
Jia, S.R., Wang, F., Shi, L., Yuan, Q.H., Liu, W.G., Liao, Y.L. et al.
(2008) Transgene flow to hybrid rice and its male-sterile lines. Transgenic Research, 16, 491–501.
Khatun, S. & Flowers, T.J. (1995) The estimation of pollen viability in
rice. Journal of Experimental Botany, 46, 151–154.
Lin, C.Y., Nie, P., Lu, W., Zhang, Q., Li, J. & Shen, Z.C. (2010) A selectively terminable transgenic rice line expressing human lactoferrin.
Protein Expression and Purification, 74, 60–64.
Lu, B.R. & Snow, A.A. (2005) Gene flow from genetically modified rice
and its environmental consequences. BioScience, 55, 669–678.
Messeguer, J., Fogher, C., Guiderdoni, E., Marfa, V., Catala, M.M.,
Baldi, G. et al. (2001) Field assessment of gene flow from transgenic to
cultivated rices (Oryza sativa L.) using a herbicide resistance gene as tracer marker. Theoretical and Applied Genetics, 103, 1151–1159.
Messeguer, J., Marfa, V., Catala, M.M., Guiderdoni, E. & Mele, E. (2004)
A field study of pollen-mediated gene flow from Mediterranean GM rice
to conventional rice and the red rice weed. Molecular Breeding, 13,
103–112.
Pierre, J., Vaissiere, B., Vallee, P. & Renard, M. (2010) Efficiency of airborne pollen released by honeybee foraging on pollination in oilseed
rape: a wind insect-assisted pollination. Apidologie, 41, 109–115.
Poppy, G.M. & Wilkinson, M.J. (2005) Gene Flow from GM Plants. Blackwell, Oxford.
Proctor, M., Yeo, P. & Lack, A. (2006) The Natural History of Pollination.
Timber Press, Portland.
Rader, R., Edwards, W., Westcott, D.A., Cunningham, S.A. & Howlett,
B.G. (2011) Pollen transport differs among bees and flies in a
human-modified landscape. Diversity and Distributions, 17, 519–529.
Real, L. (1983) Pollination Biology. Academic Press, Michigan, USA.
Rieben, S., Kalinina, O., Schmid, B. & Zeller, S.L. (2011) Gene flow in
genetically modified wheat. PLoS ONE, 6, e29730.
© 2014 The Authors. Journal of Applied Ecology © 2014 British Ecological Society, Journal of Applied Ecology, 51, 1357–1365
Impact of insects on transgene flow
Rieger, M.A., Lamond, M., Preston, C., Powles, S.B. & Roush, R.T.
(2002) Pollen-mediated movement of herbicide resistance between commercial canola fields. Science, 296, 2386–2388.
Rong, J., Song, Z.P., Su, J., Xia, H., Lu, B.R. & Wang, F. (2005) Low
frequency of transgene flow from Bt/CpTI rice to its nontransgenic
counterparts planted at close spacing. New Phytologist, 168, 559–566.
Rong, J., Lu, B.R., Song, Z.P., Su, J., Snow, A.A., Zhang, X.S. et al.
(2007) Dramatic reduction of crop-to-crop gene flow within a short distance from transgenic rice fields. New Phytologist, 173, 346–353.
Rong, J., Song, Z.P., de Jong, T.J., Zhang, X.S., Sun, S.G., Xu, X. et al.
(2010) Modelling pollen-mediated gene flow in rice: risk assessment and
management of transgene escape. Plant Biotechnology Journal, 8, 452–464.
Rose, R., Dively, G.P. & Pettis, J. (2007) Effects of Bt corn pollen on
honey bees: emphasis on protocol development. Apidologie, 38, 368–377.
Snow, A.A. (2002) Transgenic crops - why gene flow matters. Nature Biotechnology, 20, 542–542.
Stone, R. (2008) Food safety - Arsenic and paddy rice: a neglected cancer
risk? Science, 321, 184–185.
Tsunoda, S. & Takahashi, N. (1984) Biology of Rice. Elsevier, Amsterdam.
Vaeck, M., Reynaerts, A., Hofte, H., Jansens, S., Debeuckeleer, M., Dean,
C. et al. (1987) Transgenic plants protected from insect attack. Nature,
328, 32–37.
Van Deynze, A.E., Sundstrom, F.J. & Bradford, K.J. (2005) Pollenmediated gene flow in California cotton depends on pollinator activity.
Crop Science, 45, 1565–1570.
Vogel, G. (2006) Genetically modified crops - Tracing the transatlantic
spread of GM rice. Science, 313, 1714–1714.
de Vries, A.P. (1971) Flowering biology of wheat, particularly in view of
hybrid seed production — A review. Euphytica, 20, 152–170.
Wallander, E. (2008) Systematics of Fraxinus (Oleaceae) and evolution of
dioecy. Plant Systematics and Evolution, 273, 25–49.
Watrud, L., Lee, E.H., Fairbrother, A., Burdick, C., Reichman, J.R., Bollman, M. et al. (2004) Evidence for landscape-level, pollen-mediated gene
flow from genetically modified creeping bentgrass with CP4 EPSPS as a
marker. Proceedings of the National Academy of Sciences of the United
States of America, 101, 14533–14538.
1365
Wilkinson, M.J., Elliott, L.J., Allainguillaume, J., Shaw, M.W., Norris,
C., Welters, R. et al. (2002) Hybridization between Brassica napus
and B. rapa on a national scale in the United Kingdom. Science, 302,
457–459.
Wolfenbarger, L.L. & Phifer, P.R. (2000) Biotechnology and ecology-The
ecological risks and benefits of genetically engineered plants. Science,
290, 2088–2093.
Yoshida, S., Forno, D.A., Cock, J.H. & Gomez, K.A. (1976) Laboratory
Manual for Physiological Studies of Rice. International Rice Research
Institute (IRRI), Manila.
Zong, Y., Chen, Z., Innes, J.B., Chen, C., Wang, Z. & Wang, H. (2007)
Fire and flood management of coastal swamp enabled first rice paddy
cultivation in east China. Nature, 449, 459–463.
Received 27 January 2014; accepted 29 May 2014
Handling Editor: Danny Hooftman
Supporting Information
Additional Supporting Information may be found in the online version
of this article.
Table S1. Sampling locations with information of names, GPS
coordinates, wind speed, wind direction, weather and state of florescence
Table S2. Rice flower-visiting arthropods in 2010 and 2011.
Table S3. Transgene flow frequencies (%) from GM rice to its
non-GM parental variety.
Movie S1. Video clip of honeybee visiting rice flowers.
© 2014 The Authors. Journal of Applied Ecology © 2014 British Ecological Society, Journal of Applied Ecology, 51, 1357–1365