FEMS Yeast Research 1 (2001) 241^245
www.fems-microbiology.org
Evidence for the attachment of Hsp150/Pir2 to the cell wall of
Saccharomyces cerevisiae through disul¢de bridges
Isma|«l Moukadiri, Jesüs Zueco *
Secciön Departamental de Microbiolog|¨a, Facultad Farmacia, Universidad de Valencia, Avda. Vicente Andres Estelles s/n, 46100 Burjassot, Valencia, Spain
Received 22 January 2001; received in revised form 18 May 2001; accepted 29 May 2001
First published online 21 June 2001
Abstract
Here we present evidence that Hsp150/Pir2, a member of the Pir family of cell wall proteins, can be extracted from the purified cell walls
of Saccharomyces cerevisiae by treatment with L-mercaptoethanol, demonstrating that at least part of this protein is attached to the cell wall
through disulfide bridges. We also present evidence that Pir4, another member of this family, is partly secreted to the growth medium.
Finally we propose a hypothesis to explain the relationship between the differently localized forms of particular members of the Pir family of
cell wall proteins. ß 2001 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.
Keywords : Hsp150; Disul¢de bridge; Cell wall ; Pir cell wall protein
1. Introduction
The cell wall of Saccharomyces cerevisiae represents
some 30% of the total weight of the cell and is made up
of L-glucans, mannose-containing glycoproteins (mannoproteins) and small amounts of chitin [1,2]. The mannoproteins can be divided into three groups according to the
linkages that bind them to the structure of the cell wall: (i)
non-covalently bound, (ii) covalently bound to the structural glucan, and (iii) disul¢de-bound to other proteins
that are themselves covalently bound to the structural glucan of the cell wall [3]. The proteins that are covalently
bound to the structural glucan of the cell wall have themselves been classi¢ed in two groups: glycosylphosphatidylinositol (GPI) cell wall proteins, that are immobilized in
the wall by linkage to L-1,6-glucan, and the Pir family of
proteins, that are directly bound to the L-1,3-glucan [4,5].
However, Pir4, a member of the Pir family, has recently
been described as a disul¢de-bound cell wall protein [6],
and Pir2, another member of this family, is mostly secreted to the medium [7], only a fraction being retained
in the cell wall. According to Kapteyn et al. [5], this fraction of Pir2 would remain attached to the cell wall through
direct linkages to the L-1,3-glucan. In this work, we
* Corresponding author. Tel. : +34 (96) 3983605;
Fax: +34 (96) 3864299. E-mail address: [email protected] (J. Zueco).
present evidence that, as is the case with Pir4, at least
some part of the cell wall-retained fraction of Pir2 can
be extracted with reducing agents. Also, we propose a
hypothesis that would explain the simultaneous presence
of some Pir proteins in the medium and in di¡erent cell
wall extracts.
2. Materials and methods
2.1. Strains and media
Escherichia coli strain DH5K was used for the propagation of plasmids, and it was grown in Luria broth (LB)
supplemented with 100 Wg ampicillin ml31 when necessary.
The standard yeast strains X2180-1A (MATa SUC2 mal
mel gal2 cup1) and BMA64-1A (MATa ade2-1 can1-100
ura3-1 leu2-3,112 trp1-D 2 his3-11) were used. All strains,
apart from mnn1 mnn9, were provided by the Spanish
Type Culture Collection (CECT). Strain mnn1 mnn9 was
provided by Luis Miguel Hernandez (Universidad de Extremadura, Badajoz, Spain). Yeast strains were grown in
1% yeast extract, 2% Bacto peptone, 2% glucose or synthetic minimal medium SD (0.7% yeast nitrogen base without amino acids, 2% glucose and amino acids as required).
The growth medium of exponentially growing cells was
concentrated for electrophoresis by passing it through a
Microcon microconcentrator device from Amicon (Bev-
1567-1356 / 01 / $20.00 ß 2001 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved.
PII: S 1 5 6 7 - 1 3 5 6 ( 0 1 ) 0 0 0 2 5 - 3
FEMSYR 1419 26-11-01
242
I. Moukadiri, J. Zueco / FEMS Yeast Research 1 (2001) 241^245
erly, MA, USA). In this way 500 Wl of growth medium
was concentrated to 10 Wl, enough for loading a lane.
2.2. Reagents
Agar, yeast extract, peptone and yeast nitrogen base
were purchased from Difco Laboratories (Detroit, MI,
USA); phenylmethylsulfonyl £uoride (PMSF) was from
Boehringer (Mannheim, Germany); DNA restriction and
modi¢cation enzymes were from Boehringer, New England Biolabs (Beverly, MA, USA) and Amersham Pharmacia (Amersham, UK). The usual chemicals were purchased from Sigma Chemical Co. (St. Louis, MO, USA)
and from Panreac (Barcelona, Spain). Electrophoresis reagents were from Bio-Rad Laboratories. Nitrocellulose
membranes and the chemiluminescence ECL reagents for
developing Western immunoblots were from Amersham.
Goat anti-rabbit IgG peroxidase was from Bio-Rad.
2.3. Isolation of cell wall mannoproteins
Cell walls from S. cerevisiae were puri¢ed and extracted
with L-mercaptoethanol as follows : cells in the early exponential phase from 1-l cultures were harvested and
washed twice in Tris^HCl 10 mM pH 7.4, 1 mM in
PMSF (bu¡er A). The harvested biomass was resuspended
in bu¡er A in a proportion of 2 ml g31 (wet weight), glass
beads (0.45 mm in diameter) were added up to 50% of the
¢nal volume, and the cells were broken by shaking four
times for 30 s, with 1-min intervals, in a CO2 refrigerated
MSK homogenizer (Braun Melsungen AG, Germany).
Breakage was con¢rmed by phase contrast microscopy
and the walls were washed six to eight times in bu¡er A.
Removal of non-covalently bound proteins was achieved
by boiling the walls in bu¡er A containing 2% SDS (10 ml
g31 of walls, wet weight) for 10 min, followed by six to
eight washes in bu¡er A. The puri¢ed cell walls were ¢nally resuspended in 10 mM ammonium acetate bu¡er,
pH 6.3, containing 2% (v/v) L-mercaptoethanol (5 ml
g31 walls, wet weight) and incubated for 3 h at 30³C in
an orbital incubator at 200 rpm. The extract was separated
from the cell walls by centrifugation, concentrated by lyophilization and resuspended in a ¢nal volume of 200 Wl of
distilled water. For electrophoresis, 5 Wl of this sample was
loaded per lane.
2.4. SDS^polyacrylamide gels and Western blot analysis
Proteins were separated by SDS^polyacrylamide gel
electrophoresis (SDS^PAGE) according to the method of
Laemmli [8] in 10% or 12% polyacrylamide gels. The proteins separated by SDS^PAGE were either stained with
Coomassie brilliant blue or transferred onto Hybond-C
nitrocellulose membranes as described by Towbin et al.
[9] and Burnette [10]. Membranes were blocked overnight
in Tris-bu¡ered saline containing 0.05% Tween-20 (TBST)
and 5% non-fat milk. The blocked membranes were
washed three times in TBST and incubated for 1 h in
TBST containing the antibody at a dilution of 1:5000.
After three washes in TBST, the membranes were incubated for 20 min in TBST containing goat anti-rabbit
IgG-peroxidase at a dilution of 1:12 000 and washed in
TBST. Finally, antibody binding was visualized on X-ray
¢lm by using the ECL method (Amersham).
2.5. Transformation of strains and DNA isolation
Basic DNA manipulation and transformation in E. coli
was performed as described by Sambrook et al. [11]. Yeast
transformation was carried out by the lithium acetate
method [12]. Plasmid DNA from E. coli was prepared
using the Flexi-Prep kit (Pharmacia) and DNA fragments
were puri¢ed from agarose gels using the Sephaglass
Band-Prep kit, also from Pharmacia.
2.6. Construction of the deletion cassette and con¢rmation
of the deletion mutant by PCR
The simultaneous replacement of the genomic copies of
PIR2 and PIR4 by the deletion cassette was performed by
the one-step transplacement method [13], taking advantage of their contiguity in chromosome X. A fragment
of 2700 bp containing the PIR2 and PIR4 open reading
frames (ORFs) was generated by PCR using Taq DNA
polymerase and the oligonucleotides A1: TCCGTCTGTAGTGATAAGTCGCC (located 331 bp upstream of the
ATG of YJL159w/PIR2) and A4: GGATCCATGCAATTCAAAAACGTCGCCCTAG (located 6 bp upstream
of the ATG of YJL158c/PIR4) as primers. This 2700-bp
fragment was subcloned in pGEMT (Promega) to give
plasmid pIM11. This plasmid was then digested with
XhoI and EcoRI and the 2000-bp fragment released was
substituted by the KanMX4 marker digested out of pFA6
[14] with SalI and EcoRI to give plasmid pIM12. Finally,
a 2000-bp disruption cassette comprising a small part of
the PIR2 and PIR4 ORFs, interrupted by the KanMX4
marker, was generated by PCR using the oligonucleotides
A1 and A4 as primers and plasmid pIM12 as the template.
Approximately 1 Wg of the disruption cassette was transformed in strains BMA64-1A and mnn1 mnn9. To con¢rm
the replacement in the PIR2 and PIR4 loci, stable geneticin-resistant transformants of the viable haploid form of
each strain were analyzed by PCR using the oligonucleotides A1 and A4. The sequence of these oligonucleotides
and the length of the predicted PCR product were derived
from the yeast genome sequence.
3. Results
In a previous work, we have shown that the treatment
of puri¢ed cell walls of a wild-type strain of S. cerevisiae
FEMSYR 1419 26-11-01
I. Moukadiri, J. Zueco / FEMS Yeast Research 1 (2001) 241^245
with L-mercaptoethanol releases mainly a mannoprotein
of 40 kDa, which we identi¢ed as Pir4 [6]. In the same
work, we also showed that the treatment of the cell walls
of the mnn1 mnn9 mutant strain, characterized by the low
level of glycosylation of its mannoproteins [15], releases
mainly two mannoproteins of 45 and 40 kDa, that correspond to the Kex2 unprocessed and Kex2 processed forms
of Pir4, and a mannoprotein of 120 kDa identi¢ed as the
underglycosylated form of Bar1p [6].
Based on these previous results we have undertaken a
more detailed analysis of other, minor mannoproteins,
that are also present in the L-mercaptoethanol extracts
obtained from the puri¢ed cell walls of the wild-type
and mnn1 mnn9 strains of S. cerevisiae, and of the mannoproteins that, related with those, are secreted to the
growth medium by these strains. To achieve this, we obtained L-mercaptoethanol extracts from the puri¢ed cell
walls, and concentrated growth medium from the two
strains, and analyzed them by Western immunoblot, using
a polyclonal antibody raised against the L-mercaptoethanol extract from the mnn1 mnn9 strain. As can be seen in
Fig. 1, the antibody, apart from the two forms of Pir4,
recognizes several bands of 60^90 kDa and around 150
kDa in the L-mercaptoethanol extract from the mnn1
mnn9 strain. The pattern of the bands recognized by the
antibody in the concentrated growth medium is strikingly
similar, and this would indicate that the L-mercaptoetha-
Fig. 1. Western immunoblot of L-mercaptoethanol extracts from puri¢ed
cell walls (lanes 1 and 3) and concentrated growth medium (lanes 2 and
4) from wild-type and mnn1 mnn9 strains of S. cerevisiae, probed with a
polyclonal antibody raised against the L-mercaptoethanol extracts from
the mnn1 mnn9 strain. Lanes corresponding to the growth medium were
loaded with the equivalent of 0.5 ml of medium. Lanes corresponding
to the L-mercaptoethanol extracts were loaded with the material extracted from cells equivalent to 25 ml of growth medium. Accordingly,
comparatively, 50 times more material was loaded in the lanes corresponding to the L-mercaptoethanol extracts.
243
Fig. 2. Western immunoblot of L-mercaptoethanol extracts from puri¢ed
cell walls of the mnn1 mnn9 and wild-type strains (lanes 1 and 4) and
the mnn1 mnn9 and wild-type strains containing the PIR4: :KanMX4
(lanes 2 and 5) and the double PIR2-PIR4: :KanMX4 disruption respectively (lanes 3 and 6).
nol-extractable mannoproteins are mostly secreted to the
medium in this strain. In the case of Pir4, the relative
amount present in the growth medium represents over
90% of the total sum of Pir4 from the growth medium
and the L-mercaptoethanol extract from the cells harvested
from the same volume of medium. The pattern of bands
recognized by the antibody in the L-mercaptoethanol extract of the wild-type strain (Fig. 1) includes only two
bands, one of 40 kDa that corresponds to Pir4 and another one of 150 kDa that is also present in the growth medium. Interestingly a proportion of Pir4, that can be estimated as some 50% of the total, is also present in the
medium. To rule out the possibility of cell lysis contributing to the presence of Pir4 in the growth medium, the
concentrated growth medium from both strains was
probed with an antibody against alcohol dehydrogenase,
a typical cytosolic protein, with negative results (data not
shown). Because of its size and the fact that it was also a
secreted protein, we suspected that the 150-kDa band
present in the growth medium of the wild-type strain could
correspond to Hsp150/Pir2.
To test this hypothesis we proceeded to the joint disruption of the ORFs YJL158c and YJL159w, encoding
Pir4 and Pir2, respectively, taking advantage of their contiguity in chromosome X. The disruption of the two genes
was done with a disruption cassette that included the
KanMX4 [14] gene as marker, and was performed both
in the wild-type and in the mnn1 mnn9 strain. Western
immunoblot analysis of the L-mercaptoethanol extracts
FEMSYR 1419 26-11-01
244
I. Moukadiri, J. Zueco / FEMS Yeast Research 1 (2001) 241^245
of the double disruptant pir2pir4 strains was performed
and compared to those of single disruptant pir4 strains
and of the parental strains. The results (Fig. 2) show
that, as expected, in the extracts from strains that contain
the single pir4 disruption, the polypeptide bands corresponding to Pir4 are absent, whilst in the case of the extracts from the strains containing the double pir2pir4 disruption, the 150-kDa polypeptide has also disappeared,
con¢rming its identity as Hsp150. Accordingly, at least
some part of the Hsp150 that remains attached to the
cell wall is bound to its structure through disul¢de bridges.
This portion of disul¢de-bound Hsp150 can be estimated
as 2^4% of the secreted Hsp150.
would account for part of the protein being extracted
from the cell wall by reducing agents and another part
by weak alkali, the percentage of the protein secreted,
attached through disul¢de bridges or directly linked to
L-1,3-glucan being dependent on the particular Pir protein.
In this context, the increased presence of Pir4 in the
culture medium of the mnn1 mnn9 double mutant strain
would suggest the involvement of the glycosidic moiety
of Pir proteins in the alkali-sensitive linkage to L-1,3-glucan. Further work will be necessary to prove this hypothesis.
4. Discussion
This work was supported by Grant PM96-0019 from the
Secretar|¨a de Estado de Universidades, Investigacion y
Desarrollo. I.M. was supported by a fellowship from the
Ministe©re de l'Education Nationale du Maroc.
The main issues we intended to address with this work
were those of the localization of some members of the Pir
family of proteins, and of the kind of linkages that bind
them to the cell wall. The evidence reported so far has
been diverse and sometimes even contradictory. Mrsa et
al. [16] were ¢rst to describe a new family of covalently
linked cell wall proteins formed, among others, by Ccw5p
(Pir4), Ccw6p (Pir1), Ccw7p (Pir2) and Ccw8p (Pir3). This
new family of cell wall proteins does not contain a GPI
anchor, can be released from the cell walls by treatment
with mild alkali and seems to be directly linked to L-1,3glucan molecules in the cell wall [5]. However, Pir2/
Hsp150 had previously been described as a heat shock
protein that is mostly secreted to the medium [7], and
Ccw5p (Pir4) was later described as Scw8p, a dithiothreitol-extractable cell wall protein [17]. Our previous results
have also shown that Pir4 can be released from the cell
walls by treatment with L-mercaptoethanol [6], and in this
work we present evidence that up to 50% of Pir4 is secreted into the growth medium, a result that suggests that
Pir4, as is the case with Pir2, is also, at least in part, a
secreted protein. Finally, we also present evidence that
part of the cell wall-associated Pir2 is bound to the cell
wall through disul¢de bridges. From all this, it can be
concluded that some Pir proteins can be either associated
with the cell wall or secreted to the medium, and that the
portion of the protein that remains cell wall-associated can
be attached either through disul¢de bridges, sensitive to
reducing agents, or through direct linkages to L-1,3-glucan, sensitive to mild alkali treatment. A hypothesis that
would explain the relationship between the di¡erent
localizations of some Pir proteins and the di¡erent kind
of linkages that attach them to the cell wall is that
these proteins would be secreted as disul¢de-bound
dimers or multimers that, once in the cell wall, would, at
least partially, be attached through one of the subunits
to the L-1,3-glucan by the kind of linkages described
by Mrsa et al. [16] and Kapteyn et al. [5], with the nonbound portion being exported into the medium. This
Acknowledgements
References
[1] Fleet, G.H. (1991) Cell walls. In: The Yeast, Yeast Organelles, 2nd
edn. (Rose, A.H. and Harrison, J.S., Eds.), Vol. 14, pp. 199^277.
Academic Press, London.
[2] Klis, F.M. (1994) Review: cell wall assembly in yeast. Yeast 10, 851^
869.
[3] De Nobel, H. and Lipke, P.N. (1994) Is there a role for GPIs in yeast
cell-wall assembly? Trends Cell. Biol. 4, 42^46.
[4] Smits, G.J., Kapteyn, J.C., Van Den Ende, H. and Klis, F.M. (1999)
Cell wall dynamics in yeast. Curr. Opin. Microbiol. 2, 348^352.
[5] Kapteyn, J.C., Van Egmond, P., Slevi, E., Van Den Ende, H., Makarow, M. and Klis, F.M.. (1999) The contribution of the O-glycosylated protein Pir2/Hsp150 to the construction of the yeast cell wall
in wild-type cells and L-1,6-glucan de¢cient mutants. Mol. Microbiol.
31, 1835^1844.
[6] Moukadiri, I., Jaafar, L. and Zueco, J. (1999) Identi¢cation of two
mannoproteins released from cell walls of a Saccharomyces cerevisiae
mnn1 mnn9 double mutant by reducing agents. J. Bacteriol. 181,
4741^4745.
[7] Russo, P., Kalkkinen, N., Sareneva, H., Paakkola, J. and Makarow,
M. (1992) A heat shock gene from Saccharomyces cerevisiae encoding
a secretory glycoprotein. Proc. Natl. Acad. Sci. USA 89, 3671^3675.
[8] Laemmli, U.K. (1970) Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227, 680^685.
[9] Towbin, H., Staehelin, T. and Gordon, J. (1979) Electrophoretic
transfer of proteins from polyacrylamide gels to nitrocellulose sheets:
procedure and some applications. Proc. Natl. Acad. Sci. USA 76,
4350^4354.
[10] Burnette, W.N. (1981) Western blotting: electrophoretic transfer of
proteins from sodium dodecyl-sulfate^polyacrylamide gels to unmodi¢ed nitrocellulose and radiographic detection with antibody
and radioiodinated protein A. Anal. Biochem. 112, 195^203.
[11] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
[12] Ito, H., Fukuda, Y., Murata, K. and Kimura, A. (1983) Transformation of intact yeast cells treated with alkali cations. J. Bacteriol.
153, 163^168.
[13] Rothstein, R. (1983) One-step gene disruption in yeast. Methods
Enzymol. 101, 202^211.
FEMSYR 1419 26-11-01
I. Moukadiri, J. Zueco / FEMS Yeast Research 1 (2001) 241^245
[14] Wach, A., Brachar, A., Pohlmann, R. and Philipsen, P. (1994) New
heterologous modules for classical or PCR-based gene disruptions in
Saccharomyces cerevisiae. Yeast 10, 1793^1808.
[15] Hernandez, L.M., Ballou, L., Alvarado, E., Gillece-Castro, B.L.,
Burlingame, A.L. and Ballou, C.E. (1989) A new Saccharomyces cerevisiae mnn mutant N-linked oligosaccharide structure. J. Biol.
Chem. 246, 11846^11856.
245
[16] Mrsa, V., Seidl, T., Gentzsch, M. and Tanner, W. (1997) Speci¢c
labelling of cell wall proteins by biotinylation. Identi¢cation of four
covalently linked O-mannosylated proteins of Saccharomyces cerevisiae. Yeast 13, 1145^1154.
[17] Cappellaro, C., Mrsa, V. and Tanner, W. (1998) New potential cell
wall glucanases of Saccharomyces cerevisiae and their involvement in
mating. J. Bacteriol. 180, 5030^5037.
FEMSYR 1419 26-11-01