From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
The Gene for B7, a Costimulatory Signal for T-cell Activation, Maps to
Chromosomal Region 3q13.3-3qZ 1
By Gordon J. Freeman, Christine M. Disteche, John G. Gribben, David A. Adler, Arnold S. Freedman,
James Dougery, and Lee M. Nadler
8 7 is an activation antigen expressed on activated B cells and
y-interferon-stimulated monocytes. The 8 7 antigen is the
natural ligand for CD28 on T cells. After engagement of T-cell
receptor with antigen in associationwith major histocompatibility complex class II, a second signal mediated through the
binding of 8 7 to CD28 greatly upregulates the production of
multiple lymphokines. We have now mapped the B7 gene to
human chromosome 3 using the technique of polymerase
chain reaction on a panel of hamster x human somatic cell
hybrid DNAs. We have further localized the gene to 3q13.33q21 using in situ hybridization on human metaphase chromosomes. Trisomy of chromosome 3 is a recurrent chromosome
change seen in various lymphomas and lymphoproliferative
diseases, particularly diffuse, mixed, small, and large cell
lymphomas, human T-cell lymphotropic virus type I-induced
adult T-cell leukemia, and angioimmunoblastic lymphadenopathy. A number of chromosomal defects involving 3q21 have
been described in acute myeloid leukemia and also in myelodysplastic and myeloproliferative syndromes. The mapping
of B7 may permit further insight into disease states associated with aberrant lymphocyte activation and lymphokine
synthesis.
0 1992 by The American Society of Hematology.
B
hybrids were constructed and characterized as described using
parental lines Chinese hamster ovary (CHO-K1) cells and normal
human B lymphocytes.’* Large numbers of each cell line were
characterized karyotypically, DNA was prepared, and additional
cells are cryopreserved at -135°C. This panel discriminates every
human chromosome. The human chromosome content of each cell
line is given in Table 1. At least 75% of the cells in each hybrid line
contain the human chromosome listed (with exceptions as listed in
Table 1). The human-mouse somatic cell lines 18B 2110-6, 10
211-9, CLL 11-2, 24-216-6, 32-315-8, and 20-817-9 have been
described and were kindly provided by Drs F.E. Katz and M.F.
Greaves (Imperial Cancer Research Fund, London, UK).”
Oligonucleotides. The B7 IgV-like domain is encoded by a
single exon corresponding to nucleotides 421-733 of the cDNAZ(G.
Freeman and G. Gray, unpublished results). Sense (TATCCACGTGACCAAGGAAGTG, nucleotides 422-443) and antisense
(ATATCTGACTTTGAAATTCCAAC, 707-687) primers within
the B7-IgV-like exon and a hybridization oligonucleotide (CCGGACCATCTTTGATA, 584-600) were synthesized. Sense
(GCATCGTTTTGGGTTCTCTTGGCT,nucleotides 71-94 of the
cDNA sequence) and antisense (CATGTCTTCCTTGATGGTCTCCAC, nucleotides 310-333) primers spanning two exons and a
hybridization oligonucleotide (CAGGACCCATATGTAAAAGAAGCA, nucleotides 103-126) of the human y-IFN gene were
made.’4 Nucleotides were synthesized on an Applied Biosystems
(Foster City, CA) EP391 synthesizer using standard p-cyanoethyl
phosphoramidite chemistry and purified by Sep-Pak C18 chromatography (Millipore, Milford, MA).
7 IS AN ACTIVATION antigen expressed on activated B cells’r2 and y-interferon (y-1FN)-stimulated
monocyte^.^ The B7 antigen is the natural ligand for CD28
on T c e k 4 After the engagement of T-cell receptor with
antigen in association with major histocompatibility complex (MHC) class 11, a second signal mediated through the
binding of B7 to CD28 greatly upregulates the production
of multiple lymphokines, including interleukin-2 (IL-2),
y-INF, tumor necrosis factor-a (TNF-a), and granulocytemacrophage colony-stimulating factor (GM-CSF), but not
IL-4.5-8B7-transfected cells or B7-Ig fusion protein can
provide this costimulatory signal for T-cell activation and
IL-2 ~ecretion.~.’~
B7 antigen expression on normal human cells is restricted to activated B cells and y-INF-stimulated monocytes.’.’ The 44- to 54-Kd B7 glycoprotein is a member of
the Ig superfamily with an extracellular region consisting of
an IgV-like and an IgC1-like domain followed by a single
transmembrane domain and a short intracytoplasmic region.* After in vitro activation of B cells, the B7 protein is
first detected on the cell surface at 24 hours, peaks at 72
hours, and declines thereafter. B7-positive B cells isolated
from human lymphoid tissues do not proliferate in response
to growth factors alone; however, after Ig crosslinking,
these cells more rapidly enter S phase than B7-negative
cells.’ By its induction on activated B cells and y-IFNstimulated monocytes and subsequent engagement with
CD28, B7 may play a critical role in the amplification of the
immune response by regulating T-cell activation and lymphokine synthesis.
We have now mapped the B7 gene to human chromosome 3 using the technique of polymerase chain reaction
(PCR) on a panel of hamster X human somatic cell hybrid
DNAs. We have further localized the gene to 3q13.3-3q21
using in situ hybridization on human metaphase chromosomes. The mapping of B7 may permit further insight into
disease states associated with aberrant lymphocyte activation and lymphokine synthesis.
MATERIALS AND METHODS
Somatic cell hybrid lines. DNAs from a panel of 25 humanhamster somatic cell hybrids were purchased from the BIOS
Corporation (New Haven, CT).” Human-hamster somatic cell
Blood, Vol79, No 2 (January 15). 1992: pp 489-494
From the Diviswn of Tumor Immunology, Dana-Farber Cancer
Institute, Departments of Medicine and Pathology, Harvard Medical
School, Boston MA; and the Department of Pathology, University of
Washington,Seattle.
Submitted December 28, 1990; accepted September 19, 1991.
Supported by National Institutes of Health Grant No. CA-40216
and AGO057 and a grant from The March of Dimes. J.G.G. is
supported by the Fogaq International Centerof the National Institutes
of Health Grant No. IF05 TW04469.
Address reprint requests to Gordon Freeman, PhD, Division of
Tumor Immunology, Dana-Farber Cancer Institute, Mayer 726, 44
Binney St, Boston, M A 02115.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
indicate thisfact.
0 I992 by The American Society of Hematology.
0006-497119217902-0015$3.00/0
489
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
FREEMAN ET AL
490
Table 1. Production of Human 87 and y-IFN PCR Product From Human x Hamster Somatic Cell Hybrid DNAs
LeneNo.
inFig1
BIOS
No.
1
324
2
423
3
734
4
750
5
803
6
860
7
867
8
940
9
212
10
507
11
683
12
756
13
81 1
14
983
15
862
16
909
17
937
18
854
19
904
20
967
21
968
22
1006
23
1049
24
1079
25
1099
B7 concordant
87 discordant
y-IFN concordant
y-IFN discordant
87
y-IFN
PCR
PCR
Product Product
Human Chromosome Content
1
2
3
4
5
6
8
9
+ +
-
7
10
11
12
13
14
15
16
17 18
19
20
21
22
X
Y
-
-
-
-
-
Yes
Yes
-
+
-
_
-
-
+
-
-
-
-
55%
+
-
-
-
-
-
+
-
-
+
-
-
-
-
-
-
-
-
-
-
-
-
+
-
+ - - - -
-
-
-
-
loo/.
+
-
-
-
-
-
+
-
- - _ -
-
-
+
- + + - -
18
7
21
4
19 15 16
6 1 0
9
24 18 19
1
7
6
-
17 19 25
8
6
0
20 21 18
5
4
7
-
D
-
-
19 4 19 19
6 2 1 6 6
20
6 22 22
5 1 9 3 3
16
9
17
8
18
7
19
6
+
-
-
- - _
19
6
18
7
20 19 17 16
5 6 8
9
21 20 18 20
4 5 7 5
21
4
21
4
16 19 18 19
9
6
7 6
21 20 19 22
4 5 6 3
Percentages are the percent of the cell population containing the noted chromosome.
Abbreviations: D, deleted at 5~15.1-5~15.2;
Dq, multiple deletions in 5q; +, greaterthan 75% of the cell population.
PCR. PCRs were performed using Taq DNA polymerase and
the GeneAmp kit (Perkins-Elmer/Cetus, Nonvalk, CT)according
to the manufacturer's instructions. Ten picomoles of sense and
antisense primers was used to prime DNA synthesis from 50 ng of
DNA from a panel of 25 human-hamster somatic cell hybrids as
well as human and hamster DNAs alone. Thermal cycling conditions were denaturation at 94°C for 1minute, annealing at 60°C for
1 minute, extension at 72°C for 1 minute, for 30 cycles, and a final
cycle of 72°C for 10 minutes.
Analysis of PCR reaction products. Twenty microliters of each
PCR reaction was electrophoresed on a 3% Nusieve/l% agarose
gel (FMC, Rockland, ME), followed by staining with ethidium
bromide and Southern blot transfer to ZetaProbe membranes
(Biorad, Richmond, CA). The identity of the single DNA band
observed was confirmed by hybridization to a "P-labeled oligonucleotide corresponding to nucleotides 584-600 within the B7-IgVlike domain.''
In situ hybridization. The probe used for the in situ hybridization mapping of the B7 gene is a cDNA corresponding to
nucleotides 1-1,491 of the B7 gene.' In situ hybridization to
metaphase chromosomes from lymphocytes of a normal male
donor was performed using the B7 cDNA probe at a concentration
of 0.08 to 0.1 ng/mL of hybridization mixture as described." The
slides were exposed for 22 to 26 days. The chromosomes were
identified with Q-banding (Sigma, St Louis, MO).
RESULTS
The B7 gene was mapped to chromosome 3 by the PCR
technique using primers within the B7-IgV-like exon and
DNAs from a set of 25 human-hamster somatic cell hybrids.
Initially, the specificity of the B7 primers for the human B7
gene was examined in a PCR using either human or
hamster genomic DNA. Using human DNA at annealing
temperatures from 40 to 65"C, a single DNA band was
observed and was of the expected size of 285 bp. The
identity of this band was confirmed by hybridization to an
oligonucleotide within the B7-IgV exon. Hamster DNA did
not produce a detectable PCR product by ethidium bromide staining or hybridization at any of the annealing
temperatures tested. Figure 1 shows the specificity for the
human B7 gene at an annealing temperature of 60°C. PCR
reactions were then performed using DNAs from a set of 25
human-hamster hybrids. A PCR product was generated
from four of the human-hamster somatic cell hybrid DNAs
but not from hamster DNA or the remaining 21 humanhamster somatic cell hybrids (Fig 1A). An oligonucleotide
within the B7-IgV exon hybridized to this PCR product (Fig
1B). Production of the B7 PCR product after the amplification of a human-hamster hybrid was considered as positive
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
491
CHROMOSOME LOCATION OF THE HUMAN 87 GENE
A
B
- 1 3 5 3 bp
603
-
-
310
281
234
C
-2036
-1636
-1018
Fig 1. Production of 87 and ylFN PCR product from DNA of human-hamster somatic cell hybrids. Primers within the B7-IgV-like exon or y l F N
gene were used t o prime DNA synthesis from DNA of a panel of 25 human-hamster somatic cell hybrids as well as human and hamster DNAs
alone. The human chromosome content of the hybrids is given in Table 1. (A) 87 PCR product DNAs were electrophoresed on an agarose gel and
stained with ethidium bromide. (B) The 87 PCR product DNA was transferred t o a Gprobe membrane and hybridized t o an oligonucleotide within
the 87-lgV-like domain. (C) ylFN PCR product DNAs were electrophoresed on an agarose gel, transferred t o a eprobe membrane, and hybridized
t o an oligonucleotide within the ylFN gene.
evidence that the human gene was present in that somatic
cell hybrid. Table 1 summarizes the correlation between the
production of the B7-IgV PCR product and the human
chromosome content of the 25 human-hamster somatic cell
hybrids. Chromosome 3 was present in all four hybrids
where a B7 PCR product was detected. In fact, in hybrid
423, from which a B7 PCR product is produced, the only
human chromosome present is number 3. In contrast,
hybrids with other chromosome combinations have three or
more discordancies. These data suggest that the B7 locus is
on chromosome 3.
Several lines of evidence show that the B7 protein is
recognized by both the B7 and BB1 monoclonal antibodies
(MoAbs). A previous report mapped the human BBl gene
to chromosome 12.l.' To show that the B7 mapping is
discordant with chromosome 12, we have performed PCR
reactions with the somatic cell hybrid panel DNAs using
primers specific for y-IFN, which is located at 12q24.1."
Using human DNA as a template, a PCR product of the
expected size of 1,596 bp was produced. An oligonucleotide
within the human y-IFN gene hybridized to this PCR
product (Fig IC). A y-IFN-specific PCR product was
produced in three hybrids, each of which is reported to
contain chromosome 12 and none of which contains chromosome 3. One hybrid reported to contain chromosome 12 did
not produce a y-IFN PCR product. No other hybrids
produced a y-IFN PCR product. These results show the
accuracy of the chromosomal content of the hybrid panel
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
FREEMAN ET AL
492
localized to 3q13.3-q21 on human metaphase chromosomes
by in situ hybridization using the B7 cDNA as a probe.
Another Ig superfamily member, MOX-1 (human homologue of MRC OX-2), with a similar structure of IgV, IgC,
transmembrane, and short cytoplasmic tail, maps to 3q1213.18MOX-1 is expressed on activated T cells, thymocytes,
B cells, follicular dendritic cells, neurons, and vascular
endothelium. Except for a similar Ig organization, the
MOX-1 gene is not highly homologous to the B7 gene. A
number of metal binding proteins, including CALLA (neutral endopeptidase) (3q21-27),I9 transferrin (3q21-26.1),”
ferritin (q21-q23)?’ lactotransferrin (3q21-23),’* and malanotransferrin (3q21-29),23map to this region. B7 has no
obvious homology to other genes mapping to 3q13.3-q21
including the uridine monophosphate synthetase (3cenq21),24MER6, an antigen identified by the MoAb 1D8
(3~en-q22),’~
propionyl coenzyme A carboxylase (3q13.3q22),26 cholinesterase (serum)-like 1 (3q21),” retinolbinding protein 1 (3q21-q22),a rhodopsin (3q21-q24),” and
prostate acid phosphatase (3q21-qter).30
Several lines of evidence show that the B7 and BBl
proteins are encoded by the same gene.’34BB1 MoAb binds
to B7-transfected COS cells and immunoprecipitates the
B7 protein.’ In binding studies, CD28-transfected CHO
cells bound to B7-transfected COS cells and this adhesion
was blocked by both anti-CD28 and anti-BB1 MoAbs4 In
addition, CD28-positive REX cells bound B7-transfected
CHO cells and adhesion was blocked by either anti-B7 or
anti-BB1 MoAb (unpublished results, A. Freedman et al).
In contrast to our mapping results, BB1 has been previously
mapped to chromosome 12 using the BB1 MoAb to detect
the presence of the BB1 antigen on somatic cell hybrids
between human leukemic cells and mouse plasmacytoma
cells.13We obtained six of the somatic cell hybrids used in
this mapping, and examined them for the presence of the
B7 gene by the production of B7 PCR product. None
produced a B7 PCR product and only one contained the
and show that an assignment of B7 to chromosome 12 is
highly discordant with the chromosomal content of the
hybrid panel (Table 1).
BB1 was mapped to chromosome 12 using the BBl
MoAb to detect the presence of the BB1 antigen on somatic
cell hybrids between human leukemic cells and mouse
plasmacytoma cells. We obtained six of the somatic cell
hybrids used in this mapping, three reported to express BBl
and three that did not.13 DNA was prepared from the cells
and used in PCR reactions with primers specific for the B7
and y-IFN genes. None of the somatic cell hybrid DNAs
produced detectable B7 PCR product. Of the three somatic
cell hybrids reported to contain chromosome 12 and express BB1, only one produced a y-IFN PCR product (data
not shown).
For regional mapping of the B7 gene, in situ hybridization was performed on human metaphase chromosomes
using the B7 cDNA clone as a probe. A total of 76
metaphase cells were examined. Of 200 sites of hybridization scored, 41 (20%) were located between bands q13-q22
of chromosome 3 (Fig 2A). The largest peak of hybridization was at band 3q21 (21 grains) with fewer grains (13
grains) at band 3q13.3 and 3q22 (2 grains). Although the
background was fairly evenly distributed on other chromosomes, there were small peaks of hybridization on the
centromeric heterochromatin of chromosomes 1 and 9 (lqh
and 9qh), at the distal end of the short arm of chromosome
1(lp36), on the short arm of chromosome 3 at 3p21, and on
the proximal long arm of chromosome 12 (12q12). These
small peaks of hybridization were not statistically significant.
DISCUSSION
The B7 gene was mapped to chromosome 3 by the
production of B7-specific PCR product using DNAs from a
panel of 25 human-hamster somatic cell hybrids that
discriminate each human chromosome. The B7 gene was
.4-
0
1
3
2
5
4
7
6
x
op~AArdc&d--*&&*&&&b
8
9
10
11
12
13
14
15
16
17
18
:I&-
19 20 21 22 Y
16.1
26.3
-
28
-
26.1
29
A
B
0
-
3
Fig 2. Regional localization of the B7 gene to human chromosome 3 band q13.3-q21. (A) Distribution of 200 sites of hybridization on human
chromosomes. (B) Distributionof autoradiographicgrains on a diagram of chromosome 3.
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
CHROMOSOME LOCATION OF THE HUMAN 87 GENE
493
region of chromosome 12 containing the y-IFN gene. We
conclude that this initial mapping was in error. This study
used human enzyme markers to establish the presence of
human chromosomes in a somatic cell hybrid, a method
that has been superseded. Alternatively, the BB1 MoAb
might recognize a nonpolypeptide determinant, eg, glycosylation, present on multiple proteins including B7. The
previous mapping might be of this modifying enzyme. A
possibility that cannot be excluded is that B7 and BB1 are
distinct genes that share an epitope involved in binding to
CD28 and that both MoAbs recognize this shared epitope.
Trisomy of chromosome 3 is a recurrent chromosome
change seen in various lymphomas and lymphoproliferative
diseases, particularly diffuse, mixed, small, and large cell
lymphoma^,^' human T-cell lymphotropic virus type I
(HTLV-1)-induced adult T-cell leukemia,” and angioimmunoblastic lymphaden0pathy.3~This corresponds closely with
the pattern of B7 expression found in B-cell malignancies.*
In addition, T-cell lines derived after HTLV-1 infection
express B7.34In general, aberrant expression of I37 might be
expected to lead to disregulated lymphokine production
through stimulation of the CD28 pathway. Aberrant lymphokine expression might lead to a pleiotropic range of clinical
presentations.
A number of chromosomal defects involving 3q21 have
been described in acute myeloid leukemia (AML) and also
in myelodysplastic and myeloproliferative syndrome^.^'-^' In
AML, these include translocations t(3;5)(q21;q31),38 t(3;
3)(q21;q26),36 and t(1;3)(p36;q21), a paracentric inversion
and other rearrangements
of this region, in~(3)(q21q26),~’.~’
affecting 3q21 or 3q26.36 Prominent megakaryocytic and
platelet abnormalities a r e often associated with rearrangements affecting 3q21 or 3q26.’”’’ While the regulation of
platelet production is poorly understood, it is stimulated by
erythropoietin4’ and by secreted products of activated T
cells, including IL-3,41IL-6;’ and IL-11. We have recently
shown that B7 is expressed in monocytes after y-IFN
growth is regulated by a number of
t ~ a t m e n t Monocyte
.~
T-cell-derived cytokines including CSF-1, GM-CSF, macrophage-CSF, IL-3, and IL-6. Because B7 has the function of
amplifying T-cell lymphokine synthesis through engagement of the CD28 pathway, a role for B7 in these syndromes is possible. Aberrant expression of B7 in these
diseases might allow the cells to interact with T cells and
stimulate the production of lymphokines that, in turn,
stimulate the growth of the malignant cells. Whether some
disregulation of B7 function is involved in these hematologic malignancies and lymphoproliferative diseases remains to be determined.
ACKNOWLEDGMENT
The authors thank Kerstin Hildebrandt for preparation of the
manuscript.
REFERENCES
1. Freedman AS, Freeman G, Horowitz JC, Daley J, Nadler
LM: B7, a B cell restricted antigen which identifies pre-activated B
cells. J Immunol137:3260, 1987
2. Freeman GJ, Freedman AS, Segil JM, Lee G, Whitman JF,
Nadler LM: B7, a new member of the Ig superfamily with unique
expression on activated and neoplastic B cells. J Immunol 143:
2714,1989
3. Freedman AS, Freeman GJ, Rhynhart K, Nadler LM: Selective induction of B7/BB-1 on interferon-y stimulated monocytes: A
potential mechanism for amplification of T cell activation. Cell
Immunol137:429,1991
4. Linsley PS, Clark EA, Ledbetter JA: T-cell antigen CD28
mediates adhesion with B cells by interacting with activation
antigen B7IBB-1. Proc Natl Acad Sci USA 87:5031,1990
5. Thompson CB, Lindsten T, Ledbetter JA, Kunkel SL, Young
HA, Emerson SG, Leiden JM, June CH: CD28 activation pathway
regulates the production of multiple T-cell-derived lymphokines/
cytokines. Proc Natl Acad Sci USA 86:1333,1989
6. June CH, Ledbetter JA, Lindsten T, Thompson CB: Evidence
for the involvement of three distinct signals in the induction of IL-2
gene expression in human T lymphocytes. J Immunol143:153,1989
7. June CH, Ledbetter JA, Linsley PS, Thompson CB: Role of
the CD28 receptor in T-cell activation. Immunol Today 11:211,
1990
8. Ledbetter JA, Imboden JB, Schieven GL, Grosmaire LS,
Rabinovitch PS, Lindsten T, Thompson CB, June CH: CD28
ligation in T-cell activation: Evidence for two signal transduction
pathways. Blood 75:1531,1990
9. Gimmi CD, Freeman GJ, Gribben JG, Sugita K, Freedman
AS, Morimoto C, Nadler LM: B7 provides a costimulatory signal
which induces T cells to proliferate and secrete interleukin-2.Proc
Natl Acad Sci USA 88:6575,1991
10. Linsley PS, Brady W, Grosmaire L, Aruffo A, Damle NK,
Ledbetter JA: Binding of the B cell activation antigen B7 to CD28
costimulates T cell proliferation and interleukin 2 mRNA accumulation. J Exp Med 173:721,1991
11. Lewis ME, Ruano G, Latorra D, Hozier JC, Green ED,
Weber B, Hayden M, Weber JL, Kennedy J, Kouri RR: Use of a
commercially available somatic cell hybrid panel for chromosome
mapping by polymerase chain reaction. Biotechniques (submitted)
12. Carlock LR, Smith D, Wasmuth JJ: Genetic counterselective procedure to isolate interspecific cell hybrids containing single
human chromosomes: Construction of cell hybrids and recombinant DNA libraries specific for human chromosomes 3 and 4.
Somat Cell Mol Genet 12:163, 1986
13. Katz FE, Parkar M, Stanley K, Murray LJ, Clark EA,
Greaves MF: Chromosome mapping of cell membrane antigens
expressed on activated B cells. Eur J Immunol15:103,1985
14. Gray PW, Goeddel DV: Structure of the human immune
interferon gene. Nature 298:859,1982
15. Maniatis T, Fritsch EF, Sambrook J: Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor
Laboratory, 1982, p 387
16. Marth JD, Disteche C, Pravtcheva D, Ruddle F, Krebs EG,
Perlmutter RM: Localization of a lymphocyte-specific protein
tyrosine kinase gene (Ick) at a site of frequent chromosomal
abnormalities in human lymphomas. Proc Natl Acad Sci USA
83:7400,1986
17. Trent JM, Olson S, Lawn RM: Chromosomal localization of
leukocyte, fibroblast, and immune interferon genes by means of in
situ hybridization. Proc Natl Acad Sci USA 79:7809,1982
18. Douglas J, Albertson DG, Barclay AN, Davis M, Rabbitts
PH: RFLP and mapping of human MOX-1 gene on chromosome 3.
Nucleic Acids Res 16:9067,1988
19. Barker PE, Shipp MA, D’Adamio L, Masteller EL, Rein-
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
494
herz E L The common acute lymphoblastic leukemia antigen gene
maps to chromosomal region 3(q21-q27). J Immunol142:283,1989
20. Yang F, Lum JB, McGill JR, Moore CM, Naylor SL, van
Bragt PH, Baldwin WD, Bowman BH: Human transferrin: cDNA
characterization and chromosomal localization. Proc Natl Acad Sci
USA 81:2752,1984
21. Gatti R, Shaked R, MohandasTK, Saker W: Human ferritin
genes: Chromosomal assignments and polymorphisms. Am J Hum
Genet 41:654, 1987
22. Teng CT, Pentecost BT, Marshall A, Solomon A, Bowman
BH, Lalley PA, Naylor S L Assignment of the lactotransferrin gene
to human chromosome 3 and to mouse chromosome 9. Somat Cell
Mol Genet 13:689,1987
23. Le Beau MM, Diaz MO, Plowman GD, Brown JP, Rowley
JD: Chromosomal sublocalization of the human p97 melanoma
antigen. Hum Genet 72:294,1986
24. Patterson D, Jones C, Morse H, Rumsby P, Miller Y, Davis
R: Structural gene coding for multifunctional protein carrying
orotate phosphoribosyltransferaseand OMP decarboxylase activity
is located on long arm of human chromosome 3. Somatic Cell Mol
Genet 9:359,1983
25. Miller YE, Daniels GL, Jones C, Palmer DK: Identification
of a cell-surface antigen produced by a gene on human chromosome 3 (cen-q22) and not expressed by Rh null cells. Am J Hum
Genet 41:1061,1987
26. Lamhonwah AM, Barankiewicz TJ, Willard HF, Mahuran
DJ, Quan F, Gravel R A Isolation of cDNA clones coding for the
alpha and beta chains of human propionyl-CoA carboxylase:
Chromosomal assignments and DNA polymorphisms associated
with PCCA and PCCB genes. Proc Natl Acad Sci USA 83:4864,
1986
27. Soreq H, Zamir R, Zevin SD, Zakut H: Human cholinesterase genes localized by hybridization to chromosomes 3 and 16.
Hum Genet 77:325,1987
28. Rocchi M, Covone A, Romeo G, Faraonio R, Colantuoni V
Regional mapping of RBP4 to 10q23-q24and RBPl to 3q21-q22 in
man, Somat Cell Mol Genet 15:185,1989
29. Sparkes RS, Klisak I, Kaufman D, Mohandas T, Tobin AJ,
McGinnis JF: Assignment of the rhodopsin gene to human
chromosome three, region 3q21-3q24 by in situ hybridization
studies. Curr Eye Res 5:797,1986
30. Winqvist R, Virkkunen P, Grzeschik KH, Vihko P: Chromosomal localization to 3q21-qter and two TaqI RFLPs of the human
prostate-specific acid phosphatase gene (ACPP). Cytogenet Cell
Genet 52:68,1989
FREEMAN ET AL
31. Sandberg AA: The Chromosomes in Human Cancer and
Leukemia. New York, NY, Elsevier, 1990, p 714
32. Verma RS, Macera MJ, Krishnamurthy M, Abramson J,
Kapelner S, Dosik H: Chromosomal abnormalities in adult T-cell
leukemiailymphoma (ATL). A report of six cases with review of
the literature. J Cancer Res Clin Oncol113:192,1987
33. Kaneko Y, Maseki N, Sakurai M, Takayama S, Nanba K,
Kikuchi M, Frizzera G: Characteristic karyotypic pattern in T-cell
lymphoproliferative disorders with reactive “angioimmunoblastic
lymphadenopathy with dysproteinemia-type” features. Blood 72:
413,1988
34. Valle A, Garrone P, Yssel H, Bonnefoy J-Y, Freedman AS,
Freeman G, Nadler LM, Banchereau J: mAb 104, a new monoclonal antibody, recognizes the B7 antigen that is expressed on
activated B cells and HTLV-1-transformed T cells. Immunology
69531, 1990
35. Rowley JD, Potter D: Chromosomal banding patterns in
acute nonlymphocytic leukemia. Blood 45:705,1976
36. Bloomfield CD, Garson OM, Volin L, Knuutila S, de la
Chapelle A t( 1;3)(p36;q21) in acute nonlymphocytic leukemia: A
new cytogenetic-clinicopathologic association. Blood 66:1409, 1985
37. Pintado T, Ferro MT, San Roman C, Mayayo M, Larano JG:
Clinical correlations of the 3q21;q26 cytogenetic anomaly. A
leukemic or myelodysplastic syndrome with presewed or increased
platelet production and lack of response to cytotoxic drug therapy.
Cancer 55:535,1984
38. Bitter MA, Neilly ME, Le Beau MM, Rearson MG, Rowley
JD: Rearrangements of chromosome 3 involving bands 3q21 and
3q26 are associated with normal or elevated platelet counts in
acute nonlymphocytic leukemia. Blood 66:1362,1985
39. Pinto MR, King MA, Goss GD, Bezwoda WR, Fernandes
CF, Mendelow B, McDonald TP, Dowdle E, Bernstein R: Acute
megakaryoblastic leukaemia with 3q inversion and elevated thrombopoietin (TSF): An autocrine role for TSF? Br J Haematol
61:687,1985
40. Kuter DJ, Greenberg SM, Rosenberg RD: Analysis of
megakaryocyte ploidy in rat bone marrow culture. Blood 74:1952,
1989
41. Ishibashi T, Burstein SA: Interleukin 3 promotes the differentiation of isolated single megakaryocytes. Blood 67:1512, 1986
42. Ishibashi T, Kimura H, Uchida T, Kariyone S, Friese P,
Burstein SA: Human interleukin 6 is a direct promoter of maturation of megakaryocytes in vitro. Proc Natl Acad Sci USA 86:5953,
1989
From www.bloodjournal.org by guest on June 16, 2017. For personal use only.
1992 79: 489-494
The gene for B7, a costimulatory signal for T-cell activation, maps to
chromosomal region 3q13.3-3q21
GJ Freeman, CM Disteche, JG Gribben, DA Adler, AS Freedman, J Dougery and LM Nadler
Updated information and services can be found at:
http://www.bloodjournal.org/content/79/2/489.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.